>Feature sequence1 28 1764 gene locus_tag LOCUS_00010 28 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2246 3388 gene locus_tag LOCUS_00020 gene dnaN 2246 3388 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_00020 3420 4298 gene locus_tag LOCUS_00030 gene gnd 3420 4298 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221957.1 protein_id gnl|my_center|LOCUS_00030 4365 5501 gene locus_tag LOCUS_00040 gene recF 4365 5501 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_00040 5491 5895 gene locus_tag LOCUS_00050 5491 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6164 8134 gene locus_tag LOCUS_00060 gene gyrB 6164 8134 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_00060 8415 8176 gene locus_tag LOCUS_00070 8415 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8329 10743 gene locus_tag LOCUS_00080 gene gyrA 8329 10743 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221961.1 protein_id gnl|my_center|LOCUS_00080 10749 11357 gene locus_tag LOCUS_00090 10749 11357 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221962.1 protein_id gnl|my_center|LOCUS_00090 11445 11521 gene locus_tag LOCUS_t00010 11445 11521 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 11687 12403 gene locus_tag LOCUS_00100 11687 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12407 12853 gene locus_tag LOCUS_00110 12407 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14750 12924 gene locus_tag LOCUS_00120 14750 12924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338787.1 protein_id gnl|my_center|LOCUS_00120 17662 14936 gene locus_tag LOCUS_00130 17662 14936 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229233.1 protein_id gnl|my_center|LOCUS_00130 18845 17859 gene locus_tag LOCUS_00140 18845 17859 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 protein_id gnl|my_center|LOCUS_00140 19444 18872 gene locus_tag LOCUS_00150 19444 18872 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_00150 19648 21021 gene locus_tag LOCUS_00160 19648 21021 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816208.1 protein_id gnl|my_center|LOCUS_00160 21160 21038 gene locus_tag LOCUS_00170 21160 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22034 21366 gene locus_tag LOCUS_00180 22034 21366 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312123.1 protein_id gnl|my_center|LOCUS_00180 22138 23130 gene locus_tag LOCUS_00190 22138 23130 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653653.1 protein_id gnl|my_center|LOCUS_00190 23187 24437 gene locus_tag LOCUS_00200 23187 24437 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_00200 24604 25716 gene locus_tag LOCUS_00210 gene msiK 24604 25716 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_00210 26558 25785 gene locus_tag LOCUS_00220 26558 25785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26874 28607 gene locus_tag LOCUS_00230 26874 28607 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029118.1 protein_id gnl|my_center|LOCUS_00230 28682 29839 gene locus_tag LOCUS_00240 28682 29839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30440 29910 gene locus_tag LOCUS_00250 30440 29910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31006 30455 gene locus_tag LOCUS_00260 31006 30455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 33551 31080 gene locus_tag LOCUS_00270 33551 31080 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257474.1 protein_id gnl|my_center|LOCUS_00270 33595 35343 gene locus_tag LOCUS_00280 33595 35343 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_00280 35423 35498 gene locus_tag LOCUS_t00020 35423 35498 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35592 36209 gene locus_tag LOCUS_00290 35592 36209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37593 36691 gene locus_tag LOCUS_00300 37593 36691 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222798.1 protein_id gnl|my_center|LOCUS_00300 38946 38185 gene locus_tag LOCUS_00310 38946 38185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39869 38946 gene locus_tag LOCUS_00320 39869 38946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 42188 40179 gene locus_tag LOCUS_00330 42188 40179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 43995 42427 gene locus_tag LOCUS_00340 43995 42427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 44374 43979 gene locus_tag LOCUS_00350 44374 43979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 45365 44403 gene locus_tag LOCUS_00360 45365 44403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45720 45355 gene locus_tag LOCUS_00370 45720 45355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 46277 45756 gene locus_tag LOCUS_00380 46277 45756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 47410 46412 gene locus_tag LOCUS_00390 47410 46412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 48047 47442 gene locus_tag LOCUS_00400 48047 47442 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229111.1 protein_id gnl|my_center|LOCUS_00400 48532 48074 gene locus_tag LOCUS_00410 48532 48074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50070 48601 gene locus_tag LOCUS_00420 50070 48601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 50436 50080 gene locus_tag LOCUS_00430 50436 50080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 50879 50433 gene locus_tag LOCUS_00440 50879 50433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51929 51060 gene locus_tag LOCUS_00450 51929 51060 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729466.1 protein_id gnl|my_center|LOCUS_00450 53089 51944 gene locus_tag LOCUS_00460 gene dgoD 53089 51944 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230776.1 protein_id gnl|my_center|LOCUS_00460 53797 53090 gene locus_tag LOCUS_00470 53797 53090 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230779.1 protein_id gnl|my_center|LOCUS_00470 54554 53814 gene locus_tag LOCUS_00480 54554 53814 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031481.1 protein_id gnl|my_center|LOCUS_00480 54675 55979 gene locus_tag LOCUS_00490 54675 55979 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 protein_id gnl|my_center|LOCUS_00490 55992 56885 gene locus_tag LOCUS_00500 55992 56885 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804057.1 protein_id gnl|my_center|LOCUS_00500 56882 57718 gene locus_tag LOCUS_00510 56882 57718 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804058.1 protein_id gnl|my_center|LOCUS_00510 57715 59718 gene locus_tag LOCUS_00520 57715 59718 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 protein_id gnl|my_center|LOCUS_00520 60304 59744 gene locus_tag LOCUS_00530 60304 59744 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227926.1 protein_id gnl|my_center|LOCUS_00530 60375 61211 gene locus_tag LOCUS_00540 60375 61211 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389197.1 protein_id gnl|my_center|LOCUS_00540 61314 61547 gene locus_tag LOCUS_00550 61314 61547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 61544 62539 gene locus_tag LOCUS_00560 61544 62539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 63208 62666 gene locus_tag LOCUS_00570 63208 62666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63921 63235 gene locus_tag LOCUS_00580 63921 63235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 64622 63972 gene locus_tag LOCUS_00590 64622 63972 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229995.1 protein_id gnl|my_center|LOCUS_00590 64712 65290 gene locus_tag LOCUS_00600 64712 65290 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284350.1 protein_id gnl|my_center|LOCUS_00600 65903 65346 gene locus_tag LOCUS_00610 65903 65346 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854048.1 protein_id gnl|my_center|LOCUS_00610 66840 66058 gene locus_tag LOCUS_00620 66840 66058 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185965189.1 protein_id gnl|my_center|LOCUS_00620 67744 67067 gene locus_tag LOCUS_00630 67744 67067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 71511 68185 gene locus_tag LOCUS_00640 gene lysX 71511 68185 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223114.1 protein_id gnl|my_center|LOCUS_00640 74444 71640 gene locus_tag LOCUS_00650 gene afsR 74444 71640 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_00650 74558 74989 gene locus_tag LOCUS_00660 74558 74989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 74998 76455 gene locus_tag LOCUS_00670 74998 76455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 76446 76973 gene locus_tag LOCUS_00680 76446 76973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 76952 77281 gene locus_tag LOCUS_00690 76952 77281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 77299 78162 gene locus_tag LOCUS_00700 77299 78162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 78289 80472 gene locus_tag LOCUS_00710 78289 80472 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230881.1 protein_id gnl|my_center|LOCUS_00710 80612 82501 gene locus_tag LOCUS_00720 80612 82501 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_00720 82979 82524 gene locus_tag LOCUS_00730 82979 82524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229734.1 protein_id gnl|my_center|LOCUS_00730 83901 83017 gene locus_tag LOCUS_00740 83901 83017 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_00740 84067 85125 gene locus_tag LOCUS_00750 84067 85125 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731557.1 protein_id gnl|my_center|LOCUS_00750 85193 85999 gene locus_tag LOCUS_00760 85193 85999 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_00760 85996 87753 gene locus_tag LOCUS_00770 85996 87753 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 protein_id gnl|my_center|LOCUS_00770 87756 88367 gene locus_tag LOCUS_00780 87756 88367 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_00780 88357 89412 gene locus_tag LOCUS_00790 88357 89412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 89547 89458 gene locus_tag LOCUS_t00030 89547 89458 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 89655 90515 gene locus_tag LOCUS_00800 89655 90515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 90940 91036 gene locus_tag LOCUS_t00040 90940 91036 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 92169 91294 gene locus_tag LOCUS_00810 gene nadC 92169 91294 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_00810 92557 92318 gene locus_tag LOCUS_00820 92557 92318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 93426 92554 gene locus_tag LOCUS_00830 93426 92554 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028631.1 protein_id gnl|my_center|LOCUS_00830 93624 93803 gene locus_tag LOCUS_00840 93624 93803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 95949 94309 gene locus_tag LOCUS_00850 95949 94309 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_00850 97421 95958 gene locus_tag LOCUS_00860 97421 95958 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229918.1 protein_id gnl|my_center|LOCUS_00860 97885 97433 gene locus_tag LOCUS_00870 97885 97433 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_00870 98622 97885 gene locus_tag LOCUS_00880 gene panC 98622 97885 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_00880 99629 98703 gene locus_tag LOCUS_00890 99629 98703 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_00890 99782 100633 gene locus_tag LOCUS_00900 99782 100633 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082846.1 protein_id gnl|my_center|LOCUS_00900 100678 101448 gene locus_tag LOCUS_00910 100678 101448 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 protein_id gnl|my_center|LOCUS_00910 101455 102390 gene locus_tag LOCUS_00920 101455 102390 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_00920 102444 103580 gene locus_tag LOCUS_00930 102444 103580 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_00930 104146 103586 gene locus_tag LOCUS_00940 104146 103586 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449652.1 protein_id gnl|my_center|LOCUS_00940 105686 104136 gene locus_tag LOCUS_00950 105686 104136 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 protein_id gnl|my_center|LOCUS_00950 106692 105787 gene locus_tag LOCUS_00960 106692 105787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 107998 106589 gene locus_tag LOCUS_00970 gene hutI 107998 106589 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 protein_id gnl|my_center|LOCUS_00970 109650 107995 gene locus_tag LOCUS_00980 gene hutU 109650 107995 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223168.1 protein_id gnl|my_center|LOCUS_00980 110703 109702 gene locus_tag LOCUS_00990 110703 109702 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_00990 110775 111353 gene locus_tag LOCUS_01000 110775 111353 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224777.1 protein_id gnl|my_center|LOCUS_01000 111438 111911 gene locus_tag LOCUS_01010 111438 111911 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028645.1 protein_id gnl|my_center|LOCUS_01010 112036 112914 gene locus_tag LOCUS_01020 112036 112914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 113007 114920 gene locus_tag LOCUS_01030 113007 114920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 116061 115042 gene locus_tag LOCUS_01040 116061 115042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 116455 116075 gene locus_tag LOCUS_01050 116455 116075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 116988 116485 gene locus_tag LOCUS_01060 116988 116485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 117844 117227 gene locus_tag LOCUS_01070 117844 117227 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222191.1 protein_id gnl|my_center|LOCUS_01070 118701 117910 gene locus_tag LOCUS_01080 gene menB 118701 117910 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 protein_id gnl|my_center|LOCUS_01080 119665 118712 gene locus_tag LOCUS_01090 119665 118712 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_01090 119683 120495 gene locus_tag LOCUS_01100 119683 120495 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_01100 120723 121859 gene locus_tag LOCUS_01110 120723 121859 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 protein_id gnl|my_center|LOCUS_01110 122669 122022 gene locus_tag LOCUS_01120 122669 122022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_01120 123816 122662 gene locus_tag LOCUS_01130 123816 122662 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031117.1 protein_id gnl|my_center|LOCUS_01130 125096 124233 gene locus_tag LOCUS_01140 125096 124233 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228716.1 protein_id gnl|my_center|LOCUS_01140 125202 126437 gene locus_tag LOCUS_01150 125202 126437 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228715.1 protein_id gnl|my_center|LOCUS_01150 126495 127196 gene locus_tag LOCUS_01160 126495 127196 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973092.1 protein_id gnl|my_center|LOCUS_01160 128682 127165 gene locus_tag LOCUS_01170 128682 127165 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223174.1 protein_id gnl|my_center|LOCUS_01170 129262 128666 gene locus_tag LOCUS_01180 129262 128666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 129528 129698 gene locus_tag LOCUS_01190 129528 129698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 129751 130353 gene locus_tag LOCUS_01200 129751 130353 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283977.1 protein_id gnl|my_center|LOCUS_01200 130380 131711 gene locus_tag LOCUS_01210 130380 131711 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_01210 131708 132625 gene locus_tag LOCUS_01220 131708 132625 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089659.1 protein_id gnl|my_center|LOCUS_01220 132812 133711 gene locus_tag LOCUS_01230 132812 133711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 134180 135238 gene locus_tag LOCUS_01240 134180 135238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 135522 135812 gene locus_tag LOCUS_01250 gene rpsF 135522 135812 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_01250 135884 136375 gene locus_tag LOCUS_01260 135884 136375 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_01260 136434 136673 gene locus_tag LOCUS_01270 gene rpsR 136434 136673 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_01270 136690 137139 gene locus_tag LOCUS_01280 gene rplI 136690 137139 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_01280 137350 138474 gene locus_tag LOCUS_01290 137350 138474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 138852 139214 gene locus_tag LOCUS_01300 138852 139214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 139343 139690 gene locus_tag LOCUS_01310 139343 139690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 139793 140155 gene locus_tag LOCUS_01320 139793 140155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 140399 140605 gene locus_tag LOCUS_01330 140399 140605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 141039 140668 gene locus_tag LOCUS_01340 141039 140668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 141382 142806 gene locus_tag LOCUS_01350 gene dnaB 141382 142806 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231009.1 protein_id gnl|my_center|LOCUS_01350 142927 143277 gene locus_tag LOCUS_01360 142927 143277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 143385 143750 gene locus_tag LOCUS_01370 143385 143750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 144783 143659 gene locus_tag LOCUS_01380 144783 143659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 145267 144794 gene locus_tag LOCUS_01390 gene ispF 145267 144794 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 protein_id gnl|my_center|LOCUS_01390 145835 145350 gene locus_tag LOCUS_01400 145835 145350 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_01400 146110 146475 gene locus_tag LOCUS_01410 146110 146475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 147779 146472 gene locus_tag LOCUS_01420 147779 146472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 148896 147865 gene locus_tag LOCUS_01430 148896 147865 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_01430 150102 148954 gene locus_tag LOCUS_01440 150102 148954 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088825.1 protein_id gnl|my_center|LOCUS_01440 150787 150065 gene locus_tag LOCUS_01450 150787 150065 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918725.1 protein_id gnl|my_center|LOCUS_01450 150787 151584 gene locus_tag LOCUS_01460 150787 151584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 151691 152461 gene locus_tag LOCUS_01470 151691 152461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230400.1 protein_id gnl|my_center|LOCUS_01470 152491 153888 gene locus_tag LOCUS_01480 gene radA 152491 153888 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230399.1 protein_id gnl|my_center|LOCUS_01480 155083 153917 gene locus_tag LOCUS_01490 155083 153917 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225903.1 protein_id gnl|my_center|LOCUS_01490 155218 155874 gene locus_tag LOCUS_01500 155218 155874 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225902.1 protein_id gnl|my_center|LOCUS_01500 155904 157067 gene locus_tag LOCUS_01510 155904 157067 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225901.1 protein_id gnl|my_center|LOCUS_01510 157079 157735 gene locus_tag LOCUS_01520 157079 157735 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974444.1 protein_id gnl|my_center|LOCUS_01520 158394 157750 gene locus_tag LOCUS_01530 158394 157750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 158587 159639 gene locus_tag LOCUS_01540 gene disA 158587 159639 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_01540 159713 162115 gene locus_tag LOCUS_01550 159713 162115 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112141171.1 protein_id gnl|my_center|LOCUS_01550 162112 162777 gene locus_tag LOCUS_01560 162112 162777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 163548 162787 gene locus_tag LOCUS_01570 163548 162787 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141309845.1 protein_id gnl|my_center|LOCUS_01570 164205 163624 gene locus_tag LOCUS_01580 164205 163624 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_01580 164330 164950 gene locus_tag LOCUS_01590 164330 164950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 165026 165511 gene locus_tag LOCUS_01600 165026 165511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 167168 165522 gene locus_tag LOCUS_01610 167168 165522 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_01610 167806 167234 gene locus_tag LOCUS_01620 167806 167234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 168055 167858 gene locus_tag LOCUS_01630 168055 167858 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971465.1 protein_id gnl|my_center|LOCUS_01630 169271 168066 gene locus_tag LOCUS_01640 169271 168066 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_01640 169816 169319 gene locus_tag LOCUS_01650 169816 169319 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110393.1 protein_id gnl|my_center|LOCUS_01650 170682 169933 gene locus_tag LOCUS_01660 170682 169933 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224574.1 protein_id gnl|my_center|LOCUS_01660 172065 170746 gene locus_tag LOCUS_01670 172065 170746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064593.1 protein_id gnl|my_center|LOCUS_01670 173144 172062 gene locus_tag LOCUS_01680 173144 172062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_01680 174038 173175 gene locus_tag LOCUS_01690 174038 173175 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228342.1 protein_id gnl|my_center|LOCUS_01690 174916 174035 gene locus_tag LOCUS_01700 174916 174035 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228343.1 protein_id gnl|my_center|LOCUS_01700 176249 174918 gene locus_tag LOCUS_01710 176249 174918 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065231.1 protein_id gnl|my_center|LOCUS_01710 176363 177583 gene locus_tag LOCUS_01720 176363 177583 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223433.1 protein_id gnl|my_center|LOCUS_01720 177616 177689 gene locus_tag LOCUS_t00050 177616 177689 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 178439 177744 gene locus_tag LOCUS_01730 178439 177744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 178818 178468 gene locus_tag LOCUS_01740 178818 178468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 178952 180112 gene locus_tag LOCUS_01750 178952 180112 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_01750 180103 180768 gene locus_tag LOCUS_01760 180103 180768 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_01760 181945 180773 gene locus_tag LOCUS_01770 181945 180773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01770 182170 182514 gene locus_tag LOCUS_01780 182170 182514 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141202.1 protein_id gnl|my_center|LOCUS_01780 182511 183464 gene locus_tag LOCUS_01790 182511 183464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 183935 183522 gene locus_tag LOCUS_01800 183935 183522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 184502 184020 gene locus_tag LOCUS_01810 184502 184020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 185022 184549 gene locus_tag LOCUS_01820 185022 184549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226076.1 protein_id gnl|my_center|LOCUS_01820 185781 185050 gene locus_tag LOCUS_01830 185781 185050 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226077.1 protein_id gnl|my_center|LOCUS_01830 186595 185819 gene locus_tag LOCUS_01840 186595 185819 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484565.1 protein_id gnl|my_center|LOCUS_01840 186653 187114 gene locus_tag LOCUS_01850 186653 187114 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027459.1 protein_id gnl|my_center|LOCUS_01850 192031 187115 gene locus_tag LOCUS_01860 192031 187115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 193295 192015 gene locus_tag LOCUS_01870 193295 192015 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_01870 194028 193279 gene locus_tag LOCUS_01880 194028 193279 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 protein_id gnl|my_center|LOCUS_01880 197254 194039 gene locus_tag LOCUS_01890 197254 194039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 202991 197247 gene locus_tag LOCUS_01900 202991 197247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01900 206181 203017 gene locus_tag LOCUS_01910 206181 203017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01910 207523 206264 gene locus_tag LOCUS_01920 207523 206264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 208190 207765 gene locus_tag LOCUS_01930 208190 207765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 211114 208265 gene locus_tag LOCUS_01940 211114 208265 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_01940 212146 211220 gene locus_tag LOCUS_01950 212146 211220 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027021.1 protein_id gnl|my_center|LOCUS_01950 212236 212586 gene locus_tag LOCUS_01960 212236 212586 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227496.1 protein_id gnl|my_center|LOCUS_01960 212583 213800 gene locus_tag LOCUS_01970 212583 213800 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227497.1 protein_id gnl|my_center|LOCUS_01970 214423 213833 gene locus_tag LOCUS_01980 214423 213833 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403741.1 protein_id gnl|my_center|LOCUS_01980 215558 214530 gene locus_tag LOCUS_01990 215558 214530 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_01990 215715 217232 gene locus_tag LOCUS_02000 215715 217232 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976375.1 protein_id gnl|my_center|LOCUS_02000 217229 218563 gene locus_tag LOCUS_02010 217229 218563 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975884.1 protein_id gnl|my_center|LOCUS_02010 218568 219467 gene locus_tag LOCUS_02020 218568 219467 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_02020 219474 220313 gene locus_tag LOCUS_02030 219474 220313 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_02030 220315 221229 gene locus_tag LOCUS_02040 220315 221229 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103129516.1 protein_id gnl|my_center|LOCUS_02040 221384 221926 gene locus_tag LOCUS_02050 221384 221926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 223459 222035 gene locus_tag LOCUS_02060 223459 222035 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 protein_id gnl|my_center|LOCUS_02060 223552 224139 gene locus_tag LOCUS_02070 223552 224139 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123667195.1 protein_id gnl|my_center|LOCUS_02070 225224 224208 gene locus_tag LOCUS_02080 225224 224208 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_02080 226020 225238 gene locus_tag LOCUS_02090 226020 225238 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226469.1 protein_id gnl|my_center|LOCUS_02090 226622 226017 gene locus_tag LOCUS_02100 226622 226017 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 protein_id gnl|my_center|LOCUS_02100 228013 226655 gene locus_tag LOCUS_02110 228013 226655 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028357.1 protein_id gnl|my_center|LOCUS_02110 229446 228010 gene locus_tag LOCUS_02120 229446 228010 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028356.1 protein_id gnl|my_center|LOCUS_02120 230718 229471 gene locus_tag LOCUS_02130 230718 229471 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038700.1 protein_id gnl|my_center|LOCUS_02130 230919 231626 gene locus_tag LOCUS_02140 230919 231626 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976364.1 protein_id gnl|my_center|LOCUS_02140 231663 232898 gene locus_tag LOCUS_02150 231663 232898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_02150 233005 233619 gene locus_tag LOCUS_02160 233005 233619 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 protein_id gnl|my_center|LOCUS_02160 233621 234241 gene locus_tag LOCUS_02170 233621 234241 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 protein_id gnl|my_center|LOCUS_02170 235288 234242 gene locus_tag LOCUS_02180 235288 234242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 235703 235356 gene locus_tag LOCUS_02190 235703 235356 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894079.1 protein_id gnl|my_center|LOCUS_02190 238528 235772 gene locus_tag LOCUS_02200 238528 235772 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 protein_id gnl|my_center|LOCUS_02200 238770 240560 gene locus_tag LOCUS_02210 238770 240560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 240659 241699 gene locus_tag LOCUS_02220 240659 241699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 241709 241891 gene locus_tag LOCUS_02230 241709 241891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 242828 241944 gene locus_tag LOCUS_02240 242828 241944 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_02240 243806 242895 gene locus_tag LOCUS_02250 243806 242895 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029125.1 protein_id gnl|my_center|LOCUS_02250 243920 244687 gene locus_tag LOCUS_02260 243920 244687 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974027.1 protein_id gnl|my_center|LOCUS_02260 245148 244741 gene locus_tag LOCUS_02270 245148 244741 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723339.1 protein_id gnl|my_center|LOCUS_02270 245292 245846 gene locus_tag LOCUS_02280 245292 245846 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_02280 247217 245946 gene locus_tag LOCUS_02290 247217 245946 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_02290 247668 247210 gene locus_tag LOCUS_02300 247668 247210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 247808 249253 gene locus_tag LOCUS_02310 247808 249253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 249392 250384 gene locus_tag LOCUS_02320 249392 250384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 252125 250443 gene locus_tag LOCUS_02330 252125 250443 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 protein_id gnl|my_center|LOCUS_02330 253073 252135 gene locus_tag LOCUS_02340 253073 252135 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222259.1 protein_id gnl|my_center|LOCUS_02340 253661 253275 gene locus_tag LOCUS_02350 253661 253275 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_02350 253733 254998 gene locus_tag LOCUS_02360 253733 254998 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_02360 254995 256989 gene locus_tag LOCUS_02370 254995 256989 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_02370 257071 257700 gene locus_tag LOCUS_02380 257071 257700 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_02380 257701 258705 gene locus_tag LOCUS_02390 gene pitH 257701 258705 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_02390 259511 260482 gene locus_tag LOCUS_02400 259511 260482 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029498.1 protein_id gnl|my_center|LOCUS_02400 261579 260554 gene locus_tag LOCUS_02410 gene fbaA 261579 260554 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_02410 261698 261871 gene locus_tag LOCUS_02420 261698 261871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 262426 261911 gene locus_tag LOCUS_02430 262426 261911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 262612 262701 gene locus_tag LOCUS_t00060 262612 262701 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 263107 262775 gene locus_tag LOCUS_02440 263107 262775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 263398 263838 gene locus_tag LOCUS_02450 263398 263838 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107259.1 protein_id gnl|my_center|LOCUS_02450 264077 264841 gene locus_tag LOCUS_02460 264077 264841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 265297 264833 gene locus_tag LOCUS_02470 gene soxR 265297 264833 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803686.1 protein_id gnl|my_center|LOCUS_02470 266295 265372 gene locus_tag LOCUS_02480 266295 265372 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_02480 266375 267040 gene locus_tag LOCUS_02490 266375 267040 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977108.1 protein_id gnl|my_center|LOCUS_02490 267701 267087 gene locus_tag LOCUS_02500 267701 267087 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367229.1 protein_id gnl|my_center|LOCUS_02500 268336 267836 gene locus_tag LOCUS_02510 268336 267836 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529453.1 protein_id gnl|my_center|LOCUS_02510 268620 268877 gene locus_tag LOCUS_02520 268620 268877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 268924 269415 gene locus_tag LOCUS_02530 268924 269415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 269477 270043 gene locus_tag LOCUS_02540 269477 270043 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894896.1 protein_id gnl|my_center|LOCUS_02540 270859 270053 gene locus_tag LOCUS_02550 270859 270053 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340251.1 protein_id gnl|my_center|LOCUS_02550 271929 270856 gene locus_tag LOCUS_02560 271929 270856 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141179.1 protein_id gnl|my_center|LOCUS_02560 272777 272043 gene locus_tag LOCUS_02570 272777 272043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 272837 273811 gene locus_tag LOCUS_02580 272837 273811 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_02580 276031 273842 gene locus_tag LOCUS_02590 276031 273842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 278312 276084 gene locus_tag LOCUS_02600 278312 276084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 278713 278327 gene locus_tag LOCUS_02610 278713 278327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 281749 278909 gene locus_tag LOCUS_02620 281749 278909 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 protein_id gnl|my_center|LOCUS_02620 281825 282295 gene locus_tag LOCUS_02630 281825 282295 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228426.1 protein_id gnl|my_center|LOCUS_02630 282397 283470 gene locus_tag LOCUS_02640 282397 283470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 284444 283551 gene locus_tag LOCUS_02650 284444 283551 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390074.1 protein_id gnl|my_center|LOCUS_02650 285435 284506 gene locus_tag LOCUS_02660 285435 284506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 285564 286178 gene locus_tag LOCUS_02670 285564 286178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 286587 286165 gene locus_tag LOCUS_02680 286587 286165 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228573.1 protein_id gnl|my_center|LOCUS_02680 286677 287501 gene locus_tag LOCUS_02690 286677 287501 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228572.1 protein_id gnl|my_center|LOCUS_02690 287901 287509 gene locus_tag LOCUS_02700 287901 287509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 288772 288074 gene locus_tag LOCUS_02710 288772 288074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 289752 289132 gene locus_tag LOCUS_02720 289752 289132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 290313 290843 gene locus_tag LOCUS_02730 290313 290843 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 protein_id gnl|my_center|LOCUS_02730 290833 291459 gene locus_tag LOCUS_02740 290833 291459 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229694.1 protein_id gnl|my_center|LOCUS_02740 292135 291464 gene locus_tag LOCUS_02750 292135 291464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 292924 292232 gene locus_tag LOCUS_02760 292924 292232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 294164 292962 gene locus_tag LOCUS_02770 294164 292962 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_02770 294275 294733 gene locus_tag LOCUS_02780 294275 294733 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_02780 295882 294626 gene locus_tag LOCUS_02790 295882 294626 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031604.1 protein_id gnl|my_center|LOCUS_02790 295938 296678 gene locus_tag LOCUS_02800 295938 296678 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486023.1 protein_id gnl|my_center|LOCUS_02800 296727 297497 gene locus_tag LOCUS_02810 296727 297497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 297517 298641 gene locus_tag LOCUS_02820 297517 298641 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_02820 299131 298649 gene locus_tag LOCUS_02830 299131 298649 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_02830 299266 300444 gene locus_tag LOCUS_02840 gene hppD 299266 300444 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083248.1 protein_id gnl|my_center|LOCUS_02840 300486 301316 gene locus_tag LOCUS_02850 300486 301316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 301291 302373 gene locus_tag LOCUS_02860 gene hisC 301291 302373 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222222.1 protein_id gnl|my_center|LOCUS_02860 302370 302990 gene locus_tag LOCUS_02870 302370 302990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 303057 304148 gene locus_tag LOCUS_02880 303057 304148 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869068.1 protein_id gnl|my_center|LOCUS_02880 304578 305153 gene locus_tag LOCUS_02890 304578 305153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 305657 305259 gene locus_tag LOCUS_02900 305657 305259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 305769 306281 gene locus_tag LOCUS_02910 305769 306281 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116126.1 protein_id gnl|my_center|LOCUS_02910 306380 307234 gene locus_tag LOCUS_02920 306380 307234 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400822.1 protein_id gnl|my_center|LOCUS_02920 307309 308223 gene locus_tag LOCUS_02930 307309 308223 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_02930 310518 308260 gene locus_tag LOCUS_02940 310518 308260 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230093.1 protein_id gnl|my_center|LOCUS_02940 310554 311291 gene locus_tag LOCUS_02950 310554 311291 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227159.1 protein_id gnl|my_center|LOCUS_02950 311992 311390 gene locus_tag LOCUS_02960 311992 311390 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226782.1 protein_id gnl|my_center|LOCUS_02960 312051 312857 gene locus_tag LOCUS_02970 gene fdhD 312051 312857 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_02970 313772 313041 gene locus_tag LOCUS_02980 313772 313041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 315137 314106 gene locus_tag LOCUS_02990 315137 314106 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179809238.1 protein_id gnl|my_center|LOCUS_02990 315598 315233 gene locus_tag LOCUS_03000 315598 315233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 316430 315510 gene locus_tag LOCUS_03010 316430 315510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 316472 317761 gene locus_tag LOCUS_03020 316472 317761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 318126 317746 gene locus_tag LOCUS_03030 318126 317746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 318176 318865 gene locus_tag LOCUS_03040 318176 318865 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_03040 319229 318906 gene locus_tag LOCUS_03050 319229 318906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 320470 319226 gene locus_tag LOCUS_03060 320470 319226 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_03060 320922 320629 gene locus_tag LOCUS_03070 320922 320629 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_03070 321226 320978 gene locus_tag LOCUS_03080 321226 320978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 321264 321383 gene locus_tag LOCUS_03090 321264 321383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 321423 321626 gene locus_tag LOCUS_03100 321423 321626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 322502 321672 gene locus_tag LOCUS_03110 322502 321672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 322501 323115 gene locus_tag LOCUS_03120 322501 323115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 323363 326881 gene locus_tag LOCUS_03130 323363 326881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 327004 327993 gene locus_tag LOCUS_03140 327004 327993 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282906.1 protein_id gnl|my_center|LOCUS_03140 328433 328083 gene locus_tag LOCUS_03150 328433 328083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 328591 329679 gene locus_tag LOCUS_03160 328591 329679 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_03160 329941 329669 gene locus_tag LOCUS_03170 329941 329669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 331120 330227 gene locus_tag LOCUS_03180 331120 330227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 331839 332681 gene locus_tag LOCUS_03190 331839 332681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 333273 333037 gene locus_tag LOCUS_03200 333273 333037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 334941 333409 gene locus_tag LOCUS_03210 334941 333409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 335312 334938 gene locus_tag LOCUS_03220 335312 334938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 335890 335606 gene locus_tag LOCUS_03230 335890 335606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 336377 336661 gene locus_tag LOCUS_03240 336377 336661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 337303 337175 gene locus_tag LOCUS_03250 337303 337175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 337392 337628 gene locus_tag LOCUS_03260 337392 337628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 338468 337644 gene locus_tag LOCUS_03270 338468 337644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 339178 338465 gene locus_tag LOCUS_03280 339178 338465 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 protein_id gnl|my_center|LOCUS_03280 340044 339175 gene locus_tag LOCUS_03290 340044 339175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 340184 340879 gene locus_tag LOCUS_03300 340184 340879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 340880 341134 gene locus_tag LOCUS_03310 340880 341134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 341159 341521 gene locus_tag LOCUS_03320 341159 341521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029773.1 protein_id gnl|my_center|LOCUS_03320 341587 341952 gene locus_tag LOCUS_03330 341587 341952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 341949 342608 gene locus_tag LOCUS_03340 341949 342608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 342605 343003 gene locus_tag LOCUS_03350 342605 343003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 343000 344802 gene locus_tag LOCUS_03360 343000 344802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 344799 345521 gene locus_tag LOCUS_03370 344799 345521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 345561 345944 gene locus_tag LOCUS_03380 345561 345944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 345948 347366 gene locus_tag LOCUS_03390 345948 347366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 347433 349613 gene locus_tag LOCUS_03400 347433 349613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 349645 349905 gene locus_tag LOCUS_03410 349645 349905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 350030 350218 gene locus_tag LOCUS_03420 350030 350218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 350285 350467 gene locus_tag LOCUS_03430 350285 350467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 350544 350759 gene locus_tag LOCUS_03440 350544 350759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 350752 351039 gene locus_tag LOCUS_03450 350752 351039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 351075 351353 gene locus_tag LOCUS_03460 351075 351353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 351403 351843 gene locus_tag LOCUS_03470 351403 351843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 351953 352327 gene locus_tag LOCUS_03480 351953 352327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 352426 354426 gene locus_tag LOCUS_03490 352426 354426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 354444 354647 gene locus_tag LOCUS_03500 354444 354647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 354644 356047 gene locus_tag LOCUS_03510 354644 356047 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227938.1 protein_id gnl|my_center|LOCUS_03510 356254 356179 gene locus_tag LOCUS_t00070 356254 356179 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 359176 356321 gene locus_tag LOCUS_03520 359176 356321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 360477 359458 gene locus_tag LOCUS_03530 gene rlmB 360477 359458 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_03530 361909 360467 gene locus_tag LOCUS_03540 gene cysS 361909 360467 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_03540 362085 363029 gene locus_tag LOCUS_03550 gene moaA 362085 363029 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_03550 363277 363516 gene locus_tag LOCUS_03560 363277 363516 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_03560 363705 364886 gene locus_tag LOCUS_03570 363705 364886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 364957 365565 gene locus_tag LOCUS_03580 364957 365565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 365696 365609 gene locus_tag LOCUS_t00080 365696 365609 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 366076 365750 gene locus_tag LOCUS_03590 366076 365750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 366464 366045 gene locus_tag LOCUS_03600 366464 366045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 368806 366461 gene locus_tag LOCUS_03610 368806 366461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 368833 369198 gene locus_tag LOCUS_03620 368833 369198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 369612 369085 gene locus_tag LOCUS_03630 369612 369085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 370862 369693 gene locus_tag LOCUS_03640 gene dnaJ 370862 369693 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401821.1 protein_id gnl|my_center|LOCUS_03640 371783 370887 gene locus_tag LOCUS_03650 371783 370887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 373633 371780 gene locus_tag LOCUS_03660 gene dnaK 373633 371780 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_03660 374023 373805 gene locus_tag LOCUS_03670 374023 373805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 373940 375148 gene locus_tag LOCUS_03680 373940 375148 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230806.1 protein_id gnl|my_center|LOCUS_03680 375307 376464 gene locus_tag LOCUS_03690 375307 376464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 377339 376461 gene locus_tag LOCUS_03700 377339 376461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 377338 378015 gene locus_tag LOCUS_03710 377338 378015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 378089 378162 gene locus_tag LOCUS_t00090 378089 378162 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 378554 379072 gene locus_tag LOCUS_03720 378554 379072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 379623 379111 gene locus_tag LOCUS_03730 379623 379111 CDS product DUF2199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830214.1 protein_id gnl|my_center|LOCUS_03730 380515 379925 gene locus_tag LOCUS_03740 380515 379925 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230366.1 protein_id gnl|my_center|LOCUS_03740 381597 380512 gene locus_tag LOCUS_03750 381597 380512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 381730 381918 gene locus_tag LOCUS_03760 381730 381918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 381915 382148 gene locus_tag LOCUS_03770 381915 382148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 382126 382530 gene locus_tag LOCUS_03780 382126 382530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 382571 383392 gene locus_tag LOCUS_03790 382571 383392 CDS product SCP1.201-like deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224013.1 protein_id gnl|my_center|LOCUS_03790 383389 383838 gene locus_tag LOCUS_03800 383389 383838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 384937 383936 gene locus_tag LOCUS_03810 384937 383936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 387680 385092 gene locus_tag LOCUS_03820 387680 385092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 388425 388306 gene locus_tag LOCUS_03830 388425 388306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 388526 388696 gene locus_tag LOCUS_03840 388526 388696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 389072 388701 gene locus_tag LOCUS_03850 389072 388701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 390252 389017 gene locus_tag LOCUS_03860 390252 389017 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728099.1 protein_id gnl|my_center|LOCUS_03860 390966 390307 gene locus_tag LOCUS_03870 390966 390307 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 protein_id gnl|my_center|LOCUS_03870 391038 391340 gene locus_tag LOCUS_03880 391038 391340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 391948 391337 gene locus_tag LOCUS_03890 391948 391337 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 protein_id gnl|my_center|LOCUS_03890 392220 392771 gene locus_tag LOCUS_03900 392220 392771 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971509.1 protein_id gnl|my_center|LOCUS_03900 394368 392827 gene locus_tag LOCUS_03910 gene putP 394368 392827 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 protein_id gnl|my_center|LOCUS_03910 394573 396084 gene locus_tag LOCUS_03920 394573 396084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 394954 394875 gene locus_tag LOCUS_t00100 394954 394875 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 396164 397504 gene locus_tag LOCUS_03930 396164 397504 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226013.1 protein_id gnl|my_center|LOCUS_03930 397657 398685 gene locus_tag LOCUS_03940 397657 398685 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_03940 399961 398705 gene locus_tag LOCUS_03950 399961 398705 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228715.1 protein_id gnl|my_center|LOCUS_03950 401224 400103 gene locus_tag LOCUS_03960 401224 400103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 401594 401229 gene locus_tag LOCUS_03970 401594 401229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 403009 401663 gene locus_tag LOCUS_03980 gene eccB 403009 401663 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_03980 403108 404205 gene locus_tag LOCUS_03990 403108 404205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 404202 404363 gene locus_tag LOCUS_04000 404202 404363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 405531 404350 gene locus_tag LOCUS_04010 405531 404350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04010 405728 406606 gene locus_tag LOCUS_04020 405728 406606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 407246 406596 gene locus_tag LOCUS_04030 407246 406596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 408275 407340 gene locus_tag LOCUS_04040 408275 407340 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226531.1 protein_id gnl|my_center|LOCUS_04040 408356 409219 gene locus_tag LOCUS_04050 408356 409219 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 protein_id gnl|my_center|LOCUS_04050 410756 409266 gene locus_tag LOCUS_04060 410756 409266 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968019.1 protein_id gnl|my_center|LOCUS_04060 411419 410913 gene locus_tag LOCUS_04070 411419 410913 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976461.1 protein_id gnl|my_center|LOCUS_04070 412850 411453 gene locus_tag LOCUS_04080 gene eccD 412850 411453 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224120.1 protein_id gnl|my_center|LOCUS_04080 412952 416902 gene locus_tag LOCUS_04090 412952 416902 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 protein_id gnl|my_center|LOCUS_04090 417069 417335 gene locus_tag LOCUS_04100 417069 417335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 417362 417643 gene locus_tag LOCUS_04110 417362 417643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 418306 417650 gene locus_tag LOCUS_04120 418306 417650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 418890 418303 gene locus_tag LOCUS_04130 418890 418303 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111797.1 protein_id gnl|my_center|LOCUS_04130 420077 418947 gene locus_tag LOCUS_04140 gene mycP 420077 418947 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 protein_id gnl|my_center|LOCUS_04140 421885 420248 gene locus_tag LOCUS_04150 421885 420248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 422065 423186 gene locus_tag LOCUS_04160 422065 423186 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_04160 423393 423115 gene locus_tag LOCUS_04170 423393 423115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 423614 424453 gene locus_tag LOCUS_04180 423614 424453 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229227.1 protein_id gnl|my_center|LOCUS_04180 424539 425879 gene locus_tag LOCUS_04190 424539 425879 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031775.1 protein_id gnl|my_center|LOCUS_04190 426271 425927 gene locus_tag LOCUS_04200 426271 425927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 426487 428211 gene locus_tag LOCUS_04210 426487 428211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_04210 428208 429953 gene locus_tag LOCUS_04220 428208 429953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030252.1 protein_id gnl|my_center|LOCUS_04220 430792 429950 gene locus_tag LOCUS_04230 430792 429950 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028225.1 protein_id gnl|my_center|LOCUS_04230 431547 430918 gene locus_tag LOCUS_04240 431547 430918 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030926.1 protein_id gnl|my_center|LOCUS_04240 431647 432561 gene locus_tag LOCUS_04250 431647 432561 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030927.1 protein_id gnl|my_center|LOCUS_04250 432964 432572 gene locus_tag LOCUS_04260 432964 432572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 433071 433844 gene locus_tag LOCUS_04270 433071 433844 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222282.1 protein_id gnl|my_center|LOCUS_04270 433963 434928 gene locus_tag LOCUS_04280 433963 434928 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_04280 435203 435358 gene locus_tag LOCUS_04290 435203 435358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 436258 435410 gene locus_tag LOCUS_04300 436258 435410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 437167 436328 gene locus_tag LOCUS_04310 437167 436328 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_04310 437238 438200 gene locus_tag LOCUS_04320 437238 438200 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_04320 438208 438723 gene locus_tag LOCUS_04330 438208 438723 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224813.1 protein_id gnl|my_center|LOCUS_04330 439721 438726 gene locus_tag LOCUS_04340 439721 438726 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_04340 441437 440358 gene locus_tag LOCUS_04350 441437 440358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 443701 441452 gene locus_tag LOCUS_04360 443701 441452 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230289.1 protein_id gnl|my_center|LOCUS_04360 444142 443711 gene locus_tag LOCUS_04370 444142 443711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 444421 444221 gene locus_tag LOCUS_04380 444421 444221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_04380 445101 444445 gene locus_tag LOCUS_04390 445101 444445 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_04390 445264 447840 gene locus_tag LOCUS_04400 445264 447840 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_04400 447837 448727 gene locus_tag LOCUS_04410 447837 448727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_04410 448808 449590 gene locus_tag LOCUS_04420 448808 449590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 450380 449607 gene locus_tag LOCUS_04430 450380 449607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 451128 450388 gene locus_tag LOCUS_04440 451128 450388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 452627 451125 gene locus_tag LOCUS_04450 452627 451125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 453058 454314 gene locus_tag LOCUS_04460 gene thrC 453058 454314 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_04460 455516 454311 gene locus_tag LOCUS_04470 455516 454311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 455947 455513 gene locus_tag LOCUS_04480 455947 455513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 456162 455944 gene locus_tag LOCUS_04490 456162 455944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 457420 456203 gene locus_tag LOCUS_04500 457420 456203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 458709 457417 gene locus_tag LOCUS_04510 458709 457417 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104227.1 protein_id gnl|my_center|LOCUS_04510 459476 458757 gene locus_tag LOCUS_04520 459476 458757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 protein_id gnl|my_center|LOCUS_04520 460401 459484 gene locus_tag LOCUS_04530 460401 459484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_04530 461291 460398 gene locus_tag LOCUS_04540 461291 460398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974986.1 protein_id gnl|my_center|LOCUS_04540 462225 461275 gene locus_tag LOCUS_04550 462225 461275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_04550 462414 464027 gene locus_tag LOCUS_04560 462414 464027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 464005 465477 gene locus_tag LOCUS_04570 464005 465477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 465502 465575 gene locus_tag LOCUS_t00110 465502 465575 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 467070 465595 gene locus_tag LOCUS_04580 467070 465595 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183125562.1 protein_id gnl|my_center|LOCUS_04580 467326 467090 gene locus_tag LOCUS_04590 467326 467090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 467747 468502 gene locus_tag LOCUS_04600 467747 468502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 471580 468527 gene locus_tag LOCUS_04610 471580 468527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 471676 472017 gene locus_tag LOCUS_04620 471676 472017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 476025 472009 gene locus_tag LOCUS_04630 476025 472009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 477422 477754 gene locus_tag LOCUS_04640 477422 477754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 477767 478510 gene locus_tag LOCUS_04650 477767 478510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 479449 478595 gene locus_tag LOCUS_04660 479449 478595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 479600 479812 gene locus_tag LOCUS_04670 479600 479812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 480616 479939 gene locus_tag LOCUS_04680 480616 479939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 481403 482902 gene locus_tag LOCUS_04690 481403 482902 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_04690 482908 483456 gene locus_tag LOCUS_04700 482908 483456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 483508 486618 gene locus_tag LOCUS_04710 483508 486618 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230443.1 protein_id gnl|my_center|LOCUS_04710 486710 487855 gene locus_tag LOCUS_04720 486710 487855 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845175.1 protein_id gnl|my_center|LOCUS_04720 487883 489250 gene locus_tag LOCUS_04730 487883 489250 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225318.1 protein_id gnl|my_center|LOCUS_04730 490261 489272 gene locus_tag LOCUS_04740 gene bioB 490261 489272 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199838974.1 protein_id gnl|my_center|LOCUS_04740 490434 491762 gene locus_tag LOCUS_04750 gene bioA 490434 491762 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_04750 491759 492871 gene locus_tag LOCUS_04760 491759 492871 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728881.1 protein_id gnl|my_center|LOCUS_04760 492868 493527 gene locus_tag LOCUS_04770 gene bioD 492868 493527 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_04770 494681 493434 gene locus_tag LOCUS_04780 494681 493434 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229724.1 protein_id gnl|my_center|LOCUS_04780 494795 495223 gene locus_tag LOCUS_04790 494795 495223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 495411 496166 gene locus_tag LOCUS_04800 495411 496166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 496305 497285 gene locus_tag LOCUS_04810 496305 497285 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282906.1 protein_id gnl|my_center|LOCUS_04810 497403 498803 gene locus_tag LOCUS_04820 497403 498803 CDS product FG-GAP repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168538635.1 protein_id gnl|my_center|LOCUS_04820 499203 499637 gene locus_tag LOCUS_04830 499203 499637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 500481 499708 gene locus_tag LOCUS_04840 500481 499708 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228646.1 protein_id gnl|my_center|LOCUS_04840 501424 500537 gene locus_tag LOCUS_04850 501424 500537 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227669.1 protein_id gnl|my_center|LOCUS_04850 502415 501555 gene locus_tag LOCUS_04860 502415 501555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 502659 502928 gene locus_tag LOCUS_04870 502659 502928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 503097 503459 gene locus_tag LOCUS_04880 503097 503459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 504089 507694 gene locus_tag LOCUS_04890 504089 507694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 507698 509569 gene locus_tag LOCUS_04900 507698 509569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223091.1 protein_id gnl|my_center|LOCUS_04900 509623 510129 gene locus_tag LOCUS_04910 509623 510129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 510162 511301 gene locus_tag LOCUS_04920 510162 511301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 511837 511298 gene locus_tag LOCUS_04930 511837 511298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 512444 511890 gene locus_tag LOCUS_04940 512444 511890 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226947.1 protein_id gnl|my_center|LOCUS_04940 514265 512556 gene locus_tag LOCUS_04950 gene leuA 514265 512556 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285511.1 protein_id gnl|my_center|LOCUS_04950 515423 514476 gene locus_tag LOCUS_04960 515423 514476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 516175 515435 gene locus_tag LOCUS_04970 516175 515435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 516081 516278 gene locus_tag LOCUS_04980 516081 516278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 516346 517611 gene locus_tag LOCUS_04990 516346 517611 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063166.1 protein_id gnl|my_center|LOCUS_04990 517618 518676 gene locus_tag LOCUS_05000 517618 518676 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_05000 518783 519145 gene locus_tag LOCUS_05010 518783 519145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222450.1 protein_id gnl|my_center|LOCUS_05010 520223 519165 gene locus_tag LOCUS_05020 520223 519165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 523055 520296 gene locus_tag LOCUS_05030 gene topA 523055 520296 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_05030 523737 523228 gene locus_tag LOCUS_05040 523737 523228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 526179 523834 gene locus_tag LOCUS_05050 526179 523834 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_05050 526715 526284 gene locus_tag LOCUS_05060 526715 526284 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_05060 527048 526719 gene locus_tag LOCUS_05070 gene bldG 527048 526719 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_05070 527122 527604 gene locus_tag LOCUS_05080 527122 527604 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227557.1 protein_id gnl|my_center|LOCUS_05080 528218 527610 gene locus_tag LOCUS_05090 528218 527610 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_05090 529438 528215 gene locus_tag LOCUS_05100 529438 528215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 529595 530566 gene locus_tag LOCUS_05110 529595 530566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_05110 530569 531324 gene locus_tag LOCUS_05120 530569 531324 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974898.1 protein_id gnl|my_center|LOCUS_05120 531360 531587 gene locus_tag LOCUS_05130 531360 531587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 533874 531595 gene locus_tag LOCUS_05140 533874 531595 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_05140 533962 534144 gene locus_tag LOCUS_05150 533962 534144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 535526 534105 gene locus_tag LOCUS_05160 535526 534105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 536146 535667 gene locus_tag LOCUS_05170 536146 535667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 536950 536195 gene locus_tag LOCUS_05180 536950 536195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 538863 537085 gene locus_tag LOCUS_05190 538863 537085 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_05190 539867 538863 gene locus_tag LOCUS_05200 539867 538863 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_05200 539939 541138 gene locus_tag LOCUS_05210 539939 541138 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313186.1 protein_id gnl|my_center|LOCUS_05210 541503 541183 gene locus_tag LOCUS_05220 541503 541183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 541421 542071 gene locus_tag LOCUS_05230 541421 542071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 542106 542960 gene locus_tag LOCUS_05240 542106 542960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 545253 542962 gene locus_tag LOCUS_05250 545253 542962 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_05250 545813 545322 gene locus_tag LOCUS_05260 545813 545322 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977470.1 protein_id gnl|my_center|LOCUS_05260 546012 546569 gene locus_tag LOCUS_05270 546012 546569 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224600.1 protein_id gnl|my_center|LOCUS_05270 546566 547237 gene locus_tag LOCUS_05280 546566 547237 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224601.1 protein_id gnl|my_center|LOCUS_05280 548161 547244 gene locus_tag LOCUS_05290 548161 547244 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989419.1 protein_id gnl|my_center|LOCUS_05290 549490 548687 gene locus_tag LOCUS_05300 549490 548687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760712.1 protein_id gnl|my_center|LOCUS_05300 550274 549495 gene locus_tag LOCUS_05310 550274 549495 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259153.1 protein_id gnl|my_center|LOCUS_05310 551257 550271 gene locus_tag LOCUS_05320 551257 550271 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_05320 552332 551325 gene locus_tag LOCUS_05330 552332 551325 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028313.1 protein_id gnl|my_center|LOCUS_05330 552763 552332 gene locus_tag LOCUS_05340 552763 552332 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326123.1 protein_id gnl|my_center|LOCUS_05340 552930 553898 gene locus_tag LOCUS_05350 552930 553898 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_05350 554233 553952 gene locus_tag LOCUS_05360 554233 553952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 554886 554233 gene locus_tag LOCUS_05370 554886 554233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 555473 558034 gene locus_tag LOCUS_05380 gene lanKC 555473 558034 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495285.1 protein_id gnl|my_center|LOCUS_05380 558290 559996 gene locus_tag LOCUS_05390 558290 559996 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031101.1 protein_id gnl|my_center|LOCUS_05390 560016 561725 gene locus_tag LOCUS_05400 560016 561725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031102.1 protein_id gnl|my_center|LOCUS_05400 562303 561722 gene locus_tag LOCUS_05410 562303 561722 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226387.1 protein_id gnl|my_center|LOCUS_05410 563063 567607 gene locus_tag LOCUS_05420 563063 567607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 569157 567667 gene locus_tag LOCUS_05430 569157 567667 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224111.1 protein_id gnl|my_center|LOCUS_05430 571264 569318 gene locus_tag LOCUS_05440 571264 569318 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227328.1 protein_id gnl|my_center|LOCUS_05440 571499 572638 gene locus_tag LOCUS_05450 571499 572638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 572638 573303 gene locus_tag LOCUS_05460 572638 573303 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229954.1 protein_id gnl|my_center|LOCUS_05460 573344 573820 gene locus_tag LOCUS_05470 573344 573820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 574795 573794 gene locus_tag LOCUS_05480 574795 573794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 575621 574824 gene locus_tag LOCUS_05490 575621 574824 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742118.1 protein_id gnl|my_center|LOCUS_05490 576901 575675 gene locus_tag LOCUS_05500 576901 575675 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_05500 578752 577037 gene locus_tag LOCUS_05510 578752 577037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 580994 578898 gene locus_tag LOCUS_05520 580994 578898 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_05520 581515 581105 gene locus_tag LOCUS_05530 581515 581105 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_05530 582223 581621 gene locus_tag LOCUS_05540 582223 581621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 582433 583116 gene locus_tag LOCUS_05550 582433 583116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 583109 584059 gene locus_tag LOCUS_05560 583109 584059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 584102 585955 gene locus_tag LOCUS_05570 584102 585955 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_05570 585948 586973 gene locus_tag LOCUS_05580 585948 586973 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222471.1 protein_id gnl|my_center|LOCUS_05580 587167 588879 gene locus_tag LOCUS_05590 587167 588879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 589006 589476 gene locus_tag LOCUS_05600 589006 589476 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_05600 589561 590034 gene locus_tag LOCUS_05610 589561 590034 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092949.1 protein_id gnl|my_center|LOCUS_05610 591209 590100 gene locus_tag LOCUS_05620 gene serC 591209 590100 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_05620 591368 592474 gene locus_tag LOCUS_05630 591368 592474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 592561 593661 gene locus_tag LOCUS_05640 gene alr 592561 593661 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222656.1 protein_id gnl|my_center|LOCUS_05640 593658 594830 gene locus_tag LOCUS_05650 593658 594830 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250368.1 protein_id gnl|my_center|LOCUS_05650 594831 595367 gene locus_tag LOCUS_05660 gene tsaE 594831 595367 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466589.1 protein_id gnl|my_center|LOCUS_05660 595369 596025 gene locus_tag LOCUS_05670 gene tsaB 595369 596025 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222662.1 protein_id gnl|my_center|LOCUS_05670 596018 596467 gene locus_tag LOCUS_05680 gene rimI 596018 596467 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_05680 596464 597516 gene locus_tag LOCUS_05690 gene tsaD 596464 597516 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222664.1 protein_id gnl|my_center|LOCUS_05690 597846 597586 gene locus_tag LOCUS_05700 597846 597586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 598517 597858 gene locus_tag LOCUS_05710 598517 597858 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_05710 598636 599922 gene locus_tag LOCUS_05720 598636 599922 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_05720 600569 599943 gene locus_tag LOCUS_05730 600569 599943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 601090 600665 gene locus_tag LOCUS_05740 601090 600665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 601189 601755 gene locus_tag LOCUS_05750 601189 601755 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226517.1 protein_id gnl|my_center|LOCUS_05750 603053 601752 gene locus_tag LOCUS_05760 603053 601752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_05760 604407 603175 gene locus_tag LOCUS_05770 604407 603175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_05770 604573 605325 gene locus_tag LOCUS_05780 604573 605325 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_05780 606243 605329 gene locus_tag LOCUS_05790 gene sigJ 606243 605329 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978451.1 protein_id gnl|my_center|LOCUS_05790 606394 606807 gene locus_tag LOCUS_05800 606394 606807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027097.1 protein_id gnl|my_center|LOCUS_05800 606804 607310 gene locus_tag LOCUS_05810 606804 607310 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029961.1 protein_id gnl|my_center|LOCUS_05810 607882 607307 gene locus_tag LOCUS_05820 607882 607307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 607948 609225 gene locus_tag LOCUS_05830 607948 609225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230552.1 protein_id gnl|my_center|LOCUS_05830 609322 610527 gene locus_tag LOCUS_05840 609322 610527 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_05840 610524 611204 gene locus_tag LOCUS_05850 610524 611204 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_05850 611360 612232 gene locus_tag LOCUS_05860 611360 612232 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_05860 612229 613392 gene locus_tag LOCUS_05870 612229 613392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_05870 615999 613774 gene locus_tag LOCUS_05880 615999 613774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 616792 616238 gene locus_tag LOCUS_05890 616792 616238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 618703 617405 gene locus_tag LOCUS_05900 618703 617405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 618878 620050 gene locus_tag LOCUS_05910 gene mqnE 618878 620050 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974455.1 protein_id gnl|my_center|LOCUS_05910 620054 620491 gene locus_tag LOCUS_05920 620054 620491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 620488 620736 gene locus_tag LOCUS_05930 620488 620736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 621558 620785 gene locus_tag LOCUS_05940 621558 620785 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_05940 622412 621555 gene locus_tag LOCUS_05950 622412 621555 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_05950 623281 622409 gene locus_tag LOCUS_05960 623281 622409 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_05960 623847 623392 gene locus_tag LOCUS_05970 623847 623392 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731125.1 protein_id gnl|my_center|LOCUS_05970 623873 624763 gene locus_tag LOCUS_05980 623873 624763 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731114.1 protein_id gnl|my_center|LOCUS_05980 624815 624891 gene locus_tag LOCUS_t00120 624815 624891 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 626119 625124 gene locus_tag LOCUS_05990 626119 625124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 627032 626163 gene locus_tag LOCUS_06000 627032 626163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 627571 627038 gene locus_tag LOCUS_06010 627571 627038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 628106 627561 gene locus_tag LOCUS_06020 628106 627561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 628552 628725 gene locus_tag LOCUS_06030 628552 628725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 628821 631415 gene locus_tag LOCUS_06040 628821 631415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 631438 632904 gene locus_tag LOCUS_06050 631438 632904 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531929.1 protein_id gnl|my_center|LOCUS_06050 633827 632994 gene locus_tag LOCUS_06060 633827 632994 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 protein_id gnl|my_center|LOCUS_06060 634081 636867 gene locus_tag LOCUS_06070 634081 636867 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003078144.1 protein_id gnl|my_center|LOCUS_06070 637512 636883 gene locus_tag LOCUS_06080 637512 636883 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030557.1 protein_id gnl|my_center|LOCUS_06080 637604 638641 gene locus_tag LOCUS_06090 637604 638641 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970230.1 protein_id gnl|my_center|LOCUS_06090 638803 639981 gene locus_tag LOCUS_06100 gene sucC 638803 639981 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_06100 639983 640870 gene locus_tag LOCUS_06110 gene sucD 639983 640870 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222716.1 protein_id gnl|my_center|LOCUS_06110 641050 642045 gene locus_tag LOCUS_06120 641050 642045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 642705 642055 gene locus_tag LOCUS_06130 642705 642055 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_06130 643757 642702 gene locus_tag LOCUS_06140 643757 642702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 643944 646307 gene locus_tag LOCUS_06150 643944 646307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 646398 647039 gene locus_tag LOCUS_06160 gene purN 646398 647039 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_06160 647669 647022 gene locus_tag LOCUS_06170 647669 647022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 648185 647679 gene locus_tag LOCUS_06180 648185 647679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 648844 648230 gene locus_tag LOCUS_06190 648844 648230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 649044 650600 gene locus_tag LOCUS_06200 gene purH 649044 650600 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_06200 650706 651656 gene locus_tag LOCUS_06210 gene mdh 650706 651656 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_06210 653030 651720 gene locus_tag LOCUS_06220 653030 651720 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029314.1 protein_id gnl|my_center|LOCUS_06220 654915 653125 gene locus_tag LOCUS_06230 654915 653125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 655103 654912 gene locus_tag LOCUS_06240 655103 654912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 656147 655110 gene locus_tag LOCUS_06250 656147 655110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_06250 657186 656140 gene locus_tag LOCUS_06260 657186 656140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_06260 658090 657194 gene locus_tag LOCUS_06270 658090 657194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868657.1 protein_id gnl|my_center|LOCUS_06270 659184 658087 gene locus_tag LOCUS_06280 659184 658087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225593.1 protein_id gnl|my_center|LOCUS_06280 660529 659369 gene locus_tag LOCUS_06290 660529 659369 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224638.1 protein_id gnl|my_center|LOCUS_06290 660721 661581 gene locus_tag LOCUS_06300 660721 661581 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_06300 661578 662228 gene locus_tag LOCUS_06310 661578 662228 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224637.1 protein_id gnl|my_center|LOCUS_06310 663429 662404 gene locus_tag LOCUS_06320 gene lgt 663429 662404 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971316.1 protein_id gnl|my_center|LOCUS_06320 663941 663636 gene locus_tag LOCUS_06330 663941 663636 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 protein_id gnl|my_center|LOCUS_06330 664324 663941 gene locus_tag LOCUS_06340 664324 663941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 665112 664666 gene locus_tag LOCUS_06350 665112 664666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 666159 665185 gene locus_tag LOCUS_06360 666159 665185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 666513 666295 gene locus_tag LOCUS_06370 666513 666295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 666693 666520 gene locus_tag LOCUS_06380 666693 666520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 666799 667071 gene locus_tag LOCUS_06390 666799 667071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 667123 667302 gene locus_tag LOCUS_06400 667123 667302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 667548 667895 gene locus_tag LOCUS_06410 667548 667895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 668199 668435 gene locus_tag LOCUS_06420 668199 668435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 668432 669013 gene locus_tag LOCUS_06430 668432 669013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 669169 669960 gene locus_tag LOCUS_06440 669169 669960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 protein_id gnl|my_center|LOCUS_06440 670480 670061 gene locus_tag LOCUS_06450 670480 670061 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026330850.1 protein_id gnl|my_center|LOCUS_06450 671918 670512 gene locus_tag LOCUS_06460 671918 670512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 673846 672056 gene locus_tag LOCUS_06470 673846 672056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 676218 673798 gene locus_tag LOCUS_06480 676218 673798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 676365 677087 gene locus_tag LOCUS_06490 676365 677087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 677139 678206 gene locus_tag LOCUS_06500 677139 678206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 678094 678873 gene locus_tag LOCUS_06510 678094 678873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 679542 678880 gene locus_tag LOCUS_06520 679542 678880 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222882.1 protein_id gnl|my_center|LOCUS_06520 680648 679539 gene locus_tag LOCUS_06530 680648 679539 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972557.1 protein_id gnl|my_center|LOCUS_06530 680881 681768 gene locus_tag LOCUS_06540 680881 681768 CDS product SCO0930 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222269.1 protein_id gnl|my_center|LOCUS_06540 681923 682762 gene locus_tag LOCUS_06550 681923 682762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 682806 683159 gene locus_tag LOCUS_06560 682806 683159 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081309.1 protein_id gnl|my_center|LOCUS_06560 683143 683628 gene locus_tag LOCUS_06570 683143 683628 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081306.1 protein_id gnl|my_center|LOCUS_06570 683704 684645 gene locus_tag LOCUS_06580 683704 684645 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975162.1 protein_id gnl|my_center|LOCUS_06580 684638 685471 gene locus_tag LOCUS_06590 gene rbsK 684638 685471 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_06590 686486 685482 gene locus_tag LOCUS_06600 686486 685482 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268319.1 protein_id gnl|my_center|LOCUS_06600 687302 686499 gene locus_tag LOCUS_06610 687302 686499 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031352.1 protein_id gnl|my_center|LOCUS_06610 688360 687308 gene locus_tag LOCUS_06620 688360 687308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270370.1 protein_id gnl|my_center|LOCUS_06620 689348 688368 gene locus_tag LOCUS_06630 689348 688368 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031350.1 protein_id gnl|my_center|LOCUS_06630 690272 689361 gene locus_tag LOCUS_06640 690272 689361 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_06640 691777 690287 gene locus_tag LOCUS_06650 691777 690287 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 protein_id gnl|my_center|LOCUS_06650 693661 691790 gene locus_tag LOCUS_06660 gene iolD 693661 691790 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_06660 694521 693661 gene locus_tag LOCUS_06670 gene iolB 694521 693661 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_06670 695381 694518 gene locus_tag LOCUS_06680 695381 694518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031349.1 protein_id gnl|my_center|LOCUS_06680 696354 695371 gene locus_tag LOCUS_06690 gene iolC 696354 695371 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 protein_id gnl|my_center|LOCUS_06690 696585 697565 gene locus_tag LOCUS_06700 696585 697565 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_06700 698978 697566 gene locus_tag LOCUS_06710 698978 697566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 699036 699545 gene locus_tag LOCUS_06720 699036 699545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 699582 700379 gene locus_tag LOCUS_06730 699582 700379 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079744.1 protein_id gnl|my_center|LOCUS_06730 702160 700376 gene locus_tag LOCUS_06740 702160 700376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 702483 702154 gene locus_tag LOCUS_06750 702483 702154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 702996 702508 gene locus_tag LOCUS_06760 702996 702508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 704528 703026 gene locus_tag LOCUS_06770 704528 703026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 704844 704554 gene locus_tag LOCUS_06780 704844 704554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 705845 704844 gene locus_tag LOCUS_06790 705845 704844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 706288 705851 gene locus_tag LOCUS_06800 706288 705851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 707794 706400 gene locus_tag LOCUS_06810 gene eccB 707794 706400 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_06810 707994 709184 gene locus_tag LOCUS_06820 gene eccE 707994 709184 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304772.1 protein_id gnl|my_center|LOCUS_06820 709205 709582 gene locus_tag LOCUS_06830 709205 709582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 709625 710917 gene locus_tag LOCUS_06840 709625 710917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 712367 710970 gene locus_tag LOCUS_06850 gene eccD 712367 710970 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_06850 712570 716577 gene locus_tag LOCUS_06860 712570 716577 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 protein_id gnl|my_center|LOCUS_06860 716750 717055 gene locus_tag LOCUS_06870 716750 717055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 717100 717411 gene locus_tag LOCUS_06880 717100 717411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 718521 717472 gene locus_tag LOCUS_06890 718521 717472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 720263 718494 gene locus_tag LOCUS_06900 720263 718494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 720629 721036 gene locus_tag LOCUS_06910 gene ndk 720629 721036 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412592.1 protein_id gnl|my_center|LOCUS_06910 721190 722749 gene locus_tag LOCUS_06920 721190 722749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 724866 722746 gene locus_tag LOCUS_06930 724866 722746 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_06930 728054 725043 gene locus_tag LOCUS_06940 728054 725043 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228172.1 protein_id gnl|my_center|LOCUS_06940 728370 731516 gene locus_tag LOCUS_06950 gene ileS 728370 731516 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224829.1 protein_id gnl|my_center|LOCUS_06950 732978 731584 gene locus_tag LOCUS_06960 732978 731584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 734441 732978 gene locus_tag LOCUS_06970 gene eccB 734441 732978 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_06970 734903 734604 gene locus_tag LOCUS_06980 734903 734604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 735278 734952 gene locus_tag LOCUS_06990 735278 734952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 736828 735407 gene locus_tag LOCUS_07000 gene eccD 736828 735407 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_07000 737304 737101 gene locus_tag LOCUS_07010 737304 737101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 737195 741046 gene locus_tag LOCUS_07020 737195 741046 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_07020 741889 741074 gene locus_tag LOCUS_07030 741889 741074 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027718.1 protein_id gnl|my_center|LOCUS_07030 742045 742317 gene locus_tag LOCUS_07040 742045 742317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 742547 743731 gene locus_tag LOCUS_07050 742547 743731 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975140.1 protein_id gnl|my_center|LOCUS_07050 743745 744170 gene locus_tag LOCUS_07060 743745 744170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 744167 744748 gene locus_tag LOCUS_07070 744167 744748 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406244.1 protein_id gnl|my_center|LOCUS_07070 744745 744951 gene locus_tag LOCUS_07080 744745 744951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 745034 745843 gene locus_tag LOCUS_07090 745034 745843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 746657 745875 gene locus_tag LOCUS_07100 746657 745875 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_07100 747444 746665 gene locus_tag LOCUS_07110 747444 746665 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230091.1 protein_id gnl|my_center|LOCUS_07110 747672 747974 gene locus_tag LOCUS_07120 747672 747974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 748017 749336 gene locus_tag LOCUS_07130 748017 749336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 749376 749816 gene locus_tag LOCUS_07140 749376 749816 CDS product sec-independent translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030086.1 protein_id gnl|my_center|LOCUS_07140 749898 750773 gene locus_tag LOCUS_07150 749898 750773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 751923 750778 gene locus_tag LOCUS_07160 751923 750778 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074275.1 protein_id gnl|my_center|LOCUS_07160 752762 751953 gene locus_tag LOCUS_07170 752762 751953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 752972 753856 gene locus_tag LOCUS_07180 gene hemC 752972 753856 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971798.1 protein_id gnl|my_center|LOCUS_07180 754384 753863 gene locus_tag LOCUS_07190 754384 753863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973821.1 protein_id gnl|my_center|LOCUS_07190 754989 754381 gene locus_tag LOCUS_07200 754989 754381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 755147 756025 gene locus_tag LOCUS_07210 755147 756025 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099690.1 protein_id gnl|my_center|LOCUS_07210 755928 756254 gene locus_tag LOCUS_07220 755928 756254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 756334 756951 gene locus_tag LOCUS_07230 756334 756951 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085726.1 protein_id gnl|my_center|LOCUS_07230 757313 757450 gene locus_tag LOCUS_07240 757313 757450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 757457 758224 gene locus_tag LOCUS_07250 757457 758224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 758777 758256 gene locus_tag LOCUS_07260 758777 758256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 760210 758855 gene locus_tag LOCUS_07270 760210 758855 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 protein_id gnl|my_center|LOCUS_07270 760439 760840 gene locus_tag LOCUS_07280 760439 760840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 760882 761583 gene locus_tag LOCUS_07290 760882 761583 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_07290 761580 762602 gene locus_tag LOCUS_07300 761580 762602 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230049.1 protein_id gnl|my_center|LOCUS_07300 762772 763362 gene locus_tag LOCUS_07310 762772 763362 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_07310 764256 763381 gene locus_tag LOCUS_07320 gene mca 764256 763381 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_07320 764419 764832 gene locus_tag LOCUS_07330 764419 764832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 764978 765481 gene locus_tag LOCUS_07340 gene greA 764978 765481 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896664.1 protein_id gnl|my_center|LOCUS_07340 765504 766754 gene locus_tag LOCUS_07350 gene ilvA 765504 766754 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229835.1 protein_id gnl|my_center|LOCUS_07350 766771 767511 gene locus_tag LOCUS_07360 766771 767511 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_07360 767521 767736 gene locus_tag LOCUS_07370 767521 767736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 767896 768459 gene locus_tag LOCUS_07380 767896 768459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 protein_id gnl|my_center|LOCUS_07380 768804 770639 gene locus_tag LOCUS_07390 768804 770639 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230959.1 protein_id gnl|my_center|LOCUS_07390 770696 771466 gene locus_tag LOCUS_07400 770696 771466 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_07400 771714 772376 gene locus_tag LOCUS_07410 771714 772376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 772635 773318 gene locus_tag LOCUS_07420 772635 773318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 773463 774488 gene locus_tag LOCUS_07430 773463 774488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 774609 775580 gene locus_tag LOCUS_07440 774609 775580 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_07440 776734 775616 gene locus_tag LOCUS_07450 776734 775616 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_07450 777435 777013 gene locus_tag LOCUS_07460 777435 777013 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417776.1 protein_id gnl|my_center|LOCUS_07460 778939 777440 gene locus_tag LOCUS_07470 778939 777440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 779989 779075 gene locus_tag LOCUS_07480 779989 779075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 780931 780071 gene locus_tag LOCUS_07490 780931 780071 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_07490 782360 780924 gene locus_tag LOCUS_07500 782360 780924 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_07500 783282 782362 gene locus_tag LOCUS_07510 gene deoC 783282 782362 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_07510 783351 783983 gene locus_tag LOCUS_07520 gene upp 783351 783983 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222797.1 protein_id gnl|my_center|LOCUS_07520 784187 787621 gene locus_tag LOCUS_07530 784187 787621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 787614 789233 gene locus_tag LOCUS_07540 787614 789233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 789268 789981 gene locus_tag LOCUS_07550 789268 789981 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_07550 790146 790877 gene locus_tag LOCUS_07560 790146 790877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 791003 792394 gene locus_tag LOCUS_07570 791003 792394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 792478 793935 gene locus_tag LOCUS_07580 792478 793935 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227506.1 protein_id gnl|my_center|LOCUS_07580 793984 794391 gene locus_tag LOCUS_07590 793984 794391 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895166.1 protein_id gnl|my_center|LOCUS_07590 794429 795631 gene locus_tag LOCUS_07600 794429 795631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 796916 795774 gene locus_tag LOCUS_07610 796916 795774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731583.1 protein_id gnl|my_center|LOCUS_07610 798175 796910 gene locus_tag LOCUS_07620 798175 796910 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_07620 799107 798172 gene locus_tag LOCUS_07630 799107 798172 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227768.1 protein_id gnl|my_center|LOCUS_07630 799995 799132 gene locus_tag LOCUS_07640 799995 799132 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384666.1 protein_id gnl|my_center|LOCUS_07640 800882 799992 gene locus_tag LOCUS_07650 800882 799992 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384667.1 protein_id gnl|my_center|LOCUS_07650 802213 800882 gene locus_tag LOCUS_07660 802213 800882 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175341.1 protein_id gnl|my_center|LOCUS_07660 802370 803149 gene locus_tag LOCUS_07670 802370 803149 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227770.1 protein_id gnl|my_center|LOCUS_07670 804017 803181 gene locus_tag LOCUS_07680 804017 803181 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878779.1 protein_id gnl|my_center|LOCUS_07680 804203 805294 gene locus_tag LOCUS_07690 804203 805294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 805480 806895 gene locus_tag LOCUS_07700 805480 806895 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973721.1 protein_id gnl|my_center|LOCUS_07700 806978 808018 gene locus_tag LOCUS_07710 806978 808018 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134732678.1 protein_id gnl|my_center|LOCUS_07710 808018 809454 gene locus_tag LOCUS_07720 808018 809454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 809549 810340 gene locus_tag LOCUS_07730 809549 810340 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091388998.1 protein_id gnl|my_center|LOCUS_07730 810838 810416 gene locus_tag LOCUS_07740 810838 810416 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222863.1 protein_id gnl|my_center|LOCUS_07740 810948 811337 gene locus_tag LOCUS_07750 810948 811337 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968175.1 protein_id gnl|my_center|LOCUS_07750 812052 811387 gene locus_tag LOCUS_07760 812052 811387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 812285 812674 gene locus_tag LOCUS_07770 812285 812674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 813583 812795 gene locus_tag LOCUS_07780 813583 812795 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532623.1 protein_id gnl|my_center|LOCUS_07780 813711 814073 gene locus_tag LOCUS_07790 813711 814073 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226809.1 protein_id gnl|my_center|LOCUS_07790 814100 815065 gene locus_tag LOCUS_07800 814100 815065 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227818.1 protein_id gnl|my_center|LOCUS_07800 816723 815062 gene locus_tag LOCUS_07810 816723 815062 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_07810 818574 816787 gene locus_tag LOCUS_07820 818574 816787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 818765 820345 gene locus_tag LOCUS_07830 818765 820345 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031217.1 protein_id gnl|my_center|LOCUS_07830 820840 822015 gene locus_tag LOCUS_07840 820840 822015 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222829.1 protein_id gnl|my_center|LOCUS_07840 822214 823725 gene locus_tag LOCUS_07850 822214 823725 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222444.1 protein_id gnl|my_center|LOCUS_07850 824239 823790 gene locus_tag LOCUS_07860 824239 823790 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974055.1 protein_id gnl|my_center|LOCUS_07860 824311 825702 gene locus_tag LOCUS_07870 824311 825702 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222832.1 protein_id gnl|my_center|LOCUS_07870 827146 825710 gene locus_tag LOCUS_07880 827146 825710 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_07880 827309 827896 gene locus_tag LOCUS_07890 827309 827896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 829656 827908 gene locus_tag LOCUS_07900 829656 827908 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_07900 829728 830291 gene locus_tag LOCUS_07910 829728 830291 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487417.1 protein_id gnl|my_center|LOCUS_07910 831009 830341 gene locus_tag LOCUS_07920 831009 830341 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229981.1 protein_id gnl|my_center|LOCUS_07920 831203 832177 gene locus_tag LOCUS_07930 831203 832177 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461138.1 protein_id gnl|my_center|LOCUS_07930 832189 832953 gene locus_tag LOCUS_07940 832189 832953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229983.1 protein_id gnl|my_center|LOCUS_07940 833337 833017 gene locus_tag LOCUS_07950 833337 833017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 833996 833397 gene locus_tag LOCUS_07960 833996 833397 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_07960 834168 834560 gene locus_tag LOCUS_07970 834168 834560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 834792 834613 gene locus_tag LOCUS_07980 834792 834613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 835804 834797 gene locus_tag LOCUS_07990 835804 834797 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469674.1 protein_id gnl|my_center|LOCUS_07990 837475 835901 gene locus_tag LOCUS_08000 837475 835901 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_08000 837697 838341 gene locus_tag LOCUS_08010 837697 838341 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_08010 838363 839376 gene locus_tag LOCUS_08020 838363 839376 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_08020 839413 839940 gene locus_tag LOCUS_08030 839413 839940 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727928.1 protein_id gnl|my_center|LOCUS_08030 842969 839868 gene locus_tag LOCUS_08040 842969 839868 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228238.1 protein_id gnl|my_center|LOCUS_08040 846015 843010 gene locus_tag LOCUS_08050 846015 843010 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_08050 847431 846157 gene locus_tag LOCUS_08060 847431 846157 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814774.1 protein_id gnl|my_center|LOCUS_08060 849748 847514 gene locus_tag LOCUS_08070 849748 847514 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_08070 850401 849916 gene locus_tag LOCUS_08080 850401 849916 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529991.1 protein_id gnl|my_center|LOCUS_08080 850934 850425 gene locus_tag LOCUS_08090 850934 850425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 851449 850967 gene locus_tag LOCUS_08100 851449 850967 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930319.1 protein_id gnl|my_center|LOCUS_08100 854062 851567 gene locus_tag LOCUS_08110 854062 851567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 854236 854664 gene locus_tag LOCUS_08120 854236 854664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 854668 855828 gene locus_tag LOCUS_08130 854668 855828 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222902.1 protein_id gnl|my_center|LOCUS_08130 855825 856382 gene locus_tag LOCUS_08140 gene purE 855825 856382 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222903.1 protein_id gnl|my_center|LOCUS_08140 856417 856704 gene locus_tag LOCUS_08150 856417 856704 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228474.1 protein_id gnl|my_center|LOCUS_08150 857233 856712 gene locus_tag LOCUS_08160 857233 856712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 857681 857388 gene locus_tag LOCUS_08170 857681 857388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 857730 858140 gene locus_tag LOCUS_08180 857730 858140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 858156 858551 gene locus_tag LOCUS_08190 858156 858551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 859425 858601 gene locus_tag LOCUS_08200 859425 858601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 860356 859415 gene locus_tag LOCUS_08210 860356 859415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_08210 860431 862383 gene locus_tag LOCUS_08220 860431 862383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 863205 862366 gene locus_tag LOCUS_08230 863205 862366 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_08230 864135 863512 gene locus_tag LOCUS_08240 864135 863512 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111779.1 protein_id gnl|my_center|LOCUS_08240 864217 864711 gene locus_tag LOCUS_08250 864217 864711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 865799 864708 gene locus_tag LOCUS_08260 865799 864708 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_08260 866321 865863 gene locus_tag LOCUS_08270 866321 865863 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 protein_id gnl|my_center|LOCUS_08270 866450 866647 gene locus_tag LOCUS_08280 866450 866647 CDS product BldC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081896.1 protein_id gnl|my_center|LOCUS_08280 867337 866711 gene locus_tag LOCUS_08290 867337 866711 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974457.1 protein_id gnl|my_center|LOCUS_08290 867445 868701 gene locus_tag LOCUS_08300 867445 868701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 868710 870167 gene locus_tag LOCUS_08310 868710 870167 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 protein_id gnl|my_center|LOCUS_08310 870164 871099 gene locus_tag LOCUS_08320 870164 871099 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029692.1 protein_id gnl|my_center|LOCUS_08320 872182 871109 gene locus_tag LOCUS_08330 gene ccsB 872182 871109 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_08330 873750 872182 gene locus_tag LOCUS_08340 873750 872182 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088832.1 protein_id gnl|my_center|LOCUS_08340 874496 873747 gene locus_tag LOCUS_08350 874496 873747 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080301.1 protein_id gnl|my_center|LOCUS_08350 875148 874609 gene locus_tag LOCUS_08360 875148 874609 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443163.1 protein_id gnl|my_center|LOCUS_08360 875774 875148 gene locus_tag LOCUS_08370 875774 875148 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402845.1 protein_id gnl|my_center|LOCUS_08370 877090 875792 gene locus_tag LOCUS_08380 gene hemL 877090 875792 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 protein_id gnl|my_center|LOCUS_08380 877216 878253 gene locus_tag LOCUS_08390 877216 878253 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_08390 878250 879284 gene locus_tag LOCUS_08400 gene tilS 878250 879284 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_08400 880133 879294 gene locus_tag LOCUS_08410 880133 879294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 880199 880687 gene locus_tag LOCUS_08420 gene tamR 880199 880687 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_08420 881275 880688 gene locus_tag LOCUS_08430 gene hpt 881275 880688 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_08430 881531 883531 gene locus_tag LOCUS_08440 gene ftsH 881531 883531 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230468.1 protein_id gnl|my_center|LOCUS_08440 883681 884325 gene locus_tag LOCUS_08450 gene folE 883681 884325 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_08450 884734 884345 gene locus_tag LOCUS_08460 884734 884345 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_08460 885433 884837 gene locus_tag LOCUS_08470 885433 884837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 885566 886960 gene locus_tag LOCUS_08480 885566 886960 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_08480 887682 887026 gene locus_tag LOCUS_08490 887682 887026 CDS product DUF4360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028347.1 protein_id gnl|my_center|LOCUS_08490 887848 889806 gene locus_tag LOCUS_08500 887848 889806 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224706.1 protein_id gnl|my_center|LOCUS_08500 891134 889803 gene locus_tag LOCUS_08510 891134 889803 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227361.1 protein_id gnl|my_center|LOCUS_08510 892593 891409 gene locus_tag LOCUS_08520 892593 891409 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_08520 894733 892610 gene locus_tag LOCUS_08530 894733 892610 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230508.1 protein_id gnl|my_center|LOCUS_08530 894846 896057 gene locus_tag LOCUS_08540 894846 896057 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222035.1 protein_id gnl|my_center|LOCUS_08540 896764 897204 gene locus_tag LOCUS_08550 896764 897204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 897817 897179 gene locus_tag LOCUS_08560 897817 897179 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_08560 898425 897886 gene locus_tag LOCUS_08570 898425 897886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 900890 898512 gene locus_tag LOCUS_08580 900890 898512 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030298.1 protein_id gnl|my_center|LOCUS_08580 901084 901395 gene locus_tag LOCUS_08590 901084 901395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 901392 902174 gene locus_tag LOCUS_08600 901392 902174 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 protein_id gnl|my_center|LOCUS_08600 902251 905283 gene locus_tag LOCUS_08610 gene afsR 902251 905283 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_08610 905850 905515 gene locus_tag LOCUS_08620 905850 905515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 906073 906894 gene locus_tag LOCUS_08630 906073 906894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 906957 907709 gene locus_tag LOCUS_08640 906957 907709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223675.1 protein_id gnl|my_center|LOCUS_08640 907711 908499 gene locus_tag LOCUS_08650 907711 908499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223674.1 protein_id gnl|my_center|LOCUS_08650 908496 909854 gene locus_tag LOCUS_08660 908496 909854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 909987 911057 gene locus_tag LOCUS_08670 909987 911057 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027852.1 protein_id gnl|my_center|LOCUS_08670 911137 911418 gene locus_tag LOCUS_08680 911137 911418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 912188 911415 gene locus_tag LOCUS_08690 912188 911415 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_08690 912412 913044 gene locus_tag LOCUS_08700 912412 913044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 913041 913583 gene locus_tag LOCUS_08710 913041 913583 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 protein_id gnl|my_center|LOCUS_08710 913632 914162 gene locus_tag LOCUS_08720 913632 914162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 914195 914620 gene locus_tag LOCUS_08730 914195 914620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 914621 916168 gene locus_tag LOCUS_08740 914621 916168 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976349.1 protein_id gnl|my_center|LOCUS_08740 917467 916175 gene locus_tag LOCUS_08750 917467 916175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 918350 917580 gene locus_tag LOCUS_08760 918350 917580 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223724.1 protein_id gnl|my_center|LOCUS_08760 918729 918394 gene locus_tag LOCUS_08770 918729 918394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 919498 918983 gene locus_tag LOCUS_08780 919498 918983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 919555 920457 gene locus_tag LOCUS_08790 919555 920457 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222113.1 protein_id gnl|my_center|LOCUS_08790 921197 920454 gene locus_tag LOCUS_08800 921197 920454 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_08800 921352 923319 gene locus_tag LOCUS_08810 gene acs 921352 923319 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_08810 923469 923864 gene locus_tag LOCUS_08820 923469 923864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 923869 925326 gene locus_tag LOCUS_08830 923869 925326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 925382 925903 gene locus_tag LOCUS_08840 925382 925903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 925915 927024 gene locus_tag LOCUS_08850 925915 927024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 927156 928421 gene locus_tag LOCUS_08860 927156 928421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 929001 928450 gene locus_tag LOCUS_08870 929001 928450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 929168 930373 gene locus_tag LOCUS_08880 gene nhaA 929168 930373 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230542.1 protein_id gnl|my_center|LOCUS_08880 930398 931321 gene locus_tag LOCUS_08890 930398 931321 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230544.1 protein_id gnl|my_center|LOCUS_08890 931461 932720 gene locus_tag LOCUS_08900 931461 932720 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776637.1 protein_id gnl|my_center|LOCUS_08900 932765 933673 gene locus_tag LOCUS_08910 932765 933673 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584152.1 protein_id gnl|my_center|LOCUS_08910 933670 934545 gene locus_tag LOCUS_08920 933670 934545 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776639.1 protein_id gnl|my_center|LOCUS_08920 935275 934553 gene locus_tag LOCUS_08930 935275 934553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 936277 935330 gene locus_tag LOCUS_08940 936277 935330 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_08940 936999 936379 gene locus_tag LOCUS_08950 936999 936379 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466502.1 protein_id gnl|my_center|LOCUS_08950 938988 937015 gene locus_tag LOCUS_08960 938988 937015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 940300 939230 gene locus_tag LOCUS_08970 940300 939230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 941712 940348 gene locus_tag LOCUS_08980 941712 940348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 942469 941777 gene locus_tag LOCUS_08990 942469 941777 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_08990 943813 942638 gene locus_tag LOCUS_09000 gene galK 943813 942638 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_09000 944771 943806 gene locus_tag LOCUS_09010 gene galE 944771 943806 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_09010 945847 944768 gene locus_tag LOCUS_09020 gene galT 945847 944768 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_09020 946626 945844 gene locus_tag LOCUS_09030 946626 945844 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_09030 946908 947942 gene locus_tag LOCUS_09040 gene trpS 946908 947942 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_09040 947943 948464 gene locus_tag LOCUS_09050 947943 948464 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_09050 948504 949427 gene locus_tag LOCUS_09060 948504 949427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 949641 952400 gene locus_tag LOCUS_09070 949641 952400 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_09070 952397 955123 gene locus_tag LOCUS_09080 952397 955123 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_09080 955365 955114 gene locus_tag LOCUS_09090 955365 955114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 955497 957164 gene locus_tag LOCUS_09100 955497 957164 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_09100 957822 957166 gene locus_tag LOCUS_09110 957822 957166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 958738 957869 gene locus_tag LOCUS_09120 958738 957869 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026871.1 protein_id gnl|my_center|LOCUS_09120 959598 958762 gene locus_tag LOCUS_09130 959598 958762 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026871.1 protein_id gnl|my_center|LOCUS_09130 959854 961284 gene locus_tag LOCUS_09140 959854 961284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 961429 962937 gene locus_tag LOCUS_09150 961429 962937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 962953 964401 gene locus_tag LOCUS_09160 962953 964401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 964485 965513 gene locus_tag LOCUS_09170 964485 965513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 966543 965503 gene locus_tag LOCUS_09180 966543 965503 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 protein_id gnl|my_center|LOCUS_09180 966770 967426 gene locus_tag LOCUS_09190 gene thiE 966770 967426 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404299.1 protein_id gnl|my_center|LOCUS_09190 967426 968475 gene locus_tag LOCUS_09200 gene thiO 967426 968475 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_09200 968541 968735 gene locus_tag LOCUS_09210 gene thiS 968541 968735 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_09210 968738 969502 gene locus_tag LOCUS_09220 968738 969502 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_09220 969555 970379 gene locus_tag LOCUS_09230 gene thiD 969555 970379 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_09230 970391 971941 gene locus_tag LOCUS_09240 gene thiC 970391 971941 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230295.1 protein_id gnl|my_center|LOCUS_09240 972077 972424 gene locus_tag LOCUS_09250 972077 972424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 972883 972431 gene locus_tag LOCUS_09260 972883 972431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 974110 972950 gene locus_tag LOCUS_09270 974110 972950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 974216 975823 gene locus_tag LOCUS_09280 974216 975823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 975816 978359 gene locus_tag LOCUS_09290 975816 978359 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030575.1 protein_id gnl|my_center|LOCUS_09290 978565 979008 gene locus_tag LOCUS_09300 gene rplM 978565 979008 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_09300 979037 979501 gene locus_tag LOCUS_09310 gene rpsI 979037 979501 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418308.1 protein_id gnl|my_center|LOCUS_09310 979579 980898 gene locus_tag LOCUS_09320 gene glmM 979579 980898 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_09320 980938 981561 gene locus_tag LOCUS_09330 980938 981561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 981586 982254 gene locus_tag LOCUS_09340 981586 982254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 982364 982972 gene locus_tag LOCUS_09350 982364 982972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 982998 983504 gene locus_tag LOCUS_09360 982998 983504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 983981 983580 gene locus_tag LOCUS_09370 983981 983580 CDS product DUF4267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227795.1 protein_id gnl|my_center|LOCUS_09370 984076 984666 gene locus_tag LOCUS_09380 984076 984666 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028219.1 protein_id gnl|my_center|LOCUS_09380 985235 984663 gene locus_tag LOCUS_09390 985235 984663 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_09390 986302 985307 gene locus_tag LOCUS_09400 986302 985307 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229961.1 protein_id gnl|my_center|LOCUS_09400 986891 986448 gene locus_tag LOCUS_09410 986891 986448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 986948 987595 gene locus_tag LOCUS_09420 986948 987595 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222271.1 protein_id gnl|my_center|LOCUS_09420 987701 988213 gene locus_tag LOCUS_09430 987701 988213 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_09430 988210 989193 gene locus_tag LOCUS_09440 988210 989193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 989266 990396 gene locus_tag LOCUS_09450 989266 990396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 990562 990894 gene locus_tag LOCUS_09460 gene nuoK 990562 990894 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029757.1 protein_id gnl|my_center|LOCUS_09460 990891 992705 gene locus_tag LOCUS_09470 990891 992705 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 protein_id gnl|my_center|LOCUS_09470 992702 994183 gene locus_tag LOCUS_09480 992702 994183 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_09480 994180 995622 gene locus_tag LOCUS_09490 994180 995622 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 protein_id gnl|my_center|LOCUS_09490 995752 996801 gene locus_tag LOCUS_09500 995752 996801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 996880 998244 gene locus_tag LOCUS_09510 996880 998244 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_09510 999224 998487 gene locus_tag LOCUS_09520 999224 998487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1000672 999236 gene locus_tag LOCUS_09530 1000672 999236 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172046.1 protein_id gnl|my_center|LOCUS_09530 1001592 1000711 gene locus_tag LOCUS_09540 1001592 1000711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1002806 1001589 gene locus_tag LOCUS_09550 1002806 1001589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1004179 1002818 gene locus_tag LOCUS_09560 1004179 1002818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1006181 1004496 gene locus_tag LOCUS_09570 1006181 1004496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1006359 1007951 gene locus_tag LOCUS_09580 1006359 1007951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1008771 1007959 gene locus_tag LOCUS_09590 1008771 1007959 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_09590 1009072 1010364 gene locus_tag LOCUS_09600 gene proP 1009072 1010364 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198608.1 protein_id gnl|my_center|LOCUS_09600 1010812 1010381 gene locus_tag LOCUS_09610 1010812 1010381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1011863 1010823 gene locus_tag LOCUS_09620 1011863 1010823 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226051.1 protein_id gnl|my_center|LOCUS_09620 1012426 1014006 gene locus_tag LOCUS_09630 1012426 1014006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1015272 1014028 gene locus_tag LOCUS_09640 1015272 1014028 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_09640 1015327 1016220 gene locus_tag LOCUS_09650 1015327 1016220 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646256.1 protein_id gnl|my_center|LOCUS_09650 1016728 1016228 gene locus_tag LOCUS_09660 1016728 1016228 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402987.1 protein_id gnl|my_center|LOCUS_09660 1016821 1017804 gene locus_tag LOCUS_09670 1016821 1017804 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_09670 1017877 1017959 gene locus_tag LOCUS_t00130 1017877 1017959 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1018459 1018677 gene locus_tag LOCUS_09680 1018459 1018677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1018674 1019075 gene locus_tag LOCUS_09690 1018674 1019075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1020263 1020940 gene locus_tag LOCUS_09700 1020263 1020940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1021919 1022824 gene locus_tag LOCUS_09710 1021919 1022824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1023271 1023960 gene locus_tag LOCUS_09720 1023271 1023960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1024077 1024481 gene locus_tag LOCUS_09730 1024077 1024481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1024500 1024787 gene locus_tag LOCUS_09740 1024500 1024787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1025621 1024782 gene locus_tag LOCUS_09750 1025621 1024782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1025831 1026076 gene locus_tag LOCUS_09760 1025831 1026076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1026077 1026403 gene locus_tag LOCUS_09770 1026077 1026403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1026400 1026687 gene locus_tag LOCUS_09780 1026400 1026687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1026684 1027535 gene locus_tag LOCUS_09790 1026684 1027535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230499.1 protein_id gnl|my_center|LOCUS_09790 1027539 1029698 gene locus_tag LOCUS_09800 1027539 1029698 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230500.1 protein_id gnl|my_center|LOCUS_09800 1029799 1030077 gene locus_tag LOCUS_09810 1029799 1030077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1030147 1032012 gene locus_tag LOCUS_09820 1030147 1032012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1032009 1032197 gene locus_tag LOCUS_09830 1032009 1032197 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039432.1 protein_id gnl|my_center|LOCUS_09830 1032194 1033606 gene locus_tag LOCUS_09840 1032194 1033606 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030198.1 protein_id gnl|my_center|LOCUS_09840 1033898 1034299 gene locus_tag LOCUS_09850 1033898 1034299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1034434 1034817 gene locus_tag LOCUS_09860 1034434 1034817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1034814 1035695 gene locus_tag LOCUS_09870 1034814 1035695 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230141.1 protein_id gnl|my_center|LOCUS_09870 1035803 1036441 gene locus_tag LOCUS_09880 1035803 1036441 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088307.1 protein_id gnl|my_center|LOCUS_09880 1036660 1037829 gene locus_tag LOCUS_09890 1036660 1037829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1037850 1038212 gene locus_tag LOCUS_09900 1037850 1038212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1038233 1038718 gene locus_tag LOCUS_09910 1038233 1038718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1038715 1039449 gene locus_tag LOCUS_09920 1038715 1039449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1039807 1039517 gene locus_tag LOCUS_09930 1039807 1039517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1041337 1039976 gene locus_tag LOCUS_09940 gene eccB 1041337 1039976 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_09940 1041524 1042702 gene locus_tag LOCUS_09950 1041524 1042702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1042731 1043021 gene locus_tag LOCUS_09960 1042731 1043021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1043049 1044278 gene locus_tag LOCUS_09970 1043049 1044278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1045870 1044458 gene locus_tag LOCUS_09980 gene eccD 1045870 1044458 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_09980 1045988 1050010 gene locus_tag LOCUS_09990 1045988 1050010 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 protein_id gnl|my_center|LOCUS_09990 1048343 1048251 gene locus_tag LOCUS_t00140 1048343 1048251 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1050148 1050450 gene locus_tag LOCUS_10000 1050148 1050450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1050470 1050745 gene locus_tag LOCUS_10010 1050470 1050745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1053827 1050840 gene locus_tag LOCUS_10020 1053827 1050840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1055036 1053840 gene locus_tag LOCUS_10030 1055036 1053840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1055141 1056319 gene locus_tag LOCUS_10040 1055141 1056319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1057944 1056325 gene locus_tag LOCUS_10050 1057944 1056325 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030784.1 protein_id gnl|my_center|LOCUS_10050 1059761 1058172 gene locus_tag LOCUS_10060 1059761 1058172 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228541.1 protein_id gnl|my_center|LOCUS_10060 1060660 1059758 gene locus_tag LOCUS_10070 1060660 1059758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_10070 1060758 1061267 gene locus_tag LOCUS_10080 1060758 1061267 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222249.1 protein_id gnl|my_center|LOCUS_10080 1062044 1061421 gene locus_tag LOCUS_10090 1062044 1061421 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030265.1 protein_id gnl|my_center|LOCUS_10090 1063972 1062128 gene locus_tag LOCUS_10100 1063972 1062128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1064445 1064023 gene locus_tag LOCUS_10110 1064445 1064023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1064769 1065959 gene locus_tag LOCUS_10120 gene mycP 1064769 1065959 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_10120 1066022 1066894 gene locus_tag LOCUS_10130 1066022 1066894 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_10130 1068346 1066877 gene locus_tag LOCUS_10140 1068346 1066877 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_10140 1070405 1068396 gene locus_tag LOCUS_10150 1070405 1068396 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972899.1 protein_id gnl|my_center|LOCUS_10150 1070734 1071579 gene locus_tag LOCUS_10160 gene rsmA 1070734 1071579 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_10160 1071576 1072523 gene locus_tag LOCUS_10170 1071576 1072523 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 protein_id gnl|my_center|LOCUS_10170 1072988 1072500 gene locus_tag LOCUS_10180 1072988 1072500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1073051 1073758 gene locus_tag LOCUS_10190 1073051 1073758 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029682.1 protein_id gnl|my_center|LOCUS_10190 1074188 1073781 gene locus_tag LOCUS_10200 1074188 1073781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1076069 1074219 gene locus_tag LOCUS_10210 gene glmS 1076069 1074219 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_10210 1076270 1076569 gene locus_tag LOCUS_10220 1076270 1076569 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_10220 1076671 1078101 gene locus_tag LOCUS_10230 1076671 1078101 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727745.1 protein_id gnl|my_center|LOCUS_10230 1079211 1078111 gene locus_tag LOCUS_10240 1079211 1078111 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_10240 1080786 1079566 gene locus_tag LOCUS_10250 1080786 1079566 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_10250 1080886 1081530 gene locus_tag LOCUS_10260 gene pdxH 1080886 1081530 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_10260 1081614 1082513 gene locus_tag LOCUS_10270 1081614 1082513 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_10270 1082679 1083041 gene locus_tag LOCUS_10280 1082679 1083041 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060335.1 protein_id gnl|my_center|LOCUS_10280 1083651 1082968 gene locus_tag LOCUS_10290 1083651 1082968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1084660 1083698 gene locus_tag LOCUS_10300 1084660 1083698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1085086 1084787 gene locus_tag LOCUS_10310 1085086 1084787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1085436 1085083 gene locus_tag LOCUS_10320 1085436 1085083 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977138.1 protein_id gnl|my_center|LOCUS_10320 1085679 1086272 gene locus_tag LOCUS_10330 1085679 1086272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1086455 1088500 gene locus_tag LOCUS_10340 1086455 1088500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1088497 1090236 gene locus_tag LOCUS_10350 1088497 1090236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1090239 1090793 gene locus_tag LOCUS_10360 1090239 1090793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1091237 1091013 gene locus_tag LOCUS_10370 1091237 1091013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1091119 1091646 gene locus_tag LOCUS_10380 1091119 1091646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1091973 1092824 gene locus_tag LOCUS_10390 1091973 1092824 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_10390 1092828 1093166 gene locus_tag LOCUS_10400 1092828 1093166 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404278.1 protein_id gnl|my_center|LOCUS_10400 1093273 1094091 gene locus_tag LOCUS_10410 1093273 1094091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1095072 1094104 gene locus_tag LOCUS_10420 1095072 1094104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1095139 1095822 gene locus_tag LOCUS_10430 1095139 1095822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222372.1 protein_id gnl|my_center|LOCUS_10430 1095819 1096529 gene locus_tag LOCUS_10440 1095819 1096529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030627.1 protein_id gnl|my_center|LOCUS_10440 1096548 1097567 gene locus_tag LOCUS_10450 1096548 1097567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1097760 1098941 gene locus_tag LOCUS_10460 1097760 1098941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1099438 1099067 gene locus_tag LOCUS_10470 1099438 1099067 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971536.1 protein_id gnl|my_center|LOCUS_10470 1100475 1099468 gene locus_tag LOCUS_10480 1100475 1099468 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226898.1 protein_id gnl|my_center|LOCUS_10480 1100496 1101248 gene locus_tag LOCUS_10490 1100496 1101248 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_10490 1101311 1102540 gene locus_tag LOCUS_10500 1101311 1102540 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222988.1 protein_id gnl|my_center|LOCUS_10500 1102537 1103415 gene locus_tag LOCUS_10510 1102537 1103415 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222989.1 protein_id gnl|my_center|LOCUS_10510 1103416 1104237 gene locus_tag LOCUS_10520 1103416 1104237 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222990.1 protein_id gnl|my_center|LOCUS_10520 1104243 1105406 gene locus_tag LOCUS_10530 gene ugpC 1104243 1105406 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222991.1 protein_id gnl|my_center|LOCUS_10530 1106443 1105472 gene locus_tag LOCUS_10540 1106443 1105472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1106958 1106440 gene locus_tag LOCUS_10550 1106958 1106440 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_10550 1107089 1108252 gene locus_tag LOCUS_10560 1107089 1108252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027555.1 protein_id gnl|my_center|LOCUS_10560 1108861 1108298 gene locus_tag LOCUS_10570 1108861 1108298 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112393.1 protein_id gnl|my_center|LOCUS_10570 1109002 1109328 gene locus_tag LOCUS_10580 1109002 1109328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1109363 1111105 gene locus_tag LOCUS_10590 1109363 1111105 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030846.1 protein_id gnl|my_center|LOCUS_10590 1113314 1111242 gene locus_tag LOCUS_10600 1113314 1111242 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_10600 1115291 1113324 gene locus_tag LOCUS_10610 1115291 1113324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1115508 1119884 gene locus_tag LOCUS_10620 1115508 1119884 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228557.1 protein_id gnl|my_center|LOCUS_10620 1119887 1120453 gene locus_tag LOCUS_10630 1119887 1120453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1120536 1120901 gene locus_tag LOCUS_10640 1120536 1120901 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229185.1 protein_id gnl|my_center|LOCUS_10640 1123029 1120912 gene locus_tag LOCUS_10650 1123029 1120912 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319019.1 protein_id gnl|my_center|LOCUS_10650 1123339 1123641 gene locus_tag LOCUS_10660 1123339 1123641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1124811 1123690 gene locus_tag LOCUS_10670 1124811 1123690 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_10670 1125889 1124921 gene locus_tag LOCUS_10680 1125889 1124921 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_10680 1126415 1125900 gene locus_tag LOCUS_10690 1126415 1125900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1126486 1126659 gene locus_tag LOCUS_10700 1126486 1126659 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_10700 1126656 1127111 gene locus_tag LOCUS_10710 1126656 1127111 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092109.1 protein_id gnl|my_center|LOCUS_10710 1127329 1127994 gene locus_tag LOCUS_10720 1127329 1127994 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_10720 1128158 1131838 gene locus_tag LOCUS_10730 1128158 1131838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1131957 1133690 gene locus_tag LOCUS_10740 1131957 1133690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1134450 1133773 gene locus_tag LOCUS_10750 gene crp 1134450 1133773 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908817.1 protein_id gnl|my_center|LOCUS_10750 1134689 1135156 gene locus_tag LOCUS_10760 1134689 1135156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1136346 1135153 gene locus_tag LOCUS_10770 1136346 1135153 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 protein_id gnl|my_center|LOCUS_10770 1137042 1136401 gene locus_tag LOCUS_10780 1137042 1136401 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_10780 1137602 1137039 gene locus_tag LOCUS_10790 1137602 1137039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1138336 1137599 gene locus_tag LOCUS_10800 gene nth 1138336 1137599 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 protein_id gnl|my_center|LOCUS_10800 1138497 1140602 gene locus_tag LOCUS_10810 1138497 1140602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1140595 1140957 gene locus_tag LOCUS_10820 1140595 1140957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1141042 1141797 gene locus_tag LOCUS_10830 1141042 1141797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223851.1 protein_id gnl|my_center|LOCUS_10830 1142996 1141794 gene locus_tag LOCUS_10840 1142996 1141794 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_10840 1143189 1143908 gene locus_tag LOCUS_10850 1143189 1143908 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974575.1 protein_id gnl|my_center|LOCUS_10850 1144003 1145157 gene locus_tag LOCUS_10860 1144003 1145157 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 protein_id gnl|my_center|LOCUS_10860 1145195 1146325 gene locus_tag LOCUS_10870 1145195 1146325 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 protein_id gnl|my_center|LOCUS_10870 1146322 1147122 gene locus_tag LOCUS_10880 1146322 1147122 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028560.1 protein_id gnl|my_center|LOCUS_10880 1147662 1147150 gene locus_tag LOCUS_10890 1147662 1147150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1149195 1147672 gene locus_tag LOCUS_10900 1149195 1147672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1150591 1149218 gene locus_tag LOCUS_10910 1150591 1149218 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_10910 1150705 1151565 gene locus_tag LOCUS_10920 1150705 1151565 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325363.1 protein_id gnl|my_center|LOCUS_10920 1151760 1152485 gene locus_tag LOCUS_10930 1151760 1152485 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230540.1 protein_id gnl|my_center|LOCUS_10930 1153657 1152446 gene locus_tag LOCUS_10940 1153657 1152446 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_10940 1153890 1154186 gene locus_tag LOCUS_10950 gene groES 1153890 1154186 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_10950 1154329 1155873 gene locus_tag LOCUS_10960 gene groL 1154329 1155873 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_10960 1156100 1156723 gene locus_tag LOCUS_10970 1156100 1156723 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073605.1 protein_id gnl|my_center|LOCUS_10970 1159250 1156794 gene locus_tag LOCUS_10980 1159250 1156794 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230337.1 protein_id gnl|my_center|LOCUS_10980 1159705 1159316 gene locus_tag LOCUS_10990 1159705 1159316 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073549.1 protein_id gnl|my_center|LOCUS_10990 1159898 1161436 gene locus_tag LOCUS_11000 gene guaB 1159898 1161436 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727766.1 protein_id gnl|my_center|LOCUS_11000 1161534 1162592 gene locus_tag LOCUS_11010 1161534 1162592 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_11010 1162608 1163267 gene locus_tag LOCUS_11020 1162608 1163267 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_11020 1164445 1163408 gene locus_tag LOCUS_11030 1164445 1163408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1166636 1164546 gene locus_tag LOCUS_11040 1166636 1164546 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036738.1 protein_id gnl|my_center|LOCUS_11040 1166741 1168264 gene locus_tag LOCUS_11050 gene guaA 1166741 1168264 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222695.1 protein_id gnl|my_center|LOCUS_11050 1168505 1169422 gene locus_tag LOCUS_11060 1168505 1169422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1169879 1170673 gene locus_tag LOCUS_11070 gene pssA 1169879 1170673 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957377.1 protein_id gnl|my_center|LOCUS_11070 1170691 1171428 gene locus_tag LOCUS_11080 gene modA 1170691 1171428 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230240.1 protein_id gnl|my_center|LOCUS_11080 1171445 1172200 gene locus_tag LOCUS_11090 1171445 1172200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_11090 1172221 1172865 gene locus_tag LOCUS_11100 1172221 1172865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1172876 1173748 gene locus_tag LOCUS_11110 1172876 1173748 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230424.1 protein_id gnl|my_center|LOCUS_11110 1173807 1174253 gene locus_tag LOCUS_11120 1173807 1174253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1175159 1174263 gene locus_tag LOCUS_11130 1175159 1174263 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_11130 1175260 1176264 gene locus_tag LOCUS_11140 1175260 1176264 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222702.1 protein_id gnl|my_center|LOCUS_11140 1177075 1176194 gene locus_tag LOCUS_11150 1177075 1176194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1177771 1177184 gene locus_tag LOCUS_11160 1177771 1177184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1178185 1177784 gene locus_tag LOCUS_11170 1178185 1177784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1180370 1178382 gene locus_tag LOCUS_11180 1180370 1178382 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_11180 1180294 1180512 gene locus_tag LOCUS_11190 1180294 1180512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1180688 1182193 gene locus_tag LOCUS_11200 1180688 1182193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1183206 1182190 gene locus_tag LOCUS_11210 gene cydB 1183206 1182190 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933479.1 protein_id gnl|my_center|LOCUS_11210 1184636 1183203 gene locus_tag LOCUS_11220 1184636 1183203 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116948659.1 protein_id gnl|my_center|LOCUS_11220 1184749 1185684 gene locus_tag LOCUS_11230 1184749 1185684 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028976.1 protein_id gnl|my_center|LOCUS_11230 1185688 1186521 gene locus_tag LOCUS_11240 1185688 1186521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1186597 1188207 gene locus_tag LOCUS_11250 1186597 1188207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1189634 1188270 gene locus_tag LOCUS_11260 1189634 1188270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1190005 1189637 gene locus_tag LOCUS_11270 1190005 1189637 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_11270 1190225 1190752 gene locus_tag LOCUS_11280 1190225 1190752 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222999.1 protein_id gnl|my_center|LOCUS_11280 1190740 1191672 gene locus_tag LOCUS_11290 1190740 1191672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1191725 1192849 gene locus_tag LOCUS_11300 1191725 1192849 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226181.1 protein_id gnl|my_center|LOCUS_11300 1192940 1193689 gene locus_tag LOCUS_11310 1192940 1193689 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977938.1 protein_id gnl|my_center|LOCUS_11310 1193686 1194456 gene locus_tag LOCUS_11320 1193686 1194456 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027447.1 protein_id gnl|my_center|LOCUS_11320 1194591 1194518 gene locus_tag LOCUS_t00150 1194591 1194518 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1197120 1194610 gene locus_tag LOCUS_11330 1197120 1194610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1198370 1197117 gene locus_tag LOCUS_11340 1198370 1197117 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_11340 1199167 1198367 gene locus_tag LOCUS_11350 1199167 1198367 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_11350 1200342 1199239 gene locus_tag LOCUS_11360 1200342 1199239 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_11360 1202897 1200588 gene locus_tag LOCUS_11370 1202897 1200588 CDS product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030632.1 protein_id gnl|my_center|LOCUS_11370 1203348 1202986 gene locus_tag LOCUS_11380 1203348 1202986 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_11380 1203499 1205802 gene locus_tag LOCUS_11390 gene glgX 1203499 1205802 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224463.1 protein_id gnl|my_center|LOCUS_11390 1206615 1205806 gene locus_tag LOCUS_11400 1206615 1205806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1206769 1208910 gene locus_tag LOCUS_11410 1206769 1208910 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_11410 1209227 1210201 gene locus_tag LOCUS_11420 1209227 1210201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1210234 1211352 gene locus_tag LOCUS_11430 1210234 1211352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1212289 1211291 gene locus_tag LOCUS_11440 gene glpX 1212289 1211291 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_11440 1212422 1212967 gene locus_tag LOCUS_11450 1212422 1212967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1213141 1216158 gene locus_tag LOCUS_11460 1213141 1216158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1216479 1217585 gene locus_tag LOCUS_11470 1216479 1217585 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_11470 1217582 1218454 gene locus_tag LOCUS_11480 1217582 1218454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_11480 1218462 1219517 gene locus_tag LOCUS_11490 1218462 1219517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_11490 1219514 1220527 gene locus_tag LOCUS_11500 1219514 1220527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_11500 1220524 1220730 gene locus_tag LOCUS_11510 1220524 1220730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1220727 1222577 gene locus_tag LOCUS_11520 1220727 1222577 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880698.1 protein_id gnl|my_center|LOCUS_11520 1223740 1222574 gene locus_tag LOCUS_11530 1223740 1222574 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742200.1 protein_id gnl|my_center|LOCUS_11530 1224870 1223740 gene locus_tag LOCUS_11540 1224870 1223740 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742200.1 protein_id gnl|my_center|LOCUS_11540 1225598 1227487 gene locus_tag LOCUS_11550 1225598 1227487 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031188.1 protein_id gnl|my_center|LOCUS_11550 1227521 1227955 gene locus_tag LOCUS_11560 1227521 1227955 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972203.1 protein_id gnl|my_center|LOCUS_11560 1228075 1228332 gene locus_tag LOCUS_11570 1228075 1228332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1228310 1228909 gene locus_tag LOCUS_11580 1228310 1228909 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327875.1 protein_id gnl|my_center|LOCUS_11580 1228921 1229502 gene locus_tag LOCUS_11590 1228921 1229502 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972200.1 protein_id gnl|my_center|LOCUS_11590 1230710 1229517 gene locus_tag LOCUS_11600 1230710 1229517 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_11600 1232230 1230758 gene locus_tag LOCUS_11610 1232230 1230758 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225537.1 protein_id gnl|my_center|LOCUS_11610 1234253 1232241 gene locus_tag LOCUS_11620 1234253 1232241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1236002 1234842 gene locus_tag LOCUS_11630 1236002 1234842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1236042 1236845 gene locus_tag LOCUS_11640 1236042 1236845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1236974 1237657 gene locus_tag LOCUS_11650 1236974 1237657 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111908.1 protein_id gnl|my_center|LOCUS_11650 1237711 1240320 gene locus_tag LOCUS_11660 1237711 1240320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1240434 1242071 gene locus_tag LOCUS_11670 1240434 1242071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1242163 1243509 gene locus_tag LOCUS_11680 1242163 1243509 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_11680 1243509 1243904 gene locus_tag LOCUS_11690 1243509 1243904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1244146 1244964 gene locus_tag LOCUS_11700 1244146 1244964 CDS product SCO2525 family SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976278.1 protein_id gnl|my_center|LOCUS_11700 1244912 1246741 gene locus_tag LOCUS_11710 1244912 1246741 CDS product SCO2524 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028405.1 protein_id gnl|my_center|LOCUS_11710 1246744 1247661 gene locus_tag LOCUS_11720 1246744 1247661 CDS product SCO2523 family variant P-loop protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976280.1 protein_id gnl|my_center|LOCUS_11720 1247658 1248641 gene locus_tag LOCUS_11730 1247658 1248641 CDS product SCO2522 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485045.1 protein_id gnl|my_center|LOCUS_11730 1249593 1248655 gene locus_tag LOCUS_11740 1249593 1248655 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_11740 1250629 1249631 gene locus_tag LOCUS_11750 1250629 1249631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1251588 1250647 gene locus_tag LOCUS_11760 1251588 1250647 CDS product SCO2521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028403.1 protein_id gnl|my_center|LOCUS_11760 1251710 1252666 gene locus_tag LOCUS_11770 1251710 1252666 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409545.1 protein_id gnl|my_center|LOCUS_11770 1252816 1253886 gene locus_tag LOCUS_11780 1252816 1253886 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224302.1 protein_id gnl|my_center|LOCUS_11780 1253886 1254926 gene locus_tag LOCUS_11790 1253886 1254926 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284352.1 protein_id gnl|my_center|LOCUS_11790 1254926 1256035 gene locus_tag LOCUS_11800 1254926 1256035 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222537.1 protein_id gnl|my_center|LOCUS_11800 1256032 1257165 gene locus_tag LOCUS_11810 1256032 1257165 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223669.1 protein_id gnl|my_center|LOCUS_11810 1257162 1258460 gene locus_tag LOCUS_11820 1257162 1258460 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028340.1 protein_id gnl|my_center|LOCUS_11820 1258457 1259050 gene locus_tag LOCUS_11830 1258457 1259050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1259047 1259817 gene locus_tag LOCUS_11840 1259047 1259817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1260234 1263662 gene locus_tag LOCUS_11850 1260234 1263662 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296696.1 protein_id gnl|my_center|LOCUS_11850 1263760 1267641 gene locus_tag LOCUS_11860 1263760 1267641 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_11860 1267674 1268090 gene locus_tag LOCUS_11870 1267674 1268090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1268100 1269065 gene locus_tag LOCUS_11880 1268100 1269065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1269544 1269918 gene locus_tag LOCUS_11890 gene rpsL 1269544 1269918 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_11890 1269918 1270388 gene locus_tag LOCUS_11900 gene rpsG 1269918 1270388 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403456.1 protein_id gnl|my_center|LOCUS_11900 1270431 1272530 gene locus_tag LOCUS_11910 gene fusA 1270431 1272530 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222602.1 protein_id gnl|my_center|LOCUS_11910 1272630 1273823 gene locus_tag LOCUS_11920 gene tuf 1272630 1273823 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_11920 1274113 1274421 gene locus_tag LOCUS_11930 gene rpsJ 1274113 1274421 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_11930 1274434 1275096 gene locus_tag LOCUS_11940 gene rplC 1274434 1275096 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_11940 1275093 1275746 gene locus_tag LOCUS_11950 gene rplD 1275093 1275746 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_11950 1275743 1276057 gene locus_tag LOCUS_11960 gene rplW 1275743 1276057 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102087.1 protein_id gnl|my_center|LOCUS_11960 1276080 1276919 gene locus_tag LOCUS_11970 gene rplB 1276080 1276919 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055646.1 protein_id gnl|my_center|LOCUS_11970 1276925 1277206 gene locus_tag LOCUS_11980 gene rpsS 1276925 1277206 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027275662.1 protein_id gnl|my_center|LOCUS_11980 1277234 1277710 gene locus_tag LOCUS_11990 gene rplV 1277234 1277710 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055650.1 protein_id gnl|my_center|LOCUS_11990 1277710 1278507 gene locus_tag LOCUS_12000 gene rpsC 1277710 1278507 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403590.1 protein_id gnl|my_center|LOCUS_12000 1278513 1278938 gene locus_tag LOCUS_12010 gene rplP 1278513 1278938 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_12010 1278938 1279177 gene locus_tag LOCUS_12020 gene rpmC 1278938 1279177 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892831.1 protein_id gnl|my_center|LOCUS_12020 1279174 1279440 gene locus_tag LOCUS_12030 gene rpsQ 1279174 1279440 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_12030 1279453 1279821 gene locus_tag LOCUS_12040 gene rplN 1279453 1279821 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_12040 1279826 1280140 gene locus_tag LOCUS_12050 gene rplX 1279826 1280140 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 protein_id gnl|my_center|LOCUS_12050 1280140 1280718 gene locus_tag LOCUS_12060 gene rplE 1280140 1280718 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403660.1 protein_id gnl|my_center|LOCUS_12060 1280720 1280905 gene locus_tag LOCUS_12070 1280720 1280905 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_12070 1280977 1281384 gene locus_tag LOCUS_12080 gene rpsH 1280977 1281384 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_12080 1281402 1281941 gene locus_tag LOCUS_12090 gene rplF 1281402 1281941 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_12090 1281942 1282337 gene locus_tag LOCUS_12100 gene rplR 1281942 1282337 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_12100 1282410 1283036 gene locus_tag LOCUS_12110 gene rpsE 1282410 1283036 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222614.1 protein_id gnl|my_center|LOCUS_12110 1283049 1283231 gene locus_tag LOCUS_12120 gene rpmD 1283049 1283231 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_12120 1283235 1283690 gene locus_tag LOCUS_12130 gene rplO 1283235 1283690 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222616.1 protein_id gnl|my_center|LOCUS_12130 1283912 1285285 gene locus_tag LOCUS_12140 gene secY 1283912 1285285 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_12140 1285299 1285952 gene locus_tag LOCUS_12150 1285299 1285952 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_12150 1285952 1286785 gene locus_tag LOCUS_12160 gene map 1285952 1286785 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029827.1 protein_id gnl|my_center|LOCUS_12160 1286828 1287316 gene locus_tag LOCUS_12170 1286828 1287316 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190249366.1 protein_id gnl|my_center|LOCUS_12170 1287358 1287855 gene locus_tag LOCUS_12180 1287358 1287855 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190249366.1 protein_id gnl|my_center|LOCUS_12180 1287935 1288564 gene locus_tag LOCUS_12190 1287935 1288564 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_12190 1288743 1288964 gene locus_tag LOCUS_12200 gene infA 1288743 1288964 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_12200 1289287 1289667 gene locus_tag LOCUS_12210 gene rpsM 1289287 1289667 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776352.1 protein_id gnl|my_center|LOCUS_12210 1289696 1290094 gene locus_tag LOCUS_12220 gene rpsK 1289696 1290094 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_12220 1290115 1290741 gene locus_tag LOCUS_12230 gene rpsD 1290115 1290741 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222624.1 protein_id gnl|my_center|LOCUS_12230 1290845 1291882 gene locus_tag LOCUS_12240 1290845 1291882 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558887.1 protein_id gnl|my_center|LOCUS_12240 1291913 1292425 gene locus_tag LOCUS_12250 1291913 1292425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1292435 1293337 gene locus_tag LOCUS_12260 gene truA 1292435 1293337 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418344.1 protein_id gnl|my_center|LOCUS_12260 1294234 1293377 gene locus_tag LOCUS_12270 1294234 1293377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1294380 1294982 gene locus_tag LOCUS_12280 1294380 1294982 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_12280 1295102 1296319 gene locus_tag LOCUS_12290 1295102 1296319 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_12290 1296627 1296923 gene locus_tag LOCUS_12300 1296627 1296923 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 protein_id gnl|my_center|LOCUS_12300 1298814 1296877 gene locus_tag LOCUS_12310 1298814 1296877 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_12310 1299094 1299675 gene locus_tag LOCUS_12320 1299094 1299675 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230116.1 protein_id gnl|my_center|LOCUS_12320 1299742 1301013 gene locus_tag LOCUS_12330 1299742 1301013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1301025 1301873 gene locus_tag LOCUS_12340 1301025 1301873 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_12340 1302681 1301902 gene locus_tag LOCUS_12350 1302681 1301902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1304902 1302656 gene locus_tag LOCUS_12360 1304902 1302656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1305662 1304892 gene locus_tag LOCUS_12370 1305662 1304892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1305803 1306285 gene locus_tag LOCUS_12380 1305803 1306285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1306421 1307020 gene locus_tag LOCUS_12390 1306421 1307020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1308740 1307049 gene locus_tag LOCUS_12400 1308740 1307049 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950653.1 protein_id gnl|my_center|LOCUS_12400 1309172 1308744 gene locus_tag LOCUS_12410 1309172 1308744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1309658 1309278 gene locus_tag LOCUS_12420 1309658 1309278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1309677 1310876 gene locus_tag LOCUS_12430 1309677 1310876 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804417.1 protein_id gnl|my_center|LOCUS_12430 1311022 1310873 gene locus_tag LOCUS_12440 1311022 1310873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1311126 1312184 gene locus_tag LOCUS_12450 gene paaA 1311126 1312184 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_12450 1312181 1312462 gene locus_tag LOCUS_12460 gene paaB 1312181 1312462 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_12460 1312459 1313160 gene locus_tag LOCUS_12470 gene paaC 1312459 1313160 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813293.1 protein_id gnl|my_center|LOCUS_12470 1313154 1313648 gene locus_tag LOCUS_12480 gene paaJ 1313154 1313648 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868899.1 protein_id gnl|my_center|LOCUS_12480 1313733 1314833 gene locus_tag LOCUS_12490 gene paaK 1313733 1314833 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971667.1 protein_id gnl|my_center|LOCUS_12490 1316463 1314907 gene locus_tag LOCUS_12500 1316463 1314907 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 protein_id gnl|my_center|LOCUS_12500 1317258 1316509 gene locus_tag LOCUS_12510 1317258 1316509 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532931.1 protein_id gnl|my_center|LOCUS_12510 1317390 1320866 gene locus_tag LOCUS_12520 1317390 1320866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1321609 1320863 gene locus_tag LOCUS_12530 1321609 1320863 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325634.1 protein_id gnl|my_center|LOCUS_12530 1323215 1321731 gene locus_tag LOCUS_12540 1323215 1321731 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259365.1 protein_id gnl|my_center|LOCUS_12540 1324334 1323495 gene locus_tag LOCUS_12550 1324334 1323495 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031499.1 protein_id gnl|my_center|LOCUS_12550 1324419 1325150 gene locus_tag LOCUS_12560 1324419 1325150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1325229 1325960 gene locus_tag LOCUS_12570 1325229 1325960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1327680 1325974 gene locus_tag LOCUS_12580 1327680 1325974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1328890 1327691 gene locus_tag LOCUS_12590 1328890 1327691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1331140 1328996 gene locus_tag LOCUS_12600 1331140 1328996 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_12600 1332756 1331188 gene locus_tag LOCUS_12610 1332756 1331188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1334685 1332880 gene locus_tag LOCUS_12620 1334685 1332880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1335373 1334891 gene locus_tag LOCUS_12630 1335373 1334891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1335637 1336107 gene locus_tag LOCUS_12640 1335637 1336107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12640 1336469 1337626 gene locus_tag LOCUS_12650 gene mqnC 1336469 1337626 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029726.1 protein_id gnl|my_center|LOCUS_12650 1337731 1338405 gene locus_tag LOCUS_12660 1337731 1338405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1339095 1338427 gene locus_tag LOCUS_12670 1339095 1338427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1340257 1339106 gene locus_tag LOCUS_12680 1340257 1339106 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_12680 1340664 1340254 gene locus_tag LOCUS_12690 1340664 1340254 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891724.1 protein_id gnl|my_center|LOCUS_12690 1341829 1340702 gene locus_tag LOCUS_12700 1341829 1340702 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270408.1 protein_id gnl|my_center|LOCUS_12700 1341913 1342398 gene locus_tag LOCUS_12710 1341913 1342398 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328737.1 protein_id gnl|my_center|LOCUS_12710 1343128 1342379 gene locus_tag LOCUS_12720 1343128 1342379 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974661.1 protein_id gnl|my_center|LOCUS_12720 1343196 1343897 gene locus_tag LOCUS_12730 1343196 1343897 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110820.1 protein_id gnl|my_center|LOCUS_12730 1344768 1343920 gene locus_tag LOCUS_12740 1344768 1343920 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226733.1 protein_id gnl|my_center|LOCUS_12740 1344901 1346016 gene locus_tag LOCUS_12750 1344901 1346016 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974677.1 protein_id gnl|my_center|LOCUS_12750 1346114 1347109 gene locus_tag LOCUS_12760 1346114 1347109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1347128 1347409 gene locus_tag LOCUS_12770 1347128 1347409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1347513 1348556 gene locus_tag LOCUS_12780 1347513 1348556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1348604 1349290 gene locus_tag LOCUS_12790 1348604 1349290 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061581.1 protein_id gnl|my_center|LOCUS_12790 1349380 1350753 gene locus_tag LOCUS_12800 1349380 1350753 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_12800 1350809 1351168 gene locus_tag LOCUS_12810 1350809 1351168 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_12810 1351171 1351821 gene locus_tag LOCUS_12820 1351171 1351821 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_12820 1351821 1352462 gene locus_tag LOCUS_12830 1351821 1352462 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222454.1 protein_id gnl|my_center|LOCUS_12830 1352459 1353793 gene locus_tag LOCUS_12840 1352459 1353793 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_12840 1353793 1354485 gene locus_tag LOCUS_12850 gene nuoE 1353793 1354485 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_12850 1354482 1355798 gene locus_tag LOCUS_12860 gene nuoF 1354482 1355798 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222457.1 protein_id gnl|my_center|LOCUS_12860 1355799 1358192 gene locus_tag LOCUS_12870 1355799 1358192 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899937.1 protein_id gnl|my_center|LOCUS_12870 1358185 1359528 gene locus_tag LOCUS_12880 gene nuoH 1358185 1359528 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_12880 1359532 1360089 gene locus_tag LOCUS_12890 gene nuoI 1359532 1360089 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_12890 1360086 1360856 gene locus_tag LOCUS_12900 1360086 1360856 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222461.1 protein_id gnl|my_center|LOCUS_12900 1360859 1361158 gene locus_tag LOCUS_12910 gene nuoK 1360859 1361158 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_12910 1361174 1363081 gene locus_tag LOCUS_12920 gene nuoL 1361174 1363081 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222462.1 protein_id gnl|my_center|LOCUS_12920 1363078 1364607 gene locus_tag LOCUS_12930 1363078 1364607 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_12930 1364604 1366178 gene locus_tag LOCUS_12940 gene nuoN 1364604 1366178 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222464.1 protein_id gnl|my_center|LOCUS_12940 1366309 1367175 gene locus_tag LOCUS_12950 1366309 1367175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1367227 1367299 gene locus_tag LOCUS_t00160 1367227 1367299 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1367476 1368900 gene locus_tag LOCUS_12960 gene glmU 1367476 1368900 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_12960 1369010 1369990 gene locus_tag LOCUS_12970 1369010 1369990 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405263.1 protein_id gnl|my_center|LOCUS_12970 1370167 1370784 gene locus_tag LOCUS_12980 1370167 1370784 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229968.1 protein_id gnl|my_center|LOCUS_12980 1370790 1371431 gene locus_tag LOCUS_12990 gene pth 1370790 1371431 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_12990 1371562 1372926 gene locus_tag LOCUS_13000 1371562 1372926 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_13000 1372954 1373802 gene locus_tag LOCUS_13010 1372954 1373802 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_13010 1373768 1374676 gene locus_tag LOCUS_13020 gene cysD 1373768 1374676 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086386.1 protein_id gnl|my_center|LOCUS_13020 1374679 1375944 gene locus_tag LOCUS_13030 1374679 1375944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1377155 1375950 gene locus_tag LOCUS_13040 1377155 1375950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1377259 1378119 gene locus_tag LOCUS_13050 1377259 1378119 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_13050 1378119 1378286 gene locus_tag LOCUS_13060 1378119 1378286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1378296 1379210 gene locus_tag LOCUS_13070 gene thrB 1378296 1379210 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_13070 1379602 1381389 gene locus_tag LOCUS_13080 gene rho 1379602 1381389 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229539.1 protein_id gnl|my_center|LOCUS_13080 1381478 1383262 gene locus_tag LOCUS_13090 1381478 1383262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1383396 1383623 gene locus_tag LOCUS_13100 gene rpmE 1383396 1383623 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775950.1 protein_id gnl|my_center|LOCUS_13100 1383730 1384833 gene locus_tag LOCUS_13110 gene prfA 1383730 1384833 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 protein_id gnl|my_center|LOCUS_13110 1386366 1384837 gene locus_tag LOCUS_13120 1386366 1384837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1386471 1387394 gene locus_tag LOCUS_13130 gene prmC 1386471 1387394 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730206.1 protein_id gnl|my_center|LOCUS_13130 1387381 1388034 gene locus_tag LOCUS_13140 1387381 1388034 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730205.1 protein_id gnl|my_center|LOCUS_13140 1388034 1388612 gene locus_tag LOCUS_13150 1388034 1388612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1388626 1389066 gene locus_tag LOCUS_13160 1388626 1389066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1389166 1389396 gene locus_tag LOCUS_13170 1389166 1389396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1389413 1390210 gene locus_tag LOCUS_13180 gene atpB 1389413 1390210 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_13180 1390280 1390522 gene locus_tag LOCUS_13190 gene atpE 1390280 1390522 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_13190 1390532 1391077 gene locus_tag LOCUS_13200 1390532 1391077 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_13200 1391077 1391904 gene locus_tag LOCUS_13210 1391077 1391904 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_13210 1391954 1393591 gene locus_tag LOCUS_13220 gene atpA 1391954 1393591 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229524.1 protein_id gnl|my_center|LOCUS_13220 1393595 1394533 gene locus_tag LOCUS_13230 1393595 1394533 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074370.1 protein_id gnl|my_center|LOCUS_13230 1394537 1395970 gene locus_tag LOCUS_13240 gene atpD 1394537 1395970 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406701.1 protein_id gnl|my_center|LOCUS_13240 1396058 1396327 gene locus_tag LOCUS_13250 1396058 1396327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1396324 1398984 gene locus_tag LOCUS_13260 1396324 1398984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1399541 1399041 gene locus_tag LOCUS_13270 1399541 1399041 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727524.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13270 1401018 1399780 gene locus_tag LOCUS_13280 1401018 1399780 CDS product selenocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665736.1 protein_id gnl|my_center|LOCUS_13280 1401094 1402020 gene locus_tag LOCUS_13290 1401094 1402020 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027744.1 protein_id gnl|my_center|LOCUS_13290 1402017 1402649 gene locus_tag LOCUS_13300 1402017 1402649 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_13300 1402682 1403935 gene locus_tag LOCUS_13310 gene mrx(A) 1402682 1403935 CDS product macrolide resistance MFS transporter Mrx(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004159.1 protein_id gnl|my_center|LOCUS_13310 1406543 1403982 gene locus_tag LOCUS_13320 1406543 1403982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1406727 1407269 gene locus_tag LOCUS_13330 1406727 1407269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1407266 1408450 gene locus_tag LOCUS_13340 1407266 1408450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1408452 1410062 gene locus_tag LOCUS_13350 1408452 1410062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1411515 1410613 gene locus_tag LOCUS_13360 1411515 1410613 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722221.1 protein_id gnl|my_center|LOCUS_13360 1411668 1412123 gene locus_tag LOCUS_13370 1411668 1412123 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223126.1 protein_id gnl|my_center|LOCUS_13370 1412134 1412928 gene locus_tag LOCUS_13380 1412134 1412928 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396522.1 protein_id gnl|my_center|LOCUS_13380 1413383 1412925 gene locus_tag LOCUS_13390 1413383 1412925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1413817 1413395 gene locus_tag LOCUS_13400 1413817 1413395 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230480.1 protein_id gnl|my_center|LOCUS_13400 1415286 1413928 gene locus_tag LOCUS_13410 1415286 1413928 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_13410 1415979 1415395 gene locus_tag LOCUS_13420 1415979 1415395 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140484.1 protein_id gnl|my_center|LOCUS_13420 1416185 1415976 gene locus_tag LOCUS_13430 1416185 1415976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1416830 1416261 gene locus_tag LOCUS_13440 1416830 1416261 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_13440 1418472 1416886 gene locus_tag LOCUS_13450 1418472 1416886 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_13450 1418390 1418605 gene locus_tag LOCUS_13460 1418390 1418605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1418643 1419467 gene locus_tag LOCUS_13470 1418643 1419467 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228034.1 protein_id gnl|my_center|LOCUS_13470 1419731 1419468 gene locus_tag LOCUS_13480 1419731 1419468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666679.1 protein_id gnl|my_center|LOCUS_13480 1419920 1420489 gene locus_tag LOCUS_13490 1419920 1420489 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971509.1 protein_id gnl|my_center|LOCUS_13490 1420641 1421279 gene locus_tag LOCUS_13500 1420641 1421279 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_13500 1421360 1421584 gene locus_tag LOCUS_13510 1421360 1421584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1421773 1422135 gene locus_tag LOCUS_13520 1421773 1422135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1423587 1422166 gene locus_tag LOCUS_13530 1423587 1422166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1425161 1423608 gene locus_tag LOCUS_13540 1425161 1423608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1425299 1425460 gene locus_tag LOCUS_13550 1425299 1425460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1425609 1425971 gene locus_tag LOCUS_13560 1425609 1425971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1426108 1426833 gene locus_tag LOCUS_13570 1426108 1426833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13570 1427258 1426830 gene locus_tag LOCUS_13580 1427258 1426830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1427348 1427695 gene locus_tag LOCUS_13590 1427348 1427695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1427823 1428899 gene locus_tag LOCUS_13600 1427823 1428899 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_13600 1429009 1430559 gene locus_tag LOCUS_13610 1429009 1430559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_13610 1430549 1431790 gene locus_tag LOCUS_13620 1430549 1431790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13620 1431796 1433088 gene locus_tag LOCUS_13630 1431796 1433088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_13630 1433119 1433517 gene locus_tag LOCUS_13640 1433119 1433517 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056128.1 protein_id gnl|my_center|LOCUS_13640 1433526 1434800 gene locus_tag LOCUS_13650 1433526 1434800 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776139.1 protein_id gnl|my_center|LOCUS_13650 1434957 1435631 gene locus_tag LOCUS_13660 1434957 1435631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1435902 1436120 gene locus_tag LOCUS_13670 1435902 1436120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1436187 1437053 gene locus_tag LOCUS_13680 1436187 1437053 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225433.1 protein_id gnl|my_center|LOCUS_13680 1437050 1437424 gene locus_tag LOCUS_13690 1437050 1437424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1437415 1438497 gene locus_tag LOCUS_13700 1437415 1438497 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_13700 1438639 1439364 gene locus_tag LOCUS_13710 1438639 1439364 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030153.1 protein_id gnl|my_center|LOCUS_13710 1439468 1441270 gene locus_tag LOCUS_13720 1439468 1441270 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_13720 1441282 1442538 gene locus_tag LOCUS_13730 1441282 1442538 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_13730 1442666 1444441 gene locus_tag LOCUS_13740 1442666 1444441 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971902.1 protein_id gnl|my_center|LOCUS_13740 1445232 1444558 gene locus_tag LOCUS_13750 1445232 1444558 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410207.1 protein_id gnl|my_center|LOCUS_13750 1445286 1445645 gene locus_tag LOCUS_13760 1445286 1445645 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_13760 1445825 1447201 gene locus_tag LOCUS_13770 gene tig 1445825 1447201 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093116.1 protein_id gnl|my_center|LOCUS_13770 1447442 1448065 gene locus_tag LOCUS_13780 1447442 1448065 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030186848.1 protein_id gnl|my_center|LOCUS_13780 1448088 1448720 gene locus_tag LOCUS_13790 1448088 1448720 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 protein_id gnl|my_center|LOCUS_13790 1448930 1450633 gene locus_tag LOCUS_13800 1448930 1450633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1450530 1451546 gene locus_tag LOCUS_13810 1450530 1451546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1452435 1451560 gene locus_tag LOCUS_13820 1452435 1451560 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230953.1 protein_id gnl|my_center|LOCUS_13820 1453877 1452501 gene locus_tag LOCUS_13830 1453877 1452501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1453957 1454937 gene locus_tag LOCUS_13840 gene yedA 1453957 1454937 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_13840 1454964 1455803 gene locus_tag LOCUS_13850 1454964 1455803 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136583.1 protein_id gnl|my_center|LOCUS_13850 1456018 1455842 gene locus_tag LOCUS_13860 1456018 1455842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1457679 1456123 gene locus_tag LOCUS_13870 1457679 1456123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1459096 1457672 gene locus_tag LOCUS_13880 1459096 1457672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1459236 1462256 gene locus_tag LOCUS_13890 1459236 1462256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1462298 1464046 gene locus_tag LOCUS_13900 1462298 1464046 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 protein_id gnl|my_center|LOCUS_13900 1464145 1467225 gene locus_tag LOCUS_13910 1464145 1467225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1467236 1468120 gene locus_tag LOCUS_13920 1467236 1468120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_13920 1468117 1468773 gene locus_tag LOCUS_13930 1468117 1468773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_13930 1468821 1470386 gene locus_tag LOCUS_13940 gene dacB 1468821 1470386 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_13940 1470504 1471121 gene locus_tag LOCUS_13950 1470504 1471121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1471148 1472266 gene locus_tag LOCUS_13960 1471148 1472266 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_13960 1473332 1472289 gene locus_tag LOCUS_13970 1473332 1472289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1473782 1473375 gene locus_tag LOCUS_13980 1473782 1473375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1474311 1473808 gene locus_tag LOCUS_13990 1474311 1473808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1477893 1474618 gene locus_tag LOCUS_14000 1477893 1474618 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225961.1 protein_id gnl|my_center|LOCUS_14000 1478162 1479898 gene locus_tag LOCUS_14010 1478162 1479898 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_14010 1480555 1479905 gene locus_tag LOCUS_14020 1480555 1479905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1481055 1480624 gene locus_tag LOCUS_14030 1481055 1480624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14030 1482189 1481164 gene locus_tag LOCUS_14040 1482189 1481164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1482286 1482849 gene locus_tag LOCUS_14050 1482286 1482849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1483363 1482902 gene locus_tag LOCUS_14060 1483363 1482902 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863690.1 protein_id gnl|my_center|LOCUS_14060 1483873 1483397 gene locus_tag LOCUS_14070 1483873 1483397 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_14070 1484798 1483938 gene locus_tag LOCUS_14080 1484798 1483938 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_14080 1484908 1485492 gene locus_tag LOCUS_14090 1484908 1485492 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 protein_id gnl|my_center|LOCUS_14090 1486133 1485519 gene locus_tag LOCUS_14100 1486133 1485519 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_14100 1487275 1486130 gene locus_tag LOCUS_14110 1487275 1486130 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_14110 1487343 1487942 gene locus_tag LOCUS_14120 1487343 1487942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1488074 1489696 gene locus_tag LOCUS_14130 1488074 1489696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1490918 1489707 gene locus_tag LOCUS_14140 1490918 1489707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1492018 1490942 gene locus_tag LOCUS_14150 1492018 1490942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 protein_id gnl|my_center|LOCUS_14150 1492899 1492018 gene locus_tag LOCUS_14160 1492899 1492018 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030645.1 protein_id gnl|my_center|LOCUS_14160 1493864 1492896 gene locus_tag LOCUS_14170 1493864 1492896 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_14170 1495287 1493839 gene locus_tag LOCUS_14180 1495287 1493839 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_14180 1495667 1496269 gene locus_tag LOCUS_14190 1495667 1496269 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094783.1 protein_id gnl|my_center|LOCUS_14190 1496311 1497207 gene locus_tag LOCUS_14200 gene map 1496311 1497207 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223934.1 protein_id gnl|my_center|LOCUS_14200 1500061 1497281 gene locus_tag LOCUS_14210 1500061 1497281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1500717 1500058 gene locus_tag LOCUS_14220 1500717 1500058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 protein_id gnl|my_center|LOCUS_14220 1501355 1500771 gene locus_tag LOCUS_14230 1501355 1500771 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_14230 1501917 1501480 gene locus_tag LOCUS_14240 1501917 1501480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1502372 1501917 gene locus_tag LOCUS_14250 1502372 1501917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1502492 1502980 gene locus_tag LOCUS_14260 gene rimP 1502492 1502980 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_14260 1502984 1504027 gene locus_tag LOCUS_14270 gene nusA 1502984 1504027 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228123.1 protein_id gnl|my_center|LOCUS_14270 1504489 1507431 gene locus_tag LOCUS_14280 1504489 1507431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1507487 1507822 gene locus_tag LOCUS_14290 1507487 1507822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1507819 1508208 gene locus_tag LOCUS_14300 1507819 1508208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1508211 1508933 gene locus_tag LOCUS_14310 1508211 1508933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1509487 1508930 gene locus_tag LOCUS_14320 gene orn 1509487 1508930 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831683.1 protein_id gnl|my_center|LOCUS_14320 1509997 1510923 gene locus_tag LOCUS_14330 1509997 1510923 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_14330 1511880 1510975 gene locus_tag LOCUS_14340 1511880 1510975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1512115 1512576 gene locus_tag LOCUS_14350 gene mscL 1512115 1512576 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889048.1 protein_id gnl|my_center|LOCUS_14350 1513379 1512573 gene locus_tag LOCUS_14360 1513379 1512573 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_14360 1514023 1513391 gene locus_tag LOCUS_14370 1514023 1513391 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312123.1 protein_id gnl|my_center|LOCUS_14370 1516510 1514309 gene locus_tag LOCUS_14380 1516510 1514309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1516642 1516932 gene locus_tag LOCUS_14390 1516642 1516932 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365828.1 protein_id gnl|my_center|LOCUS_14390 1517564 1516929 gene locus_tag LOCUS_14400 1517564 1516929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1519426 1517561 gene locus_tag LOCUS_14410 1519426 1517561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1519775 1520989 gene locus_tag LOCUS_14420 1519775 1520989 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495115.1 protein_id gnl|my_center|LOCUS_14420 1522056 1520932 gene locus_tag LOCUS_14430 1522056 1520932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1524617 1522053 gene locus_tag LOCUS_14440 1524617 1522053 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223788.1 protein_id gnl|my_center|LOCUS_14440 1525590 1524661 gene locus_tag LOCUS_14450 1525590 1524661 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730506.1 protein_id gnl|my_center|LOCUS_14450 1527725 1525587 gene locus_tag LOCUS_14460 gene kdpB 1527725 1525587 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730505.1 protein_id gnl|my_center|LOCUS_14460 1529403 1527742 gene locus_tag LOCUS_14470 gene kdpA 1529403 1527742 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730504.1 protein_id gnl|my_center|LOCUS_14470 1529764 1530342 gene locus_tag LOCUS_14480 1529764 1530342 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_14480 1530411 1531724 gene locus_tag LOCUS_14490 1530411 1531724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1532509 1531781 gene locus_tag LOCUS_14500 1532509 1531781 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091388998.1 protein_id gnl|my_center|LOCUS_14500 1532569 1532754 gene locus_tag LOCUS_14510 1532569 1532754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1533149 1532712 gene locus_tag LOCUS_14520 1533149 1532712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1533454 1533146 gene locus_tag LOCUS_14530 1533454 1533146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1533567 1534193 gene locus_tag LOCUS_14540 1533567 1534193 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028964.1 protein_id gnl|my_center|LOCUS_14540 1534290 1535249 gene locus_tag LOCUS_14550 1534290 1535249 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_14550 1535262 1536017 gene locus_tag LOCUS_14560 1535262 1536017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229983.1 protein_id gnl|my_center|LOCUS_14560 1536049 1536876 gene locus_tag LOCUS_14570 1536049 1536876 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228034.1 protein_id gnl|my_center|LOCUS_14570 1536966 1537259 gene locus_tag LOCUS_14580 1536966 1537259 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973319.1 protein_id gnl|my_center|LOCUS_14580 1537275 1537712 gene locus_tag LOCUS_14590 gene rbfA 1537275 1537712 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228119.1 protein_id gnl|my_center|LOCUS_14590 1537828 1539156 gene locus_tag LOCUS_14600 1537828 1539156 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228111.1 protein_id gnl|my_center|LOCUS_14600 1541383 1539173 gene locus_tag LOCUS_14610 1541383 1539173 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742195.1 protein_id gnl|my_center|LOCUS_14610 1541768 1541499 gene locus_tag LOCUS_14620 1541768 1541499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230005.1 protein_id gnl|my_center|LOCUS_14620 1542133 1541765 gene locus_tag LOCUS_14630 1542133 1541765 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230004.1 protein_id gnl|my_center|LOCUS_14630 1543104 1542202 gene locus_tag LOCUS_14640 1543104 1542202 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_14640 1543517 1543591 gene locus_tag LOCUS_t00170 1543517 1543591 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1544827 1544471 gene locus_tag LOCUS_14650 1544827 1544471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1548170 1547421 gene locus_tag LOCUS_14660 1548170 1547421 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_14660 1548255 1549460 gene locus_tag LOCUS_14670 1548255 1549460 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776478.1 protein_id gnl|my_center|LOCUS_14670 1549535 1550743 gene locus_tag LOCUS_14680 1549535 1550743 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870180.1 protein_id gnl|my_center|LOCUS_14680 1550754 1551212 gene locus_tag LOCUS_14690 1550754 1551212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1551212 1552234 gene locus_tag LOCUS_14700 1551212 1552234 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425603.1 protein_id gnl|my_center|LOCUS_14700 1552231 1552848 gene locus_tag LOCUS_14710 1552231 1552848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1553340 1552849 gene locus_tag LOCUS_14720 1553340 1552849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1553372 1554025 gene locus_tag LOCUS_14730 1553372 1554025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1554905 1554054 gene locus_tag LOCUS_14740 1554905 1554054 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223519.1 protein_id gnl|my_center|LOCUS_14740 1555021 1555632 gene locus_tag LOCUS_14750 1555021 1555632 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973719.1 protein_id gnl|my_center|LOCUS_14750 1555941 1555696 gene locus_tag LOCUS_14760 1555941 1555696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1556311 1556081 gene locus_tag LOCUS_14770 1556311 1556081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1557171 1556308 gene locus_tag LOCUS_14780 1557171 1556308 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_14780 1557408 1557950 gene locus_tag LOCUS_14790 1557408 1557950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1559148 1558006 gene locus_tag LOCUS_14800 1559148 1558006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1559477 1559145 gene locus_tag LOCUS_14810 1559477 1559145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1559580 1559909 gene locus_tag LOCUS_14820 1559580 1559909 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921019.1 protein_id gnl|my_center|LOCUS_14820 1559906 1562005 gene locus_tag LOCUS_14830 1559906 1562005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1562063 1562575 gene locus_tag LOCUS_14840 1562063 1562575 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965573.1 protein_id gnl|my_center|LOCUS_14840 1562578 1563534 gene locus_tag LOCUS_14850 1562578 1563534 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312131.1 protein_id gnl|my_center|LOCUS_14850 1564031 1563531 gene locus_tag LOCUS_14860 1564031 1563531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227099.1 protein_id gnl|my_center|LOCUS_14860 1564827 1564126 gene locus_tag LOCUS_14870 gene sfp 1564827 1564126 CDS product 4'-phosphopantetheinyl transferase Sfp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573004.1 protein_id gnl|my_center|LOCUS_14870 1565756 1564851 gene locus_tag LOCUS_14880 1565756 1564851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1566825 1565749 gene locus_tag LOCUS_14890 1566825 1565749 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017275914.1 protein_id gnl|my_center|LOCUS_14890 1566993 1567748 gene locus_tag LOCUS_14900 1566993 1567748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1569563 1567779 gene locus_tag LOCUS_14910 1569563 1567779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1569990 1569571 gene locus_tag LOCUS_14920 1569990 1569571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1571225 1570026 gene locus_tag LOCUS_14930 1571225 1570026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1571766 1571227 gene locus_tag LOCUS_14940 1571766 1571227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1571975 1572463 gene locus_tag LOCUS_14950 1571975 1572463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1572495 1572965 gene locus_tag LOCUS_14960 1572495 1572965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1572947 1573897 gene locus_tag LOCUS_14970 1572947 1573897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1574011 1574364 gene locus_tag LOCUS_14980 1574011 1574364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1574361 1575116 gene locus_tag LOCUS_14990 1574361 1575116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1575612 1575103 gene locus_tag LOCUS_15000 1575612 1575103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1576973 1575609 gene locus_tag LOCUS_15010 1576973 1575609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1580325 1577359 gene locus_tag LOCUS_15020 1580325 1577359 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_15020 1581034 1580459 gene locus_tag LOCUS_15030 gene msrA 1581034 1580459 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083656.1 protein_id gnl|my_center|LOCUS_15030 1581411 1581139 gene locus_tag LOCUS_15040 1581411 1581139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1581614 1582762 gene locus_tag LOCUS_15050 1581614 1582762 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_15050 1582834 1584153 gene locus_tag LOCUS_15060 1582834 1584153 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_15060 1584173 1585516 gene locus_tag LOCUS_15070 1584173 1585516 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_15070 1585569 1586597 gene locus_tag LOCUS_15080 1585569 1586597 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887674.1 protein_id gnl|my_center|LOCUS_15080 1586791 1588647 gene locus_tag LOCUS_15090 1586791 1588647 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093091.1 protein_id gnl|my_center|LOCUS_15090 1589659 1588640 gene locus_tag LOCUS_15100 1589659 1588640 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908874.1 protein_id gnl|my_center|LOCUS_15100 1590003 1589731 gene locus_tag LOCUS_15110 1590003 1589731 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_15110 1590154 1590945 gene locus_tag LOCUS_15120 1590154 1590945 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027387.1 protein_id gnl|my_center|LOCUS_15120 1591193 1591753 gene locus_tag LOCUS_15130 1591193 1591753 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803749.1 protein_id gnl|my_center|LOCUS_15130 1593986 1591872 gene locus_tag LOCUS_15140 1593986 1591872 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030047.1 protein_id gnl|my_center|LOCUS_15140 1594758 1594093 gene locus_tag LOCUS_15150 1594758 1594093 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_15150 1595891 1594755 gene locus_tag LOCUS_15160 1595891 1594755 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222881.1 protein_id gnl|my_center|LOCUS_15160 1596015 1597346 gene locus_tag LOCUS_15170 1596015 1597346 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_15170 1597393 1598724 gene locus_tag LOCUS_15180 1597393 1598724 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_15180 1598751 1599425 gene locus_tag LOCUS_15190 1598751 1599425 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_15190 1599628 1602315 gene locus_tag LOCUS_15200 1599628 1602315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1602356 1602775 gene locus_tag LOCUS_15210 1602356 1602775 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467633.1 protein_id gnl|my_center|LOCUS_15210 1603468 1602779 gene locus_tag LOCUS_15220 1603468 1602779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1603650 1605368 gene locus_tag LOCUS_15230 gene ctaD 1603650 1605368 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_15230 1606300 1605428 gene locus_tag LOCUS_15240 1606300 1605428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1606371 1606940 gene locus_tag LOCUS_15250 1606371 1606940 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_15250 1608235 1606937 gene locus_tag LOCUS_15260 1608235 1606937 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229465.1 protein_id gnl|my_center|LOCUS_15260 1608428 1609000 gene locus_tag LOCUS_15270 1608428 1609000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1608997 1610121 gene locus_tag LOCUS_15280 1608997 1610121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1610809 1610147 gene locus_tag LOCUS_15290 1610809 1610147 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_15290 1612468 1610828 gene locus_tag LOCUS_15300 1612468 1610828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_15300 1612951 1612481 gene locus_tag LOCUS_15310 1612951 1612481 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_15310 1613061 1614002 gene locus_tag LOCUS_15320 1613061 1614002 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227924.1 protein_id gnl|my_center|LOCUS_15320 1614060 1614764 gene locus_tag LOCUS_15330 1614060 1614764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1614807 1615391 gene locus_tag LOCUS_15340 1614807 1615391 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223649.1 protein_id gnl|my_center|LOCUS_15340 1615491 1616222 gene locus_tag LOCUS_15350 1615491 1616222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1616275 1616991 gene locus_tag LOCUS_15360 1616275 1616991 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_15360 1617245 1616970 gene locus_tag LOCUS_15370 1617245 1616970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1617127 1617933 gene locus_tag LOCUS_15380 1617127 1617933 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_15380 1617997 1618575 gene locus_tag LOCUS_15390 1617997 1618575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1618572 1619132 gene locus_tag LOCUS_15400 1618572 1619132 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_15400 1619443 1619186 gene locus_tag LOCUS_15410 1619443 1619186 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972569.1 protein_id gnl|my_center|LOCUS_15410 1619484 1620302 gene locus_tag LOCUS_15420 gene map 1619484 1620302 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_15420 1621408 1620320 gene locus_tag LOCUS_15430 1621408 1620320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1621530 1621904 gene locus_tag LOCUS_15440 1621530 1621904 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_15440 1622015 1623172 gene locus_tag LOCUS_15450 1622015 1623172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1623267 1623716 gene locus_tag LOCUS_15460 1623267 1623716 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084685.1 protein_id gnl|my_center|LOCUS_15460 1623778 1624053 gene locus_tag LOCUS_15470 1623778 1624053 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_15470 1624059 1625009 gene locus_tag LOCUS_15480 1624059 1625009 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084687.1 protein_id gnl|my_center|LOCUS_15480 1625122 1625478 gene locus_tag LOCUS_15490 1625122 1625478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1625598 1626431 gene locus_tag LOCUS_15500 gene murI 1625598 1626431 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908178.1 protein_id gnl|my_center|LOCUS_15500 1626487 1627245 gene locus_tag LOCUS_15510 1626487 1627245 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_15510 1627886 1627317 gene locus_tag LOCUS_15520 gene rdgB 1627886 1627317 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_15520 1628620 1627895 gene locus_tag LOCUS_15530 gene rph 1628620 1627895 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_15530 1629352 1629606 gene locus_tag LOCUS_15540 1629352 1629606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1629674 1629759 gene locus_tag LOCUS_t00180 1629674 1629759 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1629889 1630554 gene locus_tag LOCUS_15550 1629889 1630554 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624078.1 protein_id gnl|my_center|LOCUS_15550 1630763 1632097 gene locus_tag LOCUS_15560 1630763 1632097 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567745.1 protein_id gnl|my_center|LOCUS_15560 1631882 1631956 gene locus_tag LOCUS_t00190 1631882 1631956 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1632144 1632389 gene locus_tag LOCUS_15570 1632144 1632389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1632382 1633782 gene locus_tag LOCUS_15580 1632382 1633782 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243011.1 protein_id gnl|my_center|LOCUS_15580 1633766 1634380 gene locus_tag LOCUS_15590 1633766 1634380 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243010.1 protein_id gnl|my_center|LOCUS_15590 1634418 1635098 gene locus_tag LOCUS_15600 1634418 1635098 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086944.1 protein_id gnl|my_center|LOCUS_15600 1635154 1635975 gene locus_tag LOCUS_15610 1635154 1635975 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028933.1 protein_id gnl|my_center|LOCUS_15610 1636641 1635985 gene locus_tag LOCUS_15620 1636641 1635985 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_15620 1637432 1636638 gene locus_tag LOCUS_15630 gene hyi 1637432 1636638 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 protein_id gnl|my_center|LOCUS_15630 1638403 1637429 gene locus_tag LOCUS_15640 1638403 1637429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1640116 1638572 gene locus_tag LOCUS_15650 1640116 1638572 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027742.1 protein_id gnl|my_center|LOCUS_15650 1640567 1640983 gene locus_tag LOCUS_15660 1640567 1640983 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031354.1 protein_id gnl|my_center|LOCUS_15660 1641052 1641345 gene locus_tag LOCUS_15670 1641052 1641345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1641365 1641787 gene locus_tag LOCUS_15680 1641365 1641787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1641797 1642420 gene locus_tag LOCUS_15690 1641797 1642420 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227830.1 protein_id gnl|my_center|LOCUS_15690 1642898 1642428 gene locus_tag LOCUS_15700 gene bcp 1642898 1642428 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_15700 1644470 1642986 gene locus_tag LOCUS_15710 1644470 1642986 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_15710 1645874 1644732 gene locus_tag LOCUS_15720 1645874 1644732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1646159 1646542 gene locus_tag LOCUS_15730 1646159 1646542 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_15730 1646704 1647585 gene locus_tag LOCUS_15740 1646704 1647585 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976361.1 protein_id gnl|my_center|LOCUS_15740 1647691 1648404 gene locus_tag LOCUS_15750 1647691 1648404 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104219.1 protein_id gnl|my_center|LOCUS_15750 1648404 1648757 gene locus_tag LOCUS_15760 1648404 1648757 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728468.1 protein_id gnl|my_center|LOCUS_15760 1648757 1649515 gene locus_tag LOCUS_15770 gene cbiQ 1648757 1649515 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_15770 1649515 1650243 gene locus_tag LOCUS_15780 1649515 1650243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_15780 1651172 1650213 gene locus_tag LOCUS_15790 1651172 1650213 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200991.1 protein_id gnl|my_center|LOCUS_15790 1652056 1651280 gene locus_tag LOCUS_15800 1652056 1651280 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_15800 1652183 1653109 gene locus_tag LOCUS_15810 1652183 1653109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1653849 1653106 gene locus_tag LOCUS_15820 1653849 1653106 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_15820 1654553 1653846 gene locus_tag LOCUS_15830 1654553 1653846 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 protein_id gnl|my_center|LOCUS_15830 1654661 1655557 gene locus_tag LOCUS_15840 1654661 1655557 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_15840 1655562 1656062 gene locus_tag LOCUS_15850 1655562 1656062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1657501 1656122 gene locus_tag LOCUS_15860 1657501 1656122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1658356 1657568 gene locus_tag LOCUS_15870 1658356 1657568 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_15870 1658615 1660207 gene locus_tag LOCUS_15880 gene phoD 1658615 1660207 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_15880 1660587 1662173 gene locus_tag LOCUS_15890 1660587 1662173 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230378.1 protein_id gnl|my_center|LOCUS_15890 1662183 1662782 gene locus_tag LOCUS_15900 1662183 1662782 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086837759.1 protein_id gnl|my_center|LOCUS_15900 1662798 1663319 gene locus_tag LOCUS_15910 1662798 1663319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230376.1 protein_id gnl|my_center|LOCUS_15910 1664119 1665906 gene locus_tag LOCUS_15920 1664119 1665906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1665994 1666698 gene locus_tag LOCUS_15930 1665994 1666698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1666695 1667207 gene locus_tag LOCUS_15940 1666695 1667207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1667225 1668250 gene locus_tag LOCUS_15950 1667225 1668250 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804471.1 protein_id gnl|my_center|LOCUS_15950 1668250 1669539 gene locus_tag LOCUS_15960 1668250 1669539 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804470.1 protein_id gnl|my_center|LOCUS_15960 1669536 1670108 gene locus_tag LOCUS_15970 1669536 1670108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1670172 1671512 gene locus_tag LOCUS_15980 1670172 1671512 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_15980 1672274 1671570 gene locus_tag LOCUS_15990 gene nucS 1672274 1671570 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775934.1 protein_id gnl|my_center|LOCUS_15990 1672551 1675313 gene locus_tag LOCUS_16000 1672551 1675313 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_16000 1675315 1678644 gene locus_tag LOCUS_16010 1675315 1678644 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_16010 1682124 1678711 gene locus_tag LOCUS_16020 1682124 1678711 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_16020 1682353 1683564 gene locus_tag LOCUS_16030 1682353 1683564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1683727 1684530 gene locus_tag LOCUS_16040 1683727 1684530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1684724 1687384 gene locus_tag LOCUS_16050 1684724 1687384 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230656.1 protein_id gnl|my_center|LOCUS_16050 1687374 1688057 gene locus_tag LOCUS_16060 1687374 1688057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1688165 1689022 gene locus_tag LOCUS_16070 1688165 1689022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1690077 1689049 gene locus_tag LOCUS_16080 1690077 1689049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1690189 1691688 gene locus_tag LOCUS_16090 1690189 1691688 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_16090 1691841 1692716 gene locus_tag LOCUS_16100 1691841 1692716 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029747.1 protein_id gnl|my_center|LOCUS_16100 1692810 1693109 gene locus_tag LOCUS_16110 1692810 1693109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_16110 1693289 1694095 gene locus_tag LOCUS_16120 1693289 1694095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1695410 1694100 gene locus_tag LOCUS_16130 1695410 1694100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1696625 1695510 gene locus_tag LOCUS_16140 1696625 1695510 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_16140 1698725 1696671 gene locus_tag LOCUS_16150 1698725 1696671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1700240 1699014 gene locus_tag LOCUS_16160 1700240 1699014 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_16160 1700586 1701191 gene locus_tag LOCUS_16170 1700586 1701191 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 protein_id gnl|my_center|LOCUS_16170 1701448 1701921 gene locus_tag LOCUS_16180 1701448 1701921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1702941 1701928 gene locus_tag LOCUS_16190 1702941 1701928 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_16190 1703029 1704000 gene locus_tag LOCUS_16200 1703029 1704000 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223050.1 protein_id gnl|my_center|LOCUS_16200 1704142 1704228 gene locus_tag LOCUS_t00200 1704142 1704228 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1704262 1704594 gene locus_tag LOCUS_16210 1704262 1704594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1704653 1705507 gene locus_tag LOCUS_16220 1704653 1705507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1705901 1705521 gene locus_tag LOCUS_16230 1705901 1705521 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_16230 1707582 1706269 gene locus_tag LOCUS_16240 gene dcm 1707582 1706269 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_16240 1709484 1707940 gene locus_tag LOCUS_16250 1709484 1707940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1710122 1710616 gene locus_tag LOCUS_16260 1710122 1710616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1711286 1710621 gene locus_tag LOCUS_16270 1711286 1710621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1711411 1712598 gene locus_tag LOCUS_16280 1711411 1712598 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_16280 1712598 1713686 gene locus_tag LOCUS_16290 1712598 1713686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1713733 1715070 gene locus_tag LOCUS_16300 1713733 1715070 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567745.1 protein_id gnl|my_center|LOCUS_16300 1715102 1715329 gene locus_tag LOCUS_16310 1715102 1715329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1715398 1715853 gene locus_tag LOCUS_16320 1715398 1715853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1716112 1717398 gene locus_tag LOCUS_16330 1716112 1717398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1717404 1718714 gene locus_tag LOCUS_16340 1717404 1718714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1719691 1718762 gene locus_tag LOCUS_16350 1719691 1718762 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486295.1 protein_id gnl|my_center|LOCUS_16350 1720143 1719742 gene locus_tag LOCUS_16360 1720143 1719742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1720218 1720655 gene locus_tag LOCUS_16370 1720218 1720655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1720658 1721164 gene locus_tag LOCUS_16380 1720658 1721164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1721686 1721222 gene locus_tag LOCUS_16390 1721686 1721222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101257084.1 protein_id gnl|my_center|LOCUS_16390 1721786 1722718 gene locus_tag LOCUS_16400 1721786 1722718 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_16400 1722829 1724340 gene locus_tag LOCUS_16410 1722829 1724340 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466576.1 protein_id gnl|my_center|LOCUS_16410 1727593 1724417 gene locus_tag LOCUS_16420 1727593 1724417 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230443.1 protein_id gnl|my_center|LOCUS_16420 1729154 1727661 gene locus_tag LOCUS_16430 1729154 1727661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1729351 1729151 gene locus_tag LOCUS_16440 1729351 1729151 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228974.1 protein_id gnl|my_center|LOCUS_16440 1730557 1729355 gene locus_tag LOCUS_16450 1730557 1729355 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_16450 1730716 1731525 gene locus_tag LOCUS_16460 1730716 1731525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1731543 1732238 gene locus_tag LOCUS_16470 1731543 1732238 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_16470 1732327 1733073 gene locus_tag LOCUS_16480 1732327 1733073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1733099 1733929 gene locus_tag LOCUS_16490 1733099 1733929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1736784 1734049 gene locus_tag LOCUS_16500 1736784 1734049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1737169 1738491 gene locus_tag LOCUS_16510 1737169 1738491 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226013.1 protein_id gnl|my_center|LOCUS_16510 1740112 1738553 gene locus_tag LOCUS_16520 1740112 1738553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1740066 1740488 gene locus_tag LOCUS_16530 1740066 1740488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1740544 1740930 gene locus_tag LOCUS_16540 1740544 1740930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1741361 1740927 gene locus_tag LOCUS_16550 1741361 1740927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1741856 1741425 gene locus_tag LOCUS_16560 1741856 1741425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1741876 1742658 gene locus_tag LOCUS_16570 1741876 1742658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1742749 1743273 gene locus_tag LOCUS_16580 1742749 1743273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1744246 1743599 gene locus_tag LOCUS_16590 1744246 1743599 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831492.1 protein_id gnl|my_center|LOCUS_16590 1744343 1744933 gene locus_tag LOCUS_16600 1744343 1744933 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_16600 1745764 1745048 gene locus_tag LOCUS_16610 1745764 1745048 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228583.1 protein_id gnl|my_center|LOCUS_16610 1745791 1746795 gene locus_tag LOCUS_16620 1745791 1746795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1746811 1747368 gene locus_tag LOCUS_16630 1746811 1747368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1747392 1748378 gene locus_tag LOCUS_16640 1747392 1748378 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_16640 1748524 1750065 gene locus_tag LOCUS_16650 1748524 1750065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16650 1750058 1751275 gene locus_tag LOCUS_16660 1750058 1751275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1751411 1751587 gene locus_tag LOCUS_16670 1751411 1751587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1751704 1752507 gene locus_tag LOCUS_16680 1751704 1752507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1752982 1752494 gene locus_tag LOCUS_16690 1752982 1752494 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 protein_id gnl|my_center|LOCUS_16690 1753093 1753929 gene locus_tag LOCUS_16700 1753093 1753929 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 protein_id gnl|my_center|LOCUS_16700 1754795 1753953 gene locus_tag LOCUS_16710 1754795 1753953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1754925 1756130 gene locus_tag LOCUS_16720 1754925 1756130 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141544.1 protein_id gnl|my_center|LOCUS_16720 1758118 1756112 gene locus_tag LOCUS_16730 1758118 1756112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1758546 1758217 gene locus_tag LOCUS_16740 1758546 1758217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1758757 1759746 gene locus_tag LOCUS_16750 1758757 1759746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1759879 1760520 gene locus_tag LOCUS_16760 1759879 1760520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1761365 1760598 gene locus_tag LOCUS_16770 1761365 1760598 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777055.1 protein_id gnl|my_center|LOCUS_16770 1761509 1762726 gene locus_tag LOCUS_16780 1761509 1762726 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776478.1 protein_id gnl|my_center|LOCUS_16780 1764750 1762849 gene locus_tag LOCUS_16790 1764750 1762849 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_16790 1765296 1764844 gene locus_tag LOCUS_16800 1765296 1764844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1766301 1765351 gene locus_tag LOCUS_16810 1766301 1765351 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229986.1 protein_id gnl|my_center|LOCUS_16810 1766392 1767579 gene locus_tag LOCUS_16820 1766392 1767579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1769507 1768062 gene locus_tag LOCUS_16830 1769507 1768062 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222938.1 protein_id gnl|my_center|LOCUS_16830 1769544 1770200 gene locus_tag LOCUS_16840 1769544 1770200 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974101.1 protein_id gnl|my_center|LOCUS_16840 1770679 1770179 gene locus_tag LOCUS_16850 1770679 1770179 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978113.1 protein_id gnl|my_center|LOCUS_16850 1771281 1770697 gene locus_tag LOCUS_16860 1771281 1770697 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228294.1 protein_id gnl|my_center|LOCUS_16860 1771377 1772336 gene locus_tag LOCUS_16870 1771377 1772336 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027239.1 protein_id gnl|my_center|LOCUS_16870 1772423 1773496 gene locus_tag LOCUS_16880 1772423 1773496 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973639.1 protein_id gnl|my_center|LOCUS_16880 1773757 1774539 gene locus_tag LOCUS_16890 1773757 1774539 CDS product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968119.1 protein_id gnl|my_center|LOCUS_16890 1776813 1774600 gene locus_tag LOCUS_16900 1776813 1774600 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 protein_id gnl|my_center|LOCUS_16900 1777577 1776942 gene locus_tag LOCUS_16910 1777577 1776942 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729044.1 protein_id gnl|my_center|LOCUS_16910 1777983 1777600 gene locus_tag LOCUS_16920 1777983 1777600 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_16920 1778708 1778070 gene locus_tag LOCUS_16930 1778708 1778070 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285566.1 protein_id gnl|my_center|LOCUS_16930 1778818 1780155 gene locus_tag LOCUS_16940 1778818 1780155 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005135613.1 protein_id gnl|my_center|LOCUS_16940 1780266 1780727 gene locus_tag LOCUS_16950 1780266 1780727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1780721 1781149 gene locus_tag LOCUS_16960 1780721 1781149 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059289.1 protein_id gnl|my_center|LOCUS_16960 1781289 1781693 gene locus_tag LOCUS_16970 1781289 1781693 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_16970 1781850 1782983 gene locus_tag LOCUS_16980 1781850 1782983 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_16980 1782985 1783704 gene locus_tag LOCUS_16990 1782985 1783704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1783754 1784923 gene locus_tag LOCUS_17000 1783754 1784923 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090111.1 protein_id gnl|my_center|LOCUS_17000 1785678 1784920 gene locus_tag LOCUS_17010 1785678 1784920 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777055.1 protein_id gnl|my_center|LOCUS_17010 1785784 1786722 gene locus_tag LOCUS_17020 1785784 1786722 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030711.1 protein_id gnl|my_center|LOCUS_17020 1786820 1787071 gene locus_tag LOCUS_17030 1786820 1787071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1787867 1787259 gene locus_tag LOCUS_17040 1787867 1787259 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222489.1 protein_id gnl|my_center|LOCUS_17040 1788910 1787930 gene locus_tag LOCUS_17050 1788910 1787930 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_17050 1789043 1792426 gene locus_tag LOCUS_17060 1789043 1792426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1792413 1792796 gene locus_tag LOCUS_17070 1792413 1792796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1792780 1793511 gene locus_tag LOCUS_17080 1792780 1793511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1793587 1794867 gene locus_tag LOCUS_17090 1793587 1794867 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878633.1 protein_id gnl|my_center|LOCUS_17090 1796044 1794857 gene locus_tag LOCUS_17100 1796044 1794857 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974080.1 protein_id gnl|my_center|LOCUS_17100 1796089 1796574 gene locus_tag LOCUS_17110 1796089 1796574 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803711.1 protein_id gnl|my_center|LOCUS_17110 1796634 1797590 gene locus_tag LOCUS_17120 1796634 1797590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1798658 1797603 gene locus_tag LOCUS_17130 1798658 1797603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1798969 1798655 gene locus_tag LOCUS_17140 1798969 1798655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1799658 1799029 gene locus_tag LOCUS_17150 1799658 1799029 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031706.1 protein_id gnl|my_center|LOCUS_17150 1799746 1800366 gene locus_tag LOCUS_17160 1799746 1800366 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225120.1 protein_id gnl|my_center|LOCUS_17160 1801612 1800350 gene locus_tag LOCUS_17170 1801612 1800350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1801719 1802378 gene locus_tag LOCUS_17180 1801719 1802378 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_17180 1802375 1803565 gene locus_tag LOCUS_17190 1802375 1803565 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 protein_id gnl|my_center|LOCUS_17190 1804143 1803562 gene locus_tag LOCUS_17200 1804143 1803562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1804990 1804205 gene locus_tag LOCUS_17210 1804990 1804205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1805564 1805013 gene locus_tag LOCUS_17220 1805564 1805013 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_17220 1806144 1805683 gene locus_tag LOCUS_17230 1806144 1805683 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466936.1 protein_id gnl|my_center|LOCUS_17230 1806291 1807760 gene locus_tag LOCUS_17240 1806291 1807760 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_17240 1807837 1808688 gene locus_tag LOCUS_17250 1807837 1808688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1809903 1808695 gene locus_tag LOCUS_17260 1809903 1808695 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226999.1 protein_id gnl|my_center|LOCUS_17260 1811565 1810735 gene locus_tag LOCUS_17270 1811565 1810735 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 protein_id gnl|my_center|LOCUS_17270 1811453 1811689 gene locus_tag LOCUS_17280 1811453 1811689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1812036 1811686 gene locus_tag LOCUS_17290 1812036 1811686 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_17290 1812133 1812930 gene locus_tag LOCUS_17300 1812133 1812930 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222671.1 protein_id gnl|my_center|LOCUS_17300 1813106 1813702 gene locus_tag LOCUS_17310 1813106 1813702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1813777 1814367 gene locus_tag LOCUS_17320 1813777 1814367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1814381 1814977 gene locus_tag LOCUS_17330 1814381 1814977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1815099 1815686 gene locus_tag LOCUS_17340 1815099 1815686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1815811 1817064 gene locus_tag LOCUS_17350 1815811 1817064 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_17350 1817736 1817071 gene locus_tag LOCUS_17360 1817736 1817071 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086746.1 protein_id gnl|my_center|LOCUS_17360 1818098 1817733 gene locus_tag LOCUS_17370 1818098 1817733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1818239 1819462 gene locus_tag LOCUS_17380 1818239 1819462 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_17380 1820721 1819633 gene locus_tag LOCUS_17390 1820721 1819633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1820832 1821971 gene locus_tag LOCUS_17400 1820832 1821971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1822032 1822598 gene locus_tag LOCUS_17410 1822032 1822598 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_17410 1822637 1823218 gene locus_tag LOCUS_17420 1822637 1823218 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_17420 1823299 1823799 gene locus_tag LOCUS_17430 1823299 1823799 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028548.1 protein_id gnl|my_center|LOCUS_17430 1824678 1823923 gene locus_tag LOCUS_17440 1824678 1823923 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_17440 1825589 1824678 gene locus_tag LOCUS_17450 1825589 1824678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892221.1 protein_id gnl|my_center|LOCUS_17450 1825784 1826962 gene locus_tag LOCUS_17460 1825784 1826962 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225409.1 protein_id gnl|my_center|LOCUS_17460 1826959 1827645 gene locus_tag LOCUS_17470 1826959 1827645 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222860.1 protein_id gnl|my_center|LOCUS_17470 1827745 1828356 gene locus_tag LOCUS_17480 1827745 1828356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1828368 1829312 gene locus_tag LOCUS_17490 1828368 1829312 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_17490 1829500 1829847 gene locus_tag LOCUS_17500 1829500 1829847 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_17500 1831145 1829844 gene locus_tag LOCUS_17510 1831145 1829844 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270331.1 protein_id gnl|my_center|LOCUS_17510 1831465 1831731 gene locus_tag LOCUS_17520 1831465 1831731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1831880 1832881 gene locus_tag LOCUS_17530 1831880 1832881 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850119.1 protein_id gnl|my_center|LOCUS_17530 1832960 1833304 gene locus_tag LOCUS_17540 1832960 1833304 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 protein_id gnl|my_center|LOCUS_17540 1833463 1834185 gene locus_tag LOCUS_17550 1833463 1834185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1834189 1834503 gene locus_tag LOCUS_17560 1834189 1834503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1835001 1834660 gene locus_tag LOCUS_17570 1835001 1834660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1835992 1835015 gene locus_tag LOCUS_17580 1835992 1835015 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_17580 1836075 1836530 gene locus_tag LOCUS_17590 1836075 1836530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229734.1 protein_id gnl|my_center|LOCUS_17590 1837737 1836517 gene locus_tag LOCUS_17600 1837737 1836517 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_17600 1838084 1837734 gene locus_tag LOCUS_17610 1838084 1837734 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226523.1 protein_id gnl|my_center|LOCUS_17610 1840142 1838154 gene locus_tag LOCUS_17620 1840142 1838154 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971555.1 protein_id gnl|my_center|LOCUS_17620 1840436 1840615 gene locus_tag LOCUS_17630 1840436 1840615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1840743 1843613 gene locus_tag LOCUS_17640 1840743 1843613 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224347.1 protein_id gnl|my_center|LOCUS_17640 1843732 1845420 gene locus_tag LOCUS_17650 1843732 1845420 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_17650 1845542 1845417 gene locus_tag LOCUS_17660 1845542 1845417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1845711 1846202 gene locus_tag LOCUS_17670 1845711 1846202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1846213 1847115 gene locus_tag LOCUS_17680 1846213 1847115 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227110.1 protein_id gnl|my_center|LOCUS_17680 1847937 1847173 gene locus_tag LOCUS_17690 1847937 1847173 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_17690 1848861 1849361 gene locus_tag LOCUS_17700 1848861 1849361 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225071.1 protein_id gnl|my_center|LOCUS_17700 1850228 1849368 gene locus_tag LOCUS_17710 1850228 1849368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1850755 1850246 gene locus_tag LOCUS_17720 1850755 1850246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1851292 1850759 gene locus_tag LOCUS_17730 1851292 1850759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1851419 1854142 gene locus_tag LOCUS_17740 1851419 1854142 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227699.1 protein_id gnl|my_center|LOCUS_17740 1854481 1854155 gene locus_tag LOCUS_17750 1854481 1854155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1854630 1856855 gene locus_tag LOCUS_17760 1854630 1856855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1857359 1856868 gene locus_tag LOCUS_17770 1857359 1856868 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028474.1 protein_id gnl|my_center|LOCUS_17770 1858256 1857459 gene locus_tag LOCUS_17780 1858256 1857459 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 protein_id gnl|my_center|LOCUS_17780 1858972 1858331 gene locus_tag LOCUS_17790 1858972 1858331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816007.1 protein_id gnl|my_center|LOCUS_17790 1859931 1858969 gene locus_tag LOCUS_17800 1859931 1858969 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 protein_id gnl|my_center|LOCUS_17800 1860270 1861586 gene locus_tag LOCUS_17810 1860270 1861586 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_17810 1861583 1862899 gene locus_tag LOCUS_17820 1861583 1862899 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_17820 1862896 1863744 gene locus_tag LOCUS_17830 gene nudC 1862896 1863744 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_17830 1863927 1864592 gene locus_tag LOCUS_17840 1863927 1864592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1864715 1865335 gene locus_tag LOCUS_17850 1864715 1865335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1865355 1866566 gene locus_tag LOCUS_17860 1865355 1866566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028035.1 protein_id gnl|my_center|LOCUS_17860 1868037 1866571 gene locus_tag LOCUS_17870 1868037 1866571 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222293.1 protein_id gnl|my_center|LOCUS_17870 1868219 1869742 gene locus_tag LOCUS_17880 1868219 1869742 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027628.1 protein_id gnl|my_center|LOCUS_17880 1869818 1870195 gene locus_tag LOCUS_17890 1869818 1870195 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_17890 1870291 1871370 gene locus_tag LOCUS_17900 1870291 1871370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1871632 1871381 gene locus_tag LOCUS_17910 1871632 1871381 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_17910 1871758 1872966 gene locus_tag LOCUS_17920 1871758 1872966 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975556.1 protein_id gnl|my_center|LOCUS_17920 1873798 1872974 gene locus_tag LOCUS_17930 1873798 1872974 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166174969.1 protein_id gnl|my_center|LOCUS_17930 1873894 1874478 gene locus_tag LOCUS_17940 1873894 1874478 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222789.1 protein_id gnl|my_center|LOCUS_17940 1876295 1874532 gene locus_tag LOCUS_17950 1876295 1874532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1876180 1876524 gene locus_tag LOCUS_17960 1876180 1876524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1877677 1876712 gene locus_tag LOCUS_17970 1877677 1876712 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_17970 1877883 1879019 gene locus_tag LOCUS_17980 1877883 1879019 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809304.1 protein_id gnl|my_center|LOCUS_17980 1880015 1879083 gene locus_tag LOCUS_17990 1880015 1879083 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_17990 1880168 1880755 gene locus_tag LOCUS_18000 1880168 1880755 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029275.1 protein_id gnl|my_center|LOCUS_18000 1880779 1882029 gene locus_tag LOCUS_18010 1880779 1882029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18010 1883958 1882078 gene locus_tag LOCUS_18020 1883958 1882078 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010190197.1 protein_id gnl|my_center|LOCUS_18020 1884300 1886945 gene locus_tag LOCUS_18030 gene ppdK 1884300 1886945 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_18030 1887085 1887603 gene locus_tag LOCUS_18040 1887085 1887603 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029511.1 protein_id gnl|my_center|LOCUS_18040 1889511 1887508 gene locus_tag LOCUS_18050 1889511 1887508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1889657 1891507 gene locus_tag LOCUS_18060 gene dnaG 1889657 1891507 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_18060 1891559 1892497 gene locus_tag LOCUS_18070 1891559 1892497 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_18070 1892506 1893267 gene locus_tag LOCUS_18080 1892506 1893267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_18080 1893277 1894074 gene locus_tag LOCUS_18090 1893277 1894074 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970894.1 protein_id gnl|my_center|LOCUS_18090 1894093 1894971 gene locus_tag LOCUS_18100 1894093 1894971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1895303 1894968 gene locus_tag LOCUS_18110 1895303 1894968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1895457 1895530 gene locus_tag LOCUS_t00210 1895457 1895530 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1895618 1896433 gene locus_tag LOCUS_18120 1895618 1896433 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469478.1 protein_id gnl|my_center|LOCUS_18120 1896496 1897020 gene locus_tag LOCUS_18130 1896496 1897020 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119171.1 protein_id gnl|my_center|LOCUS_18130 1898771 1897017 gene locus_tag LOCUS_18140 1898771 1897017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1899555 1898896 gene locus_tag LOCUS_18150 1899555 1898896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1899726 1900469 gene locus_tag LOCUS_18160 1899726 1900469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1901321 1900503 gene locus_tag LOCUS_18170 1901321 1900503 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066520.1 protein_id gnl|my_center|LOCUS_18170 1901794 1901381 gene locus_tag LOCUS_18180 1901794 1901381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1902207 1901791 gene locus_tag LOCUS_18190 1902207 1901791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1902345 1903283 gene locus_tag LOCUS_18200 1902345 1903283 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082376.1 protein_id gnl|my_center|LOCUS_18200 1903681 1903280 gene locus_tag LOCUS_18210 1903681 1903280 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729322.1 protein_id gnl|my_center|LOCUS_18210 1903721 1904920 gene locus_tag LOCUS_18220 1903721 1904920 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729325.1 protein_id gnl|my_center|LOCUS_18220 1904963 1905205 gene locus_tag LOCUS_18230 1904963 1905205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1905327 1906616 gene locus_tag LOCUS_18240 1905327 1906616 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_18240 1906789 1908000 gene locus_tag LOCUS_18250 1906789 1908000 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_18250 1908031 1908900 gene locus_tag LOCUS_18260 1908031 1908900 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775992.1 protein_id gnl|my_center|LOCUS_18260 1908884 1910581 gene locus_tag LOCUS_18270 1908884 1910581 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258493.1 protein_id gnl|my_center|LOCUS_18270 1910578 1911864 gene locus_tag LOCUS_18280 gene folC 1910578 1911864 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899324.1 protein_id gnl|my_center|LOCUS_18280 1911890 1914406 gene locus_tag LOCUS_18290 1911890 1914406 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_18290 1914409 1915182 gene locus_tag LOCUS_18300 1914409 1915182 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_18300 1915179 1916126 gene locus_tag LOCUS_18310 1915179 1916126 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_18310 1916167 1916967 gene locus_tag LOCUS_18320 1916167 1916967 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_18320 1917052 1917849 gene locus_tag LOCUS_18330 1917052 1917849 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896676.1 protein_id gnl|my_center|LOCUS_18330 1917853 1918176 gene locus_tag LOCUS_18340 1917853 1918176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1918331 1919641 gene locus_tag LOCUS_18350 1918331 1919641 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_18350 1919680 1921062 gene locus_tag LOCUS_18360 1919680 1921062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1921072 1921938 gene locus_tag LOCUS_18370 1921072 1921938 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014683564.1 protein_id gnl|my_center|LOCUS_18370 1922114 1923085 gene locus_tag LOCUS_18380 1922114 1923085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1923119 1924258 gene locus_tag LOCUS_18390 1923119 1924258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1924364 1924840 gene locus_tag LOCUS_18400 1924364 1924840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1925761 1924850 gene locus_tag LOCUS_18410 1925761 1924850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1926128 1926451 gene locus_tag LOCUS_18420 1926128 1926451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1926575 1927192 gene locus_tag LOCUS_18430 1926575 1927192 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230409.1 protein_id gnl|my_center|LOCUS_18430 1927303 1927584 gene locus_tag LOCUS_18440 1927303 1927584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1927618 1928058 gene locus_tag LOCUS_18450 1927618 1928058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1928956 1928156 gene locus_tag LOCUS_18460 1928956 1928156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_18460 1930028 1929030 gene locus_tag LOCUS_18470 1930028 1929030 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_18470 1930633 1930061 gene locus_tag LOCUS_18480 1930633 1930061 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730200.1 protein_id gnl|my_center|LOCUS_18480 1930705 1931556 gene locus_tag LOCUS_18490 1930705 1931556 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_18490 1931656 1932867 gene locus_tag LOCUS_18500 1931656 1932867 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222788.1 protein_id gnl|my_center|LOCUS_18500 1934189 1932879 gene locus_tag LOCUS_18510 1934189 1932879 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_18510 1935166 1934186 gene locus_tag LOCUS_18520 1935166 1934186 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_18520 1936489 1935167 gene locus_tag LOCUS_18530 1936489 1935167 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223046.1 protein_id gnl|my_center|LOCUS_18530 1937058 1936486 gene locus_tag LOCUS_18540 1937058 1936486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1937912 1937055 gene locus_tag LOCUS_18550 1937912 1937055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1938115 1938789 gene locus_tag LOCUS_18560 gene mtrA 1938115 1938789 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727971.1 protein_id gnl|my_center|LOCUS_18560 1938790 1940454 gene locus_tag LOCUS_18570 gene mtrB 1938790 1940454 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080870.1 protein_id gnl|my_center|LOCUS_18570 1940438 1942201 gene locus_tag LOCUS_18580 1940438 1942201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1942254 1942988 gene locus_tag LOCUS_18590 1942254 1942988 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416963.1 protein_id gnl|my_center|LOCUS_18590 1943184 1943804 gene locus_tag LOCUS_18600 gene raiA 1943184 1943804 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229726.1 protein_id gnl|my_center|LOCUS_18600 1944615 1943872 gene locus_tag LOCUS_18610 1944615 1943872 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030154.1 protein_id gnl|my_center|LOCUS_18610 1945749 1944616 gene locus_tag LOCUS_18620 1945749 1944616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1946921 1945746 gene locus_tag LOCUS_18630 1946921 1945746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 1947023 1949890 gene locus_tag LOCUS_18640 gene secA 1947023 1949890 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_18640 1950009 1950491 gene locus_tag LOCUS_18650 1950009 1950491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1950607 1951098 gene locus_tag LOCUS_18660 1950607 1951098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_18660 1952006 1951110 gene locus_tag LOCUS_18670 1952006 1951110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1952157 1953785 gene locus_tag LOCUS_18680 gene pruA 1952157 1953785 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_18680 1953874 1954668 gene locus_tag LOCUS_18690 1953874 1954668 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_18690 1954765 1956117 gene locus_tag LOCUS_18700 1954765 1956117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1956331 1956777 gene locus_tag LOCUS_18710 1956331 1956777 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223153.1 protein_id gnl|my_center|LOCUS_18710 1956923 1958053 gene locus_tag LOCUS_18720 gene prfB 1956923 1958053 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_18720 1958200 1958880 gene locus_tag LOCUS_18730 gene ftsE 1958200 1958880 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_18730 1958902 1959792 gene locus_tag LOCUS_18740 gene ftsX 1958902 1959792 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223155.1 protein_id gnl|my_center|LOCUS_18740 1959888 1961084 gene locus_tag LOCUS_18750 1959888 1961084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 1961131 1961610 gene locus_tag LOCUS_18760 gene smpB 1961131 1961610 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_18760 1961674 1962046 gene locus_tag LOCUS_tm00010 1961674 1962046 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1962727 1962119 gene locus_tag LOCUS_18770 1962727 1962119 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_18770 1963086 1962727 gene locus_tag LOCUS_18780 gene clpS 1963086 1962727 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_18780 1963284 1963796 gene locus_tag LOCUS_18790 1963284 1963796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1964218 1963721 gene locus_tag LOCUS_18800 1964218 1963721 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531005.1 protein_id gnl|my_center|LOCUS_18800 1964281 1965153 gene locus_tag LOCUS_18810 1964281 1965153 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531004.1 protein_id gnl|my_center|LOCUS_18810 1965214 1967979 gene locus_tag LOCUS_18820 1965214 1967979 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227699.1 protein_id gnl|my_center|LOCUS_18820 1968065 1969519 gene locus_tag LOCUS_18830 1968065 1969519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1970404 1969529 gene locus_tag LOCUS_18840 1970404 1969529 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228496.1 protein_id gnl|my_center|LOCUS_18840 1970522 1970998 gene locus_tag LOCUS_18850 1970522 1970998 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973501.1 protein_id gnl|my_center|LOCUS_18850 1971059 1971478 gene locus_tag LOCUS_18860 gene furA3 1971059 1971478 CDS product fur family transcriptional regulator FurA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_18860 1971515 1973740 gene locus_tag LOCUS_18870 gene katG 1971515 1973740 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_18870 1973858 1974658 gene locus_tag LOCUS_18880 1973858 1974658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1974803 1975609 gene locus_tag LOCUS_18890 1974803 1975609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1976273 1975626 gene locus_tag LOCUS_18900 1976273 1975626 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485986.1 protein_id gnl|my_center|LOCUS_18900 1977421 1976270 gene locus_tag LOCUS_18910 1977421 1976270 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031803.1 protein_id gnl|my_center|LOCUS_18910 1977521 1978297 gene locus_tag LOCUS_18920 1977521 1978297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027531.1 protein_id gnl|my_center|LOCUS_18920 1978297 1980762 gene locus_tag LOCUS_18930 1978297 1980762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_18930 1981405 1980851 gene locus_tag LOCUS_18940 1981405 1980851 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224590.1 protein_id gnl|my_center|LOCUS_18940 1981473 1982765 gene locus_tag LOCUS_18950 1981473 1982765 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742244.1 protein_id gnl|my_center|LOCUS_18950 1983300 1982770 gene locus_tag LOCUS_18960 1983300 1982770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1983419 1985026 gene locus_tag LOCUS_18970 1983419 1985026 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143814.1 protein_id gnl|my_center|LOCUS_18970 1985195 1985806 gene locus_tag LOCUS_18980 1985195 1985806 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878199.1 protein_id gnl|my_center|LOCUS_18980 1995746 1985871 gene locus_tag LOCUS_18990 1995746 1985871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2003127 1995799 gene locus_tag LOCUS_19000 2003127 1995799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2003696 2010952 gene locus_tag LOCUS_19010 2003696 2010952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2011826 2010894 gene locus_tag LOCUS_19020 2011826 2010894 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030134.1 protein_id gnl|my_center|LOCUS_19020 2013150 2011852 gene locus_tag LOCUS_19030 2013150 2011852 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222229.1 protein_id gnl|my_center|LOCUS_19030 2013262 2014161 gene locus_tag LOCUS_19040 2013262 2014161 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_19040 2014181 2014993 gene locus_tag LOCUS_19050 2014181 2014993 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113611.1 protein_id gnl|my_center|LOCUS_19050 2015745 2014990 gene locus_tag LOCUS_19060 2015745 2014990 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_19060 2017256 2015742 gene locus_tag LOCUS_19070 2017256 2015742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103962448.1 protein_id gnl|my_center|LOCUS_19070 2018266 2017253 gene locus_tag LOCUS_19080 2018266 2017253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228283.1 protein_id gnl|my_center|LOCUS_19080 2018339 2019712 gene locus_tag LOCUS_19090 2018339 2019712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2019709 2020386 gene locus_tag LOCUS_19100 2019709 2020386 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_19100 2020985 2020383 gene locus_tag LOCUS_19110 2020985 2020383 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258304.1 protein_id gnl|my_center|LOCUS_19110 2021971 2021078 gene locus_tag LOCUS_19120 2021971 2021078 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223554.1 protein_id gnl|my_center|LOCUS_19120 2022655 2021999 gene locus_tag LOCUS_19130 2022655 2021999 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728478.1 protein_id gnl|my_center|LOCUS_19130 2023324 2022692 gene locus_tag LOCUS_19140 2023324 2022692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2024488 2023406 gene locus_tag LOCUS_19150 2024488 2023406 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 protein_id gnl|my_center|LOCUS_19150 2025961 2024546 gene locus_tag LOCUS_19160 2025961 2024546 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_19160 2026950 2025970 gene locus_tag LOCUS_19170 2026950 2025970 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_19170 2027042 2027791 gene locus_tag LOCUS_19180 2027042 2027791 CDS product arylmalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229614.1 protein_id gnl|my_center|LOCUS_19180 2027834 2028577 gene locus_tag LOCUS_19190 2027834 2028577 CDS product arylmalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229615.1 protein_id gnl|my_center|LOCUS_19190 2028574 2029251 gene locus_tag LOCUS_19200 2028574 2029251 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229616.1 protein_id gnl|my_center|LOCUS_19200 2030331 2029273 gene locus_tag LOCUS_19210 2030331 2029273 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229618.1 protein_id gnl|my_center|LOCUS_19210 2031785 2030328 gene locus_tag LOCUS_19220 2031785 2030328 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229619.1 protein_id gnl|my_center|LOCUS_19220 2031930 2033183 gene locus_tag LOCUS_19230 2031930 2033183 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_19230 2033196 2033696 gene locus_tag LOCUS_19240 2033196 2033696 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229621.1 protein_id gnl|my_center|LOCUS_19240 2033988 2034755 gene locus_tag LOCUS_19250 gene glpF 2033988 2034755 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272193.1 protein_id gnl|my_center|LOCUS_19250 2034843 2036336 gene locus_tag LOCUS_19260 gene glpK 2034843 2036336 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 protein_id gnl|my_center|LOCUS_19260 2036473 2037465 gene locus_tag LOCUS_19270 2036473 2037465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2039213 2037573 gene locus_tag LOCUS_19280 2039213 2037573 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230949.1 protein_id gnl|my_center|LOCUS_19280 2039437 2039210 gene locus_tag LOCUS_19290 2039437 2039210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2039606 2040883 gene locus_tag LOCUS_19300 2039606 2040883 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 protein_id gnl|my_center|LOCUS_19300 2041133 2041684 gene locus_tag LOCUS_19310 2041133 2041684 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225272.1 protein_id gnl|my_center|LOCUS_19310 2041763 2042662 gene locus_tag LOCUS_19320 2041763 2042662 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_19320 2042702 2043589 gene locus_tag LOCUS_19330 2042702 2043589 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967904.1 protein_id gnl|my_center|LOCUS_19330 2043905 2048779 gene locus_tag LOCUS_19340 2043905 2048779 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_19340 2048882 2050057 gene locus_tag LOCUS_19350 2048882 2050057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2050268 2050939 gene locus_tag LOCUS_19360 2050268 2050939 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224172.1 protein_id gnl|my_center|LOCUS_19360 2050943 2051614 gene locus_tag LOCUS_19370 2050943 2051614 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224172.1 protein_id gnl|my_center|LOCUS_19370 2052811 2051678 gene locus_tag LOCUS_19380 2052811 2051678 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030127.1 protein_id gnl|my_center|LOCUS_19380 2052830 2052982 gene locus_tag LOCUS_19390 2052830 2052982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2053295 2054467 gene locus_tag LOCUS_19400 2053295 2054467 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_19400 2054514 2055566 gene locus_tag LOCUS_19410 2054514 2055566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2055630 2056022 gene locus_tag LOCUS_19420 2055630 2056022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2056022 2058535 gene locus_tag LOCUS_19430 2056022 2058535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2058867 2058544 gene locus_tag LOCUS_19440 gene sugE 2058867 2058544 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156471.1 protein_id gnl|my_center|LOCUS_19440 2059561 2058956 gene locus_tag LOCUS_19450 2059561 2058956 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 protein_id gnl|my_center|LOCUS_19450 2059682 2060362 gene locus_tag LOCUS_19460 2059682 2060362 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035488.1 protein_id gnl|my_center|LOCUS_19460 2061507 2060311 gene locus_tag LOCUS_19470 2061507 2060311 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_19470 2062340 2061540 gene locus_tag LOCUS_19480 2062340 2061540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225206.1 protein_id gnl|my_center|LOCUS_19480 2063380 2062337 gene locus_tag LOCUS_19490 2063380 2062337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2065840 2063564 gene locus_tag LOCUS_19500 2065840 2063564 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728553.1 protein_id gnl|my_center|LOCUS_19500 2066690 2065884 gene locus_tag LOCUS_19510 2066690 2065884 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891968.1 protein_id gnl|my_center|LOCUS_19510 2067830 2066748 gene locus_tag LOCUS_19520 2067830 2066748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2069081 2067960 gene locus_tag LOCUS_19530 2069081 2067960 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029609.1 protein_id gnl|my_center|LOCUS_19530 2069178 2069750 gene locus_tag LOCUS_19540 2069178 2069750 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_19540 2070396 2069737 gene locus_tag LOCUS_19550 2070396 2069737 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930032.1 protein_id gnl|my_center|LOCUS_19550 2070536 2072110 gene locus_tag LOCUS_19560 2070536 2072110 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 protein_id gnl|my_center|LOCUS_19560 2072136 2072474 gene locus_tag LOCUS_19570 2072136 2072474 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173001.1 protein_id gnl|my_center|LOCUS_19570 2072938 2072480 gene locus_tag LOCUS_19580 2072938 2072480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2072961 2073380 gene locus_tag LOCUS_19590 2072961 2073380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2075633 2073444 gene locus_tag LOCUS_19600 2075633 2073444 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 protein_id gnl|my_center|LOCUS_19600 2076007 2075768 gene locus_tag LOCUS_19610 2076007 2075768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2076334 2076008 gene locus_tag LOCUS_19620 2076334 2076008 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109030614.1 protein_id gnl|my_center|LOCUS_19620 2077025 2076417 gene locus_tag LOCUS_19630 2077025 2076417 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836424.1 protein_id gnl|my_center|LOCUS_19630 2077118 2077534 gene locus_tag LOCUS_19640 2077118 2077534 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398287.1 protein_id gnl|my_center|LOCUS_19640 2078141 2077611 gene locus_tag LOCUS_19650 2078141 2077611 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_19650 2078692 2078141 gene locus_tag LOCUS_19660 2078692 2078141 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973945.1 protein_id gnl|my_center|LOCUS_19660 2078852 2079262 gene locus_tag LOCUS_19670 2078852 2079262 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173334.1 protein_id gnl|my_center|LOCUS_19670 2079916 2079266 gene locus_tag LOCUS_19680 2079916 2079266 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228133.1 protein_id gnl|my_center|LOCUS_19680 2081175 2079913 gene locus_tag LOCUS_19690 2081175 2079913 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228132.1 protein_id gnl|my_center|LOCUS_19690 2081293 2082219 gene locus_tag LOCUS_19700 2081293 2082219 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030711.1 protein_id gnl|my_center|LOCUS_19700 2082294 2083088 gene locus_tag LOCUS_19710 2082294 2083088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2084047 2083103 gene locus_tag LOCUS_19720 2084047 2083103 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012708.1 protein_id gnl|my_center|LOCUS_19720 2084890 2084186 gene locus_tag LOCUS_19730 2084890 2084186 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_19730 2085000 2085761 gene locus_tag LOCUS_19740 2085000 2085761 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 protein_id gnl|my_center|LOCUS_19740 2085936 2087552 gene locus_tag LOCUS_19750 gene cimA 2085936 2087552 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223593.1 protein_id gnl|my_center|LOCUS_19750 2087557 2087889 gene locus_tag LOCUS_19760 2087557 2087889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2087988 2088767 gene locus_tag LOCUS_19770 2087988 2088767 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_19770 2088760 2090238 gene locus_tag LOCUS_19780 gene gltX 2088760 2090238 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728308.1 protein_id gnl|my_center|LOCUS_19780 2090333 2090890 gene locus_tag LOCUS_19790 2090333 2090890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2090887 2092077 gene locus_tag LOCUS_19800 2090887 2092077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2092183 2095209 gene locus_tag LOCUS_19810 gene afsR 2092183 2095209 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_19810 2095441 2095268 gene locus_tag LOCUS_19820 2095441 2095268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2095613 2096212 gene locus_tag LOCUS_19830 2095613 2096212 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 protein_id gnl|my_center|LOCUS_19830 2096827 2096216 gene locus_tag LOCUS_19840 2096827 2096216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2097750 2096824 gene locus_tag LOCUS_19850 2097750 2096824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028200.1 protein_id gnl|my_center|LOCUS_19850 2099385 2097781 gene locus_tag LOCUS_19860 2099385 2097781 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_19860 2099646 2100719 gene locus_tag LOCUS_19870 2099646 2100719 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029853.1 protein_id gnl|my_center|LOCUS_19870 2100844 2101887 gene locus_tag LOCUS_19880 2100844 2101887 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 protein_id gnl|my_center|LOCUS_19880 2102929 2101943 gene locus_tag LOCUS_19890 2102929 2101943 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 protein_id gnl|my_center|LOCUS_19890 2103061 2103420 gene locus_tag LOCUS_19900 2103061 2103420 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_19900 2103426 2104523 gene locus_tag LOCUS_19910 2103426 2104523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2105353 2104520 gene locus_tag LOCUS_19920 2105353 2104520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2105898 2105350 gene locus_tag LOCUS_19930 2105898 2105350 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971492.1 protein_id gnl|my_center|LOCUS_19930 2106551 2105913 gene locus_tag LOCUS_19940 2106551 2105913 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894928.1 protein_id gnl|my_center|LOCUS_19940 2107150 2106605 gene locus_tag LOCUS_19950 2107150 2106605 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926066.1 protein_id gnl|my_center|LOCUS_19950 2108095 2107226 gene locus_tag LOCUS_19960 2108095 2107226 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_19960 2108220 2108984 gene locus_tag LOCUS_19970 2108220 2108984 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919163.1 protein_id gnl|my_center|LOCUS_19970 2109804 2108962 gene locus_tag LOCUS_19980 2109804 2108962 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225103.1 protein_id gnl|my_center|LOCUS_19980 2110939 2109818 gene locus_tag LOCUS_19990 2110939 2109818 CDS product family 2 encapsulin nanocompartment cargo protein terpene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225102.1 protein_id gnl|my_center|LOCUS_19990 2110817 2110912 gene locus_tag LOCUS_t00220 2110817 2110912 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2111143 2112576 gene locus_tag LOCUS_20000 2111143 2112576 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_20000 2112597 2113982 gene locus_tag LOCUS_20010 2112597 2113982 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_20010 2115089 2113941 gene locus_tag LOCUS_20020 gene ispG 2115089 2113941 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_20020 2116903 2115122 gene locus_tag LOCUS_20030 gene dxs 2116903 2115122 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_20030 2118174 2116906 gene locus_tag LOCUS_20040 2118174 2116906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2119308 2118202 gene locus_tag LOCUS_20050 2119308 2118202 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 protein_id gnl|my_center|LOCUS_20050 2119465 2120847 gene locus_tag LOCUS_20060 2119465 2120847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_20060 2122049 2120826 gene locus_tag LOCUS_20070 2122049 2120826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2123501 2122857 gene locus_tag LOCUS_20080 2123501 2122857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2124429 2123569 gene locus_tag LOCUS_20090 2124429 2123569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2125386 2124553 gene locus_tag LOCUS_20100 2125386 2124553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2125838 2125383 gene locus_tag LOCUS_20110 2125838 2125383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2126158 2125835 gene locus_tag LOCUS_20120 2126158 2125835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2126378 2127556 gene locus_tag LOCUS_20130 2126378 2127556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2127569 2128291 gene locus_tag LOCUS_20140 2127569 2128291 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763153.1 protein_id gnl|my_center|LOCUS_20140 2128495 2129391 gene locus_tag LOCUS_20150 2128495 2129391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2129388 2130014 gene locus_tag LOCUS_20160 2129388 2130014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2130695 2132461 gene locus_tag LOCUS_20170 2130695 2132461 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225058.1 protein_id gnl|my_center|LOCUS_20170 2132484 2133548 gene locus_tag LOCUS_20180 2132484 2133548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2134895 2133678 gene locus_tag LOCUS_20190 2134895 2133678 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027463.1 protein_id gnl|my_center|LOCUS_20190 2135970 2134942 gene locus_tag LOCUS_20200 2135970 2134942 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027465.1 protein_id gnl|my_center|LOCUS_20200 2136151 2137422 gene locus_tag LOCUS_20210 2136151 2137422 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804716.1 protein_id gnl|my_center|LOCUS_20210 2137424 2138302 gene locus_tag LOCUS_20220 2137424 2138302 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804717.1 protein_id gnl|my_center|LOCUS_20220 2138299 2139150 gene locus_tag LOCUS_20230 2138299 2139150 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027464.1 protein_id gnl|my_center|LOCUS_20230 2139169 2140110 gene locus_tag LOCUS_20240 2139169 2140110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2140989 2140207 gene locus_tag LOCUS_20250 2140989 2140207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2141143 2141218 gene locus_tag LOCUS_t00230 2141143 2141218 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2141322 2141750 gene locus_tag LOCUS_20260 2141322 2141750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 2141747 2142760 gene locus_tag LOCUS_20270 2141747 2142760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2142769 2143275 gene locus_tag LOCUS_20280 2142769 2143275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2143904 2143272 gene locus_tag LOCUS_20290 2143904 2143272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804164.1 protein_id gnl|my_center|LOCUS_20290 2144847 2143942 gene locus_tag LOCUS_20300 2144847 2143942 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_20300 2144980 2145504 gene locus_tag LOCUS_20310 2144980 2145504 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028645.1 protein_id gnl|my_center|LOCUS_20310 2145826 2145452 gene locus_tag LOCUS_20320 2145826 2145452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2146848 2146009 gene locus_tag LOCUS_20330 2146848 2146009 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_20330 2146982 2147686 gene locus_tag LOCUS_20340 2146982 2147686 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223032.1 protein_id gnl|my_center|LOCUS_20340 2147737 2148171 gene locus_tag LOCUS_20350 2147737 2148171 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532202.1 protein_id gnl|my_center|LOCUS_20350 2148218 2149513 gene locus_tag LOCUS_20360 2148218 2149513 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031025.1 protein_id gnl|my_center|LOCUS_20360 2149553 2150482 gene locus_tag LOCUS_20370 2149553 2150482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2150624 2151550 gene locus_tag LOCUS_20380 2150624 2151550 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027747.1 protein_id gnl|my_center|LOCUS_20380 2151632 2152246 gene locus_tag LOCUS_20390 2151632 2152246 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223118.1 protein_id gnl|my_center|LOCUS_20390 2154209 2152302 gene locus_tag LOCUS_20400 2154209 2152302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2156269 2154368 gene locus_tag LOCUS_20410 2156269 2154368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2157676 2156363 gene locus_tag LOCUS_20420 gene paaF 2157676 2156363 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031681.1 protein_id gnl|my_center|LOCUS_20420 2157884 2158987 gene locus_tag LOCUS_20430 2157884 2158987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2159012 2160157 gene locus_tag LOCUS_20440 2159012 2160157 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229631.1 protein_id gnl|my_center|LOCUS_20440 2160154 2160831 gene locus_tag LOCUS_20450 2160154 2160831 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229632.1 protein_id gnl|my_center|LOCUS_20450 2160948 2163104 gene locus_tag LOCUS_20460 2160948 2163104 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229633.1 protein_id gnl|my_center|LOCUS_20460 2163840 2163094 gene locus_tag LOCUS_20470 2163840 2163094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2163911 2164750 gene locus_tag LOCUS_20480 gene recO 2163911 2164750 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895862.1 protein_id gnl|my_center|LOCUS_20480 2164747 2165535 gene locus_tag LOCUS_20490 2164747 2165535 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_20490 2165644 2165994 gene locus_tag LOCUS_20500 2165644 2165994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2167005 2166040 gene locus_tag LOCUS_20510 2167005 2166040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2167923 2167129 gene locus_tag LOCUS_20520 2167923 2167129 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731491.1 protein_id gnl|my_center|LOCUS_20520 2169368 2167920 gene locus_tag LOCUS_20530 2169368 2167920 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731492.1 protein_id gnl|my_center|LOCUS_20530 2169955 2169368 gene locus_tag LOCUS_20540 2169955 2169368 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858584.1 protein_id gnl|my_center|LOCUS_20540 2170192 2171127 gene locus_tag LOCUS_20550 2170192 2171127 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_20550 2171124 2171861 gene locus_tag LOCUS_20560 2171124 2171861 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_20560 2171861 2172712 gene locus_tag LOCUS_20570 2171861 2172712 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_20570 2172843 2173097 gene locus_tag LOCUS_20580 2172843 2173097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2173809 2173501 gene locus_tag LOCUS_20590 2173809 2173501 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227128.1 protein_id gnl|my_center|LOCUS_20590 2174483 2173806 gene locus_tag LOCUS_20600 2174483 2173806 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284464.1 protein_id gnl|my_center|LOCUS_20600 2174558 2175118 gene locus_tag LOCUS_20610 2174558 2175118 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284483.1 protein_id gnl|my_center|LOCUS_20610 2175571 2175281 gene locus_tag LOCUS_20620 2175571 2175281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2175648 2176013 gene locus_tag LOCUS_20630 2175648 2176013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2176010 2176594 gene locus_tag LOCUS_20640 2176010 2176594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 2176779 2178164 gene locus_tag LOCUS_20650 2176779 2178164 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_20650 2178478 2178248 gene locus_tag LOCUS_20660 2178478 2178248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2178738 2179922 gene locus_tag LOCUS_20670 gene dusB 2178738 2179922 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_20670 2180196 2179927 gene locus_tag LOCUS_20680 2180196 2179927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2180431 2180862 gene locus_tag LOCUS_20690 2180431 2180862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2180892 2181425 gene locus_tag LOCUS_20700 2180892 2181425 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403546.1 protein_id gnl|my_center|LOCUS_20700 2181425 2182627 gene locus_tag LOCUS_20710 2181425 2182627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2182971 2183462 gene locus_tag LOCUS_20720 2182971 2183462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2183821 2186469 gene locus_tag LOCUS_20730 2183821 2186469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2186469 2188079 gene locus_tag LOCUS_20740 2186469 2188079 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 protein_id gnl|my_center|LOCUS_20740 2188223 2188861 gene locus_tag LOCUS_20750 2188223 2188861 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_20750 2189008 2190978 gene locus_tag LOCUS_20760 2189008 2190978 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207808.1 protein_id gnl|my_center|LOCUS_20760 2191954 2191025 gene locus_tag LOCUS_20770 2191954 2191025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2193451 2192024 gene locus_tag LOCUS_20780 2193451 2192024 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978299.1 protein_id gnl|my_center|LOCUS_20780 2193551 2194645 gene locus_tag LOCUS_20790 2193551 2194645 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091679.1 protein_id gnl|my_center|LOCUS_20790 2195344 2194655 gene locus_tag LOCUS_20800 2195344 2194655 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928911.1 protein_id gnl|my_center|LOCUS_20800 2195369 2199325 gene locus_tag LOCUS_20810 gene hrpA 2195369 2199325 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_20810 2199411 2199863 gene locus_tag LOCUS_20820 2199411 2199863 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971444.1 protein_id gnl|my_center|LOCUS_20820 2199979 2203353 gene locus_tag LOCUS_20830 2199979 2203353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2205006 2203489 gene locus_tag LOCUS_20840 2205006 2203489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 2205452 2205093 gene locus_tag LOCUS_20850 2205452 2205093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2207496 2205985 gene locus_tag LOCUS_20860 2207496 2205985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2207599 2208234 gene locus_tag LOCUS_20870 2207599 2208234 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229674.1 protein_id gnl|my_center|LOCUS_20870 2209976 2208231 gene locus_tag LOCUS_20880 2209976 2208231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030252.1 protein_id gnl|my_center|LOCUS_20880 2211700 2209973 gene locus_tag LOCUS_20890 2211700 2209973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230756.1 protein_id gnl|my_center|LOCUS_20890 2212110 2212676 gene locus_tag LOCUS_20900 2212110 2212676 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031866.1 protein_id gnl|my_center|LOCUS_20900 2212687 2213559 gene locus_tag LOCUS_20910 2212687 2213559 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_20910 2213629 2214774 gene locus_tag LOCUS_20920 2213629 2214774 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085576.1 protein_id gnl|my_center|LOCUS_20920 2216241 2214841 gene locus_tag LOCUS_20930 2216241 2214841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2216602 2216234 gene locus_tag LOCUS_20940 2216602 2216234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2217047 2216640 gene locus_tag LOCUS_20950 2217047 2216640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2217331 2217134 gene locus_tag LOCUS_20960 2217331 2217134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2217823 2217587 gene locus_tag LOCUS_20970 2217823 2217587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2218017 2218838 gene locus_tag LOCUS_20980 2218017 2218838 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971565.1 protein_id gnl|my_center|LOCUS_20980 2218835 2219008 gene locus_tag LOCUS_20990 2218835 2219008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2219738 2219010 gene locus_tag LOCUS_21000 2219738 2219010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2221204 2219771 gene locus_tag LOCUS_21010 2221204 2219771 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 protein_id gnl|my_center|LOCUS_21010 2221978 2221208 gene locus_tag LOCUS_21020 gene phoP 2221978 2221208 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_21020 2222131 2223525 gene locus_tag LOCUS_21030 2222131 2223525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287129.1 protein_id gnl|my_center|LOCUS_21030 2223528 2224223 gene locus_tag LOCUS_21040 2223528 2224223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_21040 2224403 2224864 gene locus_tag LOCUS_21050 2224403 2224864 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225420.1 protein_id gnl|my_center|LOCUS_21050 2224925 2225323 gene locus_tag LOCUS_21060 2224925 2225323 CDS product DUF3224 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775867.1 protein_id gnl|my_center|LOCUS_21060 2226017 2225352 gene locus_tag LOCUS_21070 2226017 2225352 CDS product DUF4360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028347.1 protein_id gnl|my_center|LOCUS_21070 2226177 2226845 gene locus_tag LOCUS_21080 2226177 2226845 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227693.1 protein_id gnl|my_center|LOCUS_21080 2226858 2228315 gene locus_tag LOCUS_21090 2226858 2228315 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228451.1 protein_id gnl|my_center|LOCUS_21090 2229369 2228605 gene locus_tag LOCUS_21100 2229369 2228605 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030224.1 protein_id gnl|my_center|LOCUS_21100 2229501 2230178 gene locus_tag LOCUS_21110 2229501 2230178 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_21110 2230171 2231649 gene locus_tag LOCUS_21120 2230171 2231649 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_21120 2231660 2232568 gene locus_tag LOCUS_21130 2231660 2232568 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081643.1 protein_id gnl|my_center|LOCUS_21130 2232627 2234438 gene locus_tag LOCUS_21140 2232627 2234438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2235236 2234481 gene locus_tag LOCUS_21150 2235236 2234481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2235952 2235338 gene locus_tag LOCUS_21160 2235952 2235338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2236199 2235966 gene locus_tag LOCUS_21170 2236199 2235966 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_21170 2236334 2237287 gene locus_tag LOCUS_21180 2236334 2237287 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_21180 2237567 2237376 gene locus_tag LOCUS_21190 gene rpmB 2237567 2237376 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728318.1 protein_id gnl|my_center|LOCUS_21190 2237785 2238786 gene locus_tag LOCUS_21200 2237785 2238786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2238934 2240475 gene locus_tag LOCUS_21210 2238934 2240475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2240551 2242173 gene locus_tag LOCUS_21220 2240551 2242173 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_21220 2242173 2244329 gene locus_tag LOCUS_21230 gene recG 2242173 2244329 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_21230 2244326 2244892 gene locus_tag LOCUS_21240 gene rsmD 2244326 2244892 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_21240 2244883 2245404 gene locus_tag LOCUS_21250 gene coaD 2244883 2245404 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_21250 2245451 2245972 gene locus_tag LOCUS_21260 2245451 2245972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2246074 2246619 gene locus_tag LOCUS_21270 2246074 2246619 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284376.1 protein_id gnl|my_center|LOCUS_21270 2246888 2247619 gene locus_tag LOCUS_21280 gene rnc 2246888 2247619 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_21280 2247872 2248066 gene locus_tag LOCUS_21290 2247872 2248066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2248219 2251794 gene locus_tag LOCUS_21300 gene smc 2248219 2251794 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223795.1 protein_id gnl|my_center|LOCUS_21300 2251865 2253106 gene locus_tag LOCUS_21310 gene ftsY 2251865 2253106 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_21310 2253030 2253818 gene locus_tag LOCUS_21320 2253030 2253818 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074041.1 protein_id gnl|my_center|LOCUS_21320 2254142 2254768 gene locus_tag LOCUS_21330 2254142 2254768 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_21330 2255138 2256091 gene locus_tag LOCUS_21340 2255138 2256091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2256088 2257719 gene locus_tag LOCUS_21350 2256088 2257719 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227262.1 protein_id gnl|my_center|LOCUS_21350 2257818 2260370 gene locus_tag LOCUS_21360 2257818 2260370 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112141171.1 protein_id gnl|my_center|LOCUS_21360 2260398 2261042 gene locus_tag LOCUS_21370 2260398 2261042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2261083 2262582 gene locus_tag LOCUS_21380 2261083 2262582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2262644 2264452 gene locus_tag LOCUS_21390 2262644 2264452 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 protein_id gnl|my_center|LOCUS_21390 2265413 2264466 gene locus_tag LOCUS_21400 2265413 2264466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2266648 2265410 gene locus_tag LOCUS_21410 2266648 2265410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2266930 2267373 gene locus_tag LOCUS_21420 2266930 2267373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2267370 2269235 gene locus_tag LOCUS_21430 2267370 2269235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2269236 2269784 gene locus_tag LOCUS_21440 2269236 2269784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2269781 2270218 gene locus_tag LOCUS_21450 2269781 2270218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2270211 2271305 gene locus_tag LOCUS_21460 2270211 2271305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2271405 2272166 gene locus_tag LOCUS_21470 2271405 2272166 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_21470 2272163 2273104 gene locus_tag LOCUS_21480 gene pfkB 2272163 2273104 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_21480 2273157 2274629 gene locus_tag LOCUS_21490 2273157 2274629 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886406.1 protein_id gnl|my_center|LOCUS_21490 2274622 2275068 gene locus_tag LOCUS_21500 2274622 2275068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21500 2275065 2276105 gene locus_tag LOCUS_21510 2275065 2276105 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_21510 2276117 2276401 gene locus_tag LOCUS_21520 2276117 2276401 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804336.1 protein_id gnl|my_center|LOCUS_21520 2276589 2278205 gene locus_tag LOCUS_21530 gene ptsP 2276589 2278205 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226345.1 protein_id gnl|my_center|LOCUS_21530 2278673 2278215 gene locus_tag LOCUS_21540 2278673 2278215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2280133 2278691 gene locus_tag LOCUS_21550 2280133 2278691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2280360 2282600 gene locus_tag LOCUS_21560 2280360 2282600 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_21560 2283143 2282613 gene locus_tag LOCUS_21570 2283143 2282613 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895362.1 protein_id gnl|my_center|LOCUS_21570 2283317 2284498 gene locus_tag LOCUS_21580 2283317 2284498 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776478.1 protein_id gnl|my_center|LOCUS_21580 2284890 2285093 gene locus_tag LOCUS_21590 2284890 2285093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 2285097 2285870 gene locus_tag LOCUS_21600 2285097 2285870 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112261.1 protein_id gnl|my_center|LOCUS_21600 2286215 2294311 gene locus_tag LOCUS_21610 2286215 2294311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2294363 2303410 gene locus_tag LOCUS_21620 2294363 2303410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2303555 2304130 gene locus_tag LOCUS_21630 2303555 2304130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224682.1 protein_id gnl|my_center|LOCUS_21630 2305221 2304193 gene locus_tag LOCUS_21640 2305221 2304193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2305802 2305218 gene locus_tag LOCUS_21650 2305802 2305218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2306667 2305927 gene locus_tag LOCUS_21660 2306667 2305927 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222330.1 protein_id gnl|my_center|LOCUS_21660 2307822 2306725 gene locus_tag LOCUS_21670 2307822 2306725 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226510.1 protein_id gnl|my_center|LOCUS_21670 2308371 2307889 gene locus_tag LOCUS_21680 2308371 2307889 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976424.1 protein_id gnl|my_center|LOCUS_21680 2308463 2309770 gene locus_tag LOCUS_21690 gene efeB 2308463 2309770 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073925.1 protein_id gnl|my_center|LOCUS_21690 2310199 2309771 gene locus_tag LOCUS_21700 2310199 2309771 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974764.1 protein_id gnl|my_center|LOCUS_21700 2310250 2311206 gene locus_tag LOCUS_21710 2310250 2311206 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029500.1 protein_id gnl|my_center|LOCUS_21710 2312124 2313056 gene locus_tag LOCUS_21720 2312124 2313056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031110.1 protein_id gnl|my_center|LOCUS_21720 2313022 2314290 gene locus_tag LOCUS_21730 2313022 2314290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2314287 2315084 gene locus_tag LOCUS_21740 2314287 2315084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2315074 2316198 gene locus_tag LOCUS_21750 2315074 2316198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2316924 2316160 gene locus_tag LOCUS_21760 2316924 2316160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2317370 2317017 gene locus_tag LOCUS_21770 2317370 2317017 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728561.1 protein_id gnl|my_center|LOCUS_21770 2318820 2317387 gene locus_tag LOCUS_21780 2318820 2317387 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_21780 2319714 2318830 gene locus_tag LOCUS_21790 gene pqqB 2319714 2318830 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229609.1 protein_id gnl|my_center|LOCUS_21790 2320763 2319711 gene locus_tag LOCUS_21800 gene pqqE 2320763 2319711 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229608.1 protein_id gnl|my_center|LOCUS_21800 2321161 2320895 gene locus_tag LOCUS_21810 gene pqqD 2321161 2320895 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229607.1 protein_id gnl|my_center|LOCUS_21810 2321850 2321158 gene locus_tag LOCUS_21820 gene pqqC 2321850 2321158 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467700.1 protein_id gnl|my_center|LOCUS_21820 2322231 2322716 gene locus_tag LOCUS_21830 2322231 2322716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2322773 2324179 gene locus_tag LOCUS_21840 gene proS 2322773 2324179 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869066.1 protein_id gnl|my_center|LOCUS_21840 2324358 2324864 gene locus_tag LOCUS_21850 2324358 2324864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2324866 2325093 gene locus_tag LOCUS_21860 2324866 2325093 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_21860 2325094 2325603 gene locus_tag LOCUS_21870 gene rimM 2325094 2325603 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_21870 2325608 2326378 gene locus_tag LOCUS_21880 gene trmD 2325608 2326378 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223852.1 protein_id gnl|my_center|LOCUS_21880 2326492 2326836 gene locus_tag LOCUS_21890 gene rplS 2326492 2326836 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_21890 2326946 2327860 gene locus_tag LOCUS_21900 2326946 2327860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21900 2327880 2328626 gene locus_tag LOCUS_21910 2327880 2328626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2328623 2329336 gene locus_tag LOCUS_21920 2328623 2329336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2329344 2330033 gene locus_tag LOCUS_21930 2329344 2330033 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414713.1 protein_id gnl|my_center|LOCUS_21930 2330118 2330405 gene locus_tag LOCUS_21940 2330118 2330405 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_21940 2331585 2330431 gene locus_tag LOCUS_21950 gene dprA 2331585 2330431 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_21950 2333110 2331602 gene locus_tag LOCUS_21960 2333110 2331602 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189256709.1 protein_id gnl|my_center|LOCUS_21960 2333757 2333134 gene locus_tag LOCUS_21970 2333757 2333134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2333819 2334772 gene locus_tag LOCUS_21980 2333819 2334772 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088347.1 protein_id gnl|my_center|LOCUS_21980 2334791 2335963 gene locus_tag LOCUS_21990 2334791 2335963 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033518021.1 protein_id gnl|my_center|LOCUS_21990 2336087 2336632 gene locus_tag LOCUS_22000 2336087 2336632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2336736 2337632 gene locus_tag LOCUS_22010 2336736 2337632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22010 2337888 2338781 gene locus_tag LOCUS_22020 gene rpsB 2337888 2338781 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899528.1 protein_id gnl|my_center|LOCUS_22020 2338826 2339638 gene locus_tag LOCUS_22030 gene tsf 2338826 2339638 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223863.1 protein_id gnl|my_center|LOCUS_22030 2339734 2340468 gene locus_tag LOCUS_22040 gene pyrH 2339734 2340468 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223864.1 protein_id gnl|my_center|LOCUS_22040 2340594 2341151 gene locus_tag LOCUS_22050 gene frr 2340594 2341151 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_22050 2341151 2342170 gene locus_tag LOCUS_22060 2341151 2342170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2342239 2343405 gene locus_tag LOCUS_22070 gene rlmN 2342239 2343405 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092553592.1 protein_id gnl|my_center|LOCUS_22070 2343405 2345495 gene locus_tag LOCUS_22080 2343405 2345495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2345781 2345557 gene locus_tag LOCUS_22090 2345781 2345557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2345942 2347492 gene locus_tag LOCUS_22100 2345942 2347492 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084106.1 protein_id gnl|my_center|LOCUS_22100 2348255 2349109 gene locus_tag LOCUS_22110 2348255 2349109 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_22110 2349330 2349145 gene locus_tag LOCUS_22120 2349330 2349145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2349611 2350615 gene locus_tag LOCUS_22130 2349611 2350615 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028175.1 protein_id gnl|my_center|LOCUS_22130 2350659 2351159 gene locus_tag LOCUS_22140 2350659 2351159 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057492.1 protein_id gnl|my_center|LOCUS_22140 2352116 2351208 gene locus_tag LOCUS_22150 2352116 2351208 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_22150 2352455 2352976 gene locus_tag LOCUS_22160 2352455 2352976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147131375.1 protein_id gnl|my_center|LOCUS_22160 2353370 2352981 gene locus_tag LOCUS_22170 2353370 2352981 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_22170 2354378 2353464 gene locus_tag LOCUS_22180 gene pstB 2354378 2353464 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_22180 2355300 2354380 gene locus_tag LOCUS_22190 gene pstA 2355300 2354380 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112722.1 protein_id gnl|my_center|LOCUS_22190 2356271 2355297 gene locus_tag LOCUS_22200 gene pstC 2356271 2355297 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_22200 2357397 2356345 gene locus_tag LOCUS_22210 gene pstS 2357397 2356345 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582618.1 protein_id gnl|my_center|LOCUS_22210 2358228 2357578 gene locus_tag LOCUS_22220 gene phoU 2358228 2357578 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_22220 2358544 2358619 gene locus_tag LOCUS_t00240 2358544 2358619 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2358847 2359098 gene locus_tag LOCUS_22230 2358847 2359098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2359139 2359327 gene locus_tag LOCUS_22240 2359139 2359327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2359596 2359405 gene locus_tag LOCUS_22250 2359596 2359405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2359912 2360340 gene locus_tag LOCUS_22260 2359912 2360340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2360352 2360984 gene locus_tag LOCUS_22270 2360352 2360984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2361831 2360992 gene locus_tag LOCUS_22280 2361831 2360992 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_22280 2362336 2361917 gene locus_tag LOCUS_22290 2362336 2361917 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028624.1 protein_id gnl|my_center|LOCUS_22290 2362475 2362864 gene locus_tag LOCUS_22300 2362475 2362864 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978036.1 protein_id gnl|my_center|LOCUS_22300 2362864 2363727 gene locus_tag LOCUS_22310 2362864 2363727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227650.1 protein_id gnl|my_center|LOCUS_22310 2363724 2364659 gene locus_tag LOCUS_22320 2363724 2364659 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227649.1 protein_id gnl|my_center|LOCUS_22320 2364781 2366463 gene locus_tag LOCUS_22330 2364781 2366463 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 protein_id gnl|my_center|LOCUS_22330 2367157 2366468 gene locus_tag LOCUS_22340 2367157 2366468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2367889 2367167 gene locus_tag LOCUS_22350 2367889 2367167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2367785 2369008 gene locus_tag LOCUS_22360 2367785 2369008 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_22360 2369077 2369742 gene locus_tag LOCUS_22370 2369077 2369742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2369819 2370427 gene locus_tag LOCUS_22380 2369819 2370427 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230625.1 protein_id gnl|my_center|LOCUS_22380 2372027 2370420 gene locus_tag LOCUS_22390 2372027 2370420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2372730 2372110 gene locus_tag LOCUS_22400 2372730 2372110 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088199.1 protein_id gnl|my_center|LOCUS_22400 2373410 2372790 gene locus_tag LOCUS_22410 2373410 2372790 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090461.1 protein_id gnl|my_center|LOCUS_22410 2373946 2373506 gene locus_tag LOCUS_22420 2373946 2373506 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977090.1 protein_id gnl|my_center|LOCUS_22420 2374031 2374405 gene locus_tag LOCUS_22430 2374031 2374405 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977089.1 protein_id gnl|my_center|LOCUS_22430 2375353 2374406 gene locus_tag LOCUS_22440 2375353 2374406 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840050.1 protein_id gnl|my_center|LOCUS_22440 2375531 2376847 gene locus_tag LOCUS_22450 2375531 2376847 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 protein_id gnl|my_center|LOCUS_22450 2377156 2378715 gene locus_tag LOCUS_22460 gene ffh 2377156 2378715 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223845.1 protein_id gnl|my_center|LOCUS_22460 2378774 2379877 gene locus_tag LOCUS_22470 2378774 2379877 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_22470 2380537 2379911 gene locus_tag LOCUS_22480 2380537 2379911 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328056.1 protein_id gnl|my_center|LOCUS_22480 2383161 2380645 gene locus_tag LOCUS_22490 2383161 2380645 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029212.1 protein_id gnl|my_center|LOCUS_22490 2383901 2383158 gene locus_tag LOCUS_22500 2383901 2383158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029211.1 protein_id gnl|my_center|LOCUS_22500 2384191 2383898 gene locus_tag LOCUS_22510 2384191 2383898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2384323 2385585 gene locus_tag LOCUS_22520 2384323 2385585 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029209.1 protein_id gnl|my_center|LOCUS_22520 2385573 2386226 gene locus_tag LOCUS_22530 2385573 2386226 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030189071.1 protein_id gnl|my_center|LOCUS_22530 2388040 2386880 gene locus_tag LOCUS_22540 2388040 2386880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 2388171 2388770 gene locus_tag LOCUS_22550 2388171 2388770 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_22550 2388767 2390227 gene locus_tag LOCUS_22560 2388767 2390227 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_22560 2390951 2390244 gene locus_tag LOCUS_22570 2390951 2390244 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028619.1 protein_id gnl|my_center|LOCUS_22570 2391309 2391013 gene locus_tag LOCUS_22580 2391309 2391013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2391895 2391344 gene locus_tag LOCUS_22590 2391895 2391344 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_22590 2392007 2393269 gene locus_tag LOCUS_22600 2392007 2393269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2394587 2393337 gene locus_tag LOCUS_22610 2394587 2393337 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225903.1 protein_id gnl|my_center|LOCUS_22610 2395778 2394672 gene locus_tag LOCUS_22620 2395778 2394672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2396959 2395811 gene locus_tag LOCUS_22630 2396959 2395811 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229937.1 protein_id gnl|my_center|LOCUS_22630 2399118 2396998 gene locus_tag LOCUS_22640 2399118 2396998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2399939 2399127 gene locus_tag LOCUS_22650 2399939 2399127 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189285321.1 protein_id gnl|my_center|LOCUS_22650 2400846 2399941 gene locus_tag LOCUS_22660 2400846 2399941 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189285322.1 protein_id gnl|my_center|LOCUS_22660 2402109 2400853 gene locus_tag LOCUS_22670 2402109 2400853 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026821.1 protein_id gnl|my_center|LOCUS_22670 2403992 2402163 gene locus_tag LOCUS_22680 2403992 2402163 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_22680 2404894 2403992 gene locus_tag LOCUS_22690 2404894 2403992 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_22690 2406032 2405016 gene locus_tag LOCUS_22700 2406032 2405016 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269927.1 protein_id gnl|my_center|LOCUS_22700 2406298 2413647 gene locus_tag LOCUS_22710 2406298 2413647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2414262 2413657 gene locus_tag LOCUS_22720 2414262 2413657 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403741.1 protein_id gnl|my_center|LOCUS_22720 2414428 2415000 gene locus_tag LOCUS_22730 2414428 2415000 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_22730 2414997 2416043 gene locus_tag LOCUS_22740 2414997 2416043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2417372 2416110 gene locus_tag LOCUS_22750 2417372 2416110 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_22750 2418132 2417554 gene locus_tag LOCUS_22760 2418132 2417554 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898165.1 protein_id gnl|my_center|LOCUS_22760 2419061 2418195 gene locus_tag LOCUS_22770 2419061 2418195 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_22770 2419120 2420166 gene locus_tag LOCUS_22780 2419120 2420166 CDS product s-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679362.1 protein_id gnl|my_center|LOCUS_22780 2420258 2420851 gene locus_tag LOCUS_22790 2420258 2420851 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976453.1 protein_id gnl|my_center|LOCUS_22790 2421824 2420838 gene locus_tag LOCUS_22800 2421824 2420838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2423049 2421922 gene locus_tag LOCUS_22810 2423049 2421922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2424377 2423160 gene locus_tag LOCUS_22820 2424377 2423160 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727468.1 protein_id gnl|my_center|LOCUS_22820 2425891 2424374 gene locus_tag LOCUS_22830 2425891 2424374 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777078.1 protein_id gnl|my_center|LOCUS_22830 2425961 2426302 gene locus_tag LOCUS_22840 2425961 2426302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2426371 2426721 gene locus_tag LOCUS_22850 2426371 2426721 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222672.1 protein_id gnl|my_center|LOCUS_22850 2427113 2426718 gene locus_tag LOCUS_22860 2427113 2426718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2427533 2427141 gene locus_tag LOCUS_22870 2427533 2427141 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223443.1 protein_id gnl|my_center|LOCUS_22870 2428208 2427663 gene locus_tag LOCUS_22880 2428208 2427663 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 protein_id gnl|my_center|LOCUS_22880 2428586 2428377 gene locus_tag LOCUS_22890 2428586 2428377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2428476 2429204 gene locus_tag LOCUS_22900 2428476 2429204 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063703.1 protein_id gnl|my_center|LOCUS_22900 2430749 2429169 gene locus_tag LOCUS_22910 2430749 2429169 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368533.1 protein_id gnl|my_center|LOCUS_22910 2431964 2430789 gene locus_tag LOCUS_22920 2431964 2430789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977118.1 protein_id gnl|my_center|LOCUS_22920 2432210 2433244 gene locus_tag LOCUS_22930 2432210 2433244 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819931.1 protein_id gnl|my_center|LOCUS_22930 2433361 2434176 gene locus_tag LOCUS_22940 2433361 2434176 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030644.1 protein_id gnl|my_center|LOCUS_22940 2434173 2435033 gene locus_tag LOCUS_22950 2434173 2435033 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030645.1 protein_id gnl|my_center|LOCUS_22950 2435084 2436361 gene locus_tag LOCUS_22960 2435084 2436361 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030646.1 protein_id gnl|my_center|LOCUS_22960 2436437 2437588 gene locus_tag LOCUS_22970 2436437 2437588 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_22970 2437585 2438934 gene locus_tag LOCUS_22980 2437585 2438934 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_22980 2438931 2439851 gene locus_tag LOCUS_22990 gene rbsK 2438931 2439851 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_22990 2439838 2441847 gene locus_tag LOCUS_23000 2439838 2441847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2441981 2443168 gene locus_tag LOCUS_23010 2441981 2443168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2443168 2444328 gene locus_tag LOCUS_23020 2443168 2444328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2444464 2446662 gene locus_tag LOCUS_23030 2444464 2446662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2446830 2446693 gene locus_tag LOCUS_23040 2446830 2446693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2447138 2447500 gene locus_tag LOCUS_23050 2447138 2447500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2447527 2448918 gene locus_tag LOCUS_23060 2447527 2448918 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_23060 2448948 2449241 gene locus_tag LOCUS_23070 2448948 2449241 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067734.1 protein_id gnl|my_center|LOCUS_23070 2449893 2450207 gene locus_tag LOCUS_23080 2449893 2450207 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973104.1 protein_id gnl|my_center|LOCUS_23080 2450293 2451204 gene locus_tag LOCUS_23090 2450293 2451204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2451499 2452239 gene locus_tag LOCUS_23100 2451499 2452239 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_23100 2452839 2452540 gene locus_tag LOCUS_23110 2452839 2452540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2453790 2452858 gene locus_tag LOCUS_23120 2453790 2452858 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 protein_id gnl|my_center|LOCUS_23120 2454280 2454205 gene locus_tag LOCUS_t00250 2454280 2454205 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2455611 2454391 gene locus_tag LOCUS_23130 2455611 2454391 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_23130 2456770 2455751 gene locus_tag LOCUS_23140 2456770 2455751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 2457718 2456795 gene locus_tag LOCUS_23150 2457718 2456795 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_23150 2458066 2457728 gene locus_tag LOCUS_23160 2458066 2457728 CDS product YrdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086025693.1 protein_id gnl|my_center|LOCUS_23160 2458181 2458885 gene locus_tag LOCUS_23170 2458181 2458885 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230648.1 protein_id gnl|my_center|LOCUS_23170 2460330 2458957 gene locus_tag LOCUS_23180 2460330 2458957 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_23180 2460565 2462601 gene locus_tag LOCUS_23190 2460565 2462601 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487206.1 protein_id gnl|my_center|LOCUS_23190 2463110 2462607 gene locus_tag LOCUS_23200 2463110 2462607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865192.1 protein_id gnl|my_center|LOCUS_23200 2463209 2463880 gene locus_tag LOCUS_23210 2463209 2463880 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224827.1 protein_id gnl|my_center|LOCUS_23210 2464672 2463881 gene locus_tag LOCUS_23220 2464672 2463881 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_23220 2465058 2464669 gene locus_tag LOCUS_23230 gene pcaC 2465058 2464669 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705266.1 protein_id gnl|my_center|LOCUS_23230 2465837 2465055 gene locus_tag LOCUS_23240 gene pcaD 2465837 2465055 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_23240 2467207 2465834 gene locus_tag LOCUS_23250 2467207 2465834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2467859 2467311 gene locus_tag LOCUS_23260 gene pcaG 2467859 2467311 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223754.1 protein_id gnl|my_center|LOCUS_23260 2468563 2467856 gene locus_tag LOCUS_23270 gene pcaH 2468563 2467856 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965195.1 protein_id gnl|my_center|LOCUS_23270 2469321 2468560 gene locus_tag LOCUS_23280 2469321 2468560 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_23280 2470205 2469318 gene locus_tag LOCUS_23290 2470205 2469318 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223750.1 protein_id gnl|my_center|LOCUS_23290 2470369 2471829 gene locus_tag LOCUS_23300 2470369 2471829 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384684.1 protein_id gnl|my_center|LOCUS_23300 2471838 2472782 gene locus_tag LOCUS_23310 2471838 2472782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 2472779 2473564 gene locus_tag LOCUS_23320 2472779 2473564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_23320 2473561 2474391 gene locus_tag LOCUS_23330 2473561 2474391 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 protein_id gnl|my_center|LOCUS_23330 2474388 2475170 gene locus_tag LOCUS_23340 2474388 2475170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 protein_id gnl|my_center|LOCUS_23340 2477867 2476338 gene locus_tag LOCUS_23350 2477867 2476338 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 protein_id gnl|my_center|LOCUS_23350 2479068 2477911 gene locus_tag LOCUS_23360 2479068 2477911 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_23360 2479185 2479841 gene locus_tag LOCUS_23370 2479185 2479841 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 protein_id gnl|my_center|LOCUS_23370 2479879 2480223 gene locus_tag LOCUS_23380 2479879 2480223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2480745 2480290 gene locus_tag LOCUS_23390 2480745 2480290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2480807 2481973 gene locus_tag LOCUS_23400 2480807 2481973 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976445.1 protein_id gnl|my_center|LOCUS_23400 2481964 2482611 gene locus_tag LOCUS_23410 2481964 2482611 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326115.1 protein_id gnl|my_center|LOCUS_23410 2483294 2482608 gene locus_tag LOCUS_23420 2483294 2482608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2485068 2483413 gene locus_tag LOCUS_23430 2485068 2483413 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878652.1 protein_id gnl|my_center|LOCUS_23430 2485230 2485868 gene locus_tag LOCUS_23440 2485230 2485868 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_23440 2485950 2486648 gene locus_tag LOCUS_23450 gene canB 2485950 2486648 CDS product beta-carbonic anhydrase CanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950917.1 protein_id gnl|my_center|LOCUS_23450 2487955 2486657 gene locus_tag LOCUS_23460 2487955 2486657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2488510 2488064 gene locus_tag LOCUS_23470 2488510 2488064 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223984.1 protein_id gnl|my_center|LOCUS_23470 2488946 2489284 gene locus_tag LOCUS_23480 2488946 2489284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2490582 2489338 gene locus_tag LOCUS_23490 2490582 2489338 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223543.1 protein_id gnl|my_center|LOCUS_23490 2491670 2490609 gene locus_tag LOCUS_23500 2491670 2490609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2492777 2491692 gene locus_tag LOCUS_23510 2492777 2491692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2493196 2492909 gene locus_tag LOCUS_23520 2493196 2492909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2493818 2493204 gene locus_tag LOCUS_23530 gene tmk 2493818 2493204 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 protein_id gnl|my_center|LOCUS_23530 2494026 2494805 gene locus_tag LOCUS_23540 2494026 2494805 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_23540 2494824 2495771 gene locus_tag LOCUS_23550 2494824 2495771 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_23550 2495913 2496515 gene locus_tag LOCUS_23560 2495913 2496515 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229469.1 protein_id gnl|my_center|LOCUS_23560 2497779 2496571 gene locus_tag LOCUS_23570 2497779 2496571 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015602777.1 protein_id gnl|my_center|LOCUS_23570 2498915 2497944 gene locus_tag LOCUS_23580 2498915 2497944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2500002 2499052 gene locus_tag LOCUS_23590 2500002 2499052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976865.1 protein_id gnl|my_center|LOCUS_23590 2500001 2501236 gene locus_tag LOCUS_23600 2500001 2501236 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415911.1 protein_id gnl|my_center|LOCUS_23600 2501941 2502723 gene locus_tag LOCUS_23610 2501941 2502723 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_23610 2502807 2503886 gene locus_tag LOCUS_23620 gene mnmA 2502807 2503886 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223558.1 protein_id gnl|my_center|LOCUS_23620 2503933 2504991 gene locus_tag LOCUS_23630 2503933 2504991 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_23630 2505039 2507288 gene locus_tag LOCUS_23640 gene ligA 2505039 2507288 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_23640 2507679 2509688 gene locus_tag LOCUS_23650 gene rmdB 2507679 2509688 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_23650 2509796 2510095 gene locus_tag LOCUS_23660 gene gatC 2509796 2510095 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_23660 2510096 2511586 gene locus_tag LOCUS_23670 gene gatA 2510096 2511586 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_23670 2511603 2513099 gene locus_tag LOCUS_23680 gene gatB 2511603 2513099 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_23680 2513391 2514119 gene locus_tag LOCUS_23690 2513391 2514119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2514176 2514850 gene locus_tag LOCUS_23700 2514176 2514850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2514906 2515745 gene locus_tag LOCUS_23710 2514906 2515745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2516738 2515815 gene locus_tag LOCUS_23720 2516738 2515815 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_23720 2518177 2516912 gene locus_tag LOCUS_23730 2518177 2516912 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086552.1 protein_id gnl|my_center|LOCUS_23730 2518532 2518248 gene locus_tag LOCUS_23740 2518532 2518248 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_23740 2518877 2518578 gene locus_tag LOCUS_23750 2518877 2518578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2519843 2518908 gene locus_tag LOCUS_23760 2519843 2518908 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_23760 2522105 2520042 gene locus_tag LOCUS_23770 2522105 2520042 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 protein_id gnl|my_center|LOCUS_23770 2523301 2522111 gene locus_tag LOCUS_23780 2523301 2522111 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_23780 2523646 2524602 gene locus_tag LOCUS_23790 2523646 2524602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2525823 2524639 gene locus_tag LOCUS_23800 2525823 2524639 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_23800 2526022 2526663 gene locus_tag LOCUS_23810 2526022 2526663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2526660 2529155 gene locus_tag LOCUS_23820 2526660 2529155 CDS product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_23820 2529912 2529526 gene locus_tag LOCUS_23830 2529912 2529526 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850168.1 protein_id gnl|my_center|LOCUS_23830 2530025 2530591 gene locus_tag LOCUS_23840 2530025 2530591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2531327 2530653 gene locus_tag LOCUS_23850 2531327 2530653 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228658.1 protein_id gnl|my_center|LOCUS_23850 2531426 2531872 gene locus_tag LOCUS_23860 2531426 2531872 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_23860 2531951 2532553 gene locus_tag LOCUS_23870 2531951 2532553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23870 2532499 2533131 gene locus_tag LOCUS_23880 2532499 2533131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23880 2533630 2533118 gene locus_tag LOCUS_23890 2533630 2533118 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_23890 2533737 2534951 gene locus_tag LOCUS_23900 gene eis2 2533737 2534951 CDS product amikacin resistance N-acetyltransferase Eis2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079811.1 protein_id gnl|my_center|LOCUS_23900 2535045 2537051 gene locus_tag LOCUS_23910 gene thrS 2535045 2537051 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227149.1 protein_id gnl|my_center|LOCUS_23910 2537216 2538721 gene locus_tag LOCUS_23920 2537216 2538721 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029892.1 protein_id gnl|my_center|LOCUS_23920 2538765 2539817 gene locus_tag LOCUS_23930 2538765 2539817 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_23930 2539814 2541739 gene locus_tag LOCUS_23940 2539814 2541739 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_23940 2541736 2542680 gene locus_tag LOCUS_23950 2541736 2542680 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_23950 2542702 2544423 gene locus_tag LOCUS_23960 gene betA 2542702 2544423 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_23960 2544484 2544684 gene locus_tag LOCUS_23970 2544484 2544684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2546363 2544771 gene locus_tag LOCUS_23980 2546363 2544771 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029115.1 protein_id gnl|my_center|LOCUS_23980 2546442 2546993 gene locus_tag LOCUS_23990 2546442 2546993 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 protein_id gnl|my_center|LOCUS_23990 2547921 2547025 gene locus_tag LOCUS_24000 2547921 2547025 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030042.1 protein_id gnl|my_center|LOCUS_24000 2548028 2548807 gene locus_tag LOCUS_24010 2548028 2548807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2548911 2549159 gene locus_tag LOCUS_24020 2548911 2549159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2551316 2549160 gene locus_tag LOCUS_24030 2551316 2549160 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227139.1 protein_id gnl|my_center|LOCUS_24030 2551537 2552154 gene locus_tag LOCUS_24040 2551537 2552154 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_24040 2552151 2553053 gene locus_tag LOCUS_24050 2552151 2553053 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_24050 2553072 2554223 gene locus_tag LOCUS_24060 2553072 2554223 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_24060 2554249 2554731 gene locus_tag LOCUS_24070 2554249 2554731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2556686 2554752 gene locus_tag LOCUS_24080 2556686 2554752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2556925 2557833 gene locus_tag LOCUS_24090 gene pdxS 2556925 2557833 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_24090 2558065 2558346 gene locus_tag LOCUS_24100 2558065 2558346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2558773 2559564 gene locus_tag LOCUS_24110 2558773 2559564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2560964 2559585 gene locus_tag LOCUS_24120 2560964 2559585 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224881.1 protein_id gnl|my_center|LOCUS_24120 2561095 2561535 gene locus_tag LOCUS_24130 2561095 2561535 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466823.1 protein_id gnl|my_center|LOCUS_24130 2561845 2561471 gene locus_tag LOCUS_24140 2561845 2561471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2563502 2562729 gene locus_tag LOCUS_24150 gene pgl 2563502 2562729 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_24150 2564520 2563564 gene locus_tag LOCUS_24160 gene opcA 2564520 2563564 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972335.1 protein_id gnl|my_center|LOCUS_24160 2566074 2564539 gene locus_tag LOCUS_24170 gene zwf 2566074 2564539 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031084.1 protein_id gnl|my_center|LOCUS_24170 2567675 2566071 gene locus_tag LOCUS_24180 2567675 2566071 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_24180 2568787 2567672 gene locus_tag LOCUS_24190 gene tal 2568787 2567672 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_24190 2570887 2568800 gene locus_tag LOCUS_24200 gene tkt 2570887 2568800 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_24200 2571120 2572115 gene locus_tag LOCUS_24210 2571120 2572115 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224678.1 protein_id gnl|my_center|LOCUS_24210 2572135 2572995 gene locus_tag LOCUS_24220 2572135 2572995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_24220 2573990 2572992 gene locus_tag LOCUS_24230 2573990 2572992 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037062758.1 protein_id gnl|my_center|LOCUS_24230 2574930 2574004 gene locus_tag LOCUS_24240 2574930 2574004 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495563.1 protein_id gnl|my_center|LOCUS_24240 2575687 2575010 gene locus_tag LOCUS_24250 2575687 2575010 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064918.1 protein_id gnl|my_center|LOCUS_24250 2575568 2575801 gene locus_tag LOCUS_24260 2575568 2575801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2576565 2576017 gene locus_tag LOCUS_24270 2576565 2576017 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222357.1 protein_id gnl|my_center|LOCUS_24270 2576638 2577894 gene locus_tag LOCUS_24280 2576638 2577894 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205658.1 protein_id gnl|my_center|LOCUS_24280 2579180 2578203 gene locus_tag LOCUS_24290 2579180 2578203 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_24290 2579275 2579871 gene locus_tag LOCUS_24300 2579275 2579871 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728323.1 protein_id gnl|my_center|LOCUS_24300 2579958 2581250 gene locus_tag LOCUS_24310 2579958 2581250 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 protein_id gnl|my_center|LOCUS_24310 2581247 2581480 gene locus_tag LOCUS_24320 2581247 2581480 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224377.1 protein_id gnl|my_center|LOCUS_24320 2581477 2583030 gene locus_tag LOCUS_24330 2581477 2583030 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233134.1 protein_id gnl|my_center|LOCUS_24330 2583042 2584028 gene locus_tag LOCUS_24340 2583042 2584028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2584028 2585062 gene locus_tag LOCUS_24350 2584028 2585062 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226594.1 protein_id gnl|my_center|LOCUS_24350 2585062 2586495 gene locus_tag LOCUS_24360 2585062 2586495 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226593.1 protein_id gnl|my_center|LOCUS_24360 2586492 2587724 gene locus_tag LOCUS_24370 2586492 2587724 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226592.1 protein_id gnl|my_center|LOCUS_24370 2587721 2588479 gene locus_tag LOCUS_24380 2587721 2588479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2588476 2589411 gene locus_tag LOCUS_24390 gene rarD 2588476 2589411 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24390 2589536 2590270 gene locus_tag LOCUS_24400 2589536 2590270 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_24400 2590267 2591700 gene locus_tag LOCUS_24410 gene sufB 2590267 2591700 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894509.1 protein_id gnl|my_center|LOCUS_24410 2591747 2592931 gene locus_tag LOCUS_24420 gene sufD 2591747 2592931 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_24420 2592928 2593281 gene locus_tag LOCUS_24430 2592928 2593281 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_24430 2593278 2594057 gene locus_tag LOCUS_24440 gene sufC 2593278 2594057 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_24440 2594062 2595351 gene locus_tag LOCUS_24450 2594062 2595351 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_24450 2595351 2595821 gene locus_tag LOCUS_24460 2595351 2595821 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_24460 2595814 2596203 gene locus_tag LOCUS_24470 2595814 2596203 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_24470 2597211 2596207 gene locus_tag LOCUS_24480 2597211 2596207 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086958.1 protein_id gnl|my_center|LOCUS_24480 2597459 2597259 gene locus_tag LOCUS_24490 2597459 2597259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2597595 2599340 gene locus_tag LOCUS_24500 2597595 2599340 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037191.1 protein_id gnl|my_center|LOCUS_24500 2600582 2599356 gene locus_tag LOCUS_24510 2600582 2599356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2601766 2600624 gene locus_tag LOCUS_24520 2601766 2600624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2604082 2601779 gene locus_tag LOCUS_24530 2604082 2601779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2604328 2604489 gene locus_tag LOCUS_24540 2604328 2604489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2605087 2604608 gene locus_tag LOCUS_24550 2605087 2604608 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_24550 2605171 2605734 gene locus_tag LOCUS_24560 2605171 2605734 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_24560 2605843 2606526 gene locus_tag LOCUS_24570 2605843 2606526 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_24570 2606575 2607063 gene locus_tag LOCUS_24580 2606575 2607063 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_24580 2607157 2607618 gene locus_tag LOCUS_24590 2607157 2607618 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963527.1 protein_id gnl|my_center|LOCUS_24590 2608373 2607627 gene locus_tag LOCUS_24600 2608373 2607627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2609235 2608420 gene locus_tag LOCUS_24610 2609235 2608420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2610047 2609352 gene locus_tag LOCUS_24620 2610047 2609352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2610403 2612028 gene locus_tag LOCUS_24630 2610403 2612028 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224728.1 protein_id gnl|my_center|LOCUS_24630 2612115 2612888 gene locus_tag LOCUS_24640 2612115 2612888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2612910 2614139 gene locus_tag LOCUS_24650 2612910 2614139 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224708.1 protein_id gnl|my_center|LOCUS_24650 2614557 2614108 gene locus_tag LOCUS_24660 2614557 2614108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2614780 2615424 gene locus_tag LOCUS_24670 2614780 2615424 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224709.1 protein_id gnl|my_center|LOCUS_24670 2615609 2616187 gene locus_tag LOCUS_24680 2615609 2616187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2617241 2616258 gene locus_tag LOCUS_24690 2617241 2616258 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089171.1 protein_id gnl|my_center|LOCUS_24690 2617358 2618302 gene locus_tag LOCUS_24700 2617358 2618302 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_24700 2618362 2618934 gene locus_tag LOCUS_24710 2618362 2618934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014412.1 protein_id gnl|my_center|LOCUS_24710 2619142 2620776 gene locus_tag LOCUS_24720 2619142 2620776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24720 2621524 2620955 gene locus_tag LOCUS_24730 2621524 2620955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 2622750 2621548 gene locus_tag LOCUS_24740 2622750 2621548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225298.1 protein_id gnl|my_center|LOCUS_24740 2623372 2622800 gene locus_tag LOCUS_24750 2623372 2622800 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226802.1 protein_id gnl|my_center|LOCUS_24750 2623437 2624267 gene locus_tag LOCUS_24760 2623437 2624267 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095301.1 protein_id gnl|my_center|LOCUS_24760 2624483 2626009 gene locus_tag LOCUS_24770 2624483 2626009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 2626195 2627016 gene locus_tag LOCUS_24780 2626195 2627016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2627104 2627613 gene locus_tag LOCUS_24790 2627104 2627613 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530080.1 protein_id gnl|my_center|LOCUS_24790 2628527 2627610 gene locus_tag LOCUS_24800 2628527 2627610 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_24800 2628661 2629659 gene locus_tag LOCUS_24810 2628661 2629659 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224526.1 protein_id gnl|my_center|LOCUS_24810 2630575 2629694 gene locus_tag LOCUS_24820 2630575 2629694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2631556 2630585 gene locus_tag LOCUS_24830 2631556 2630585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 2631630 2632154 gene locus_tag LOCUS_24840 2631630 2632154 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029029.1 protein_id gnl|my_center|LOCUS_24840 2632210 2633007 gene locus_tag LOCUS_24850 2632210 2633007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2633079 2633879 gene locus_tag LOCUS_24860 2633079 2633879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2635276 2633927 gene locus_tag LOCUS_24870 2635276 2633927 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 protein_id gnl|my_center|LOCUS_24870 2635776 2635273 gene locus_tag LOCUS_24880 2635776 2635273 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457918.1 protein_id gnl|my_center|LOCUS_24880 2636091 2637227 gene locus_tag LOCUS_24890 2636091 2637227 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_24890 2637231 2638208 gene locus_tag LOCUS_24900 2637231 2638208 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_24900 2638205 2639155 gene locus_tag LOCUS_24910 2638205 2639155 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_24910 2639241 2639948 gene locus_tag LOCUS_24920 2639241 2639948 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226771.1 protein_id gnl|my_center|LOCUS_24920 2639971 2640753 gene locus_tag LOCUS_24930 gene fabI 2639971 2640753 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_24930 2640811 2641836 gene locus_tag LOCUS_24940 2640811 2641836 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_24940 2641850 2642632 gene locus_tag LOCUS_24950 2641850 2642632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2642713 2643147 gene locus_tag LOCUS_24960 2642713 2643147 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728853.1 protein_id gnl|my_center|LOCUS_24960 2643144 2644364 gene locus_tag LOCUS_24970 2643144 2644364 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_24970 2644975 2644427 gene locus_tag LOCUS_24980 2644975 2644427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231066.1 protein_id gnl|my_center|LOCUS_24980 2645700 2645152 gene locus_tag LOCUS_24990 2645700 2645152 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_24990 2645804 2646439 gene locus_tag LOCUS_25000 2645804 2646439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2647227 2646469 gene locus_tag LOCUS_25010 2647227 2646469 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_25010 2647853 2647224 gene locus_tag LOCUS_25020 2647853 2647224 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895207.1 protein_id gnl|my_center|LOCUS_25020 2647942 2648304 gene locus_tag LOCUS_25030 gene hisI 2647942 2648304 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_25030 2648301 2648855 gene locus_tag LOCUS_25040 2648301 2648855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2648852 2649661 gene locus_tag LOCUS_25050 gene trpC 2648852 2649661 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057938.1 protein_id gnl|my_center|LOCUS_25050 2649658 2650878 gene locus_tag LOCUS_25060 gene trpB 2649658 2650878 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728904.1 protein_id gnl|my_center|LOCUS_25060 2650875 2651675 gene locus_tag LOCUS_25070 gene trpA 2650875 2651675 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 protein_id gnl|my_center|LOCUS_25070 2653019 2651682 gene locus_tag LOCUS_25080 2653019 2651682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2653205 2654293 gene locus_tag LOCUS_25090 2653205 2654293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2654297 2655472 gene locus_tag LOCUS_25100 2654297 2655472 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_25100 2656240 2655476 gene locus_tag LOCUS_25110 2656240 2655476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2656802 2656257 gene locus_tag LOCUS_25120 2656802 2656257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2657104 2656799 gene locus_tag LOCUS_25130 2657104 2656799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2657426 2657094 gene locus_tag LOCUS_25140 2657426 2657094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2658041 2657532 gene locus_tag LOCUS_25150 2658041 2657532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 2658269 2658790 gene locus_tag LOCUS_25160 2658269 2658790 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222738.1 protein_id gnl|my_center|LOCUS_25160 2658876 2661935 gene locus_tag LOCUS_25170 2658876 2661935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2662011 2662478 gene locus_tag LOCUS_25180 2662011 2662478 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385273.1 protein_id gnl|my_center|LOCUS_25180 2662501 2662875 gene locus_tag LOCUS_25190 2662501 2662875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2662909 2663136 gene locus_tag LOCUS_25200 2662909 2663136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2663194 2663616 gene locus_tag LOCUS_25210 2663194 2663616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2664331 2663585 gene locus_tag LOCUS_25220 2664331 2663585 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729157.1 protein_id gnl|my_center|LOCUS_25220 2665674 2664508 gene locus_tag LOCUS_25230 2665674 2664508 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_25230 2665750 2666322 gene locus_tag LOCUS_25240 2665750 2666322 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143060529.1 protein_id gnl|my_center|LOCUS_25240 2666392 2669916 gene locus_tag LOCUS_25250 2666392 2669916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2669969 2671537 gene locus_tag LOCUS_25260 2669969 2671537 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227856.1 protein_id gnl|my_center|LOCUS_25260 2672172 2671540 gene locus_tag LOCUS_25270 2672172 2671540 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 protein_id gnl|my_center|LOCUS_25270 2672286 2672786 gene locus_tag LOCUS_25280 2672286 2672786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 2672914 2673492 gene locus_tag LOCUS_25290 2672914 2673492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2674087 2673506 gene locus_tag LOCUS_25300 2674087 2673506 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_25300 2675601 2674084 gene locus_tag LOCUS_25310 2675601 2674084 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_25310 2675815 2676315 gene locus_tag LOCUS_25320 gene uraD 2675815 2676315 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223820.1 protein_id gnl|my_center|LOCUS_25320 2676312 2676638 gene locus_tag LOCUS_25330 gene uraH 2676312 2676638 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057392.1 protein_id gnl|my_center|LOCUS_25330 2676642 2677463 gene locus_tag LOCUS_25340 gene pucL 2676642 2677463 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057393.1 protein_id gnl|my_center|LOCUS_25340 2677469 2678323 gene locus_tag LOCUS_25350 2677469 2678323 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226422.1 protein_id gnl|my_center|LOCUS_25350 2678314 2678787 gene locus_tag LOCUS_25360 2678314 2678787 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223812.1 protein_id gnl|my_center|LOCUS_25360 2678718 2680157 gene locus_tag LOCUS_25370 2678718 2680157 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_25370 2680154 2682499 gene locus_tag LOCUS_25380 gene pucD 2680154 2682499 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226424.1 protein_id gnl|my_center|LOCUS_25380 2682592 2684043 gene locus_tag LOCUS_25390 2682592 2684043 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226426.1 protein_id gnl|my_center|LOCUS_25390 2684067 2685224 gene locus_tag LOCUS_25400 2684067 2685224 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_25400 2685269 2685649 gene locus_tag LOCUS_25410 2685269 2685649 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226427.1 protein_id gnl|my_center|LOCUS_25410 2685646 2686443 gene locus_tag LOCUS_25420 2685646 2686443 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972721.1 protein_id gnl|my_center|LOCUS_25420 2686532 2687416 gene locus_tag LOCUS_25430 2686532 2687416 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226420.1 protein_id gnl|my_center|LOCUS_25430 2687420 2689132 gene locus_tag LOCUS_25440 gene gcl 2687420 2689132 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316584.1 protein_id gnl|my_center|LOCUS_25440 2689137 2690294 gene locus_tag LOCUS_25450 2689137 2690294 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093786317.1 protein_id gnl|my_center|LOCUS_25450 2690294 2691601 gene locus_tag LOCUS_25460 gene allB 2690294 2691601 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_25460 2691606 2692628 gene locus_tag LOCUS_25470 gene alc 2691606 2692628 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223823.1 protein_id gnl|my_center|LOCUS_25470 2692657 2693385 gene locus_tag LOCUS_25480 2692657 2693385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2693953 2693375 gene locus_tag LOCUS_25490 2693953 2693375 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284339.1 protein_id gnl|my_center|LOCUS_25490 2694125 2693931 gene locus_tag LOCUS_25500 2694125 2693931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2694135 2695310 gene locus_tag LOCUS_25510 2694135 2695310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2695949 2695227 gene locus_tag LOCUS_25520 2695949 2695227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2696094 2697344 gene locus_tag LOCUS_25530 2696094 2697344 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 protein_id gnl|my_center|LOCUS_25530 2697341 2698015 gene locus_tag LOCUS_25540 2697341 2698015 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_25540 2698079 2698567 gene locus_tag LOCUS_25550 2698079 2698567 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_25550 2699324 2698581 gene locus_tag LOCUS_25560 2699324 2698581 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231298.1 protein_id gnl|my_center|LOCUS_25560 2699917 2699327 gene locus_tag LOCUS_25570 2699917 2699327 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173393.1 protein_id gnl|my_center|LOCUS_25570 2700917 2699919 gene locus_tag LOCUS_25580 2700917 2699919 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390626.1 protein_id gnl|my_center|LOCUS_25580 2701044 2702990 gene locus_tag LOCUS_25590 2701044 2702990 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_25590 2703046 2706039 gene locus_tag LOCUS_25600 2703046 2706039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 2706054 2706353 gene locus_tag LOCUS_25610 2706054 2706353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226946.1 protein_id gnl|my_center|LOCUS_25610 2707497 2706361 gene locus_tag LOCUS_25620 2707497 2706361 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857806.1 protein_id gnl|my_center|LOCUS_25620 2707696 2708409 gene locus_tag LOCUS_25630 2707696 2708409 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974575.1 protein_id gnl|my_center|LOCUS_25630 2708531 2708406 gene locus_tag LOCUS_25640 2708531 2708406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2708906 2708553 gene locus_tag LOCUS_25650 2708906 2708553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25650 2709015 2709383 gene locus_tag LOCUS_25660 2709015 2709383 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948844.1 protein_id gnl|my_center|LOCUS_25660 2709380 2710258 gene locus_tag LOCUS_25670 2709380 2710258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462188.1 protein_id gnl|my_center|LOCUS_25670 2710255 2710977 gene locus_tag LOCUS_25680 2710255 2710977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2711006 2711281 gene locus_tag LOCUS_25690 2711006 2711281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2711238 2711966 gene locus_tag LOCUS_25700 2711238 2711966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2712116 2712667 gene locus_tag LOCUS_25710 gene def 2712116 2712667 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 protein_id gnl|my_center|LOCUS_25710 2712673 2713590 gene locus_tag LOCUS_25720 gene fmt 2712673 2713590 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_25720 2713587 2715185 gene locus_tag LOCUS_25730 2713587 2715185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2715216 2716580 gene locus_tag LOCUS_25740 2715216 2716580 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027699.1 protein_id gnl|my_center|LOCUS_25740 2716599 2719382 gene locus_tag LOCUS_25750 2716599 2719382 CDS product DUF6493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484745.1 protein_id gnl|my_center|LOCUS_25750 2720036 2719395 gene locus_tag LOCUS_25760 2720036 2719395 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_25760 2721301 2720033 gene locus_tag LOCUS_25770 2721301 2720033 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 protein_id gnl|my_center|LOCUS_25770 2722481 2721315 gene locus_tag LOCUS_25780 2722481 2721315 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804417.1 protein_id gnl|my_center|LOCUS_25780 2723255 2722581 gene locus_tag LOCUS_25790 2723255 2722581 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_25790 2724251 2723325 gene locus_tag LOCUS_25800 2724251 2723325 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123743405.1 protein_id gnl|my_center|LOCUS_25800 2724342 2725550 gene locus_tag LOCUS_25810 2724342 2725550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 protein_id gnl|my_center|LOCUS_25810 2726020 2725526 gene locus_tag LOCUS_25820 2726020 2725526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 2727448 2726084 gene locus_tag LOCUS_25830 2727448 2726084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2727527 2728057 gene locus_tag LOCUS_25840 2727527 2728057 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326320.1 protein_id gnl|my_center|LOCUS_25840 2728100 2728345 gene locus_tag LOCUS_25850 2728100 2728345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2728442 2728897 gene locus_tag LOCUS_25860 2728442 2728897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2730344 2728926 gene locus_tag LOCUS_25870 2730344 2728926 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223174.1 protein_id gnl|my_center|LOCUS_25870 2731842 2730325 gene locus_tag LOCUS_25880 2731842 2730325 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223174.1 protein_id gnl|my_center|LOCUS_25880 2732401 2731823 gene locus_tag LOCUS_25890 2732401 2731823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 2732533 2733192 gene locus_tag LOCUS_25900 gene rpe 2732533 2733192 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894453.1 protein_id gnl|my_center|LOCUS_25900 2733193 2734215 gene locus_tag LOCUS_25910 2733193 2734215 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255942.1 protein_id gnl|my_center|LOCUS_25910 2734361 2734546 gene locus_tag LOCUS_25920 2734361 2734546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2735316 2734543 gene locus_tag LOCUS_25930 2735316 2734543 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_25930 2736172 2735336 gene locus_tag LOCUS_25940 gene erm(O) 2736172 2735336 CDS product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(O) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030647.1 protein_id gnl|my_center|LOCUS_25940 2736811 2737392 gene locus_tag LOCUS_25950 2736811 2737392 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_25950 2737389 2738606 gene locus_tag LOCUS_25960 2737389 2738606 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_25960 2738606 2739073 gene locus_tag LOCUS_25970 gene ribH 2738606 2739073 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898872.1 protein_id gnl|my_center|LOCUS_25970 2739241 2739504 gene locus_tag LOCUS_25980 2739241 2739504 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895567.1 protein_id gnl|my_center|LOCUS_25980 2739514 2740359 gene locus_tag LOCUS_25990 gene hisG 2739514 2740359 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_25990 2740401 2741357 gene locus_tag LOCUS_26000 2740401 2741357 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114440.1 protein_id gnl|my_center|LOCUS_26000 2742249 2741383 gene locus_tag LOCUS_26010 2742249 2741383 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 protein_id gnl|my_center|LOCUS_26010 2742761 2742267 gene locus_tag LOCUS_26020 2742761 2742267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2743180 2742821 gene locus_tag LOCUS_26030 2743180 2742821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2744120 2743284 gene locus_tag LOCUS_26040 2744120 2743284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2744143 2744574 gene locus_tag LOCUS_26050 2744143 2744574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 2744629 2745909 gene locus_tag LOCUS_26060 2744629 2745909 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_26060 2746287 2745916 gene locus_tag LOCUS_26070 2746287 2745916 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_26070 2747143 2746322 gene locus_tag LOCUS_26080 2747143 2746322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2747971 2747156 gene locus_tag LOCUS_26090 2747971 2747156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2748908 2747964 gene locus_tag LOCUS_26100 2748908 2747964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867902.1 protein_id gnl|my_center|LOCUS_26100 2748969 2749607 gene locus_tag LOCUS_26110 2748969 2749607 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_26110 2749618 2750364 gene locus_tag LOCUS_26120 2749618 2750364 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_26120 2750665 2750913 gene locus_tag LOCUS_26130 2750665 2750913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2751428 2750910 gene locus_tag LOCUS_26140 2751428 2750910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2751850 2751443 gene locus_tag LOCUS_26150 2751850 2751443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2752593 2751928 gene locus_tag LOCUS_26160 2752593 2751928 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230338.1 protein_id gnl|my_center|LOCUS_26160 2753688 2752642 gene locus_tag LOCUS_26170 2753688 2752642 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_26170 2754647 2753685 gene locus_tag LOCUS_26180 2754647 2753685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 protein_id gnl|my_center|LOCUS_26180 2755632 2754652 gene locus_tag LOCUS_26190 2755632 2754652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_26190 2756648 2755629 gene locus_tag LOCUS_26200 2756648 2755629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_26200 2758316 2756673 gene locus_tag LOCUS_26210 2758316 2756673 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467774.1 protein_id gnl|my_center|LOCUS_26210 2760808 2758346 gene locus_tag LOCUS_26220 2760808 2758346 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230337.1 protein_id gnl|my_center|LOCUS_26220 2761849 2760998 gene locus_tag LOCUS_26230 2761849 2760998 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971569.1 protein_id gnl|my_center|LOCUS_26230 2763052 2761862 gene locus_tag LOCUS_26240 2763052 2761862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2763227 2763859 gene locus_tag LOCUS_26250 gene pdxT 2763227 2763859 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_26250 2763856 2764611 gene locus_tag LOCUS_26260 2763856 2764611 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_26260 2765518 2764589 gene locus_tag LOCUS_26270 2765518 2764589 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_26270 2765586 2766434 gene locus_tag LOCUS_26280 2765586 2766434 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 protein_id gnl|my_center|LOCUS_26280 2766535 2766699 gene locus_tag LOCUS_26290 2766535 2766699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2766759 2768006 gene locus_tag LOCUS_26300 2766759 2768006 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110188.1 protein_id gnl|my_center|LOCUS_26300 2768109 2768864 gene locus_tag LOCUS_26310 2768109 2768864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2769560 2768871 gene locus_tag LOCUS_26320 2769560 2768871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181774168.1 protein_id gnl|my_center|LOCUS_26320 2769683 2772469 gene locus_tag LOCUS_26330 2769683 2772469 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_26330 2773494 2772493 gene locus_tag LOCUS_26340 2773494 2772493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2774354 2773557 gene locus_tag LOCUS_26350 2774354 2773557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2776048 2774459 gene locus_tag LOCUS_26360 2776048 2774459 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 protein_id gnl|my_center|LOCUS_26360 2776174 2776737 gene locus_tag LOCUS_26370 2776174 2776737 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_26370 2777410 2776748 gene locus_tag LOCUS_26380 2777410 2776748 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223288.1 protein_id gnl|my_center|LOCUS_26380 2778648 2777398 gene locus_tag LOCUS_26390 2778648 2777398 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029209.1 protein_id gnl|my_center|LOCUS_26390 2778815 2779552 gene locus_tag LOCUS_26400 2778815 2779552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223290.1 protein_id gnl|my_center|LOCUS_26400 2779556 2782114 gene locus_tag LOCUS_26410 2779556 2782114 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167338154.1 protein_id gnl|my_center|LOCUS_26410 2782219 2783052 gene locus_tag LOCUS_26420 2782219 2783052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 2783211 2784101 gene locus_tag LOCUS_26430 2783211 2784101 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_26430 2784117 2784479 gene locus_tag LOCUS_26440 gene trxA 2784117 2784479 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_26440 2784614 2785096 gene locus_tag LOCUS_26450 2784614 2785096 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899982.1 protein_id gnl|my_center|LOCUS_26450 2785118 2786317 gene locus_tag LOCUS_26460 2785118 2786317 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227797.1 protein_id gnl|my_center|LOCUS_26460 2786345 2787331 gene locus_tag LOCUS_26470 2786345 2787331 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977714.1 protein_id gnl|my_center|LOCUS_26470 2788862 2787333 gene locus_tag LOCUS_26480 2788862 2787333 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_26480 2788993 2789856 gene locus_tag LOCUS_26490 2788993 2789856 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_26490 2789887 2790483 gene locus_tag LOCUS_26500 2789887 2790483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2790493 2791824 gene locus_tag LOCUS_26510 2790493 2791824 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_26510 2791836 2792501 gene locus_tag LOCUS_26520 2791836 2792501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2792724 2792506 gene locus_tag LOCUS_26530 2792724 2792506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2793447 2792842 gene locus_tag LOCUS_26540 2793447 2792842 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 protein_id gnl|my_center|LOCUS_26540 2794776 2793661 gene locus_tag LOCUS_26550 2794776 2793661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2798571 2794909 gene locus_tag LOCUS_26560 2798571 2794909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 2799444 2798725 gene locus_tag LOCUS_26570 2799444 2798725 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_26570 2800666 2799434 gene locus_tag LOCUS_26580 2800666 2799434 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_26580 2800983 2801414 gene locus_tag LOCUS_26590 gene mraZ 2800983 2801414 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_26590 2801552 2802562 gene locus_tag LOCUS_26600 gene rsmH 2801552 2802562 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228045.1 protein_id gnl|my_center|LOCUS_26600 2802559 2803122 gene locus_tag LOCUS_26610 2802559 2803122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2803127 2805223 gene locus_tag LOCUS_26620 gene ftsI 2803127 2805223 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_26620 2806736 2805273 gene locus_tag LOCUS_26630 2806736 2805273 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485352.1 protein_id gnl|my_center|LOCUS_26630 2806935 2807333 gene locus_tag LOCUS_26640 2806935 2807333 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227867.1 protein_id gnl|my_center|LOCUS_26640 2809704 2807353 gene locus_tag LOCUS_26650 2809704 2807353 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031148.1 protein_id gnl|my_center|LOCUS_26650 2810289 2809792 gene locus_tag LOCUS_26660 2810289 2809792 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_26660 2810422 2810495 gene locus_tag LOCUS_t00260 2810422 2810495 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2810541 2810612 gene locus_tag LOCUS_t00270 2810541 2810612 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2810624 2810698 gene locus_tag LOCUS_t00280 2810624 2810698 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2812527 2811400 gene locus_tag LOCUS_26670 2812527 2811400 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742171.1 protein_id gnl|my_center|LOCUS_26670 2813183 2812524 gene locus_tag LOCUS_26680 2813183 2812524 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_26680 2813410 2814714 gene locus_tag LOCUS_26690 2813410 2814714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2814806 2815159 gene locus_tag LOCUS_26700 2814806 2815159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2815156 2816460 gene locus_tag LOCUS_26710 2815156 2816460 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130055604.1 protein_id gnl|my_center|LOCUS_26710 2817592 2816558 gene locus_tag LOCUS_26720 2817592 2816558 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727143.1 protein_id gnl|my_center|LOCUS_26720 2817707 2818339 gene locus_tag LOCUS_26730 2817707 2818339 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728980.1 protein_id gnl|my_center|LOCUS_26730 2819864 2818341 gene locus_tag LOCUS_26740 2819864 2818341 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731247.1 protein_id gnl|my_center|LOCUS_26740 2820144 2822180 gene locus_tag LOCUS_26750 2820144 2822180 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972899.1 protein_id gnl|my_center|LOCUS_26750 2822283 2822732 gene locus_tag LOCUS_26760 2822283 2822732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2822742 2823893 gene locus_tag LOCUS_26770 2822742 2823893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2824883 2823951 gene locus_tag LOCUS_26780 2824883 2823951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2825233 2824880 gene locus_tag LOCUS_26790 2825233 2824880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 2825625 2825230 gene locus_tag LOCUS_26800 2825625 2825230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2825939 2826301 gene locus_tag LOCUS_26810 2825939 2826301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2826520 2827713 gene locus_tag LOCUS_26820 2826520 2827713 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226253.1 protein_id gnl|my_center|LOCUS_26820 2827710 2828336 gene locus_tag LOCUS_26830 2827710 2828336 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_26830 2828347 2829117 gene locus_tag LOCUS_26840 2828347 2829117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2829304 2830269 gene locus_tag LOCUS_26850 2829304 2830269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 2830269 2831828 gene locus_tag LOCUS_26860 2830269 2831828 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227262.1 protein_id gnl|my_center|LOCUS_26860 2831829 2832050 gene locus_tag LOCUS_26870 2831829 2832050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2832065 2833960 gene locus_tag LOCUS_26880 2832065 2833960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2834004 2834792 gene locus_tag LOCUS_26890 2834004 2834792 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845593.1 protein_id gnl|my_center|LOCUS_26890 2834896 2836641 gene locus_tag LOCUS_26900 2834896 2836641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2836663 2837055 gene locus_tag LOCUS_26910 2836663 2837055 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 protein_id gnl|my_center|LOCUS_26910 2837905 2837057 gene locus_tag LOCUS_26920 2837905 2837057 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484806.1 protein_id gnl|my_center|LOCUS_26920 2837983 2838789 gene locus_tag LOCUS_26930 2837983 2838789 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027142.1 protein_id gnl|my_center|LOCUS_26930 2839264 2838758 gene locus_tag LOCUS_26940 2839264 2838758 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729049.1 protein_id gnl|my_center|LOCUS_26940 2839317 2840426 gene locus_tag LOCUS_26950 2839317 2840426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2840643 2840957 gene locus_tag LOCUS_26960 2840643 2840957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2842421 2840994 gene locus_tag LOCUS_26970 2842421 2840994 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 protein_id gnl|my_center|LOCUS_26970 2842483 2843166 gene locus_tag LOCUS_26980 2842483 2843166 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_26980 2843287 2844678 gene locus_tag LOCUS_26990 2843287 2844678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 2844905 2845114 gene locus_tag LOCUS_27000 2844905 2845114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2845397 2845092 gene locus_tag LOCUS_27010 2845397 2845092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 2845426 2846178 gene locus_tag LOCUS_27020 2845426 2846178 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804215.1 protein_id gnl|my_center|LOCUS_27020 2846738 2846160 gene locus_tag LOCUS_27030 2846738 2846160 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486994.1 protein_id gnl|my_center|LOCUS_27030 2848383 2846839 gene locus_tag LOCUS_27040 2848383 2846839 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222228.1 protein_id gnl|my_center|LOCUS_27040 2848591 2849268 gene locus_tag LOCUS_27050 2848591 2849268 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080583.1 protein_id gnl|my_center|LOCUS_27050 2849378 2849848 gene locus_tag LOCUS_27060 2849378 2849848 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029961.1 protein_id gnl|my_center|LOCUS_27060 2850912 2849908 gene locus_tag LOCUS_27070 2850912 2849908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2852402 2851170 gene locus_tag LOCUS_27080 2852402 2851170 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742244.1 protein_id gnl|my_center|LOCUS_27080 2853316 2852501 gene locus_tag LOCUS_27090 2853316 2852501 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029265.1 protein_id gnl|my_center|LOCUS_27090 2854313 2853414 gene locus_tag LOCUS_27100 2854313 2853414 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 protein_id gnl|my_center|LOCUS_27100 2855573 2854392 gene locus_tag LOCUS_27110 2855573 2854392 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112110.1 protein_id gnl|my_center|LOCUS_27110 2855723 2856406 gene locus_tag LOCUS_27120 2855723 2856406 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269945.1 protein_id gnl|my_center|LOCUS_27120 2856835 2856437 gene locus_tag LOCUS_27130 2856835 2856437 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031553.1 protein_id gnl|my_center|LOCUS_27130 2856962 2858026 gene locus_tag LOCUS_27140 2856962 2858026 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284156.1 protein_id gnl|my_center|LOCUS_27140 2858033 2858218 gene locus_tag LOCUS_27150 2858033 2858218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 2859375 2858269 gene locus_tag LOCUS_27160 2859375 2858269 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 protein_id gnl|my_center|LOCUS_27160 2859713 2859372 gene locus_tag LOCUS_27170 2859713 2859372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2862214 2859710 gene locus_tag LOCUS_27180 gene nirB 2862214 2859710 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111865.1 protein_id gnl|my_center|LOCUS_27180 2863569 2862211 gene locus_tag LOCUS_27190 2863569 2862211 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_27190 2865794 2863569 gene locus_tag LOCUS_27200 2865794 2863569 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_27200 2867289 2865832 gene locus_tag LOCUS_27210 2867289 2865832 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085590.1 protein_id gnl|my_center|LOCUS_27210 2868304 2867315 gene locus_tag LOCUS_27220 2868304 2867315 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125308321.1 protein_id gnl|my_center|LOCUS_27220 2868395 2869837 gene locus_tag LOCUS_27230 2868395 2869837 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229862.1 protein_id gnl|my_center|LOCUS_27230 2870506 2869850 gene locus_tag LOCUS_27240 2870506 2869850 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224030.1 protein_id gnl|my_center|LOCUS_27240 2871287 2870535 gene locus_tag LOCUS_27250 2871287 2870535 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401353.1 protein_id gnl|my_center|LOCUS_27250 2872624 2871284 gene locus_tag LOCUS_27260 2872624 2871284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2874219 2872621 gene locus_tag LOCUS_27270 gene gcvPB 2874219 2872621 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_27270 2875544 2874216 gene locus_tag LOCUS_27280 gene gcvPA 2875544 2874216 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868897.1 protein_id gnl|my_center|LOCUS_27280 2875669 2876973 gene locus_tag LOCUS_27290 2875669 2876973 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972798.1 protein_id gnl|my_center|LOCUS_27290 2876970 2877896 gene locus_tag LOCUS_27300 2876970 2877896 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969762.1 protein_id gnl|my_center|LOCUS_27300 2877893 2878699 gene locus_tag LOCUS_27310 2877893 2878699 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311851.1 protein_id gnl|my_center|LOCUS_27310 2878704 2880677 gene locus_tag LOCUS_27320 2878704 2880677 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030394.1 protein_id gnl|my_center|LOCUS_27320 2880674 2882800 gene locus_tag LOCUS_27330 gene ygjK 2880674 2882800 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_27330 2884016 2882859 gene locus_tag LOCUS_27340 2884016 2882859 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_27340 2884210 2884016 gene locus_tag LOCUS_27350 2884210 2884016 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228992.1 protein_id gnl|my_center|LOCUS_27350 2885417 2884215 gene locus_tag LOCUS_27360 2885417 2884215 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_27360 2885589 2886287 gene locus_tag LOCUS_27370 2885589 2886287 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974575.1 protein_id gnl|my_center|LOCUS_27370 2886334 2886969 gene locus_tag LOCUS_27380 2886334 2886969 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 protein_id gnl|my_center|LOCUS_27380 2887432 2886974 gene locus_tag LOCUS_27390 2887432 2886974 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230484.1 protein_id gnl|my_center|LOCUS_27390 2889074 2887536 gene locus_tag LOCUS_27400 2889074 2887536 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728453.1 protein_id gnl|my_center|LOCUS_27400 2890283 2889324 gene locus_tag LOCUS_27410 2890283 2889324 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027140.1 protein_id gnl|my_center|LOCUS_27410 2891128 2890328 gene locus_tag LOCUS_27420 2891128 2890328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050162286.1 protein_id gnl|my_center|LOCUS_27420 2892186 2891125 gene locus_tag LOCUS_27430 gene fepG 2892186 2891125 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_27430 2893190 2892183 gene locus_tag LOCUS_27440 2893190 2892183 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013700.1 protein_id gnl|my_center|LOCUS_27440 2894136 2893192 gene locus_tag LOCUS_27450 2894136 2893192 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013789.1 protein_id gnl|my_center|LOCUS_27450 2894332 2895804 gene locus_tag LOCUS_27460 2894332 2895804 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_27460 2895820 2896638 gene locus_tag LOCUS_27470 2895820 2896638 CDS product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704731.1 protein_id gnl|my_center|LOCUS_27470 2897678 2896719 gene locus_tag LOCUS_27480 2897678 2896719 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_27480 2897805 2898719 gene locus_tag LOCUS_27490 2897805 2898719 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_27490 2898798 2899718 gene locus_tag LOCUS_27500 2898798 2899718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2899863 2901062 gene locus_tag LOCUS_27510 2899863 2901062 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_27510 2901083 2901979 gene locus_tag LOCUS_27520 2901083 2901979 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_27520 2902100 2903068 gene locus_tag LOCUS_27530 2902100 2903068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 2903065 2904336 gene locus_tag LOCUS_27540 2903065 2904336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 protein_id gnl|my_center|LOCUS_27540 2904353 2905273 gene locus_tag LOCUS_27550 2904353 2905273 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_27550 2905270 2906142 gene locus_tag LOCUS_27560 2905270 2906142 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_27560 2906151 2906837 gene locus_tag LOCUS_27570 2906151 2906837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 2908430 2906847 gene locus_tag LOCUS_27580 2908430 2906847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 2909419 2908544 gene locus_tag LOCUS_27590 2909419 2908544 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_27590 2910354 2909422 gene locus_tag LOCUS_27600 2910354 2909422 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223267.1 protein_id gnl|my_center|LOCUS_27600 2910458 2910973 gene locus_tag LOCUS_27610 2910458 2910973 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_27610 2911076 2912149 gene locus_tag LOCUS_27620 2911076 2912149 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_27620 2913714 2912074 gene locus_tag LOCUS_27630 2913714 2912074 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030100.1 protein_id gnl|my_center|LOCUS_27630 2913864 2914397 gene locus_tag LOCUS_27640 2913864 2914397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 2914465 2915718 gene locus_tag LOCUS_27650 2914465 2915718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110111.1 protein_id gnl|my_center|LOCUS_27650 2915715 2916911 gene locus_tag LOCUS_27660 2915715 2916911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2917824 2916901 gene locus_tag LOCUS_27670 2917824 2916901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2917959 2919359 gene locus_tag LOCUS_27680 2917959 2919359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 2920078 2919371 gene locus_tag LOCUS_27690 2920078 2919371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 2920388 2921443 gene locus_tag LOCUS_27700 2920388 2921443 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229229.1 protein_id gnl|my_center|LOCUS_27700 2921440 2921835 gene locus_tag LOCUS_27710 2921440 2921835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2921910 2922464 gene locus_tag LOCUS_27720 2921910 2922464 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_27720 2923432 2922608 gene locus_tag LOCUS_27730 2923432 2922608 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226107.1 protein_id gnl|my_center|LOCUS_27730 2924677 2923490 gene locus_tag LOCUS_27740 2924677 2923490 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031121.1 protein_id gnl|my_center|LOCUS_27740 2925317 2924832 gene locus_tag LOCUS_27750 2925317 2924832 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973265.1 protein_id gnl|my_center|LOCUS_27750 2925664 2925314 gene locus_tag LOCUS_27760 2925664 2925314 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327415.1 protein_id gnl|my_center|LOCUS_27760 2926450 2925764 gene locus_tag LOCUS_27770 2926450 2925764 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_27770 2926536 2926715 gene locus_tag LOCUS_27780 2926536 2926715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2926849 2927592 gene locus_tag LOCUS_27790 2926849 2927592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2927717 2928565 gene locus_tag LOCUS_27800 2927717 2928565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 2931914 2928861 gene locus_tag LOCUS_27810 2931914 2928861 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_27810 2932080 2933231 gene locus_tag LOCUS_27820 2932080 2933231 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_27820 2933324 2934478 gene locus_tag LOCUS_27830 2933324 2934478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 2934483 2935946 gene locus_tag LOCUS_27840 2934483 2935946 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030046.1 protein_id gnl|my_center|LOCUS_27840 2937031 2936036 gene locus_tag LOCUS_27850 2937031 2936036 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097301.1 protein_id gnl|my_center|LOCUS_27850 2938409 2937696 gene locus_tag LOCUS_27860 2938409 2937696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 2940179 2938449 gene locus_tag LOCUS_27870 gene poxB 2940179 2938449 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729435.1 protein_id gnl|my_center|LOCUS_27870 2941776 2940196 gene locus_tag LOCUS_27880 2941776 2940196 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285120.1 protein_id gnl|my_center|LOCUS_27880 2941941 2942498 gene locus_tag LOCUS_27890 2941941 2942498 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227039.1 protein_id gnl|my_center|LOCUS_27890 2943019 2942549 gene locus_tag LOCUS_27900 2943019 2942549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 2943296 2943574 gene locus_tag LOCUS_27910 2943296 2943574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 2943571 2945364 gene locus_tag LOCUS_27920 2943571 2945364 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225166.1 protein_id gnl|my_center|LOCUS_27920 2945398 2945733 gene locus_tag LOCUS_27930 2945398 2945733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227035.1 protein_id gnl|my_center|LOCUS_27930 2946274 2945852 gene locus_tag LOCUS_27940 2946274 2945852 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_27940 2947133 2946330 gene locus_tag LOCUS_27950 2947133 2946330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2947470 2949821 gene locus_tag LOCUS_27960 2947470 2949821 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226366.1 protein_id gnl|my_center|LOCUS_27960 2949931 2950368 gene locus_tag LOCUS_27970 2949931 2950368 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227042.1 protein_id gnl|my_center|LOCUS_27970 2951384 2950476 gene locus_tag LOCUS_27980 2951384 2950476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 2951553 2952212 gene locus_tag LOCUS_27990 2951553 2952212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 2953290 2952262 gene locus_tag LOCUS_28000 2953290 2952262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2954331 2953444 gene locus_tag LOCUS_28010 2954331 2953444 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628631.1 protein_id gnl|my_center|LOCUS_28010 2955298 2954444 gene locus_tag LOCUS_28020 2955298 2954444 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978337.1 protein_id gnl|my_center|LOCUS_28020 2955770 2955285 gene locus_tag LOCUS_28030 2955770 2955285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 2956500 2955943 gene locus_tag LOCUS_28040 2956500 2955943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2956737 2957651 gene locus_tag LOCUS_28050 2956737 2957651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2957695 2958384 gene locus_tag LOCUS_28060 2957695 2958384 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 protein_id gnl|my_center|LOCUS_28060 2958438 2958791 gene locus_tag LOCUS_28070 2958438 2958791 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_28070 2959129 2958797 gene locus_tag LOCUS_28080 2959129 2958797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 2960032 2959178 gene locus_tag LOCUS_28090 2960032 2959178 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_28090 2960121 2961218 gene locus_tag LOCUS_28100 2960121 2961218 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_28100 2961218 2962135 gene locus_tag LOCUS_28110 2961218 2962135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 2963041 2962250 gene locus_tag LOCUS_28120 2963041 2962250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974572.1 protein_id gnl|my_center|LOCUS_28120 2964048 2963038 gene locus_tag LOCUS_28130 gene fepG 2964048 2963038 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_28130 2965133 2964099 gene locus_tag LOCUS_28140 2965133 2964099 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013700.1 protein_id gnl|my_center|LOCUS_28140 2966179 2965130 gene locus_tag LOCUS_28150 2966179 2965130 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211882.1 protein_id gnl|my_center|LOCUS_28150 2966345 2966869 gene locus_tag LOCUS_28160 2966345 2966869 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_28160 2966926 2968449 gene locus_tag LOCUS_28170 2966926 2968449 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_28170 2970607 2968586 gene locus_tag LOCUS_28180 2970607 2968586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2970865 2971185 gene locus_tag LOCUS_28190 2970865 2971185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 2972952 2971237 gene locus_tag LOCUS_28200 2972952 2971237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031834.1 protein_id gnl|my_center|LOCUS_28200 2974769 2972949 gene locus_tag LOCUS_28210 2974769 2972949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485997.1 protein_id gnl|my_center|LOCUS_28210 2975778 2974807 gene locus_tag LOCUS_28220 2975778 2974807 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043789805.1 protein_id gnl|my_center|LOCUS_28220 2975849 2976409 gene locus_tag LOCUS_28230 2975849 2976409 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226048.1 protein_id gnl|my_center|LOCUS_28230 2977646 2976414 gene locus_tag LOCUS_28240 2977646 2976414 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226226.1 protein_id gnl|my_center|LOCUS_28240 2978330 2977668 gene locus_tag LOCUS_28250 gene folE 2978330 2977668 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072479192.1 protein_id gnl|my_center|LOCUS_28250 2978422 2979102 gene locus_tag LOCUS_28260 2978422 2979102 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226228.1 protein_id gnl|my_center|LOCUS_28260 2980704 2979097 gene locus_tag LOCUS_28270 2980704 2979097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2982044 2980836 gene locus_tag LOCUS_28280 2982044 2980836 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043778558.1 protein_id gnl|my_center|LOCUS_28280 2982162 2982836 gene locus_tag LOCUS_28290 2982162 2982836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 2982829 2984295 gene locus_tag LOCUS_28300 gene tcuA 2982829 2984295 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228705.1 protein_id gnl|my_center|LOCUS_28300 2984344 2984889 gene locus_tag LOCUS_28310 2984344 2984889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2984936 2985646 gene locus_tag LOCUS_28320 2984936 2985646 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227110.1 protein_id gnl|my_center|LOCUS_28320 2986723 2985659 gene locus_tag LOCUS_28330 2986723 2985659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2987319 2986720 gene locus_tag LOCUS_28340 2987319 2986720 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_28340 2988325 2987297 gene locus_tag LOCUS_28350 2988325 2987297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2988460 2989704 gene locus_tag LOCUS_28360 2988460 2989704 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777054.1 protein_id gnl|my_center|LOCUS_28360 2989723 2989974 gene locus_tag LOCUS_28370 2989723 2989974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28370 2989934 2991640 gene locus_tag LOCUS_28380 2989934 2991640 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730685.1 protein_id gnl|my_center|LOCUS_28380 2991809 2991737 gene locus_tag LOCUS_t00290 2991809 2991737 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2993073 2991868 gene locus_tag LOCUS_28390 2993073 2991868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 2993714 2996086 gene locus_tag LOCUS_28400 2993714 2996086 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133828046.1 protein_id gnl|my_center|LOCUS_28400 2996083 2996496 gene locus_tag LOCUS_28410 2996083 2996496 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085368.1 protein_id gnl|my_center|LOCUS_28410 2996557 2997759 gene locus_tag LOCUS_28420 2996557 2997759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088694.1 protein_id gnl|my_center|LOCUS_28420 2997820 2998689 gene locus_tag LOCUS_28430 2997820 2998689 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_28430 2998686 2999699 gene locus_tag LOCUS_28440 2998686 2999699 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976269.1 protein_id gnl|my_center|LOCUS_28440 2999696 3000439 gene locus_tag LOCUS_28450 2999696 3000439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_28450 3000436 3001188 gene locus_tag LOCUS_28460 3000436 3001188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528528.1 protein_id gnl|my_center|LOCUS_28460 3001225 3002037 gene locus_tag LOCUS_28470 3001225 3002037 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928799.1 protein_id gnl|my_center|LOCUS_28470 3002993 3002034 gene locus_tag LOCUS_28480 3002993 3002034 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_28480 3003214 3004164 gene locus_tag LOCUS_28490 3003214 3004164 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_28490 3004223 3004975 gene locus_tag LOCUS_28500 3004223 3004975 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_28500 3005000 3006451 gene locus_tag LOCUS_28510 gene ngcE 3005000 3006451 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_28510 3006529 3007512 gene locus_tag LOCUS_28520 3006529 3007512 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030592.1 protein_id gnl|my_center|LOCUS_28520 3007528 3008424 gene locus_tag LOCUS_28530 3007528 3008424 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_28530 3009670 3008495 gene locus_tag LOCUS_28540 3009670 3008495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3010826 3009732 gene locus_tag LOCUS_28550 3010826 3009732 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 protein_id gnl|my_center|LOCUS_28550 3011881 3010871 gene locus_tag LOCUS_28560 3011881 3010871 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109282207.1 protein_id gnl|my_center|LOCUS_28560 3012016 3015033 gene locus_tag LOCUS_28570 3012016 3015033 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_28570 3015130 3015681 gene locus_tag LOCUS_28580 3015130 3015681 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891973.1 protein_id gnl|my_center|LOCUS_28580 3015666 3015992 gene locus_tag LOCUS_28590 3015666 3015992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 3016030 3018216 gene locus_tag LOCUS_28600 3016030 3018216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3018239 3019213 gene locus_tag LOCUS_28610 3018239 3019213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3019291 3019947 gene locus_tag LOCUS_28620 3019291 3019947 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026996.1 protein_id gnl|my_center|LOCUS_28620 3019944 3020819 gene locus_tag LOCUS_28630 3019944 3020819 CDS product virginiamycin B lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029662.1 protein_id gnl|my_center|LOCUS_28630 3020892 3021773 gene locus_tag LOCUS_28640 3020892 3021773 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_28640 3022534 3021770 gene locus_tag LOCUS_28650 3022534 3021770 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225327.1 protein_id gnl|my_center|LOCUS_28650 3022666 3023259 gene locus_tag LOCUS_28660 3022666 3023259 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974324.1 protein_id gnl|my_center|LOCUS_28660 3023240 3023461 gene locus_tag LOCUS_28670 3023240 3023461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3023571 3023356 gene locus_tag LOCUS_28680 3023571 3023356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3023643 3024551 gene locus_tag LOCUS_28690 3023643 3024551 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121436435.1 protein_id gnl|my_center|LOCUS_28690 3024691 3025116 gene locus_tag LOCUS_28700 3024691 3025116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3025145 3026722 gene locus_tag LOCUS_28710 3025145 3026722 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731247.1 protein_id gnl|my_center|LOCUS_28710 3027482 3026727 gene locus_tag LOCUS_28720 gene fabG 3027482 3026727 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_28720 3027602 3028630 gene locus_tag LOCUS_28730 3027602 3028630 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742137.1 protein_id gnl|my_center|LOCUS_28730 3028667 3031234 gene locus_tag LOCUS_28740 3028667 3031234 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_28740 3031716 3031231 gene locus_tag LOCUS_28750 3031716 3031231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 3032259 3031759 gene locus_tag LOCUS_28760 3032259 3031759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 3032388 3033281 gene locus_tag LOCUS_28770 3032388 3033281 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123743405.1 protein_id gnl|my_center|LOCUS_28770 3034347 3033244 gene locus_tag LOCUS_28780 3034347 3033244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 3034388 3035005 gene locus_tag LOCUS_28790 3034388 3035005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 3035589 3035002 gene locus_tag LOCUS_28800 3035589 3035002 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031930.1 protein_id gnl|my_center|LOCUS_28800 3035658 3036422 gene locus_tag LOCUS_28810 3035658 3036422 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487371.1 protein_id gnl|my_center|LOCUS_28810 3036916 3036401 gene locus_tag LOCUS_28820 3036916 3036401 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079901.1 protein_id gnl|my_center|LOCUS_28820 3037074 3038744 gene locus_tag LOCUS_28830 gene araB 3037074 3038744 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_28830 3038741 3039409 gene locus_tag LOCUS_28840 3038741 3039409 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_28840 3039433 3040833 gene locus_tag LOCUS_28850 gene araA 3039433 3040833 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776919.1 protein_id gnl|my_center|LOCUS_28850 3040871 3041950 gene locus_tag LOCUS_28860 gene chvE 3040871 3041950 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727839.1 protein_id gnl|my_center|LOCUS_28860 3041980 3043530 gene locus_tag LOCUS_28870 gene gguA 3041980 3043530 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 protein_id gnl|my_center|LOCUS_28870 3043527 3044753 gene locus_tag LOCUS_28880 gene gguB 3043527 3044753 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727841.1 protein_id gnl|my_center|LOCUS_28880 3045795 3044812 gene locus_tag LOCUS_28890 3045795 3044812 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_28890 3046010 3046747 gene locus_tag LOCUS_28900 3046010 3046747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 3047267 3047091 gene locus_tag LOCUS_28910 3047267 3047091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3047581 3047264 gene locus_tag LOCUS_28920 3047581 3047264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3047490 3047672 gene locus_tag LOCUS_28930 3047490 3047672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 3047702 3048280 gene locus_tag LOCUS_28940 3047702 3048280 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_28940 3048316 3049518 gene locus_tag LOCUS_28950 3048316 3049518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 3050155 3049541 gene locus_tag LOCUS_28960 3050155 3049541 CDS product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466853.1 protein_id gnl|my_center|LOCUS_28960 3050696 3050250 gene locus_tag LOCUS_28970 3050696 3050250 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120015315.1 protein_id gnl|my_center|LOCUS_28970 3051169 3050693 gene locus_tag LOCUS_28980 3051169 3050693 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_28980 3051269 3051898 gene locus_tag LOCUS_28990 3051269 3051898 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229694.1 protein_id gnl|my_center|LOCUS_28990 3052608 3051910 gene locus_tag LOCUS_29000 3052608 3051910 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862720.1 protein_id gnl|my_center|LOCUS_29000 3052697 3053662 gene locus_tag LOCUS_29010 3052697 3053662 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_29010 3053814 3055712 gene locus_tag LOCUS_29020 3053814 3055712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3055847 3056488 gene locus_tag LOCUS_29030 3055847 3056488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 3057973 3056465 gene locus_tag LOCUS_29040 3057973 3056465 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_29040 3058492 3058016 gene locus_tag LOCUS_29050 3058492 3058016 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_29050 3058667 3059884 gene locus_tag LOCUS_29060 3058667 3059884 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_29060 3059889 3060932 gene locus_tag LOCUS_29070 3059889 3060932 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_29070 3060969 3062159 gene locus_tag LOCUS_29080 3060969 3062159 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_29080 3062156 3063274 gene locus_tag LOCUS_29090 3062156 3063274 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027646.1 protein_id gnl|my_center|LOCUS_29090 3063288 3064289 gene locus_tag LOCUS_29100 3063288 3064289 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_29100 3064286 3065035 gene locus_tag LOCUS_29110 gene fabG 3064286 3065035 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225006.1 protein_id gnl|my_center|LOCUS_29110 3065058 3065801 gene locus_tag LOCUS_29120 3065058 3065801 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_29120 3065798 3066574 gene locus_tag LOCUS_29130 3065798 3066574 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224990.1 protein_id gnl|my_center|LOCUS_29130 3067943 3066576 gene locus_tag LOCUS_29140 3067943 3066576 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530083.1 protein_id gnl|my_center|LOCUS_29140 3068057 3068461 gene locus_tag LOCUS_29150 3068057 3068461 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800667.1 protein_id gnl|my_center|LOCUS_29150 3068483 3069916 gene locus_tag LOCUS_29160 3068483 3069916 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534689.1 protein_id gnl|my_center|LOCUS_29160 3070719 3069925 gene locus_tag LOCUS_29170 3070719 3069925 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_29170 3071235 3070792 gene locus_tag LOCUS_29180 3071235 3070792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3071964 3071293 gene locus_tag LOCUS_29190 3071964 3071293 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029204.1 protein_id gnl|my_center|LOCUS_29190 3072596 3071961 gene locus_tag LOCUS_29200 3072596 3071961 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870668.1 protein_id gnl|my_center|LOCUS_29200 3073246 3072593 gene locus_tag LOCUS_29210 3073246 3072593 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029202.1 protein_id gnl|my_center|LOCUS_29210 3074301 3073243 gene locus_tag LOCUS_29220 3074301 3073243 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029199.1 protein_id gnl|my_center|LOCUS_29220 3074417 3075208 gene locus_tag LOCUS_29230 3074417 3075208 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_29230 3075314 3076015 gene locus_tag LOCUS_29240 3075314 3076015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 3076065 3076424 gene locus_tag LOCUS_29250 3076065 3076424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977365.1 protein_id gnl|my_center|LOCUS_29250 3076427 3077578 gene locus_tag LOCUS_29260 3076427 3077578 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_29260 3077891 3077586 gene locus_tag LOCUS_29270 3077891 3077586 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_29270 3078029 3079252 gene locus_tag LOCUS_29280 3078029 3079252 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222962.1 protein_id gnl|my_center|LOCUS_29280 3079245 3080198 gene locus_tag LOCUS_29290 gene cydB 3079245 3080198 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_29290 3080290 3081744 gene locus_tag LOCUS_29300 3080290 3081744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 3082579 3081752 gene locus_tag LOCUS_29310 3082579 3081752 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978407.1 protein_id gnl|my_center|LOCUS_29310 3083416 3082640 gene locus_tag LOCUS_29320 3083416 3082640 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066517.1 protein_id gnl|my_center|LOCUS_29320 3083879 3083478 gene locus_tag LOCUS_29330 3083879 3083478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 3085191 3083980 gene locus_tag LOCUS_29340 3085191 3083980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 3085417 3085815 gene locus_tag LOCUS_29350 3085417 3085815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3086627 3085830 gene locus_tag LOCUS_29360 3086627 3085830 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_29360 3087156 3086653 gene locus_tag LOCUS_29370 3087156 3086653 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486788.1 protein_id gnl|my_center|LOCUS_29370 3087191 3088237 gene locus_tag LOCUS_29380 3087191 3088237 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284397.1 protein_id gnl|my_center|LOCUS_29380 3091862 3088272 gene locus_tag LOCUS_29390 3091862 3088272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3092245 3091859 gene locus_tag LOCUS_29400 3092245 3091859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 3097765 3092360 gene locus_tag LOCUS_29410 3097765 3092360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3099132 3097900 gene locus_tag LOCUS_29420 3099132 3097900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 3102626 3099309 gene locus_tag LOCUS_29430 3102626 3099309 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284781.1 protein_id gnl|my_center|LOCUS_29430 3104136 3102619 gene locus_tag LOCUS_29440 3104136 3102619 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727778.1 protein_id gnl|my_center|LOCUS_29440 3104889 3104137 gene locus_tag LOCUS_29450 3104889 3104137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222725.1 protein_id gnl|my_center|LOCUS_29450 3105852 3107282 gene locus_tag LOCUS_29460 3105852 3107282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 3108268 3107348 gene locus_tag LOCUS_29470 3108268 3107348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 3108484 3109422 gene locus_tag LOCUS_29480 3108484 3109422 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 protein_id gnl|my_center|LOCUS_29480 3109489 3110391 gene locus_tag LOCUS_29490 3109489 3110391 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228840.1 protein_id gnl|my_center|LOCUS_29490 3112362 3110437 gene locus_tag LOCUS_29500 3112362 3110437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3113443 3112667 gene locus_tag LOCUS_29510 3113443 3112667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 3113917 3115158 gene locus_tag LOCUS_29520 3113917 3115158 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230812.1 protein_id gnl|my_center|LOCUS_29520 3115209 3117956 gene locus_tag LOCUS_29530 3115209 3117956 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831565.1 protein_id gnl|my_center|LOCUS_29530 3118614 3117949 gene locus_tag LOCUS_29540 3118614 3117949 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975463.1 protein_id gnl|my_center|LOCUS_29540 3118701 3119939 gene locus_tag LOCUS_29550 3118701 3119939 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230812.1 protein_id gnl|my_center|LOCUS_29550 3120026 3120193 gene locus_tag LOCUS_29560 3120026 3120193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 3123118 3120224 gene locus_tag LOCUS_29570 3123118 3120224 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_29570 3123406 3123128 gene locus_tag LOCUS_29580 3123406 3123128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3124245 3123418 gene locus_tag LOCUS_29590 3124245 3123418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 3124357 3125124 gene locus_tag LOCUS_29600 3124357 3125124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3125523 3125966 gene locus_tag LOCUS_29610 3125523 3125966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3125966 3128329 gene locus_tag LOCUS_29620 3125966 3128329 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091053832.1 protein_id gnl|my_center|LOCUS_29620 3128322 3129752 gene locus_tag LOCUS_29630 3128322 3129752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 3129745 3132834 gene locus_tag LOCUS_29640 3129745 3132834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3132844 3134562 gene locus_tag LOCUS_29650 3132844 3134562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3135226 3134630 gene locus_tag LOCUS_29660 3135226 3134630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3135440 3136441 gene locus_tag LOCUS_29670 3135440 3136441 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_29670 3136944 3136438 gene locus_tag LOCUS_29680 3136944 3136438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3137025 3138134 gene locus_tag LOCUS_29690 3137025 3138134 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729758.1 protein_id gnl|my_center|LOCUS_29690 3140142 3138814 gene locus_tag LOCUS_29700 3140142 3138814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_29700 3141069 3140158 gene locus_tag LOCUS_29710 3141069 3140158 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_29710 3141143 3142525 gene locus_tag LOCUS_29720 3141143 3142525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 3142544 3144670 gene locus_tag LOCUS_29730 gene uvrC 3142544 3144670 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_29730 3144706 3145608 gene locus_tag LOCUS_29740 gene rapZ 3144706 3145608 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466867.1 protein_id gnl|my_center|LOCUS_29740 3145605 3146531 gene locus_tag LOCUS_29750 gene yvcK 3145605 3146531 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224648.1 protein_id gnl|my_center|LOCUS_29750 3146542 3147516 gene locus_tag LOCUS_29760 gene whiA 3146542 3147516 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224649.1 protein_id gnl|my_center|LOCUS_29760 3147691 3148692 gene locus_tag LOCUS_29770 gene gap 3147691 3148692 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_29770 3148692 3149891 gene locus_tag LOCUS_29780 3148692 3149891 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_29780 3149888 3150670 gene locus_tag LOCUS_29790 gene tpiA 3149888 3150670 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_29790 3150866 3152587 gene locus_tag LOCUS_29800 3150866 3152587 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803733.1 protein_id gnl|my_center|LOCUS_29800 3152692 3152934 gene locus_tag LOCUS_29810 3152692 3152934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 3153144 3153488 gene locus_tag LOCUS_29820 3153144 3153488 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284344.1 protein_id gnl|my_center|LOCUS_29820 3153961 3153536 gene locus_tag LOCUS_29830 3153961 3153536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3155145 3153958 gene locus_tag LOCUS_29840 3155145 3153958 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230055.1 protein_id gnl|my_center|LOCUS_29840 3156818 3155214 gene locus_tag LOCUS_29850 3156818 3155214 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224962.1 protein_id gnl|my_center|LOCUS_29850 3156976 3157836 gene locus_tag LOCUS_29860 3156976 3157836 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228726.1 protein_id gnl|my_center|LOCUS_29860 3158258 3157950 gene locus_tag LOCUS_29870 3158258 3157950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 3158343 3159299 gene locus_tag LOCUS_29880 3158343 3159299 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228724.1 protein_id gnl|my_center|LOCUS_29880 3159283 3160110 gene locus_tag LOCUS_29890 3159283 3160110 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228724.1 protein_id gnl|my_center|LOCUS_29890 3160948 3160073 gene locus_tag LOCUS_29900 3160948 3160073 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_29900 3160973 3161527 gene locus_tag LOCUS_29910 3160973 3161527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 3162042 3161524 gene locus_tag LOCUS_29920 3162042 3161524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 3162004 3162618 gene locus_tag LOCUS_29930 3162004 3162618 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258976.1 protein_id gnl|my_center|LOCUS_29930 3162687 3164087 gene locus_tag LOCUS_29940 gene zwf 3162687 3164087 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974206.1 protein_id gnl|my_center|LOCUS_29940 3164084 3164992 gene locus_tag LOCUS_29950 3164084 3164992 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_29950 3165073 3165588 gene locus_tag LOCUS_29960 3165073 3165588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 3166801 3165524 gene locus_tag LOCUS_29970 3166801 3165524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3168879 3166798 gene locus_tag LOCUS_29980 3168879 3166798 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_29980 3168955 3169665 gene locus_tag LOCUS_29990 gene nagR 3168955 3169665 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_29990 3169693 3170388 gene locus_tag LOCUS_30000 gene deoC 3169693 3170388 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458726.1 protein_id gnl|my_center|LOCUS_30000 3171820 3170747 gene locus_tag LOCUS_30010 3171820 3170747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 3172071 3171817 gene locus_tag LOCUS_30020 3172071 3171817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 3173446 3172232 gene locus_tag LOCUS_30030 3173446 3172232 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226160.1 protein_id gnl|my_center|LOCUS_30030 3173558 3174277 gene locus_tag LOCUS_30040 3173558 3174277 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777055.1 protein_id gnl|my_center|LOCUS_30040 3175373 3174300 gene locus_tag LOCUS_30050 3175373 3174300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 3175734 3175384 gene locus_tag LOCUS_30060 3175734 3175384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 3176225 3175731 gene locus_tag LOCUS_30070 3176225 3175731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 3176354 3177556 gene locus_tag LOCUS_30080 3176354 3177556 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_30080 3177574 3178506 gene locus_tag LOCUS_30090 3177574 3178506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 3179156 3178503 gene locus_tag LOCUS_30100 3179156 3178503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3180437 3179217 gene locus_tag LOCUS_30110 3180437 3179217 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_30110 3180904 3180446 gene locus_tag LOCUS_30120 3180904 3180446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3181015 3181593 gene locus_tag LOCUS_30130 3181015 3181593 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230938.1 protein_id gnl|my_center|LOCUS_30130 3182459 3181602 gene locus_tag LOCUS_30140 3182459 3181602 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_30140 3183811 3182474 gene locus_tag LOCUS_30150 3183811 3182474 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_30150 3183889 3185193 gene locus_tag LOCUS_30160 3183889 3185193 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_30160 3185795 3185301 gene locus_tag LOCUS_30170 3185795 3185301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3186001 3186615 gene locus_tag LOCUS_30180 3186001 3186615 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_30180 3186615 3187934 gene locus_tag LOCUS_30190 3186615 3187934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3188778 3187945 gene locus_tag LOCUS_30200 3188778 3187945 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804039.1 protein_id gnl|my_center|LOCUS_30200 3188925 3189539 gene locus_tag LOCUS_30210 3188925 3189539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 3189602 3190222 gene locus_tag LOCUS_30220 3189602 3190222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3190307 3191569 gene locus_tag LOCUS_30230 3190307 3191569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 3191731 3192276 gene locus_tag LOCUS_30240 3191731 3192276 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_30240 3192417 3192974 gene locus_tag LOCUS_30250 3192417 3192974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 3192984 3193967 gene locus_tag LOCUS_30260 3192984 3193967 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976631.1 protein_id gnl|my_center|LOCUS_30260 3194963 3194046 gene locus_tag LOCUS_30270 3194963 3194046 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_30270 3196337 3195021 gene locus_tag LOCUS_30280 3196337 3195021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 3198220 3196337 gene locus_tag LOCUS_30290 3198220 3196337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3201379 3198635 gene locus_tag LOCUS_30300 gene acnA 3201379 3198635 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_30300 3201523 3201957 gene locus_tag LOCUS_30310 3201523 3201957 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975682.1 protein_id gnl|my_center|LOCUS_30310 3201976 3202935 gene locus_tag LOCUS_30320 3201976 3202935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 3203025 3203834 gene locus_tag LOCUS_30330 3203025 3203834 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530513.1 protein_id gnl|my_center|LOCUS_30330 3203918 3204580 gene locus_tag LOCUS_30340 3203918 3204580 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_30340 3204655 3205137 gene locus_tag LOCUS_30350 3204655 3205137 CDS product DUF1453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030478.1 protein_id gnl|my_center|LOCUS_30350 3205134 3206264 gene locus_tag LOCUS_30360 3205134 3206264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3206261 3206935 gene locus_tag LOCUS_30370 3206261 3206935 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224283.1 protein_id gnl|my_center|LOCUS_30370 3207148 3208473 gene locus_tag LOCUS_30380 3207148 3208473 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974451.1 protein_id gnl|my_center|LOCUS_30380 3209522 3208539 gene locus_tag LOCUS_30390 3209522 3208539 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037062758.1 protein_id gnl|my_center|LOCUS_30390 3209618 3209998 gene locus_tag LOCUS_30400 3209618 3209998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 3211162 3210053 gene locus_tag LOCUS_30410 3211162 3210053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 3212229 3211249 gene locus_tag LOCUS_30420 3212229 3211249 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_30420 3213324 3212350 gene locus_tag LOCUS_30430 3213324 3212350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 3213830 3213321 gene locus_tag LOCUS_30440 3213830 3213321 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_30440 3215562 3214051 gene locus_tag LOCUS_30450 3215562 3214051 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_30450 3215695 3217635 gene locus_tag LOCUS_30460 gene asnB 3215695 3217635 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224072.1 protein_id gnl|my_center|LOCUS_30460 3218045 3217641 gene locus_tag LOCUS_30470 3218045 3217641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 3218134 3218592 gene locus_tag LOCUS_30480 3218134 3218592 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407340.1 protein_id gnl|my_center|LOCUS_30480 3218633 3218857 gene locus_tag LOCUS_30490 3218633 3218857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 3218854 3219402 gene locus_tag LOCUS_30500 gene infC 3218854 3219402 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901217.1 protein_id gnl|my_center|LOCUS_30500 3219440 3219634 gene locus_tag LOCUS_30510 gene rpmI 3219440 3219634 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_30510 3219697 3220062 gene locus_tag LOCUS_30520 gene rplT 3219697 3220062 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895237.1 protein_id gnl|my_center|LOCUS_30520 3220170 3220880 gene locus_tag LOCUS_30530 3220170 3220880 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_30530 3221053 3222132 gene locus_tag LOCUS_30540 gene pheS 3221053 3222132 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_30540 3222136 3224619 gene locus_tag LOCUS_30550 gene pheT 3222136 3224619 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_30550 3224943 3225818 gene locus_tag LOCUS_30560 3224943 3225818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 3228965 3225960 gene locus_tag LOCUS_30570 3228965 3225960 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228238.1 protein_id gnl|my_center|LOCUS_30570 3229532 3229062 gene locus_tag LOCUS_30580 3229532 3229062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 3230673 3229771 gene locus_tag LOCUS_30590 3230673 3229771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3230930 3230709 gene locus_tag LOCUS_30600 3230930 3230709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 3230823 3231839 gene locus_tag LOCUS_30610 gene argC 3230823 3231839 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_30610 3231836 3232984 gene locus_tag LOCUS_30620 gene argJ 3231836 3232984 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_30620 3232981 3233874 gene locus_tag LOCUS_30630 gene argB 3232981 3233874 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_30630 3233871 3235076 gene locus_tag LOCUS_30640 3233871 3235076 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408163.1 protein_id gnl|my_center|LOCUS_30640 3235073 3236032 gene locus_tag LOCUS_30650 gene argF 3235073 3236032 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729314.1 protein_id gnl|my_center|LOCUS_30650 3236029 3236589 gene locus_tag LOCUS_30660 3236029 3236589 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895215.1 protein_id gnl|my_center|LOCUS_30660 3236586 3237794 gene locus_tag LOCUS_30670 3236586 3237794 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_30670 3237791 3239203 gene locus_tag LOCUS_30680 gene argH 3237791 3239203 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_30680 3239264 3240007 gene locus_tag LOCUS_30690 3239264 3240007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 3239935 3240141 gene locus_tag LOCUS_30700 3239935 3240141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 3240226 3241056 gene locus_tag LOCUS_30710 3240226 3241056 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 protein_id gnl|my_center|LOCUS_30710 3242293 3241127 gene locus_tag LOCUS_30720 3242293 3241127 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776226.1 protein_id gnl|my_center|LOCUS_30720 3242398 3244173 gene locus_tag LOCUS_30730 3242398 3244173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 3244689 3244183 gene locus_tag LOCUS_30740 3244689 3244183 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218060570.1 protein_id gnl|my_center|LOCUS_30740 3244960 3246537 gene locus_tag LOCUS_30750 3244960 3246537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3247679 3246552 gene locus_tag LOCUS_30760 3247679 3246552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 3248516 3247983 gene locus_tag LOCUS_30770 3248516 3247983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3248638 3249300 gene locus_tag LOCUS_30780 3248638 3249300 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742102.1 protein_id gnl|my_center|LOCUS_30780 3249582 3251036 gene locus_tag LOCUS_30790 gene ahcY 3249582 3251036 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227086.1 protein_id gnl|my_center|LOCUS_30790 3252381 3251113 gene locus_tag LOCUS_30800 3252381 3251113 CDS product M64 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031040.1 protein_id gnl|my_center|LOCUS_30800 3252875 3252552 gene locus_tag LOCUS_30810 3252875 3252552 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977977.1 protein_id gnl|my_center|LOCUS_30810 3253872 3252919 gene locus_tag LOCUS_30820 3253872 3252919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3255150 3253948 gene locus_tag LOCUS_30830 3255150 3253948 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728974.1 protein_id gnl|my_center|LOCUS_30830 3255203 3256450 gene locus_tag LOCUS_30840 3255203 3256450 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227636.1 protein_id gnl|my_center|LOCUS_30840 3257425 3256481 gene locus_tag LOCUS_30850 3257425 3256481 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_30850 3257770 3257492 gene locus_tag LOCUS_30860 3257770 3257492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 3258684 3257848 gene locus_tag LOCUS_30870 3258684 3257848 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532873.1 protein_id gnl|my_center|LOCUS_30870 3259330 3258803 gene locus_tag LOCUS_30880 3259330 3258803 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191763.1 protein_id gnl|my_center|LOCUS_30880 3259848 3259363 gene locus_tag LOCUS_30890 3259848 3259363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30890 3259964 3262660 gene locus_tag LOCUS_30900 3259964 3262660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3264164 3262761 gene locus_tag LOCUS_30910 3264164 3262761 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226936.1 protein_id gnl|my_center|LOCUS_30910 3264475 3264161 gene locus_tag LOCUS_30920 3264475 3264161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 3264585 3265721 gene locus_tag LOCUS_30930 3264585 3265721 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973189.1 protein_id gnl|my_center|LOCUS_30930 3265806 3267347 gene locus_tag LOCUS_30940 gene hutH 3265806 3267347 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889407.1 protein_id gnl|my_center|LOCUS_30940 3267450 3267944 gene locus_tag LOCUS_30950 3267450 3267944 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730338.1 protein_id gnl|my_center|LOCUS_30950 3267997 3269733 gene locus_tag LOCUS_30960 3267997 3269733 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878257.1 protein_id gnl|my_center|LOCUS_30960 3270404 3269736 gene locus_tag LOCUS_30970 3270404 3269736 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286123.1 protein_id gnl|my_center|LOCUS_30970 3271072 3270575 gene locus_tag LOCUS_30980 3271072 3270575 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 protein_id gnl|my_center|LOCUS_30980 3271247 3271678 gene locus_tag LOCUS_30990 3271247 3271678 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728698.1 protein_id gnl|my_center|LOCUS_30990 3271812 3272600 gene locus_tag LOCUS_31000 3271812 3272600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 3273027 3272644 gene locus_tag LOCUS_31010 3273027 3272644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 3273317 3274282 gene locus_tag LOCUS_31020 3273317 3274282 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258645.1 protein_id gnl|my_center|LOCUS_31020 3274286 3274897 gene locus_tag LOCUS_31030 3274286 3274897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 3274894 3276456 gene locus_tag LOCUS_31040 3274894 3276456 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258643.1 protein_id gnl|my_center|LOCUS_31040 3276539 3277366 gene locus_tag LOCUS_31050 3276539 3277366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 3278125 3277319 gene locus_tag LOCUS_31060 3278125 3277319 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964645.1 protein_id gnl|my_center|LOCUS_31060 3278264 3279178 gene locus_tag LOCUS_31070 3278264 3279178 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224285.1 protein_id gnl|my_center|LOCUS_31070 3279524 3280732 gene locus_tag LOCUS_31080 3279524 3280732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3280729 3281595 gene locus_tag LOCUS_31090 3280729 3281595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3281592 3282698 gene locus_tag LOCUS_31100 3281592 3282698 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028280.1 protein_id gnl|my_center|LOCUS_31100 3282695 3284317 gene locus_tag LOCUS_31110 3282695 3284317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_31110 3284314 3285138 gene locus_tag LOCUS_31120 3284314 3285138 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013711.1 protein_id gnl|my_center|LOCUS_31120 3287006 3285135 gene locus_tag LOCUS_31130 gene typA 3287006 3285135 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_31130 3287254 3289704 gene locus_tag LOCUS_31140 3287254 3289704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 3290685 3289708 gene locus_tag LOCUS_31150 gene axeA 3290685 3289708 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_31150 3290805 3291500 gene locus_tag LOCUS_31160 3290805 3291500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 3292763 3291774 gene locus_tag LOCUS_31170 3292763 3291774 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_31170 3292813 3293742 gene locus_tag LOCUS_31180 3292813 3293742 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_31180 3293868 3295019 gene locus_tag LOCUS_31190 3293868 3295019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 3295458 3295051 gene locus_tag LOCUS_31200 3295458 3295051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3295555 3296892 gene locus_tag LOCUS_31210 3295555 3296892 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975124.1 protein_id gnl|my_center|LOCUS_31210 3296889 3297806 gene locus_tag LOCUS_31220 3296889 3297806 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066537.1 protein_id gnl|my_center|LOCUS_31220 3297796 3298620 gene locus_tag LOCUS_31230 3297796 3298620 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975126.1 protein_id gnl|my_center|LOCUS_31230 3298631 3299716 gene locus_tag LOCUS_31240 3298631 3299716 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975127.1 protein_id gnl|my_center|LOCUS_31240 3301255 3299759 gene locus_tag LOCUS_31250 3301255 3299759 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 protein_id gnl|my_center|LOCUS_31250 3302670 3301258 gene locus_tag LOCUS_31260 3302670 3301258 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083033.1 protein_id gnl|my_center|LOCUS_31260 3302806 3303801 gene locus_tag LOCUS_31270 3302806 3303801 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227893.1 protein_id gnl|my_center|LOCUS_31270 3304683 3303856 gene locus_tag LOCUS_31280 3304683 3303856 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731543.1 protein_id gnl|my_center|LOCUS_31280 3305687 3304680 gene locus_tag LOCUS_31290 3305687 3304680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731544.1 protein_id gnl|my_center|LOCUS_31290 3306734 3305727 gene locus_tag LOCUS_31300 3306734 3305727 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731545.1 protein_id gnl|my_center|LOCUS_31300 3306881 3307885 gene locus_tag LOCUS_31310 3306881 3307885 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 protein_id gnl|my_center|LOCUS_31310 3307961 3308458 gene locus_tag LOCUS_31320 3307961 3308458 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226758.1 protein_id gnl|my_center|LOCUS_31320 3308571 3309248 gene locus_tag LOCUS_31330 3308571 3309248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3309942 3309292 gene locus_tag LOCUS_31340 3309942 3309292 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227876.1 protein_id gnl|my_center|LOCUS_31340 3310197 3311288 gene locus_tag LOCUS_31350 gene rsgA 3310197 3311288 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_31350 3311310 3312617 gene locus_tag LOCUS_31360 3311310 3312617 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089082.1 protein_id gnl|my_center|LOCUS_31360 3312726 3315611 gene locus_tag LOCUS_31370 gene uvrA 3312726 3315611 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 protein_id gnl|my_center|LOCUS_31370 3315647 3317197 gene locus_tag LOCUS_31380 3315647 3317197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028698.1 protein_id gnl|my_center|LOCUS_31380 3317220 3317813 gene locus_tag LOCUS_31390 3317220 3317813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3318304 3317903 gene locus_tag LOCUS_31400 3318304 3317903 CDS product protease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978099.1 protein_id gnl|my_center|LOCUS_31400 3318685 3319863 gene locus_tag LOCUS_31410 gene aroC 3318685 3319863 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_31410 3319860 3321419 gene locus_tag LOCUS_31420 3319860 3321419 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_31420 3321416 3321853 gene locus_tag LOCUS_31430 gene aroQ 3321416 3321853 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529884.1 protein_id gnl|my_center|LOCUS_31430 3323102 3321867 gene locus_tag LOCUS_31440 3323102 3321867 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_31440 3323317 3323874 gene locus_tag LOCUS_31450 gene efp 3323317 3323874 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_31450 3323877 3324320 gene locus_tag LOCUS_31460 3323877 3324320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 3324329 3324721 gene locus_tag LOCUS_31470 3324329 3324721 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230839.1 protein_id gnl|my_center|LOCUS_31470 3325337 3324831 gene locus_tag LOCUS_31480 3325337 3324831 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096372.1 protein_id gnl|my_center|LOCUS_31480 3325607 3326167 gene locus_tag LOCUS_31490 gene pyrR 3325607 3326167 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862208.1 protein_id gnl|my_center|LOCUS_31490 3326164 3327093 gene locus_tag LOCUS_31500 3326164 3327093 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_31500 3327210 3328388 gene locus_tag LOCUS_31510 3327210 3328388 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_31510 3328385 3329623 gene locus_tag LOCUS_31520 gene carA 3328385 3329623 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_31520 3329616 3332933 gene locus_tag LOCUS_31530 gene carB 3329616 3332933 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224620.1 protein_id gnl|my_center|LOCUS_31530 3332936 3334021 gene locus_tag LOCUS_31540 3332936 3334021 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 protein_id gnl|my_center|LOCUS_31540 3334077 3334925 gene locus_tag LOCUS_31550 gene pyrF 3334077 3334925 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_31550 3335107 3335430 gene locus_tag LOCUS_31560 gene mihF 3335107 3335430 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 protein_id gnl|my_center|LOCUS_31560 3335451 3336080 gene locus_tag LOCUS_31570 gene gmk 3335451 3336080 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_31570 3336119 3336439 gene locus_tag LOCUS_31580 3336119 3336439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 3336452 3337672 gene locus_tag LOCUS_31590 gene coaBC 3336452 3337672 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_31590 3337818 3339008 gene locus_tag LOCUS_31600 3337818 3339008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 3339118 3340308 gene locus_tag LOCUS_31610 gene metK 3339118 3340308 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_31610 3340911 3340360 gene locus_tag LOCUS_31620 3340911 3340360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3341113 3341910 gene locus_tag LOCUS_31630 3341113 3341910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 3341966 3342592 gene locus_tag LOCUS_31640 3341966 3342592 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222835.1 protein_id gnl|my_center|LOCUS_31640 3342684 3342839 gene locus_tag LOCUS_31650 3342684 3342839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 3343455 3342826 gene locus_tag LOCUS_31660 3343455 3342826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 3343663 3346422 gene locus_tag LOCUS_31670 3343663 3346422 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226708.1 protein_id gnl|my_center|LOCUS_31670 3347168 3346437 gene locus_tag LOCUS_31680 3347168 3346437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 3349732 3347174 gene locus_tag LOCUS_31690 3349732 3347174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 3350197 3349742 gene locus_tag LOCUS_31700 gene mdtR 3350197 3349742 CDS product MarR family transcriptional regulator MdtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242592.1 protein_id gnl|my_center|LOCUS_31700 3350326 3353550 gene locus_tag LOCUS_31710 3350326 3353550 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976652.1 protein_id gnl|my_center|LOCUS_31710 3354543 3353770 gene locus_tag LOCUS_31720 3354543 3353770 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263481.1 protein_id gnl|my_center|LOCUS_31720 3354752 3354964 gene locus_tag LOCUS_31730 3354752 3354964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 3355872 3354961 gene locus_tag LOCUS_31740 3355872 3354961 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_31740 3355962 3357113 gene locus_tag LOCUS_31750 3355962 3357113 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 protein_id gnl|my_center|LOCUS_31750 3357589 3357110 gene locus_tag LOCUS_31760 3357589 3357110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 3357656 3358126 gene locus_tag LOCUS_31770 3357656 3358126 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092399.1 protein_id gnl|my_center|LOCUS_31770 3358765 3358172 gene locus_tag LOCUS_31780 3358765 3358172 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967875.1 protein_id gnl|my_center|LOCUS_31780 3360270 3358762 gene locus_tag LOCUS_31790 3360270 3358762 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_31790 3360924 3360298 gene locus_tag LOCUS_31800 3360924 3360298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 3361265 3362380 gene locus_tag LOCUS_31810 3361265 3362380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3364212 3362671 gene locus_tag LOCUS_31820 3364212 3362671 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_31820 3364926 3364228 gene locus_tag LOCUS_31830 3364926 3364228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 3364978 3365571 gene locus_tag LOCUS_31840 3364978 3365571 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 protein_id gnl|my_center|LOCUS_31840 3365651 3366250 gene locus_tag LOCUS_31850 3365651 3366250 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283908.1 protein_id gnl|my_center|LOCUS_31850 3367079 3366318 gene locus_tag LOCUS_31860 3367079 3366318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 3368502 3367138 gene locus_tag LOCUS_31870 3368502 3367138 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_31870 3368558 3369358 gene locus_tag LOCUS_31880 3368558 3369358 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972533.1 protein_id gnl|my_center|LOCUS_31880 3370246 3369299 gene locus_tag LOCUS_31890 3370246 3369299 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 protein_id gnl|my_center|LOCUS_31890 3370412 3370903 gene locus_tag LOCUS_31900 3370412 3370903 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_31900 3371394 3370900 gene locus_tag LOCUS_31910 3371394 3370900 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_31910 3372037 3371396 gene locus_tag LOCUS_31920 3372037 3371396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 3372255 3372431 gene locus_tag LOCUS_31930 3372255 3372431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 3373424 3372954 gene locus_tag LOCUS_31940 3373424 3372954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 3374602 3373763 gene locus_tag LOCUS_31950 3374602 3373763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 3375427 3374639 gene locus_tag LOCUS_31960 3375427 3374639 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776917.1 protein_id gnl|my_center|LOCUS_31960 3375600 3377402 gene locus_tag LOCUS_31970 3375600 3377402 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030408.1 protein_id gnl|my_center|LOCUS_31970 3377399 3378385 gene locus_tag LOCUS_31980 3377399 3378385 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_31980 3378403 3379245 gene locus_tag LOCUS_31990 3378403 3379245 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226494.1 protein_id gnl|my_center|LOCUS_31990 3379249 3380208 gene locus_tag LOCUS_32000 3379249 3380208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030406.1 protein_id gnl|my_center|LOCUS_32000 3380205 3381170 gene locus_tag LOCUS_32010 3380205 3381170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030405.1 protein_id gnl|my_center|LOCUS_32010 3381461 3381757 gene locus_tag LOCUS_32020 3381461 3381757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 3382766 3381792 gene locus_tag LOCUS_32030 3382766 3381792 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974569.1 protein_id gnl|my_center|LOCUS_32030 3382838 3384115 gene locus_tag LOCUS_32040 3382838 3384115 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029637.1 protein_id gnl|my_center|LOCUS_32040 3384176 3384838 gene locus_tag LOCUS_32050 3384176 3384838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 3384876 3385430 gene locus_tag LOCUS_32060 3384876 3385430 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_32060 3385802 3385431 gene locus_tag LOCUS_32070 3385802 3385431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 3386358 3385858 gene locus_tag LOCUS_32080 3386358 3385858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 3386407 3386790 gene locus_tag LOCUS_32090 3386407 3386790 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227883.1 protein_id gnl|my_center|LOCUS_32090 3387272 3386769 gene locus_tag LOCUS_32100 3387272 3386769 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708322.1 protein_id gnl|my_center|LOCUS_32100 3387375 3388292 gene locus_tag LOCUS_32110 3387375 3388292 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804410.1 protein_id gnl|my_center|LOCUS_32110 3389132 3388350 gene locus_tag LOCUS_32120 3389132 3388350 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 protein_id gnl|my_center|LOCUS_32120 3391664 3389292 gene locus_tag LOCUS_32130 3391664 3389292 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726746.1 protein_id gnl|my_center|LOCUS_32130 3393019 3391721 gene locus_tag LOCUS_32140 3393019 3391721 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606476.1 protein_id gnl|my_center|LOCUS_32140 3393695 3393081 gene locus_tag LOCUS_32150 3393695 3393081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975214.1 protein_id gnl|my_center|LOCUS_32150 3394176 3393742 gene locus_tag LOCUS_32160 3394176 3393742 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 protein_id gnl|my_center|LOCUS_32160 3394236 3397031 gene locus_tag LOCUS_32170 3394236 3397031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 3397194 3398660 gene locus_tag LOCUS_32180 3397194 3398660 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031786.1 protein_id gnl|my_center|LOCUS_32180 3399118 3398705 gene locus_tag LOCUS_32190 3399118 3398705 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 protein_id gnl|my_center|LOCUS_32190 3399729 3399187 gene locus_tag LOCUS_32200 3399729 3399187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 3401100 3399970 gene locus_tag LOCUS_32210 3401100 3399970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 3401194 3402237 gene locus_tag LOCUS_32220 3401194 3402237 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 protein_id gnl|my_center|LOCUS_32220 3402996 3402244 gene locus_tag LOCUS_32230 3402996 3402244 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_32230 3402911 3403807 gene locus_tag LOCUS_32240 3402911 3403807 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109967.1 protein_id gnl|my_center|LOCUS_32240 3403848 3405179 gene locus_tag LOCUS_32250 3403848 3405179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 3405173 3405970 gene locus_tag LOCUS_32260 3405173 3405970 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_32260 3406000 3408075 gene locus_tag LOCUS_32270 3406000 3408075 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_32270 3408423 3408091 gene locus_tag LOCUS_32280 3408423 3408091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3408557 3408826 gene locus_tag LOCUS_32290 3408557 3408826 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401272.1 protein_id gnl|my_center|LOCUS_32290 3409909 3408962 gene locus_tag LOCUS_32300 3409909 3408962 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030296.1 protein_id gnl|my_center|LOCUS_32300 3410008 3410583 gene locus_tag LOCUS_32310 3410008 3410583 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973464.1 protein_id gnl|my_center|LOCUS_32310 3410828 3410571 gene locus_tag LOCUS_32320 3410828 3410571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 3410920 3411810 gene locus_tag LOCUS_32330 3410920 3411810 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225421.1 protein_id gnl|my_center|LOCUS_32330 3412457 3411819 gene locus_tag LOCUS_32340 3412457 3411819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 3412906 3412454 gene locus_tag LOCUS_32350 3412906 3412454 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975070.1 protein_id gnl|my_center|LOCUS_32350 3413113 3413967 gene locus_tag LOCUS_32360 3413113 3413967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3414999 3413872 gene locus_tag LOCUS_32370 3414999 3413872 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228351.1 protein_id gnl|my_center|LOCUS_32370 3417379 3414983 gene locus_tag LOCUS_32380 3417379 3414983 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227297.1 protein_id gnl|my_center|LOCUS_32380 3417691 3418221 gene locus_tag LOCUS_32390 3417691 3418221 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_32390 3418206 3419300 gene locus_tag LOCUS_32400 3418206 3419300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3419340 3420404 gene locus_tag LOCUS_32410 3419340 3420404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 3421183 3420401 gene locus_tag LOCUS_32420 3421183 3420401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3421377 3421781 gene locus_tag LOCUS_32430 3421377 3421781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 3422944 3421778 gene locus_tag LOCUS_32440 3422944 3421778 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230592.1 protein_id gnl|my_center|LOCUS_32440 3423053 3423895 gene locus_tag LOCUS_32450 3423053 3423895 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040767.1 protein_id gnl|my_center|LOCUS_32450 3425157 3423991 gene locus_tag LOCUS_32460 3425157 3423991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 3425570 3425166 gene locus_tag LOCUS_32470 3425570 3425166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 3425703 3426371 gene locus_tag LOCUS_32480 3425703 3426371 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026982.1 protein_id gnl|my_center|LOCUS_32480 3428697 3426388 gene locus_tag LOCUS_32490 3428697 3426388 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803817.1 protein_id gnl|my_center|LOCUS_32490 3429547 3428717 gene locus_tag LOCUS_32500 3429547 3428717 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803810.1 protein_id gnl|my_center|LOCUS_32500 3430428 3429544 gene locus_tag LOCUS_32510 3430428 3429544 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803811.1 protein_id gnl|my_center|LOCUS_32510 3431711 3430425 gene locus_tag LOCUS_32520 3431711 3430425 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803812.1 protein_id gnl|my_center|LOCUS_32520 3431899 3432954 gene locus_tag LOCUS_32530 3431899 3432954 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896541.1 protein_id gnl|my_center|LOCUS_32530 3432951 3434345 gene locus_tag LOCUS_32540 gene xylB 3432951 3434345 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222654.1 protein_id gnl|my_center|LOCUS_32540 3434361 3435533 gene locus_tag LOCUS_32550 gene xylA 3434361 3435533 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_32550 3435632 3436849 gene locus_tag LOCUS_32560 3435632 3436849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3437742 3436846 gene locus_tag LOCUS_32570 3437742 3436846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 3438217 3439716 gene locus_tag LOCUS_32580 3438217 3439716 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_32580 3439877 3442627 gene locus_tag LOCUS_32590 3439877 3442627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3442674 3443312 gene locus_tag LOCUS_32600 3442674 3443312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 3443332 3444141 gene locus_tag LOCUS_32610 3443332 3444141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085782.1 protein_id gnl|my_center|LOCUS_32610 3444181 3446538 gene locus_tag LOCUS_32620 gene atsD 3444181 3446538 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_32620 3446699 3448147 gene locus_tag LOCUS_32630 3446699 3448147 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392249.1 protein_id gnl|my_center|LOCUS_32630 3448144 3449508 gene locus_tag LOCUS_32640 3448144 3449508 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845879.1 protein_id gnl|my_center|LOCUS_32640 3449505 3450548 gene locus_tag LOCUS_32650 gene pdxA 3449505 3450548 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224213.1 protein_id gnl|my_center|LOCUS_32650 3450561 3451394 gene locus_tag LOCUS_32660 3450561 3451394 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_32660 3451847 3451404 gene locus_tag LOCUS_32670 3451847 3451404 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727872.1 protein_id gnl|my_center|LOCUS_32670 3453856 3451931 gene locus_tag LOCUS_32680 3453856 3451931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 3455622 3453877 gene locus_tag LOCUS_32690 3455622 3453877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390092.1 protein_id gnl|my_center|LOCUS_32690 3457385 3455619 gene locus_tag LOCUS_32700 3457385 3455619 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485997.1 protein_id gnl|my_center|LOCUS_32700 3457506 3458183 gene locus_tag LOCUS_32710 3457506 3458183 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228712.1 protein_id gnl|my_center|LOCUS_32710 3458214 3458597 gene locus_tag LOCUS_32720 3458214 3458597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 3460042 3458633 gene locus_tag LOCUS_32730 3460042 3458633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_32730 3460220 3460029 gene locus_tag LOCUS_32740 3460220 3460029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 3461583 3460204 gene locus_tag LOCUS_32750 3461583 3460204 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_32750 3461749 3462438 gene locus_tag LOCUS_32760 3461749 3462438 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_32760 3462536 3463399 gene locus_tag LOCUS_32770 3462536 3463399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229446.1 protein_id gnl|my_center|LOCUS_32770 3463440 3465200 gene locus_tag LOCUS_32780 gene argS 3463440 3465200 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028896.1 protein_id gnl|my_center|LOCUS_32780 3465923 3465210 gene locus_tag LOCUS_32790 3465923 3465210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 3466795 3465944 gene locus_tag LOCUS_32800 3466795 3465944 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166174969.1 protein_id gnl|my_center|LOCUS_32800 3468242 3466806 gene locus_tag LOCUS_32810 3468242 3466806 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_32810 3471726 3468235 gene locus_tag LOCUS_32820 3471726 3468235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 3472997 3471723 gene locus_tag LOCUS_32830 3472997 3471723 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727047.1 protein_id gnl|my_center|LOCUS_32830 3473244 3474308 gene locus_tag LOCUS_32840 3473244 3474308 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229172.1 protein_id gnl|my_center|LOCUS_32840 3475276 3474317 gene locus_tag LOCUS_32850 3475276 3474317 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031422.1 protein_id gnl|my_center|LOCUS_32850 3475387 3475773 gene locus_tag LOCUS_32860 3475387 3475773 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224170.1 protein_id gnl|my_center|LOCUS_32860 3476172 3475819 gene locus_tag LOCUS_32870 3476172 3475819 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_32870 3476974 3476273 gene locus_tag LOCUS_32880 3476974 3476273 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222882.1 protein_id gnl|my_center|LOCUS_32880 3478098 3476971 gene locus_tag LOCUS_32890 3478098 3476971 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222881.1 protein_id gnl|my_center|LOCUS_32890 3478316 3478678 gene locus_tag LOCUS_32900 3478316 3478678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 3479111 3478680 gene locus_tag LOCUS_32910 3479111 3478680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 3479719 3479156 gene locus_tag LOCUS_32920 3479719 3479156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 3479818 3480459 gene locus_tag LOCUS_32930 3479818 3480459 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196240169.1 protein_id gnl|my_center|LOCUS_32930 3480498 3481679 gene locus_tag LOCUS_32940 3480498 3481679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086849900.1 protein_id gnl|my_center|LOCUS_32940 3482323 3481628 gene locus_tag LOCUS_32950 3482323 3481628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 3483459 3482320 gene locus_tag LOCUS_32960 3483459 3482320 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224782.1 protein_id gnl|my_center|LOCUS_32960 3483560 3484162 gene locus_tag LOCUS_32970 3483560 3484162 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728205.1 protein_id gnl|my_center|LOCUS_32970 3485348 3484167 gene locus_tag LOCUS_32980 3485348 3484167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 3486539 3485352 gene locus_tag LOCUS_32990 3486539 3485352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 3486704 3487747 gene locus_tag LOCUS_33000 gene moaA 3486704 3487747 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900633.1 protein_id gnl|my_center|LOCUS_33000 3487777 3488277 gene locus_tag LOCUS_33010 gene moaC 3487777 3488277 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899917.1 protein_id gnl|my_center|LOCUS_33010 3488302 3488985 gene locus_tag LOCUS_33020 gene moaD 3488302 3488985 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417290.1 protein_id gnl|my_center|LOCUS_33020 3489666 3488989 gene locus_tag LOCUS_33030 3489666 3488989 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222730.1 protein_id gnl|my_center|LOCUS_33030 3489740 3490306 gene locus_tag LOCUS_33040 3489740 3490306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3491438 3490275 gene locus_tag LOCUS_33050 3491438 3490275 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_33050 3492181 3491435 gene locus_tag LOCUS_33060 3492181 3491435 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224232.1 protein_id gnl|my_center|LOCUS_33060 3492702 3492163 gene locus_tag LOCUS_33070 3492702 3492163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 3492596 3493738 gene locus_tag LOCUS_33080 3492596 3493738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 3496052 3493845 gene locus_tag LOCUS_33090 3496052 3493845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 3496111 3497313 gene locus_tag LOCUS_33100 3496111 3497313 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728974.1 protein_id gnl|my_center|LOCUS_33100 3497310 3498566 gene locus_tag LOCUS_33110 3497310 3498566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 3499686 3498538 gene locus_tag LOCUS_33120 3499686 3498538 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229381.1 protein_id gnl|my_center|LOCUS_33120 3499840 3500718 gene locus_tag LOCUS_33130 gene sigJ 3499840 3500718 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_33130 3500730 3501755 gene locus_tag LOCUS_33140 3500730 3501755 CDS product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203909262.1 protein_id gnl|my_center|LOCUS_33140 3501821 3502624 gene locus_tag LOCUS_33150 3501821 3502624 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225473.1 protein_id gnl|my_center|LOCUS_33150 3502684 3503484 gene locus_tag LOCUS_33160 3502684 3503484 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_33160 3505492 3504302 gene locus_tag LOCUS_33170 gene rocD 3505492 3504302 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224552.1 protein_id gnl|my_center|LOCUS_33170 3506065 3505574 gene locus_tag LOCUS_33180 3506065 3505574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 3507045 3506062 gene locus_tag LOCUS_33190 3507045 3506062 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_33190 3507129 3508541 gene locus_tag LOCUS_33200 3507129 3508541 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104558.1 protein_id gnl|my_center|LOCUS_33200 3508613 3509395 gene locus_tag LOCUS_33210 3508613 3509395 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031754.1 protein_id gnl|my_center|LOCUS_33210 3509392 3510510 gene locus_tag LOCUS_33220 3509392 3510510 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731603.1 protein_id gnl|my_center|LOCUS_33220 3514058 3510789 gene locus_tag LOCUS_33230 3514058 3510789 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230069.1 protein_id gnl|my_center|LOCUS_33230 3515272 3514157 gene locus_tag LOCUS_33240 3515272 3514157 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742171.1 protein_id gnl|my_center|LOCUS_33240 3515928 3515269 gene locus_tag LOCUS_33250 3515928 3515269 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229632.1 protein_id gnl|my_center|LOCUS_33250 3516133 3517278 gene locus_tag LOCUS_33260 3516133 3517278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 3518323 3517283 gene locus_tag LOCUS_33270 3518323 3517283 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755440.1 protein_id gnl|my_center|LOCUS_33270 3520336 3518387 gene locus_tag LOCUS_33280 3520336 3518387 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227921.1 protein_id gnl|my_center|LOCUS_33280 3523047 3520336 gene locus_tag LOCUS_33290 3523047 3520336 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805171.1 protein_id gnl|my_center|LOCUS_33290 3523187 3523840 gene locus_tag LOCUS_33300 3523187 3523840 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227176.1 protein_id gnl|my_center|LOCUS_33300 3523909 3524925 gene locus_tag LOCUS_33310 3523909 3524925 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027128.1 protein_id gnl|my_center|LOCUS_33310 3525033 3525881 gene locus_tag LOCUS_33320 3525033 3525881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3525878 3528955 gene locus_tag LOCUS_33330 3525878 3528955 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_33330 3530415 3529150 gene locus_tag LOCUS_33340 3530415 3529150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 3531902 3530451 gene locus_tag LOCUS_33350 3531902 3530451 CDS product polysaccharide lyase 6 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029032.1 protein_id gnl|my_center|LOCUS_33350 3533253 3531916 gene locus_tag LOCUS_33360 3533253 3531916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 3534042 3533266 gene locus_tag LOCUS_33370 3534042 3533266 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029033.1 protein_id gnl|my_center|LOCUS_33370 3534209 3536398 gene locus_tag LOCUS_33380 3534209 3536398 CDS product PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030421.1 protein_id gnl|my_center|LOCUS_33380 3539226 3536416 gene locus_tag LOCUS_33390 3539226 3536416 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886092.1 protein_id gnl|my_center|LOCUS_33390 3539213 3540559 gene locus_tag LOCUS_33400 3539213 3540559 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525274.1 protein_id gnl|my_center|LOCUS_33400 3540594 3541151 gene locus_tag LOCUS_33410 3540594 3541151 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804578.1 protein_id gnl|my_center|LOCUS_33410 3541382 3541687 gene locus_tag LOCUS_33420 3541382 3541687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 3542222 3541656 gene locus_tag LOCUS_33430 3542222 3541656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 3542885 3542316 gene locus_tag LOCUS_33440 3542885 3542316 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307367.1 protein_id gnl|my_center|LOCUS_33440 3542990 3543910 gene locus_tag LOCUS_33450 3542990 3543910 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_33450 3545556 3543958 gene locus_tag LOCUS_33460 3545556 3543958 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031804.1 protein_id gnl|my_center|LOCUS_33460 3545699 3546424 gene locus_tag LOCUS_33470 3545699 3546424 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114809.1 protein_id gnl|my_center|LOCUS_33470 3547536 3546466 gene locus_tag LOCUS_33480 3547536 3546466 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728590.1 protein_id gnl|my_center|LOCUS_33480 3547869 3548237 gene locus_tag LOCUS_33490 3547869 3548237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 3549961 3548291 gene locus_tag LOCUS_33500 3549961 3548291 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226679.1 protein_id gnl|my_center|LOCUS_33500 3550127 3551512 gene locus_tag LOCUS_33510 3550127 3551512 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_33510 3551713 3552066 gene locus_tag LOCUS_33520 3551713 3552066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3553394 3552144 gene locus_tag LOCUS_33530 3553394 3552144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 3554828 3553446 gene locus_tag LOCUS_33540 3554828 3553446 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190163775.1 protein_id gnl|my_center|LOCUS_33540 3555120 3556250 gene locus_tag LOCUS_33550 3555120 3556250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 3557362 3556133 gene locus_tag LOCUS_33560 3557362 3556133 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817233.1 protein_id gnl|my_center|LOCUS_33560 3557449 3557901 gene locus_tag LOCUS_33570 3557449 3557901 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926470.1 protein_id gnl|my_center|LOCUS_33570 3558586 3557864 gene locus_tag LOCUS_33580 3558586 3557864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 3558998 3558681 gene locus_tag LOCUS_33590 3558998 3558681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 3559682 3559023 gene locus_tag LOCUS_33600 3559682 3559023 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972782.1 protein_id gnl|my_center|LOCUS_33600 3560833 3559679 gene locus_tag LOCUS_33610 3560833 3559679 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222997.1 protein_id gnl|my_center|LOCUS_33610 3561666 3560830 gene locus_tag LOCUS_33620 3561666 3560830 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222998.1 protein_id gnl|my_center|LOCUS_33620 3563289 3561796 gene locus_tag LOCUS_33630 3563289 3561796 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_33630 3563936 3563337 gene locus_tag LOCUS_33640 3563936 3563337 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115373.1 protein_id gnl|my_center|LOCUS_33640 3565144 3563945 gene locus_tag LOCUS_33650 3565144 3563945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104410.1 protein_id gnl|my_center|LOCUS_33650 3565540 3565196 gene locus_tag LOCUS_33660 3565540 3565196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 3565686 3565549 gene locus_tag LOCUS_33670 3565686 3565549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33670 3566050 3566547 gene locus_tag LOCUS_33680 3566050 3566547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 3567618 3566557 gene locus_tag LOCUS_33690 3567618 3566557 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049749196.1 protein_id gnl|my_center|LOCUS_33690 3567832 3568629 gene locus_tag LOCUS_33700 3567832 3568629 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_33700 3569387 3568626 gene locus_tag LOCUS_33710 3569387 3568626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 3570640 3569414 gene locus_tag LOCUS_33720 gene zigA 3570640 3569414 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446171.1 protein_id gnl|my_center|LOCUS_33720 3570703 3570939 gene locus_tag LOCUS_33730 gene rpmB 3570703 3570939 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731012.1 protein_id gnl|my_center|LOCUS_33730 3570939 3571244 gene locus_tag LOCUS_33740 gene rpsN 3570939 3571244 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_33740 3571329 3572603 gene locus_tag LOCUS_33750 3571329 3572603 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_33750 3573623 3572607 gene locus_tag LOCUS_33760 3573623 3572607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3573793 3574404 gene locus_tag LOCUS_33770 3573793 3574404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3574975 3574382 gene locus_tag LOCUS_33780 3574975 3574382 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_33780 3575053 3576630 gene locus_tag LOCUS_33790 3575053 3576630 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064632335.1 protein_id gnl|my_center|LOCUS_33790 3578176 3577199 gene locus_tag LOCUS_33800 3578176 3577199 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930069.1 protein_id gnl|my_center|LOCUS_33800 3578380 3578814 gene locus_tag LOCUS_33810 3578380 3578814 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030051.1 protein_id gnl|my_center|LOCUS_33810 3580176 3578821 gene locus_tag LOCUS_33820 3580176 3578821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 3581373 3580261 gene locus_tag LOCUS_33830 3581373 3580261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 3582529 3581378 gene locus_tag LOCUS_33840 3582529 3581378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3583531 3582680 gene locus_tag LOCUS_33850 gene htpX 3583531 3582680 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222504.1 protein_id gnl|my_center|LOCUS_33850 3584822 3583695 gene locus_tag LOCUS_33860 3584822 3583695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 3584975 3587479 gene locus_tag LOCUS_33870 3584975 3587479 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120729314.1 protein_id gnl|my_center|LOCUS_33870 3587767 3587913 gene locus_tag LOCUS_33880 3587767 3587913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 3588066 3590336 gene locus_tag LOCUS_33890 3588066 3590336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 3590336 3591520 gene locus_tag LOCUS_33900 3590336 3591520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 3591517 3592779 gene locus_tag LOCUS_33910 3591517 3592779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 3594116 3592854 gene locus_tag LOCUS_33920 3594116 3592854 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_33920 3594219 3595001 gene locus_tag LOCUS_33930 3594219 3595001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 3596032 3594998 gene locus_tag LOCUS_33940 3596032 3594998 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032710620.1 protein_id gnl|my_center|LOCUS_33940 3597326 3596085 gene locus_tag LOCUS_33950 3597326 3596085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 3597764 3597342 gene locus_tag LOCUS_33960 3597764 3597342 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_33960 3597824 3600322 gene locus_tag LOCUS_33970 3597824 3600322 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_33970 3600323 3601171 gene locus_tag LOCUS_33980 3600323 3601171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 3602059 3601181 gene locus_tag LOCUS_33990 3602059 3601181 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225658.1 protein_id gnl|my_center|LOCUS_33990 3602178 3604121 gene locus_tag LOCUS_34000 3602178 3604121 CDS product AfsR/SARP family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225657.1 protein_id gnl|my_center|LOCUS_34000 3604601 3604116 gene locus_tag LOCUS_34010 3604601 3604116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3605068 3604673 gene locus_tag LOCUS_34020 3605068 3604673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 3605167 3606138 gene locus_tag LOCUS_34030 3605167 3606138 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_34030 3607067 3606135 gene locus_tag LOCUS_34040 3607067 3606135 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116024687.1 protein_id gnl|my_center|LOCUS_34040 3607206 3608489 gene locus_tag LOCUS_34050 3607206 3608489 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223555.1 protein_id gnl|my_center|LOCUS_34050 3609063 3608575 gene locus_tag LOCUS_34060 3609063 3608575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 3609125 3610252 gene locus_tag LOCUS_34070 3609125 3610252 CDS product questin oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484207.1 protein_id gnl|my_center|LOCUS_34070 3610295 3611464 gene locus_tag LOCUS_34080 3610295 3611464 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721991.1 protein_id gnl|my_center|LOCUS_34080 3612103 3611480 gene locus_tag LOCUS_34090 3612103 3611480 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031579.1 protein_id gnl|my_center|LOCUS_34090 3612177 3613073 gene locus_tag LOCUS_34100 3612177 3613073 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 protein_id gnl|my_center|LOCUS_34100 3613906 3613070 gene locus_tag LOCUS_34110 3613906 3613070 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030042.1 protein_id gnl|my_center|LOCUS_34110 3614659 3614039 gene locus_tag LOCUS_34120 3614659 3614039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 3615485 3614694 gene locus_tag LOCUS_34130 3615485 3614694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 3615566 3616537 gene locus_tag LOCUS_34140 3615566 3616537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049871458.1 protein_id gnl|my_center|LOCUS_34140 3616762 3617520 gene locus_tag LOCUS_34150 3616762 3617520 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030153.1 protein_id gnl|my_center|LOCUS_34150 3618805 3617597 gene locus_tag LOCUS_34160 3618805 3617597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3619170 3619529 gene locus_tag LOCUS_34170 3619170 3619529 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_34170 3619555 3620844 gene locus_tag LOCUS_34180 3619555 3620844 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223908.1 protein_id gnl|my_center|LOCUS_34180 3621295 3620864 gene locus_tag LOCUS_34190 3621295 3620864 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027865.1 protein_id gnl|my_center|LOCUS_34190 3624051 3621322 gene locus_tag LOCUS_34200 3624051 3621322 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977982.1 protein_id gnl|my_center|LOCUS_34200 3624161 3624640 gene locus_tag LOCUS_34210 3624161 3624640 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918009.1 protein_id gnl|my_center|LOCUS_34210 3624655 3625821 gene locus_tag LOCUS_34220 3624655 3625821 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 protein_id gnl|my_center|LOCUS_34220 3626166 3626474 gene locus_tag LOCUS_34230 3626166 3626474 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222672.1 protein_id gnl|my_center|LOCUS_34230 3626484 3627209 gene locus_tag LOCUS_34240 3626484 3627209 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222671.1 protein_id gnl|my_center|LOCUS_34240 3628367 3627291 gene locus_tag LOCUS_34250 3628367 3627291 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_34250 3628442 3628789 gene locus_tag LOCUS_34260 3628442 3628789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 3629212 3628802 gene locus_tag LOCUS_34270 3629212 3628802 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_34270 3629908 3629312 gene locus_tag LOCUS_34280 3629908 3629312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 3630607 3629921 gene locus_tag LOCUS_34290 3630607 3629921 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 protein_id gnl|my_center|LOCUS_34290 3630757 3631041 gene locus_tag LOCUS_34300 3630757 3631041 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975238.1 protein_id gnl|my_center|LOCUS_34300 3631038 3632141 gene locus_tag LOCUS_34310 gene arsB 3631038 3632141 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222674.1 protein_id gnl|my_center|LOCUS_34310 3632181 3632681 gene locus_tag LOCUS_34320 3632181 3632681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085872.1 protein_id gnl|my_center|LOCUS_34320 3633253 3632678 gene locus_tag LOCUS_34330 3633253 3632678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 3634125 3633256 gene locus_tag LOCUS_34340 3634125 3633256 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_34340 3634701 3634219 gene locus_tag LOCUS_34350 3634701 3634219 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_34350 3635224 3634829 gene locus_tag LOCUS_34360 gene hspX 3635224 3634829 CDS product alpha-crystallin HspX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410189.1 protein_id gnl|my_center|LOCUS_34360 3635758 3635291 gene locus_tag LOCUS_34370 3635758 3635291 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_34370 3636089 3637111 gene locus_tag LOCUS_34380 3636089 3637111 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_34380 3638342 3637092 gene locus_tag LOCUS_34390 3638342 3637092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 3639430 3638471 gene locus_tag LOCUS_34400 3639430 3638471 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_34400 3640506 3639460 gene locus_tag LOCUS_34410 3640506 3639460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 3641351 3640512 gene locus_tag LOCUS_34420 3641351 3640512 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_34420 3641534 3641782 gene locus_tag LOCUS_34430 3641534 3641782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 3642834 3641785 gene locus_tag LOCUS_34440 gene hypE 3642834 3641785 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_34440 3643940 3642831 gene locus_tag LOCUS_34450 gene hypD 3643940 3642831 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_34450 3644188 3643937 gene locus_tag LOCUS_34460 3644188 3643937 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_34460 3646488 3644194 gene locus_tag LOCUS_34470 gene hypF 3646488 3644194 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_34470 3647375 3646485 gene locus_tag LOCUS_34480 3647375 3646485 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_34480 3650088 3647392 gene locus_tag LOCUS_34490 3650088 3647392 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_34490 3652649 3650085 gene locus_tag LOCUS_34500 3652649 3650085 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227286.1 protein_id gnl|my_center|LOCUS_34500 3653206 3652628 gene locus_tag LOCUS_34510 3653206 3652628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972757.1 protein_id gnl|my_center|LOCUS_34510 3654099 3653218 gene locus_tag LOCUS_34520 3654099 3653218 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_34520 3655155 3654286 gene locus_tag LOCUS_34530 3655155 3654286 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_34530 3655879 3655259 gene locus_tag LOCUS_34540 3655879 3655259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 3656543 3655869 gene locus_tag LOCUS_34550 3656543 3655869 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409492.1 protein_id gnl|my_center|LOCUS_34550 3657044 3656643 gene locus_tag LOCUS_34560 3657044 3656643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 3657286 3657732 gene locus_tag LOCUS_34570 3657286 3657732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 3657732 3658652 gene locus_tag LOCUS_34580 3657732 3658652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 3658639 3660048 gene locus_tag LOCUS_34590 3658639 3660048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 3660045 3660461 gene locus_tag LOCUS_34600 3660045 3660461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 3660464 3660679 gene locus_tag LOCUS_34610 3660464 3660679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 3660676 3661191 gene locus_tag LOCUS_34620 3660676 3661191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 3661179 3662915 gene locus_tag LOCUS_34630 3661179 3662915 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_34630 3662912 3664312 gene locus_tag LOCUS_34640 3662912 3664312 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869712.1 protein_id gnl|my_center|LOCUS_34640 3664309 3664920 gene locus_tag LOCUS_34650 3664309 3664920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 3665074 3666870 gene locus_tag LOCUS_34660 gene acsA 3665074 3666870 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862102.1 protein_id gnl|my_center|LOCUS_34660 3666867 3667847 gene locus_tag LOCUS_34670 gene pdhA 3666867 3667847 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928801.1 protein_id gnl|my_center|LOCUS_34670 3667847 3668854 gene locus_tag LOCUS_34680 3667847 3668854 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_34680 3668856 3670091 gene locus_tag LOCUS_34690 3668856 3670091 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_34690 3670088 3670366 gene locus_tag LOCUS_34700 3670088 3670366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 3670876 3670433 gene locus_tag LOCUS_34710 3670876 3670433 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896644.1 protein_id gnl|my_center|LOCUS_34710 3671271 3672383 gene locus_tag LOCUS_34720 3671271 3672383 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_34720 3672311 3673207 gene locus_tag LOCUS_34730 3672311 3673207 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_34730 3673204 3673953 gene locus_tag LOCUS_34740 3673204 3673953 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_34740 3674003 3675235 gene locus_tag LOCUS_34750 3674003 3675235 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 protein_id gnl|my_center|LOCUS_34750 3676130 3675255 gene locus_tag LOCUS_34760 3676130 3675255 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_34760 3676350 3677240 gene locus_tag LOCUS_34770 3676350 3677240 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_34770 3677784 3677266 gene locus_tag LOCUS_34780 3677784 3677266 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227306.1 protein_id gnl|my_center|LOCUS_34780 3678123 3678344 gene locus_tag LOCUS_34790 3678123 3678344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 3678673 3679017 gene locus_tag LOCUS_34800 3678673 3679017 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141202.1 protein_id gnl|my_center|LOCUS_34800 3679014 3679964 gene locus_tag LOCUS_34810 3679014 3679964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 3680016 3681929 gene locus_tag LOCUS_34820 3680016 3681929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 3684329 3681996 gene locus_tag LOCUS_34830 3684329 3681996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 protein_id gnl|my_center|LOCUS_34830 3684576 3685559 gene locus_tag LOCUS_34840 3684576 3685559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228117.1 protein_id gnl|my_center|LOCUS_34840 3688541 3685572 gene locus_tag LOCUS_34850 3688541 3685572 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229747.1 protein_id gnl|my_center|LOCUS_34850 3688662 3688856 gene locus_tag LOCUS_34860 3688662 3688856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 3688950 3692159 gene locus_tag LOCUS_34870 3688950 3692159 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_34870 3692168 3694018 gene locus_tag LOCUS_34880 3692168 3694018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_34880 3694015 3695439 gene locus_tag LOCUS_34890 3694015 3695439 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227138.1 protein_id gnl|my_center|LOCUS_34890 3697428 3695419 gene locus_tag LOCUS_34900 3697428 3695419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 3697760 3697434 gene locus_tag LOCUS_34910 3697760 3697434 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921019.1 protein_id gnl|my_center|LOCUS_34910 3698793 3697837 gene locus_tag LOCUS_34920 3698793 3697837 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223953.1 protein_id gnl|my_center|LOCUS_34920 3698792 3699739 gene locus_tag LOCUS_34930 3698792 3699739 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223952.1 protein_id gnl|my_center|LOCUS_34930 3699736 3700746 gene locus_tag LOCUS_34940 3699736 3700746 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186428.1 protein_id gnl|my_center|LOCUS_34940 3702260 3700743 gene locus_tag LOCUS_34950 3702260 3700743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 3703502 3702315 gene locus_tag LOCUS_34960 3703502 3702315 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970647.1 protein_id gnl|my_center|LOCUS_34960 3704702 3703524 gene locus_tag LOCUS_34970 3704702 3703524 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 protein_id gnl|my_center|LOCUS_34970 3704792 3705715 gene locus_tag LOCUS_34980 3704792 3705715 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 protein_id gnl|my_center|LOCUS_34980 3705717 3706463 gene locus_tag LOCUS_34990 3705717 3706463 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227640.1 protein_id gnl|my_center|LOCUS_34990 3706460 3707560 gene locus_tag LOCUS_35000 3706460 3707560 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227639.1 protein_id gnl|my_center|LOCUS_35000 3708165 3707539 gene locus_tag LOCUS_35010 3708165 3707539 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227638.1 protein_id gnl|my_center|LOCUS_35010 3708336 3708941 gene locus_tag LOCUS_35020 3708336 3708941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 3712319 3708999 gene locus_tag LOCUS_35030 3712319 3708999 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_35030 3712416 3713390 gene locus_tag LOCUS_35040 3712416 3713390 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282906.1 protein_id gnl|my_center|LOCUS_35040 3714779 3713352 gene locus_tag LOCUS_35050 3714779 3713352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 3715018 3714776 gene locus_tag LOCUS_35060 3715018 3714776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 3716063 3715008 gene locus_tag LOCUS_35070 3716063 3715008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35070 3717581 3716553 gene locus_tag LOCUS_35080 3717581 3716553 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031770.1 protein_id gnl|my_center|LOCUS_35080 3717699 3719225 gene locus_tag LOCUS_35090 3717699 3719225 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537499.1 protein_id gnl|my_center|LOCUS_35090 3719242 3720210 gene locus_tag LOCUS_35100 3719242 3720210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383546.1 protein_id gnl|my_center|LOCUS_35100 3720207 3721094 gene locus_tag LOCUS_35110 3720207 3721094 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537498.1 protein_id gnl|my_center|LOCUS_35110 3721109 3722281 gene locus_tag LOCUS_35120 3721109 3722281 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726727.1 protein_id gnl|my_center|LOCUS_35120 3722286 3723929 gene locus_tag LOCUS_35130 3722286 3723929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 3723932 3725557 gene locus_tag LOCUS_35140 3723932 3725557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900733.1 protein_id gnl|my_center|LOCUS_35140 3725648 3726025 gene locus_tag LOCUS_35150 3725648 3726025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 3728014 3726074 gene locus_tag LOCUS_35160 3728014 3726074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 3728182 3729132 gene locus_tag LOCUS_35170 3728182 3729132 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786700.1 protein_id gnl|my_center|LOCUS_35170 3729129 3730130 gene locus_tag LOCUS_35180 3729129 3730130 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227664.1 protein_id gnl|my_center|LOCUS_35180 3730037 3730462 gene locus_tag LOCUS_35190 3730037 3730462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 3730596 3731780 gene locus_tag LOCUS_35200 3730596 3731780 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222508.1 protein_id gnl|my_center|LOCUS_35200 3731990 3732166 gene locus_tag LOCUS_35210 3731990 3732166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3732170 3732715 gene locus_tag LOCUS_35220 3732170 3732715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 3733304 3732771 gene locus_tag LOCUS_35230 3733304 3732771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 3734054 3733566 gene locus_tag LOCUS_35240 3734054 3733566 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230886.1 protein_id gnl|my_center|LOCUS_35240 3734131 3735336 gene locus_tag LOCUS_35250 3734131 3735336 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228864.1 protein_id gnl|my_center|LOCUS_35250 3736258 3735326 gene locus_tag LOCUS_35260 3736258 3735326 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106346642.1 protein_id gnl|my_center|LOCUS_35260 3738121 3737078 gene locus_tag LOCUS_35270 3738121 3737078 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_35270 3739128 3738118 gene locus_tag LOCUS_35280 3739128 3738118 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_35280 3740273 3739218 gene locus_tag LOCUS_35290 3740273 3739218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 3740353 3741105 gene locus_tag LOCUS_35300 3740353 3741105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 3742095 3741154 gene locus_tag LOCUS_35310 3742095 3741154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 3742415 3744898 gene locus_tag LOCUS_35320 3742415 3744898 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229880.1 protein_id gnl|my_center|LOCUS_35320 3744867 3745847 gene locus_tag LOCUS_35330 3744867 3745847 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_35330 3745754 3746746 gene locus_tag LOCUS_35340 3745754 3746746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 3748426 3746816 gene locus_tag LOCUS_35350 3748426 3746816 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229262.1 protein_id gnl|my_center|LOCUS_35350 3748593 3748982 gene locus_tag LOCUS_35360 3748593 3748982 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_35360 3748979 3750220 gene locus_tag LOCUS_35370 3748979 3750220 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_35370 3750222 3750536 gene locus_tag LOCUS_35380 3750222 3750536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 3750619 3751305 gene locus_tag LOCUS_35390 3750619 3751305 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 protein_id gnl|my_center|LOCUS_35390 3751318 3751923 gene locus_tag LOCUS_35400 3751318 3751923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 3752357 3751941 gene locus_tag LOCUS_35410 3752357 3751941 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191984393.1 protein_id gnl|my_center|LOCUS_35410 3752839 3752366 gene locus_tag LOCUS_35420 3752839 3752366 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225943.1 protein_id gnl|my_center|LOCUS_35420 3753302 3752859 gene locus_tag LOCUS_35430 3753302 3752859 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226516.1 protein_id gnl|my_center|LOCUS_35430 3753567 3753295 gene locus_tag LOCUS_35440 3753567 3753295 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226515.1 protein_id gnl|my_center|LOCUS_35440 3754173 3753580 gene locus_tag LOCUS_35450 3754173 3753580 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050546857.1 protein_id gnl|my_center|LOCUS_35450 3754964 3754170 gene locus_tag LOCUS_35460 3754964 3754170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 3755064 3756650 gene locus_tag LOCUS_35470 3755064 3756650 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140493.1 protein_id gnl|my_center|LOCUS_35470 3759450 3756721 gene locus_tag LOCUS_35480 3759450 3756721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 3762285 3759466 gene locus_tag LOCUS_35490 3762285 3759466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 3762431 3764329 gene locus_tag LOCUS_35500 3762431 3764329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 3764664 3764326 gene locus_tag LOCUS_35510 3764664 3764326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 3764840 3765652 gene locus_tag LOCUS_35520 3764840 3765652 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869145.1 protein_id gnl|my_center|LOCUS_35520 3766241 3765660 gene locus_tag LOCUS_35530 3766241 3765660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 3766999 3766286 gene locus_tag LOCUS_35540 3766999 3766286 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220205807.1 protein_id gnl|my_center|LOCUS_35540 3767074 3768099 gene locus_tag LOCUS_35550 3767074 3768099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 3769175 3768114 gene locus_tag LOCUS_35560 3769175 3768114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 3769353 3770453 gene locus_tag LOCUS_35570 3769353 3770453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 3770931 3770527 gene locus_tag LOCUS_35580 3770931 3770527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 3771183 3771920 gene locus_tag LOCUS_35590 3771183 3771920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 3773399 3771981 gene locus_tag LOCUS_35600 3773399 3771981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 3775156 3773399 gene locus_tag LOCUS_35610 3775156 3773399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 3776422 3775238 gene locus_tag LOCUS_35620 3776422 3775238 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_35620 3777365 3776517 gene locus_tag LOCUS_35630 3777365 3776517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 3778375 3777656 gene locus_tag LOCUS_35640 3778375 3777656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 3780099 3778591 gene locus_tag LOCUS_35650 3780099 3778591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 3780412 3780071 gene locus_tag LOCUS_35660 3780412 3780071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 3780520 3781944 gene locus_tag LOCUS_35670 3780520 3781944 CDS product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110226.1 protein_id gnl|my_center|LOCUS_35670 3781941 3782822 gene locus_tag LOCUS_35680 3781941 3782822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 3782929 3783258 gene locus_tag LOCUS_35690 3782929 3783258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 3783255 3785276 gene locus_tag LOCUS_35700 3783255 3785276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 3785925 3785332 gene locus_tag LOCUS_35710 3785925 3785332 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220205807.1 protein_id gnl|my_center|LOCUS_35710 3786080 3788824 gene locus_tag LOCUS_35720 3786080 3788824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3789348 3788914 gene locus_tag LOCUS_35730 3789348 3788914 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_35730 3789977 3790285 gene locus_tag LOCUS_35740 3789977 3790285 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229578.1 protein_id gnl|my_center|LOCUS_35740 3790737 3791054 gene locus_tag LOCUS_35750 3790737 3791054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 3791151 3791405 gene locus_tag LOCUS_35760 3791151 3791405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 3791581 3791913 gene locus_tag LOCUS_35770 3791581 3791913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 3793002 3791995 gene locus_tag LOCUS_35780 3793002 3791995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 3793884 3793003 gene locus_tag LOCUS_35790 gene cas7c 3793884 3793003 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392032.1 protein_id gnl|my_center|LOCUS_35790 3795733 3793877 gene locus_tag LOCUS_35800 gene cas8c 3795733 3793877 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_35800 3796428 3795733 gene locus_tag LOCUS_35810 gene cas5c 3796428 3795733 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_35810 3798644 3796425 gene locus_tag LOCUS_35820 3798644 3796425 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_35820 3798824 3799945 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcgatcctcgctggagctggtgctccagcgccac 3803475 3800254 gene locus_tag LOCUS_35830 gene dnaE2 3803475 3800254 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417885.1 protein_id gnl|my_center|LOCUS_35830 3804322 3803705 gene locus_tag LOCUS_35840 3804322 3803705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 3804987 3805238 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtggcgctggagcaccagctccagcgaggatcgcaac 3806385 3806053 gene locus_tag LOCUS_35850 3806385 3806053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35850 3806824 3806447 gene locus_tag LOCUS_35860 3806824 3806447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 3808026 3806821 gene locus_tag LOCUS_35870 3808026 3806821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 3808599 3809352 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtggcgctggagcatccgctccagcgaggatcgcaac 3809877 3809521 gene locus_tag LOCUS_35880 3809877 3809521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 3810154 3811110 gene locus_tag LOCUS_35890 3810154 3811110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 3811619 3811344 gene locus_tag LOCUS_35900 3811619 3811344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 3811709 3812224 gene locus_tag LOCUS_35910 3811709 3812224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 3812496 3813008 gene locus_tag LOCUS_35920 3812496 3813008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 3813387 3813247 gene locus_tag LOCUS_35930 3813387 3813247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 3816314 3813477 gene locus_tag LOCUS_35940 3816314 3813477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 3817570 3816311 gene locus_tag LOCUS_35950 3817570 3816311 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033517.1 protein_id gnl|my_center|LOCUS_35950 3819284 3817563 gene locus_tag LOCUS_35960 3819284 3817563 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030148.1 protein_id gnl|my_center|LOCUS_35960 3820220 3819288 gene locus_tag LOCUS_35970 3820220 3819288 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033516.1 protein_id gnl|my_center|LOCUS_35970 3820572 3820210 gene locus_tag LOCUS_35980 3820572 3820210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 3820999 3820616 gene locus_tag LOCUS_35990 3820999 3820616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 3821732 3820911 gene locus_tag LOCUS_36000 3821732 3820911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 3821867 3822172 gene locus_tag LOCUS_36010 3821867 3822172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 3825993 3824050 gene locus_tag LOCUS_36020 3825993 3824050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 3826525 3827001 gene locus_tag LOCUS_36030 3826525 3827001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 3827038 3827196 gene locus_tag LOCUS_36040 3827038 3827196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 3827197 3830091 gene locus_tag LOCUS_36050 3827197 3830091 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031312.1 protein_id gnl|my_center|LOCUS_36050 3830088 3831317 gene locus_tag LOCUS_36060 3830088 3831317 CDS product lanthionine synthetase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026975.1 protein_id gnl|my_center|LOCUS_36060 3831341 3831724 gene locus_tag LOCUS_36070 3831341 3831724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 3832096 3835803 gene locus_tag LOCUS_36080 3832096 3835803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 3836061 3836405 gene locus_tag LOCUS_36090 3836061 3836405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978147.1 protein_id gnl|my_center|LOCUS_36090 3836402 3836728 gene locus_tag LOCUS_36100 3836402 3836728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 3837505 3837086 gene locus_tag LOCUS_36110 3837505 3837086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 3838831 3837788 gene locus_tag LOCUS_36120 3838831 3837788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 3839105 3840292 gene locus_tag LOCUS_36130 3839105 3840292 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189718240.1 protein_id gnl|my_center|LOCUS_36130 3840365 3840637 gene locus_tag LOCUS_36140 3840365 3840637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 3840809 3841078 gene locus_tag LOCUS_36150 3840809 3841078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 3841620 3842387 gene locus_tag LOCUS_36160 3841620 3842387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 3842813 3843175 gene locus_tag LOCUS_36170 3842813 3843175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 3843244 3843588 gene locus_tag LOCUS_36180 3843244 3843588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 3843675 3844508 gene locus_tag LOCUS_36190 3843675 3844508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 3844916 3849331 gene locus_tag LOCUS_36200 3844916 3849331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 3849890 3849456 gene locus_tag LOCUS_36210 3849890 3849456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 3850463 3851695 gene locus_tag LOCUS_36220 gene gcvT 3850463 3851695 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729697.1 protein_id gnl|my_center|LOCUS_36220 3851907 3851623 gene locus_tag LOCUS_36230 3851907 3851623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 3852997 3852068 gene locus_tag LOCUS_36240 3852997 3852068 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 protein_id gnl|my_center|LOCUS_36240 3854022 3852994 gene locus_tag LOCUS_36250 3854022 3852994 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 protein_id gnl|my_center|LOCUS_36250 3854170 3855159 gene locus_tag LOCUS_36260 3854170 3855159 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731545.1 protein_id gnl|my_center|LOCUS_36260 3855164 3856168 gene locus_tag LOCUS_36270 3855164 3856168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731544.1 protein_id gnl|my_center|LOCUS_36270 3856165 3856965 gene locus_tag LOCUS_36280 3856165 3856965 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731543.1 protein_id gnl|my_center|LOCUS_36280 3857012 3858481 gene locus_tag LOCUS_36290 3857012 3858481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 3859776 3858736 gene locus_tag LOCUS_36300 3859776 3858736 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804166.1 protein_id gnl|my_center|LOCUS_36300 3860104 3860439 gene locus_tag LOCUS_36310 3860104 3860439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 3860723 3860460 gene locus_tag LOCUS_36320 3860723 3860460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 3861102 3860806 gene locus_tag LOCUS_36330 3861102 3860806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 3862145 3861099 gene locus_tag LOCUS_36340 3862145 3861099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 3862763 3864406 gene locus_tag LOCUS_36350 3862763 3864406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 3864937 3864410 gene locus_tag LOCUS_36360 3864937 3864410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 3865449 3864943 gene locus_tag LOCUS_36370 3865449 3864943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 3866276 3865686 gene locus_tag LOCUS_36380 3866276 3865686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 3866543 3866385 gene locus_tag LOCUS_36390 3866543 3866385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 3867788 3867489 gene locus_tag LOCUS_36400 3867788 3867489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 3868157 3870430 gene locus_tag LOCUS_36410 3868157 3870430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 3871310 3870450 gene locus_tag LOCUS_36420 3871310 3870450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 3871966 3871331 gene locus_tag LOCUS_36430 3871966 3871331 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227982.1 protein_id gnl|my_center|LOCUS_36430 3873120 3871978 gene locus_tag LOCUS_36440 3873120 3871978 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227983.1 protein_id gnl|my_center|LOCUS_36440 3873282 3873755 gene locus_tag LOCUS_36450 3873282 3873755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 3873797 3875035 gene locus_tag LOCUS_36460 3873797 3875035 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804228.1 protein_id gnl|my_center|LOCUS_36460 3875278 3875808 gene locus_tag LOCUS_36470 3875278 3875808 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462739.1 protein_id gnl|my_center|LOCUS_36470 3876860 3875877 gene locus_tag LOCUS_36480 3876860 3875877 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227929.1 protein_id gnl|my_center|LOCUS_36480 3876970 3879105 gene locus_tag LOCUS_36490 3876970 3879105 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_36490 3879786 3879076 gene locus_tag LOCUS_36500 3879786 3879076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 3881231 3879789 gene locus_tag LOCUS_36510 3881231 3879789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 3881801 3881334 gene locus_tag LOCUS_36520 3881801 3881334 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228367.1 protein_id gnl|my_center|LOCUS_36520 3881887 3882258 gene locus_tag LOCUS_36530 3881887 3882258 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027430.1 protein_id gnl|my_center|LOCUS_36530 3882395 3883771 gene locus_tag LOCUS_36540 3882395 3883771 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_36540 3883820 3884362 gene locus_tag LOCUS_36550 3883820 3884362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 3884498 3884959 gene locus_tag LOCUS_36560 3884498 3884959 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_36560 3884956 3885141 gene locus_tag LOCUS_36570 3884956 3885141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 3885141 3887525 gene locus_tag LOCUS_36580 3885141 3887525 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_36580 3887800 3887558 gene locus_tag LOCUS_36590 3887800 3887558 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467266.1 protein_id gnl|my_center|LOCUS_36590 3888748 3887879 gene locus_tag LOCUS_36600 3888748 3887879 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_36600 3888941 3889495 gene locus_tag LOCUS_36610 3888941 3889495 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_36610 3890445 3889555 gene locus_tag LOCUS_36620 3890445 3889555 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_36620 3891361 3890480 gene locus_tag LOCUS_36630 3891361 3890480 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_36630 3891641 3894160 gene locus_tag LOCUS_36640 3891641 3894160 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 protein_id gnl|my_center|LOCUS_36640 3895121 3894099 gene locus_tag LOCUS_36650 3895121 3894099 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 protein_id gnl|my_center|LOCUS_36650 3895656 3895234 gene locus_tag LOCUS_36660 3895656 3895234 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_36660 3896155 3895697 gene locus_tag LOCUS_36670 gene mmpR5 3896155 3895697 CDS product siderophore transport transcriptional regulator MmpR5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403442.1 protein_id gnl|my_center|LOCUS_36670 3896278 3896907 gene locus_tag LOCUS_36680 3896278 3896907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 3897706 3896921 gene locus_tag LOCUS_36690 3897706 3896921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228359.1 protein_id gnl|my_center|LOCUS_36690 3898428 3897703 gene locus_tag LOCUS_36700 3898428 3897703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 3898991 3898425 gene locus_tag LOCUS_36710 3898991 3898425 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031930.1 protein_id gnl|my_center|LOCUS_36710 3900260 3899034 gene locus_tag LOCUS_36720 3900260 3899034 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227558.1 protein_id gnl|my_center|LOCUS_36720 3901565 3900270 gene locus_tag LOCUS_36730 3901565 3900270 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 protein_id gnl|my_center|LOCUS_36730 3901777 3901562 gene locus_tag LOCUS_36740 3901777 3901562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 3903521 3902079 gene locus_tag LOCUS_36750 3903521 3902079 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181750.1 protein_id gnl|my_center|LOCUS_36750 3903635 3904138 gene locus_tag LOCUS_36760 3903635 3904138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 3905194 3904181 gene locus_tag LOCUS_36770 3905194 3904181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 3905703 3905191 gene locus_tag LOCUS_36780 3905703 3905191 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 protein_id gnl|my_center|LOCUS_36780 3907884 3905788 gene locus_tag LOCUS_36790 3907884 3905788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 3908583 3907939 gene locus_tag LOCUS_36800 3908583 3907939 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_36800 3909806 3908580 gene locus_tag LOCUS_36810 3909806 3908580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 3910882 3909881 gene locus_tag LOCUS_36820 3910882 3909881 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653653.1 protein_id gnl|my_center|LOCUS_36820 3911986 3911021 gene locus_tag LOCUS_36830 3911986 3911021 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971534.1 protein_id gnl|my_center|LOCUS_36830 3912049 3912858 gene locus_tag LOCUS_36840 3912049 3912858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 3912861 3913547 gene locus_tag LOCUS_36850 3912861 3913547 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031779.1 protein_id gnl|my_center|LOCUS_36850 3913544 3914854 gene locus_tag LOCUS_36860 3913544 3914854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 3916009 3914903 gene locus_tag LOCUS_36870 3916009 3914903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 3916161 3918914 gene locus_tag LOCUS_36880 3916161 3918914 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227699.1 protein_id gnl|my_center|LOCUS_36880 3919139 3919227 gene locus_tag LOCUS_t00300 3919139 3919227 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3921941 3919731 gene locus_tag LOCUS_36890 3921941 3919731 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202102.1 protein_id gnl|my_center|LOCUS_36890 3922102 3922605 gene locus_tag LOCUS_36900 3922102 3922605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 3922823 3924022 gene locus_tag LOCUS_36910 3922823 3924022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809839.1 protein_id gnl|my_center|LOCUS_36910 3924030 3924842 gene locus_tag LOCUS_36920 3924030 3924842 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976846.1 protein_id gnl|my_center|LOCUS_36920 3924827 3926659 gene locus_tag LOCUS_36930 3924827 3926659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 3927055 3926660 gene locus_tag LOCUS_36940 3927055 3926660 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561253.1 protein_id gnl|my_center|LOCUS_36940 3929457 3927052 gene locus_tag LOCUS_36950 3929457 3927052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 3929782 3930261 gene locus_tag LOCUS_36960 3929782 3930261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 3930406 3931011 gene locus_tag LOCUS_36970 3930406 3931011 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 protein_id gnl|my_center|LOCUS_36970 3932598 3931024 gene locus_tag LOCUS_36980 3932598 3931024 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228685.1 protein_id gnl|my_center|LOCUS_36980 3934235 3932595 gene locus_tag LOCUS_36990 3934235 3932595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 3935067 3934270 gene locus_tag LOCUS_37000 3935067 3934270 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530494.1 protein_id gnl|my_center|LOCUS_37000 3936123 3935110 gene locus_tag LOCUS_37010 3936123 3935110 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104251.1 protein_id gnl|my_center|LOCUS_37010 3936305 3937837 gene locus_tag LOCUS_37020 3936305 3937837 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_37020 3937834 3938853 gene locus_tag LOCUS_37030 3937834 3938853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 protein_id gnl|my_center|LOCUS_37030 3938850 3939908 gene locus_tag LOCUS_37040 3938850 3939908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226380.1 protein_id gnl|my_center|LOCUS_37040 3939933 3940964 gene locus_tag LOCUS_37050 gene rhaS 3939933 3940964 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978052.1 protein_id gnl|my_center|LOCUS_37050 3940984 3942147 gene locus_tag LOCUS_37060 gene rhaI 3940984 3942147 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727048.1 protein_id gnl|my_center|LOCUS_37060 3942185 3944221 gene locus_tag LOCUS_37070 3942185 3944221 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876809.1 protein_id gnl|my_center|LOCUS_37070 3944246 3945658 gene locus_tag LOCUS_37080 3944246 3945658 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727050.1 protein_id gnl|my_center|LOCUS_37080 3945702 3946931 gene locus_tag LOCUS_37090 gene lldD 3945702 3946931 CDS product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409382.1 protein_id gnl|my_center|LOCUS_37090 3949959 3946897 gene locus_tag LOCUS_37100 3949959 3946897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3950982 3949999 gene locus_tag LOCUS_37110 3950982 3949999 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807537.1 protein_id gnl|my_center|LOCUS_37110 3951720 3951007 gene locus_tag LOCUS_37120 3951720 3951007 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224576.1 protein_id gnl|my_center|LOCUS_37120 3953619 3951769 gene locus_tag LOCUS_37130 3953619 3951769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 3953861 3953586 gene locus_tag LOCUS_37140 3953861 3953586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 3953773 3954900 gene locus_tag LOCUS_37150 3953773 3954900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 3955024 3957081 gene locus_tag LOCUS_37160 3955024 3957081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 3957224 3957679 gene locus_tag LOCUS_37170 3957224 3957679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 3958402 3957713 gene locus_tag LOCUS_37180 3958402 3957713 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930016.1 protein_id gnl|my_center|LOCUS_37180 3959528 3958404 gene locus_tag LOCUS_37190 3959528 3958404 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 protein_id gnl|my_center|LOCUS_37190 3959739 3960521 gene locus_tag LOCUS_37200 3959739 3960521 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972022.1 protein_id gnl|my_center|LOCUS_37200 3961459 3960527 gene locus_tag LOCUS_37210 3961459 3960527 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230946.1 protein_id gnl|my_center|LOCUS_37210 3961600 3962382 gene locus_tag LOCUS_37220 3961600 3962382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229390.1 protein_id gnl|my_center|LOCUS_37220 3963267 3962386 gene locus_tag LOCUS_37230 3963267 3962386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 3964448 3963444 gene locus_tag LOCUS_37240 gene cydB 3964448 3963444 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_37240 3965852 3964461 gene locus_tag LOCUS_37250 3965852 3964461 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_37250 3965971 3966663 gene locus_tag LOCUS_37260 3965971 3966663 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655759.1 protein_id gnl|my_center|LOCUS_37260 3966802 3967362 gene locus_tag LOCUS_37270 3966802 3967362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 3967897 3967403 gene locus_tag LOCUS_37280 3967897 3967403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 3968492 3967929 gene locus_tag LOCUS_37290 3968492 3967929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 3970969 3968489 gene locus_tag LOCUS_37300 3970969 3968489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 3971396 3972871 gene locus_tag LOCUS_37310 3971396 3972871 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742061.1 protein_id gnl|my_center|LOCUS_37310 3972894 3973454 gene locus_tag LOCUS_37320 3972894 3973454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 3973454 3975334 gene locus_tag LOCUS_37330 3973454 3975334 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 protein_id gnl|my_center|LOCUS_37330 3975349 3976011 gene locus_tag LOCUS_37340 3975349 3976011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 3976054 3976437 gene locus_tag LOCUS_37350 3976054 3976437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_37350 3976570 3977841 gene locus_tag LOCUS_37360 3976570 3977841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 3977971 3979644 gene locus_tag LOCUS_37370 3977971 3979644 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030749.1 protein_id gnl|my_center|LOCUS_37370 3979641 3981332 gene locus_tag LOCUS_37380 gene lbtA 3979641 3981332 CDS product siderophore legiobactin biosynthesis protein LbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444551.1 protein_id gnl|my_center|LOCUS_37380 3981329 3982495 gene locus_tag LOCUS_37390 gene sbnH 3981329 3982495 CDS product staphyloferrin B biosynthesis decarboxylase SbnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223713.1 protein_id gnl|my_center|LOCUS_37390 3983628 3982519 gene locus_tag LOCUS_37400 3983628 3982519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 3983871 3984065 gene locus_tag LOCUS_37410 3983871 3984065 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_37410 3985977 3984148 gene locus_tag LOCUS_37420 3985977 3984148 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222107.1 protein_id gnl|my_center|LOCUS_37420 3988880 3986052 gene locus_tag LOCUS_37430 gene gcvP 3988880 3986052 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_37430 3989903 3989394 gene locus_tag LOCUS_37440 3989903 3989394 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 protein_id gnl|my_center|LOCUS_37440 3990437 3989973 gene locus_tag LOCUS_37450 3990437 3989973 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_37450 3991017 3990583 gene locus_tag LOCUS_37460 3991017 3990583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 3991443 3991066 gene locus_tag LOCUS_37470 gene gcvH 3991443 3991066 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_37470 3992214 3991609 gene locus_tag LOCUS_37480 3992214 3991609 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_37480 3992918 3992211 gene locus_tag LOCUS_37490 3992918 3992211 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_37490 3994032 3992911 gene locus_tag LOCUS_37500 3994032 3992911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 3994167 3995237 gene locus_tag LOCUS_37510 3994167 3995237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 3996432 3995479 gene locus_tag LOCUS_37520 3996432 3995479 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_37520 3997450 3996545 gene locus_tag LOCUS_37530 3997450 3996545 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_37530 3997635 3998339 gene locus_tag LOCUS_37540 3997635 3998339 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_37540 3998336 3999352 gene locus_tag LOCUS_37550 3998336 3999352 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027987.1 protein_id gnl|my_center|LOCUS_37550 3999534 4001408 gene locus_tag LOCUS_37560 3999534 4001408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 4001405 4002994 gene locus_tag LOCUS_37570 4001405 4002994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 4003560 4003024 gene locus_tag LOCUS_37580 4003560 4003024 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464470.1 protein_id gnl|my_center|LOCUS_37580 4003622 4004881 gene locus_tag LOCUS_37590 4003622 4004881 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227115.1 protein_id gnl|my_center|LOCUS_37590 4005850 4004903 gene locus_tag LOCUS_37600 4005850 4004903 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_37600 4006783 4005890 gene locus_tag LOCUS_37610 gene plcA 4006783 4005890 CDS product phosphatidylinositol diacylglycerol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066288.1 protein_id gnl|my_center|LOCUS_37610 4006915 4008000 gene locus_tag LOCUS_37620 4006915 4008000 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_37620 4008068 4009012 gene locus_tag LOCUS_37630 4008068 4009012 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755419.1 protein_id gnl|my_center|LOCUS_37630 4010208 4009009 gene locus_tag LOCUS_37640 4010208 4009009 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_37640 4010533 4011030 gene locus_tag LOCUS_37650 4010533 4011030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 4013500 4011395 gene locus_tag LOCUS_37660 gene uvrB 4013500 4011395 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958334.1 protein_id gnl|my_center|LOCUS_37660 4013613 4015019 gene locus_tag LOCUS_37670 4013613 4015019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 4016470 4015283 gene locus_tag LOCUS_37680 gene coaE 4016470 4015283 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286284.1 protein_id gnl|my_center|LOCUS_37680 4017378 4016521 gene locus_tag LOCUS_37690 4017378 4016521 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227697.1 protein_id gnl|my_center|LOCUS_37690 4018013 4017411 gene locus_tag LOCUS_37700 4018013 4017411 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227696.1 protein_id gnl|my_center|LOCUS_37700 4019655 4018132 gene locus_tag LOCUS_37710 gene rpsA 4019655 4018132 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227916.1 protein_id gnl|my_center|LOCUS_37710 4020050 4022077 gene locus_tag LOCUS_37720 4020050 4022077 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111245.1 protein_id gnl|my_center|LOCUS_37720 4024815 4022089 gene locus_tag LOCUS_37730 gene polA 4024815 4022089 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_37730 4025556 4024843 gene locus_tag LOCUS_37740 4025556 4024843 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 protein_id gnl|my_center|LOCUS_37740 4026424 4025540 gene locus_tag LOCUS_37750 4026424 4025540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728923.1 protein_id gnl|my_center|LOCUS_37750 4027535 4026417 gene locus_tag LOCUS_37760 4027535 4026417 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894640.1 protein_id gnl|my_center|LOCUS_37760 4028494 4027532 gene locus_tag LOCUS_37770 4028494 4027532 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227932.1 protein_id gnl|my_center|LOCUS_37770 4029594 4028581 gene locus_tag LOCUS_37780 4029594 4028581 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877617.1 protein_id gnl|my_center|LOCUS_37780 4030553 4029918 gene locus_tag LOCUS_37790 4030553 4029918 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408045.1 protein_id gnl|my_center|LOCUS_37790 4030806 4030891 gene locus_tag LOCUS_t00310 4030806 4030891 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4031573 4031073 gene locus_tag LOCUS_37800 4031573 4031073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 4033224 4031710 gene locus_tag LOCUS_37810 4033224 4031710 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205212.1 protein_id gnl|my_center|LOCUS_37810 4034198 4033239 gene locus_tag LOCUS_37820 4034198 4033239 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227077.1 protein_id gnl|my_center|LOCUS_37820 4035196 4034300 gene locus_tag LOCUS_37830 4035196 4034300 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246070.1 protein_id gnl|my_center|LOCUS_37830 4035483 4036481 gene locus_tag LOCUS_37840 4035483 4036481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 4036965 4036516 gene locus_tag LOCUS_37850 4036965 4036516 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_37850 4039955 4037007 gene locus_tag LOCUS_37860 4039955 4037007 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_37860 4040827 4040027 gene locus_tag LOCUS_37870 4040827 4040027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_37870 4041843 4040824 gene locus_tag LOCUS_37880 gene fepG 4041843 4040824 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817186.1 protein_id gnl|my_center|LOCUS_37880 4042850 4041840 gene locus_tag LOCUS_37890 gene fepD 4042850 4041840 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346359.1 protein_id gnl|my_center|LOCUS_37890 4043830 4042847 gene locus_tag LOCUS_37900 4043830 4042847 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787743.1 protein_id gnl|my_center|LOCUS_37900 4044711 4043839 gene locus_tag LOCUS_37910 4044711 4043839 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926652.1 protein_id gnl|my_center|LOCUS_37910 4045251 4044802 gene locus_tag LOCUS_37920 4045251 4044802 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027303.1 protein_id gnl|my_center|LOCUS_37920 4045768 4045325 gene locus_tag LOCUS_37930 4045768 4045325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 4046633 4046088 gene locus_tag LOCUS_37940 4046633 4046088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 4046790 4047875 gene locus_tag LOCUS_37950 4046790 4047875 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_37950 4047973 4048263 gene locus_tag LOCUS_37960 4047973 4048263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 4049458 4048520 gene locus_tag LOCUS_37970 4049458 4048520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 4049570 4050178 gene locus_tag LOCUS_37980 4049570 4050178 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_37980 4050636 4050181 gene locus_tag LOCUS_37990 4050636 4050181 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_37990 4051126 4050647 gene locus_tag LOCUS_38000 4051126 4050647 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031876.1 protein_id gnl|my_center|LOCUS_38000 4051208 4051816 gene locus_tag LOCUS_38010 4051208 4051816 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_38010 4052006 4051803 gene locus_tag LOCUS_38020 4052006 4051803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 4052591 4052028 gene locus_tag LOCUS_38030 4052591 4052028 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_38030 4055621 4052742 gene locus_tag LOCUS_38040 4055621 4052742 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_38040 4055816 4056241 gene locus_tag LOCUS_38050 4055816 4056241 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_38050 4057126 4056251 gene locus_tag LOCUS_38060 4057126 4056251 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_38060 4056853 4056767 gene locus_tag LOCUS_t00320 4056853 4056767 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4058553 4057123 gene locus_tag LOCUS_38070 gene pyk 4058553 4057123 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728910.1 protein_id gnl|my_center|LOCUS_38070 4059110 4058652 gene locus_tag LOCUS_38080 4059110 4058652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 4060601 4059135 gene locus_tag LOCUS_38090 4060601 4059135 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728909.1 protein_id gnl|my_center|LOCUS_38090 4065102 4060594 gene locus_tag LOCUS_38100 gene gltB 4065102 4060594 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_38100 4065365 4066243 gene locus_tag LOCUS_38110 4065365 4066243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 4066377 4067144 gene locus_tag LOCUS_38120 4066377 4067144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 4067765 4067211 gene locus_tag LOCUS_38130 4067765 4067211 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_38130 4068557 4067937 gene locus_tag LOCUS_38140 4068557 4067937 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 protein_id gnl|my_center|LOCUS_38140 4069762 4068554 gene locus_tag LOCUS_38150 4069762 4068554 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029547.1 protein_id gnl|my_center|LOCUS_38150 4069959 4070513 gene locus_tag LOCUS_38160 4069959 4070513 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974701.1 protein_id gnl|my_center|LOCUS_38160 4070516 4071181 gene locus_tag LOCUS_38170 4070516 4071181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 4072995 4071241 gene locus_tag LOCUS_38180 4072995 4071241 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_38180 4073270 4072992 gene locus_tag LOCUS_38190 4073270 4072992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 4074847 4073510 gene locus_tag LOCUS_38200 gene hisS 4074847 4073510 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_38200 4075602 4074907 gene locus_tag LOCUS_38210 4075602 4074907 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_38210 4075786 4076112 gene locus_tag LOCUS_38220 4075786 4076112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 4076143 4077060 gene locus_tag LOCUS_38230 4076143 4077060 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728734.1 protein_id gnl|my_center|LOCUS_38230 4077173 4079536 gene locus_tag LOCUS_38240 4077173 4079536 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227116.1 protein_id gnl|my_center|LOCUS_38240 4079606 4079881 gene locus_tag LOCUS_38250 4079606 4079881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 4081203 4079953 gene locus_tag LOCUS_38260 gene secF 4081203 4079953 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090079.1 protein_id gnl|my_center|LOCUS_38260 4083177 4081207 gene locus_tag LOCUS_38270 4083177 4081207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 4083689 4083279 gene locus_tag LOCUS_38280 4083689 4083279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 4085002 4083923 gene locus_tag LOCUS_38290 gene ruvB 4085002 4083923 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467235.1 protein_id gnl|my_center|LOCUS_38290 4085604 4085002 gene locus_tag LOCUS_38300 gene ruvA 4085604 4085002 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_38300 4086131 4085601 gene locus_tag LOCUS_38310 gene ruvC 4086131 4085601 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_38310 4086308 4087057 gene locus_tag LOCUS_38320 4086308 4087057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 4087230 4088471 gene locus_tag LOCUS_38330 4087230 4088471 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_38330 4088493 4089164 gene locus_tag LOCUS_38340 4088493 4089164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 4089197 4090273 gene locus_tag LOCUS_38350 gene menC 4089197 4090273 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_38350 4090316 4092052 gene locus_tag LOCUS_38360 4090316 4092052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 4092059 4092691 gene locus_tag LOCUS_38370 4092059 4092691 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977779.1 protein_id gnl|my_center|LOCUS_38370 4092708 4093280 gene locus_tag LOCUS_38380 4092708 4093280 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818608.1 protein_id gnl|my_center|LOCUS_38380 4093296 4095773 gene locus_tag LOCUS_38390 4093296 4095773 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031722.1 protein_id gnl|my_center|LOCUS_38390 4095829 4096467 gene locus_tag LOCUS_38400 4095829 4096467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 4097434 4096469 gene locus_tag LOCUS_38410 gene corA 4097434 4096469 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_38410 4099147 4097459 gene locus_tag LOCUS_38420 4099147 4097459 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086255.1 protein_id gnl|my_center|LOCUS_38420 4100789 4099149 gene locus_tag LOCUS_38430 gene aspD 4100789 4099149 CDS product aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948813.1 protein_id gnl|my_center|LOCUS_38430 4102507 4100810 gene locus_tag LOCUS_38440 gene aspT 4102507 4100810 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786308.1 protein_id gnl|my_center|LOCUS_38440 4103181 4102594 gene locus_tag LOCUS_38450 4103181 4102594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 4105618 4103306 gene locus_tag LOCUS_38460 4105618 4103306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_38460 4106292 4105615 gene locus_tag LOCUS_38470 4106292 4105615 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_38470 4106813 4106289 gene locus_tag LOCUS_38480 4106813 4106289 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_38480 4106934 4107389 gene locus_tag LOCUS_38490 4106934 4107389 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_38490 4107476 4108030 gene locus_tag LOCUS_38500 4107476 4108030 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111966.1 protein_id gnl|my_center|LOCUS_38500 4108044 4108922 gene locus_tag LOCUS_38510 4108044 4108922 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_38510 4110327 4108927 gene locus_tag LOCUS_38520 4110327 4108927 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055089.1 protein_id gnl|my_center|LOCUS_38520 4110632 4110324 gene locus_tag LOCUS_38530 4110632 4110324 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_38530 4111774 4110632 gene locus_tag LOCUS_38540 4111774 4110632 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816824.1 protein_id gnl|my_center|LOCUS_38540 4112043 4112555 gene locus_tag LOCUS_38550 4112043 4112555 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_38550 4112558 4113421 gene locus_tag LOCUS_38560 4112558 4113421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 4113574 4114848 gene locus_tag LOCUS_38570 4113574 4114848 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093954241.1 protein_id gnl|my_center|LOCUS_38570 4114929 4115447 gene locus_tag LOCUS_38580 4114929 4115447 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_38580 4115444 4116415 gene locus_tag LOCUS_38590 4115444 4116415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 4118342 4116420 gene locus_tag LOCUS_38600 4118342 4116420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_38600 4119169 4118411 gene locus_tag LOCUS_38610 4119169 4118411 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_38610 4119507 4119280 gene locus_tag LOCUS_38620 4119507 4119280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 4119639 4120970 gene locus_tag LOCUS_38630 4119639 4120970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230051.1 protein_id gnl|my_center|LOCUS_38630 4121005 4121208 gene locus_tag LOCUS_38640 4121005 4121208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 4121287 4121871 gene locus_tag LOCUS_38650 4121287 4121871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 4121871 4124282 gene locus_tag LOCUS_38660 4121871 4124282 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38660 4124373 4127318 gene locus_tag LOCUS_38670 4124373 4127318 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_38670 4129210 4128275 gene locus_tag LOCUS_38680 4129210 4128275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 4131309 4129207 gene locus_tag LOCUS_38690 gene cdtC 4131309 4129207 CDS product siderophore ABC transporter permease CdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031636.1 protein_id gnl|my_center|LOCUS_38690 4132292 4131315 gene locus_tag LOCUS_38700 gene cdtB 4132292 4131315 CDS product siderophore ABC transporter substrate-binding protein CdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971744.1 protein_id gnl|my_center|LOCUS_38700 4133172 4132333 gene locus_tag LOCUS_38710 gene cdtA 4133172 4132333 CDS product siderophore ABC transporter ATP-binding protein CdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971743.1 protein_id gnl|my_center|LOCUS_38710 4134426 4133314 gene locus_tag LOCUS_38720 4134426 4133314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 4134842 4134477 gene locus_tag LOCUS_38730 4134842 4134477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 4135168 4134839 gene locus_tag LOCUS_38740 4135168 4134839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 4136832 4135165 gene locus_tag LOCUS_38750 4136832 4135165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 4137243 4136839 gene locus_tag LOCUS_38760 4137243 4136839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 4137424 4140243 gene locus_tag LOCUS_38770 4137424 4140243 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086843344.1 protein_id gnl|my_center|LOCUS_38770 4141460 4140477 gene locus_tag LOCUS_38780 4141460 4140477 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_38780 4142644 4141457 gene locus_tag LOCUS_38790 4142644 4141457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 4143106 4142651 gene locus_tag LOCUS_38800 gene ruvX 4143106 4142651 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 protein_id gnl|my_center|LOCUS_38800 4145760 4143103 gene locus_tag LOCUS_38810 gene alaS 4145760 4143103 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093585.1 protein_id gnl|my_center|LOCUS_38810 4146057 4145794 gene locus_tag LOCUS_38820 4146057 4145794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 4146570 4146067 gene locus_tag LOCUS_38830 4146570 4146067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 4147237 4146698 gene locus_tag LOCUS_38840 4147237 4146698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 4148580 4147234 gene locus_tag LOCUS_38850 4148580 4147234 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224577.1 protein_id gnl|my_center|LOCUS_38850 4149153 4148650 gene locus_tag LOCUS_38860 4149153 4148650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 4152378 4149406 gene locus_tag LOCUS_38870 4152378 4149406 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223622.1 protein_id gnl|my_center|LOCUS_38870 4152989 4152468 gene locus_tag LOCUS_38880 gene def 4152989 4152468 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974385.1 protein_id gnl|my_center|LOCUS_38880 4153696 4153091 gene locus_tag LOCUS_38890 4153696 4153091 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729327.1 protein_id gnl|my_center|LOCUS_38890 4154640 4153696 gene locus_tag LOCUS_38900 4154640 4153696 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027390.1 protein_id gnl|my_center|LOCUS_38900 4155643 4154726 gene locus_tag LOCUS_38910 4155643 4154726 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030042.1 protein_id gnl|my_center|LOCUS_38910 4155759 4156658 gene locus_tag LOCUS_38920 4155759 4156658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 4158804 4156669 gene locus_tag LOCUS_38930 4158804 4156669 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_38930 4160010 4158808 gene locus_tag LOCUS_38940 4160010 4158808 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_38940 4161326 4160136 gene locus_tag LOCUS_38950 4161326 4160136 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227533.1 protein_id gnl|my_center|LOCUS_38950 4161912 4161328 gene locus_tag LOCUS_38960 4161912 4161328 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227534.1 protein_id gnl|my_center|LOCUS_38960 4162748 4162011 gene locus_tag LOCUS_38970 4162748 4162011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 4162915 4162748 gene locus_tag LOCUS_38980 4162915 4162748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 4163624 4163070 gene locus_tag LOCUS_38990 4163624 4163070 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221499929.1 protein_id gnl|my_center|LOCUS_38990 4164641 4163658 gene locus_tag LOCUS_39000 4164641 4163658 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_39000 4165850 4164708 gene locus_tag LOCUS_39010 4165850 4164708 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225686.1 protein_id gnl|my_center|LOCUS_39010 4167003 4165861 gene locus_tag LOCUS_39020 4167003 4165861 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081873.1 protein_id gnl|my_center|LOCUS_39020 4167301 4168332 gene locus_tag LOCUS_39030 gene trpS 4167301 4168332 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804845.1 protein_id gnl|my_center|LOCUS_39030 4168502 4169200 gene locus_tag LOCUS_39040 4168502 4169200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 4170983 4169415 gene locus_tag LOCUS_39050 4170983 4169415 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140648.1 protein_id gnl|my_center|LOCUS_39050 4172456 4171005 gene locus_tag LOCUS_39060 4172456 4171005 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228142.1 protein_id gnl|my_center|LOCUS_39060 4173145 4172453 gene locus_tag LOCUS_39070 4173145 4172453 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228141.1 protein_id gnl|my_center|LOCUS_39070 4174438 4173260 gene locus_tag LOCUS_39080 4174438 4173260 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228549.1 protein_id gnl|my_center|LOCUS_39080 4174576 4174998 gene locus_tag LOCUS_39090 4174576 4174998 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228548.1 protein_id gnl|my_center|LOCUS_39090 4176018 4175008 gene locus_tag LOCUS_39100 4176018 4175008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 4176137 4176796 gene locus_tag LOCUS_39110 4176137 4176796 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_39110 4177296 4176802 gene locus_tag LOCUS_39120 4177296 4176802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 4177446 4177847 gene locus_tag LOCUS_39130 gene msrB 4177446 4177847 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_39130 4177869 4178354 gene locus_tag LOCUS_39140 4177869 4178354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 4179679 4178351 gene locus_tag LOCUS_39150 4179679 4178351 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576225.1 protein_id gnl|my_center|LOCUS_39150 4179831 4180214 gene locus_tag LOCUS_39160 4179831 4180214 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_39160 4181616 4180198 gene locus_tag LOCUS_39170 4181616 4180198 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 protein_id gnl|my_center|LOCUS_39170 4182351 4181755 gene locus_tag LOCUS_39180 4182351 4181755 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222250.1 protein_id gnl|my_center|LOCUS_39180 4183265 4182420 gene locus_tag LOCUS_39190 4183265 4182420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 4183445 4184176 gene locus_tag LOCUS_39200 4183445 4184176 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224370.1 protein_id gnl|my_center|LOCUS_39200 4185797 4184310 gene locus_tag LOCUS_39210 4185797 4184310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 4186244 4185849 gene locus_tag LOCUS_39220 4186244 4185849 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973421.1 protein_id gnl|my_center|LOCUS_39220 4186380 4187234 gene locus_tag LOCUS_39230 4186380 4187234 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210906.1 protein_id gnl|my_center|LOCUS_39230 4188020 4187463 gene locus_tag LOCUS_39240 4188020 4187463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 4189396 4188017 gene locus_tag LOCUS_39250 4189396 4188017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 4189911 4189396 gene locus_tag LOCUS_39260 4189911 4189396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 4191086 4189908 gene locus_tag LOCUS_39270 4191086 4189908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 4191251 4191439 gene locus_tag LOCUS_39280 4191251 4191439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39280 4191506 4192261 gene locus_tag LOCUS_39290 4191506 4192261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39290 4192990 4192265 gene locus_tag LOCUS_39300 4192990 4192265 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_39300 4193687 4193031 gene locus_tag LOCUS_39310 4193687 4193031 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894739.1 protein_id gnl|my_center|LOCUS_39310 4195143 4193710 gene locus_tag LOCUS_39320 gene hemG 4195143 4193710 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_39320 4196177 4195140 gene locus_tag LOCUS_39330 gene hemE 4196177 4195140 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_39330 4196491 4196270 gene locus_tag LOCUS_39340 4196491 4196270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 4197382 4196567 gene locus_tag LOCUS_39350 4197382 4196567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 4198807 4197437 gene locus_tag LOCUS_39360 4198807 4197437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 4198987 4199181 gene locus_tag LOCUS_39370 4198987 4199181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 4199690 4199490 gene locus_tag LOCUS_39380 4199690 4199490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 4200094 4199747 gene locus_tag LOCUS_39390 gene arsC 4200094 4199747 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971663.1 protein_id gnl|my_center|LOCUS_39390 4201458 4200091 gene locus_tag LOCUS_39400 4201458 4200091 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968097.1 protein_id gnl|my_center|LOCUS_39400 4202018 4201455 gene locus_tag LOCUS_39410 4202018 4201455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 4202531 4202130 gene locus_tag LOCUS_39420 4202531 4202130 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030951.1 protein_id gnl|my_center|LOCUS_39420 4203371 4202553 gene locus_tag LOCUS_39430 gene mmsB 4203371 4202553 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403844.1 protein_id gnl|my_center|LOCUS_39430 4203491 4204423 gene locus_tag LOCUS_39440 4203491 4204423 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466733.1 protein_id gnl|my_center|LOCUS_39440 4204473 4205825 gene locus_tag LOCUS_39450 4204473 4205825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 4207560 4206070 gene locus_tag LOCUS_39460 4207560 4206070 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_39460 4207880 4208218 gene locus_tag LOCUS_39470 4207880 4208218 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081521.1 protein_id gnl|my_center|LOCUS_39470 4208850 4208233 gene locus_tag LOCUS_39480 4208850 4208233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 4211493 4209673 gene locus_tag LOCUS_39490 gene lnt 4211493 4209673 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_39490 4210738 4210646 gene locus_tag LOCUS_t00330 4210738 4210646 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4213486 4212044 gene locus_tag LOCUS_39500 gene glmL 4213486 4212044 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_39500 4213869 4213483 gene locus_tag LOCUS_39510 4213869 4213483 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_39510 4214612 4213866 gene locus_tag LOCUS_39520 4214612 4213866 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_39520 4216186 4214609 gene locus_tag LOCUS_39530 4216186 4214609 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_39530 4217730 4216192 gene locus_tag LOCUS_39540 4217730 4216192 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_39540 4218866 4217736 gene locus_tag LOCUS_39550 gene kdd 4218866 4217736 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_39550 4218984 4220411 gene locus_tag LOCUS_39560 4218984 4220411 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_39560 4220528 4221484 gene locus_tag LOCUS_39570 4220528 4221484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 4221589 4222134 gene locus_tag LOCUS_39580 4221589 4222134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 4222264 4222350 gene locus_tag LOCUS_t00340 4222264 4222350 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4222667 4223116 gene locus_tag LOCUS_39590 4222667 4223116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 4223122 4223607 gene locus_tag LOCUS_39600 4223122 4223607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 4223718 4224296 gene locus_tag LOCUS_39610 4223718 4224296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 4224698 4224279 gene locus_tag LOCUS_39620 4224698 4224279 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_39620 4224782 4225288 gene locus_tag LOCUS_39630 4224782 4225288 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_39630 4225427 4225729 gene locus_tag LOCUS_39640 4225427 4225729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 4225940 4225755 gene locus_tag LOCUS_39650 4225940 4225755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 4226658 4226053 gene locus_tag LOCUS_39660 4226658 4226053 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927004.1 protein_id gnl|my_center|LOCUS_39660 4226911 4227141 gene locus_tag LOCUS_39670 4226911 4227141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 4227192 4228103 gene locus_tag LOCUS_39680 4227192 4228103 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226439.1 protein_id gnl|my_center|LOCUS_39680 4230737 4228110 gene locus_tag LOCUS_39690 4230737 4228110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 4233901 4230761 gene locus_tag LOCUS_39700 4233901 4230761 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230032.1 protein_id gnl|my_center|LOCUS_39700 4234806 4233904 gene locus_tag LOCUS_39710 4234806 4233904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 4235027 4235686 gene locus_tag LOCUS_39720 4235027 4235686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4235757 4236317 gene locus_tag LOCUS_39730 4235757 4236317 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_39730 4236371 4236910 gene locus_tag LOCUS_39740 4236371 4236910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 4239440 4236915 gene locus_tag LOCUS_39750 gene hrpB 4239440 4236915 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_39750 4241193 4239748 gene locus_tag LOCUS_39760 4241193 4239748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 4241639 4241190 gene locus_tag LOCUS_39770 4241639 4241190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 4243767 4241653 gene locus_tag LOCUS_39780 4243767 4241653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 4244143 4243757 gene locus_tag LOCUS_39790 4244143 4243757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 4244281 4247169 gene locus_tag LOCUS_39800 4244281 4247169 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_39800 4248952 4247180 gene locus_tag LOCUS_39810 4248952 4247180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_39810 4250778 4248949 gene locus_tag LOCUS_39820 4250778 4248949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_39820 4250988 4251599 gene locus_tag LOCUS_39830 4250988 4251599 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230583.1 protein_id gnl|my_center|LOCUS_39830 4251905 4251726 gene locus_tag LOCUS_39840 4251905 4251726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 4252582 4251911 gene locus_tag LOCUS_39850 4252582 4251911 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031135.1 protein_id gnl|my_center|LOCUS_39850 4252779 4253537 gene locus_tag LOCUS_39860 4252779 4253537 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894112.1 protein_id gnl|my_center|LOCUS_39860 4253617 4254537 gene locus_tag LOCUS_39870 4253617 4254537 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030447.1 protein_id gnl|my_center|LOCUS_39870 4254604 4255266 gene locus_tag LOCUS_39880 4254604 4255266 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894110.1 protein_id gnl|my_center|LOCUS_39880 4255286 4256218 gene locus_tag LOCUS_39890 4255286 4256218 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090302.1 protein_id gnl|my_center|LOCUS_39890 4256300 4257073 gene locus_tag LOCUS_39900 4256300 4257073 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029112.1 protein_id gnl|my_center|LOCUS_39900 4257849 4257085 gene locus_tag LOCUS_39910 gene hisF 4257849 4257085 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111203.1 protein_id gnl|my_center|LOCUS_39910 4258014 4261001 gene locus_tag LOCUS_39920 4258014 4261001 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228238.1 protein_id gnl|my_center|LOCUS_39920 4261642 4261004 gene locus_tag LOCUS_39930 4261642 4261004 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_39930 4262041 4261652 gene locus_tag LOCUS_39940 4262041 4261652 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_39940 4262769 4262038 gene locus_tag LOCUS_39950 gene priA 4262769 4262038 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_39950 4263386 4262769 gene locus_tag LOCUS_39960 gene hisH 4263386 4262769 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407952.1 protein_id gnl|my_center|LOCUS_39960 4263535 4263374 gene locus_tag LOCUS_39970 4263535 4263374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 4264147 4263536 gene locus_tag LOCUS_39980 gene hisB 4264147 4263536 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_39980 4265229 4264144 gene locus_tag LOCUS_39990 4265229 4264144 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_39990 4266608 4265226 gene locus_tag LOCUS_40000 gene hisD 4266608 4265226 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_40000 4267385 4266624 gene locus_tag LOCUS_40010 4267385 4266624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 4268449 4267445 gene locus_tag LOCUS_40020 4268449 4267445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 4269559 4268621 gene locus_tag LOCUS_40030 4269559 4268621 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_40030 4270139 4269552 gene locus_tag LOCUS_40040 gene lspA 4270139 4269552 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947675.1 protein_id gnl|my_center|LOCUS_40040 4270646 4270179 gene locus_tag LOCUS_40050 4270646 4270179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 4271459 4270848 gene locus_tag LOCUS_40060 4271459 4270848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 4272382 4271618 gene locus_tag LOCUS_40070 gene wag31 4272382 4271618 CDS product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411131.1 protein_id gnl|my_center|LOCUS_40070 4272747 4272463 gene locus_tag LOCUS_40080 4272747 4272463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 4273411 4272830 gene locus_tag LOCUS_40090 gene sepF 4273411 4272830 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_40090 4274213 4273464 gene locus_tag LOCUS_40100 4274213 4273464 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 protein_id gnl|my_center|LOCUS_40100 4275328 4274210 gene locus_tag LOCUS_40110 gene ftsZ 4275328 4274210 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224820.1 protein_id gnl|my_center|LOCUS_40110 4276163 4275459 gene locus_tag LOCUS_40120 gene ftsQ 4276163 4275459 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976732.1 protein_id gnl|my_center|LOCUS_40120 4277587 4276166 gene locus_tag LOCUS_40130 gene murC 4277587 4276166 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 protein_id gnl|my_center|LOCUS_40130 4278702 4277584 gene locus_tag LOCUS_40140 gene murG 4278702 4277584 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_40140 4279982 4278699 gene locus_tag LOCUS_40150 4279982 4278699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 4281346 4279982 gene locus_tag LOCUS_40160 gene murD 4281346 4279982 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228039.1 protein_id gnl|my_center|LOCUS_40160 4282450 4281353 gene locus_tag LOCUS_40170 gene mraY 4282450 4281353 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_40170 4283838 4282447 gene locus_tag LOCUS_40180 4283838 4282447 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_40180 4285341 4283854 gene locus_tag LOCUS_40190 4285341 4283854 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228042.1 protein_id gnl|my_center|LOCUS_40190 4285641 4287248 gene locus_tag LOCUS_40200 4285641 4287248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 4287492 4288487 gene locus_tag LOCUS_40210 4287492 4288487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 4288693 4289892 gene locus_tag LOCUS_40220 4288693 4289892 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_40220 4291283 4289949 gene locus_tag LOCUS_40230 4291283 4289949 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_40230 4291987 4291280 gene locus_tag LOCUS_40240 4291987 4291280 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_40240 4292221 4291997 gene locus_tag LOCUS_40250 4292221 4291997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 4292127 4292531 gene locus_tag LOCUS_40260 4292127 4292531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 4292857 4292507 gene locus_tag LOCUS_40270 4292857 4292507 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224358.1 protein_id gnl|my_center|LOCUS_40270 4293244 4292867 gene locus_tag LOCUS_40280 4293244 4292867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898833.1 protein_id gnl|my_center|LOCUS_40280 4293311 4294303 gene locus_tag LOCUS_40290 4293311 4294303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 4295136 4294300 gene locus_tag LOCUS_40300 4295136 4294300 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_40300 4296350 4295160 gene locus_tag LOCUS_40310 4296350 4295160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 4296483 4297211 gene locus_tag LOCUS_40320 4296483 4297211 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_40320 4297268 4299010 gene locus_tag LOCUS_40330 4297268 4299010 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223609.1 protein_id gnl|my_center|LOCUS_40330 4299020 4300183 gene locus_tag LOCUS_40340 4299020 4300183 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223610.1 protein_id gnl|my_center|LOCUS_40340 4300187 4302619 gene locus_tag LOCUS_40350 4300187 4302619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 4302629 4303561 gene locus_tag LOCUS_40360 4302629 4303561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223613.1 protein_id gnl|my_center|LOCUS_40360 4304091 4303558 gene locus_tag LOCUS_40370 4304091 4303558 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319925.1 protein_id gnl|my_center|LOCUS_40370 4304154 4304363 gene locus_tag LOCUS_40380 4304154 4304363 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_40380 4304365 4304892 gene locus_tag LOCUS_40390 4304365 4304892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 4306320 4304941 gene locus_tag LOCUS_40400 4306320 4304941 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803769.1 protein_id gnl|my_center|LOCUS_40400 4308185 4306410 gene locus_tag LOCUS_40410 4308185 4306410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_40410 4308776 4308276 gene locus_tag LOCUS_40420 4308776 4308276 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449652.1 protein_id gnl|my_center|LOCUS_40420 4310112 4308883 gene locus_tag LOCUS_40430 4310112 4308883 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_40430 4310268 4310882 gene locus_tag LOCUS_40440 4310268 4310882 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 protein_id gnl|my_center|LOCUS_40440 4310879 4311325 gene locus_tag LOCUS_40450 4310879 4311325 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 protein_id gnl|my_center|LOCUS_40450 4311364 4312455 gene locus_tag LOCUS_40460 4311364 4312455 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223033.1 protein_id gnl|my_center|LOCUS_40460 4313520 4312603 gene locus_tag LOCUS_40470 4313520 4312603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304036.1 protein_id gnl|my_center|LOCUS_40470 4314346 4313558 gene locus_tag LOCUS_40480 4314346 4313558 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_40480 4314545 4315396 gene locus_tag LOCUS_40490 4314545 4315396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 4316376 4315393 gene locus_tag LOCUS_40500 4316376 4315393 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222870.1 protein_id gnl|my_center|LOCUS_40500 4316474 4317244 gene locus_tag LOCUS_40510 4316474 4317244 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730620.1 protein_id gnl|my_center|LOCUS_40510 4317286 4318065 gene locus_tag LOCUS_40520 4317286 4318065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 4318689 4318069 gene locus_tag LOCUS_40530 4318689 4318069 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_40530 4319403 4318738 gene locus_tag LOCUS_40540 4319403 4318738 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_40540 4319507 4320232 gene locus_tag LOCUS_40550 4319507 4320232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 4320229 4320942 gene locus_tag LOCUS_40560 4320229 4320942 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_40560 4322068 4320902 gene locus_tag LOCUS_40570 4322068 4320902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 4322622 4327694 gene locus_tag LOCUS_40580 4322622 4327694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 4327691 4330615 gene locus_tag LOCUS_40590 4327691 4330615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 4330620 4330826 gene locus_tag LOCUS_40600 4330620 4330826 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226625.1 protein_id gnl|my_center|LOCUS_40600 4330819 4331598 gene locus_tag LOCUS_40610 4330819 4331598 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230025.1 protein_id gnl|my_center|LOCUS_40610 4331595 4333256 gene locus_tag LOCUS_40620 4331595 4333256 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_40620 4333253 4335790 gene locus_tag LOCUS_40630 4333253 4335790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 4335799 4337511 gene locus_tag LOCUS_40640 4335799 4337511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_40640 4337508 4339247 gene locus_tag LOCUS_40650 4337508 4339247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030252.1 protein_id gnl|my_center|LOCUS_40650 4339983 4339282 gene locus_tag LOCUS_40660 4339983 4339282 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_40660 4340214 4341422 gene locus_tag LOCUS_40670 4340214 4341422 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226160.1 protein_id gnl|my_center|LOCUS_40670 4343179 4341533 gene locus_tag LOCUS_40680 gene xylB 4343179 4341533 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_40680 4344879 4343176 gene locus_tag LOCUS_40690 gene glpD 4344879 4343176 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_40690 4345526 4344876 gene locus_tag LOCUS_40700 4345526 4344876 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230414.1 protein_id gnl|my_center|LOCUS_40700 4346299 4345535 gene locus_tag LOCUS_40710 4346299 4345535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 4347744 4346296 gene locus_tag LOCUS_40720 4347744 4346296 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533071.1 protein_id gnl|my_center|LOCUS_40720 4348789 4347746 gene locus_tag LOCUS_40730 4348789 4347746 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 protein_id gnl|my_center|LOCUS_40730 4349868 4348786 gene locus_tag LOCUS_40740 4349868 4348786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728940.1 protein_id gnl|my_center|LOCUS_40740 4350341 4349865 gene locus_tag LOCUS_40750 gene derI1 4350341 4349865 CDS product D-erythrulose 4-phosphate isomerase DerI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728942.1 protein_id gnl|my_center|LOCUS_40750 4350649 4350332 gene locus_tag LOCUS_40760 4350649 4350332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 4352505 4350646 gene locus_tag LOCUS_40770 gene derK 4352505 4350646 CDS product D-erythrulose 4-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728941.1 protein_id gnl|my_center|LOCUS_40770 4353176 4352517 gene locus_tag LOCUS_40780 4353176 4352517 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230987.1 protein_id gnl|my_center|LOCUS_40780 4353964 4353176 gene locus_tag LOCUS_40790 4353964 4353176 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969785.1 protein_id gnl|my_center|LOCUS_40790 4355073 4353961 gene locus_tag LOCUS_40800 4355073 4353961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728939.1 protein_id gnl|my_center|LOCUS_40800 4355939 4355073 gene locus_tag LOCUS_40810 4355939 4355073 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894672.1 protein_id gnl|my_center|LOCUS_40810 4356898 4355945 gene locus_tag LOCUS_40820 4356898 4355945 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894671.1 protein_id gnl|my_center|LOCUS_40820 4358322 4356898 gene locus_tag LOCUS_40830 4358322 4356898 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104316.1 protein_id gnl|my_center|LOCUS_40830 4359065 4358418 gene locus_tag LOCUS_40840 gene cobC 4359065 4358418 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_40840 4360687 4359062 gene locus_tag LOCUS_40850 4360687 4359062 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928604.1 protein_id gnl|my_center|LOCUS_40850 4361544 4360777 gene locus_tag LOCUS_40860 4361544 4360777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_40860 4362204 4361623 gene locus_tag LOCUS_40870 4362204 4361623 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727712.1 protein_id gnl|my_center|LOCUS_40870 4362795 4362256 gene locus_tag LOCUS_40880 4362795 4362256 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817484.1 protein_id gnl|my_center|LOCUS_40880 4363193 4362822 gene locus_tag LOCUS_40890 4363193 4362822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 4363250 4364242 gene locus_tag LOCUS_40900 4363250 4364242 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_40900 4365071 4364250 gene locus_tag LOCUS_40910 4365071 4364250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 4365298 4366371 gene locus_tag LOCUS_40920 4365298 4366371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 4366622 4366449 gene locus_tag LOCUS_40930 4366622 4366449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 4367442 4366612 gene locus_tag LOCUS_40940 4367442 4366612 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_40940 4367620 4367898 gene locus_tag LOCUS_40950 4367620 4367898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 4368272 4367970 gene locus_tag LOCUS_40960 4368272 4367970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 4368929 4368309 gene locus_tag LOCUS_40970 4368929 4368309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 4369345 4368932 gene locus_tag LOCUS_40980 4369345 4368932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 4369560 4369342 gene locus_tag LOCUS_40990 4369560 4369342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 4369803 4370393 gene locus_tag LOCUS_41000 4369803 4370393 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 protein_id gnl|my_center|LOCUS_41000 4370390 4371046 gene locus_tag LOCUS_41010 4370390 4371046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 4371162 4371764 gene locus_tag LOCUS_41020 4371162 4371764 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_41020 4371771 4372169 gene locus_tag LOCUS_41030 4371771 4372169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 4372185 4373006 gene locus_tag LOCUS_41040 4372185 4373006 CDS product APH(3'') family aminoglycoside O-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110890.1 protein_id gnl|my_center|LOCUS_41040 4373359 4373003 gene locus_tag LOCUS_41050 4373359 4373003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 4373267 4373638 gene locus_tag LOCUS_41060 4373267 4373638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 4374581 4373592 gene locus_tag LOCUS_41070 4374581 4373592 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970674.1 protein_id gnl|my_center|LOCUS_41070 4374862 4374578 gene locus_tag LOCUS_41080 4374862 4374578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 4375406 4374855 gene locus_tag LOCUS_41090 4375406 4374855 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225037.1 protein_id gnl|my_center|LOCUS_41090 4375624 4376475 gene locus_tag LOCUS_41100 4375624 4376475 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229456.1 protein_id gnl|my_center|LOCUS_41100 4376543 4377166 gene locus_tag LOCUS_41110 4376543 4377166 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466933.1 protein_id gnl|my_center|LOCUS_41110 4377221 4378411 gene locus_tag LOCUS_41120 4377221 4378411 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225094.1 protein_id gnl|my_center|LOCUS_41120 4378617 4378874 gene locus_tag LOCUS_41130 4378617 4378874 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225095.1 protein_id gnl|my_center|LOCUS_41130 4378874 4380376 gene locus_tag LOCUS_41140 4378874 4380376 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030798.1 protein_id gnl|my_center|LOCUS_41140 4380373 4381296 gene locus_tag LOCUS_41150 4380373 4381296 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225097.1 protein_id gnl|my_center|LOCUS_41150 4381401 4382354 gene locus_tag LOCUS_41160 4381401 4382354 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225098.1 protein_id gnl|my_center|LOCUS_41160 4382454 4383899 gene locus_tag LOCUS_41170 4382454 4383899 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398698.1 protein_id gnl|my_center|LOCUS_41170 4383931 4385445 gene locus_tag LOCUS_41180 4383931 4385445 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 protein_id gnl|my_center|LOCUS_41180 4386072 4385461 gene locus_tag LOCUS_41190 4386072 4385461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 4386937 4386131 gene locus_tag LOCUS_41200 gene hisN 4386937 4386131 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618313.1 protein_id gnl|my_center|LOCUS_41200 4387955 4387029 gene locus_tag LOCUS_41210 4387955 4387029 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804125.1 protein_id gnl|my_center|LOCUS_41210 4389677 4388079 gene locus_tag LOCUS_41220 4389677 4388079 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184859936.1 protein_id gnl|my_center|LOCUS_41220 4390768 4389674 gene locus_tag LOCUS_41230 4390768 4389674 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224082.1 protein_id gnl|my_center|LOCUS_41230 4391588 4390773 gene locus_tag LOCUS_41240 4391588 4390773 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086661.1 protein_id gnl|my_center|LOCUS_41240 4392310 4391708 gene locus_tag LOCUS_41250 4392310 4391708 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411389.1 protein_id gnl|my_center|LOCUS_41250 4392538 4392933 gene locus_tag LOCUS_41260 4392538 4392933 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 protein_id gnl|my_center|LOCUS_41260 4392946 4393992 gene locus_tag LOCUS_41270 gene trpD 4392946 4393992 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_41270 4394058 4394603 gene locus_tag LOCUS_41280 4394058 4394603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 4394656 4394940 gene locus_tag LOCUS_41290 4394656 4394940 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224084.1 protein_id gnl|my_center|LOCUS_41290 4395921 4395049 gene locus_tag LOCUS_41300 4395921 4395049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 4396756 4396043 gene locus_tag LOCUS_41310 4396756 4396043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 4397303 4396875 gene locus_tag LOCUS_41320 4397303 4396875 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224074.1 protein_id gnl|my_center|LOCUS_41320 4398121 4397312 gene locus_tag LOCUS_41330 4398121 4397312 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466782.1 protein_id gnl|my_center|LOCUS_41330 4398325 4399455 gene locus_tag LOCUS_41340 4398325 4399455 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 protein_id gnl|my_center|LOCUS_41340 4399706 4402150 gene locus_tag LOCUS_41350 4399706 4402150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41350 4402147 4402557 gene locus_tag LOCUS_41360 4402147 4402557 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973453.1 protein_id gnl|my_center|LOCUS_41360 4409406 4402573 gene locus_tag LOCUS_41370 4409406 4402573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 4413337 4409420 gene locus_tag LOCUS_41380 4413337 4409420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 4416687 4413382 gene locus_tag LOCUS_41390 4416687 4413382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41390 4423056 4416730 gene locus_tag LOCUS_41400 4423056 4416730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 4423479 4424600 gene locus_tag LOCUS_41410 4423479 4424600 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086395.1 protein_id gnl|my_center|LOCUS_41410 4424653 4425450 gene locus_tag LOCUS_41420 4424653 4425450 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976846.1 protein_id gnl|my_center|LOCUS_41420 4425532 4426863 gene locus_tag LOCUS_41430 gene ccrA 4425532 4426863 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_41430 4429857 4426906 gene locus_tag LOCUS_41440 4429857 4426906 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_41440 4431098 4429986 gene locus_tag LOCUS_41450 4431098 4429986 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_41450 4432125 4431091 gene locus_tag LOCUS_41460 4432125 4431091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_41460 4433067 4432132 gene locus_tag LOCUS_41470 4433067 4432132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_41470 4434067 4433060 gene locus_tag LOCUS_41480 4434067 4433060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_41480 4435768 4434185 gene locus_tag LOCUS_41490 4435768 4434185 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086928.1 protein_id gnl|my_center|LOCUS_41490 4437098 4436115 gene locus_tag LOCUS_41500 4437098 4436115 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224071.1 protein_id gnl|my_center|LOCUS_41500 4437576 4437220 gene locus_tag LOCUS_41510 4437576 4437220 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_41510 4438765 4437647 gene locus_tag LOCUS_41520 4438765 4437647 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223742.1 protein_id gnl|my_center|LOCUS_41520 4438897 4440063 gene locus_tag LOCUS_41530 gene nadA 4438897 4440063 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_41530 4440252 4441583 gene locus_tag LOCUS_41540 gene murA 4440252 4441583 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_41540 4441615 4442301 gene locus_tag LOCUS_41550 4441615 4442301 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224069.1 protein_id gnl|my_center|LOCUS_41550 4443269 4442304 gene locus_tag LOCUS_41560 4443269 4442304 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_41560 4444075 4443266 gene locus_tag LOCUS_41570 4444075 4443266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_41570 4444865 4444068 gene locus_tag LOCUS_41580 4444865 4444068 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804600.1 protein_id gnl|my_center|LOCUS_41580 4445129 4446112 gene locus_tag LOCUS_41590 4445129 4446112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 4446220 4447356 gene locus_tag LOCUS_41600 4446220 4447356 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495946.1 protein_id gnl|my_center|LOCUS_41600 4447428 4448411 gene locus_tag LOCUS_41610 4447428 4448411 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_41610 4448619 4449173 gene locus_tag LOCUS_41620 4448619 4449173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 4449170 4449811 gene locus_tag LOCUS_41630 4449170 4449811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 4449826 4450692 gene locus_tag LOCUS_41640 4449826 4450692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 4453109 4450812 gene locus_tag LOCUS_41650 4453109 4450812 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226876.1 protein_id gnl|my_center|LOCUS_41650 4454092 4453181 gene locus_tag LOCUS_41660 gene miaA 4454092 4453181 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_41660 4454373 4455593 gene locus_tag LOCUS_41670 4454373 4455593 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224256.1 protein_id gnl|my_center|LOCUS_41670 4455717 4456463 gene locus_tag LOCUS_41680 4455717 4456463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 4456503 4458569 gene locus_tag LOCUS_41690 4456503 4458569 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031409.1 protein_id gnl|my_center|LOCUS_41690 4458715 4459752 gene locus_tag LOCUS_41700 4458715 4459752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 4462909 4459760 gene locus_tag LOCUS_41710 4462909 4459760 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 protein_id gnl|my_center|LOCUS_41710 4464414 4462927 gene locus_tag LOCUS_41720 gene miaB 4464414 4462927 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224253.1 protein_id gnl|my_center|LOCUS_41720 4465155 4464424 gene locus_tag LOCUS_41730 4465155 4464424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 4465528 4465731 gene locus_tag LOCUS_41740 4465528 4465731 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978336.1 protein_id gnl|my_center|LOCUS_41740 4466493 4465873 gene locus_tag LOCUS_41750 4466493 4465873 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_41750 4467995 4466505 gene locus_tag LOCUS_41760 4467995 4466505 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_41760 4468077 4469543 gene locus_tag LOCUS_41770 4468077 4469543 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727370.1 protein_id gnl|my_center|LOCUS_41770 4470319 4469618 gene locus_tag LOCUS_41780 4470319 4469618 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001184072.1 protein_id gnl|my_center|LOCUS_41780 4470457 4471701 gene locus_tag LOCUS_41790 4470457 4471701 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222244.1 protein_id gnl|my_center|LOCUS_41790 4472540 4471698 gene locus_tag LOCUS_41800 4472540 4471698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 4472608 4473564 gene locus_tag LOCUS_41810 4472608 4473564 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028575.1 protein_id gnl|my_center|LOCUS_41810 4475430 4474483 gene locus_tag LOCUS_41820 4475430 4474483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839449.1 protein_id gnl|my_center|LOCUS_41820 4475528 4476583 gene locus_tag LOCUS_41830 4475528 4476583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 4476573 4478411 gene locus_tag LOCUS_41840 4476573 4478411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 4478414 4478809 gene locus_tag LOCUS_41850 4478414 4478809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 4480560 4479982 gene locus_tag LOCUS_41860 4480560 4479982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 4481616 4480567 gene locus_tag LOCUS_41870 gene recA 4481616 4480567 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_41870 4481965 4481657 gene locus_tag LOCUS_41880 4481965 4481657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 4483228 4481966 gene locus_tag LOCUS_41890 4483228 4481966 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234232.1 protein_id gnl|my_center|LOCUS_41890 4484787 4483477 gene locus_tag LOCUS_41900 4484787 4483477 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_41900 4484838 4485476 gene locus_tag LOCUS_41910 4484838 4485476 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_41910 4485543 4486193 gene locus_tag LOCUS_41920 gene leuE 4485543 4486193 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 protein_id gnl|my_center|LOCUS_41920 4486817 4486230 gene locus_tag LOCUS_41930 4486817 4486230 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 protein_id gnl|my_center|LOCUS_41930 4487281 4486898 gene locus_tag LOCUS_41940 4487281 4486898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 4487483 4488367 gene locus_tag LOCUS_41950 gene vanJ 4487483 4488367 CDS product teicoplanin resistance protein VanJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029107.1 protein_id gnl|my_center|LOCUS_41950 4488413 4493017 gene locus_tag LOCUS_41960 4488413 4493017 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_41960 4494100 4493027 gene locus_tag LOCUS_41970 4494100 4493027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 4494533 4494093 gene locus_tag LOCUS_41980 4494533 4494093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 4495091 4494546 gene locus_tag LOCUS_41990 4495091 4494546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 4495238 4496077 gene locus_tag LOCUS_42000 4495238 4496077 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466643.1 protein_id gnl|my_center|LOCUS_42000 4496247 4496462 gene locus_tag LOCUS_42010 4496247 4496462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 4496903 4496568 gene locus_tag LOCUS_42020 4496903 4496568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_42020 4497126 4498511 gene locus_tag LOCUS_42030 gene lpdA 4497126 4498511 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_42030 4498534 4500285 gene locus_tag LOCUS_42040 gene sucB 4498534 4500285 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 protein_id gnl|my_center|LOCUS_42040 4500539 4500333 gene locus_tag LOCUS_42050 4500539 4500333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 4500616 4501599 gene locus_tag LOCUS_42060 gene corA 4500616 4501599 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_42060 4501627 4502505 gene locus_tag LOCUS_42070 4501627 4502505 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110454.1 protein_id gnl|my_center|LOCUS_42070 4503502 4502498 gene locus_tag LOCUS_42080 4503502 4502498 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 protein_id gnl|my_center|LOCUS_42080 4504072 4503515 gene locus_tag LOCUS_42090 4504072 4503515 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831756.1 protein_id gnl|my_center|LOCUS_42090 4504304 4504161 gene locus_tag LOCUS_42100 4504304 4504161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 4504415 4505935 gene locus_tag LOCUS_42110 4504415 4505935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 4506770 4507000 gene locus_tag LOCUS_42120 4506770 4507000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 4507078 4507425 gene locus_tag LOCUS_42130 4507078 4507425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 4507422 4508180 gene locus_tag LOCUS_42140 4507422 4508180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 4508225 4508764 gene locus_tag LOCUS_42150 4508225 4508764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 4508868 4509782 gene locus_tag LOCUS_42160 4508868 4509782 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 protein_id gnl|my_center|LOCUS_42160 4509779 4510873 gene locus_tag LOCUS_42170 4509779 4510873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 4511109 4511441 gene locus_tag LOCUS_42180 4511109 4511441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 4511471 4512025 gene locus_tag LOCUS_42190 4511471 4512025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 4512022 4513701 gene locus_tag LOCUS_42200 4512022 4513701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 4513686 4514003 gene locus_tag LOCUS_42210 4513686 4514003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 4514666 4514106 gene locus_tag LOCUS_42220 4514666 4514106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 4514702 4515529 gene locus_tag LOCUS_42230 4514702 4515529 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227943.1 protein_id gnl|my_center|LOCUS_42230 4515810 4515526 gene locus_tag LOCUS_42240 4515810 4515526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 4516176 4516607 gene locus_tag LOCUS_42250 4516176 4516607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 4516642 4518222 gene locus_tag LOCUS_42260 4516642 4518222 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389873.1 protein_id gnl|my_center|LOCUS_42260 4518250 4518996 gene locus_tag LOCUS_42270 4518250 4518996 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727914.1 protein_id gnl|my_center|LOCUS_42270 4519532 4520950 gene locus_tag LOCUS_42280 4519532 4520950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 4520985 4522508 gene locus_tag LOCUS_42290 4520985 4522508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 4522505 4522690 gene locus_tag LOCUS_42300 4522505 4522690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 4522773 4523435 gene locus_tag LOCUS_42310 4522773 4523435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 4523475 4524443 gene locus_tag LOCUS_42320 4523475 4524443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 4524440 4524856 gene locus_tag LOCUS_42330 4524440 4524856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 4524861 4525232 gene locus_tag LOCUS_42340 4524861 4525232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 4525213 4525512 gene locus_tag LOCUS_42350 4525213 4525512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 4525532 4525933 gene locus_tag LOCUS_42360 4525532 4525933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 4525946 4526548 gene locus_tag LOCUS_42370 4525946 4526548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 4526669 4527082 gene locus_tag LOCUS_42380 4526669 4527082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 4527109 4527390 gene locus_tag LOCUS_42390 4527109 4527390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 4527430 4530699 gene locus_tag LOCUS_42400 4527430 4530699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 4530704 4531612 gene locus_tag LOCUS_42410 4530704 4531612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 4531609 4533921 gene locus_tag LOCUS_42420 4531609 4533921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 4533908 4534312 gene locus_tag LOCUS_42430 4533908 4534312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 4534328 4534594 gene locus_tag LOCUS_42440 4534328 4534594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 4535440 4535027 gene locus_tag LOCUS_42450 4535440 4535027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 4536582 4535602 gene locus_tag LOCUS_42460 4536582 4535602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 4537019 4536579 gene locus_tag LOCUS_42470 4537019 4536579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 4537282 4537016 gene locus_tag LOCUS_42480 4537282 4537016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 4539108 4537216 gene locus_tag LOCUS_42490 4539108 4537216 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228688.1 protein_id gnl|my_center|LOCUS_42490 4539270 4539121 gene locus_tag LOCUS_42500 4539270 4539121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 4539469 4540662 gene locus_tag LOCUS_42510 4539469 4540662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 4540833 4541582 gene locus_tag LOCUS_42520 4540833 4541582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 4542813 4541719 gene locus_tag LOCUS_42530 4542813 4541719 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_42530 4542988 4543176 gene locus_tag LOCUS_42540 4542988 4543176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 4543528 4544010 gene locus_tag LOCUS_42550 4543528 4544010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 4544007 4544414 gene locus_tag LOCUS_42560 4544007 4544414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 4544506 4544853 gene locus_tag LOCUS_42570 4544506 4544853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 4544950 4545732 gene locus_tag LOCUS_42580 4544950 4545732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 4546194 4545805 gene locus_tag LOCUS_42590 4546194 4545805 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_42590 4547161 4546232 gene locus_tag LOCUS_42600 4547161 4546232 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 protein_id gnl|my_center|LOCUS_42600 4547595 4547128 gene locus_tag LOCUS_42610 4547595 4547128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 4548675 4548010 gene locus_tag LOCUS_42620 4548675 4548010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 4549361 4548729 gene locus_tag LOCUS_42630 4549361 4548729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 4550233 4549433 gene locus_tag LOCUS_42640 4550233 4549433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 4551280 4550426 gene locus_tag LOCUS_42650 4551280 4550426 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228065.1 protein_id gnl|my_center|LOCUS_42650 4551837 4551376 gene locus_tag LOCUS_42660 4551837 4551376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 4552434 4551928 gene locus_tag LOCUS_42670 4552434 4551928 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_42670 4553069 4552431 gene locus_tag LOCUS_42680 4553069 4552431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 4554466 4553072 gene locus_tag LOCUS_42690 gene rimO 4554466 4553072 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228069.1 protein_id gnl|my_center|LOCUS_42690 4554657 4555400 gene locus_tag LOCUS_42700 4554657 4555400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666015.1 protein_id gnl|my_center|LOCUS_42700 4555470 4556006 gene locus_tag LOCUS_42710 4555470 4556006 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 protein_id gnl|my_center|LOCUS_42710 4556077 4556832 gene locus_tag LOCUS_42720 4556077 4556832 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_42720 4556878 4557360 gene locus_tag LOCUS_42730 4556878 4557360 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_42730 4557472 4558350 gene locus_tag LOCUS_42740 4557472 4558350 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031766.1 protein_id gnl|my_center|LOCUS_42740 4558789 4558334 gene locus_tag LOCUS_42750 4558789 4558334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 4561264 4558793 gene locus_tag LOCUS_42760 4561264 4558793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 4563120 4561354 gene locus_tag LOCUS_42770 4563120 4561354 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029468.1 protein_id gnl|my_center|LOCUS_42770 4564356 4563193 gene locus_tag LOCUS_42780 4564356 4563193 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229643.1 protein_id gnl|my_center|LOCUS_42780 4566077 4564371 gene locus_tag LOCUS_42790 4566077 4564371 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_42790 4566925 4566074 gene locus_tag LOCUS_42800 gene dapA 4566925 4566074 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_42800 4567787 4567035 gene locus_tag LOCUS_42810 gene thyX 4567787 4567035 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228090.1 protein_id gnl|my_center|LOCUS_42810 4567936 4568442 gene locus_tag LOCUS_42820 4567936 4568442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_42820 4568481 4569275 gene locus_tag LOCUS_42830 4568481 4569275 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153482230.1 protein_id gnl|my_center|LOCUS_42830 4569760 4569446 gene locus_tag LOCUS_42840 4569760 4569446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 4571003 4569789 gene locus_tag LOCUS_42850 4571003 4569789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 4571602 4571000 gene locus_tag LOCUS_42860 4571602 4571000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 4571752 4573089 gene locus_tag LOCUS_42870 4571752 4573089 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028409.1 protein_id gnl|my_center|LOCUS_42870 4573086 4574357 gene locus_tag LOCUS_42880 4573086 4574357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 protein_id gnl|my_center|LOCUS_42880 4575414 4574518 gene locus_tag LOCUS_42890 4575414 4574518 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804001.1 protein_id gnl|my_center|LOCUS_42890 4575637 4577790 gene locus_tag LOCUS_42900 4575637 4577790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 4577867 4579219 gene locus_tag LOCUS_42910 4577867 4579219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 4579321 4580559 gene locus_tag LOCUS_42920 4579321 4580559 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223772.1 protein_id gnl|my_center|LOCUS_42920 4580640 4581602 gene locus_tag LOCUS_42930 4580640 4581602 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_42930 4582404 4581625 gene locus_tag LOCUS_42940 4582404 4581625 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888314.1 protein_id gnl|my_center|LOCUS_42940 4583565 4582468 gene locus_tag LOCUS_42950 4583565 4582468 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145785146.1 protein_id gnl|my_center|LOCUS_42950 4584804 4583764 gene locus_tag LOCUS_42960 4584804 4583764 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223592.1 protein_id gnl|my_center|LOCUS_42960 4585863 4584895 gene locus_tag LOCUS_42970 4585863 4584895 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037062758.1 protein_id gnl|my_center|LOCUS_42970 4586553 4585891 gene locus_tag LOCUS_42980 4586553 4585891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 4587956 4587039 gene locus_tag LOCUS_42990 4587956 4587039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 4588028 4588594 gene locus_tag LOCUS_43000 4588028 4588594 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027861.1 protein_id gnl|my_center|LOCUS_43000 4588664 4589248 gene locus_tag LOCUS_43010 4588664 4589248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422870.1 protein_id gnl|my_center|LOCUS_43010 4589883 4589245 gene locus_tag LOCUS_43020 4589883 4589245 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226070.1 protein_id gnl|my_center|LOCUS_43020 4589989 4591644 gene locus_tag LOCUS_43030 4589989 4591644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 4592410 4591976 gene locus_tag LOCUS_43040 4592410 4591976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 4593230 4592502 gene locus_tag LOCUS_43050 4593230 4592502 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895492.1 protein_id gnl|my_center|LOCUS_43050 4593946 4593305 gene locus_tag LOCUS_43060 4593946 4593305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 4594084 4595022 gene locus_tag LOCUS_43070 4594084 4595022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_43070 4595019 4595882 gene locus_tag LOCUS_43080 4595019 4595882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_43080 4595922 4596164 gene locus_tag LOCUS_43090 4595922 4596164 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_43090 4597551 4596214 gene locus_tag LOCUS_43100 4597551 4596214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 4599924 4597606 gene locus_tag LOCUS_43110 4599924 4597606 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027789.1 protein_id gnl|my_center|LOCUS_43110 4600950 4600009 gene locus_tag LOCUS_43120 4600950 4600009 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978084.1 protein_id gnl|my_center|LOCUS_43120 4601107 4602249 gene locus_tag LOCUS_43130 4601107 4602249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 4602953 4602315 gene locus_tag LOCUS_43140 4602953 4602315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 4604821 4602959 gene locus_tag LOCUS_43150 4604821 4602959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 4605198 4604857 gene locus_tag LOCUS_43160 4605198 4604857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 4606851 4605250 gene locus_tag LOCUS_43170 gene serA 4606851 4605250 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_43170 4607083 4608285 gene locus_tag LOCUS_43180 4607083 4608285 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_43180 4608676 4608278 gene locus_tag LOCUS_43190 4608676 4608278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 4608979 4608692 gene locus_tag LOCUS_43200 4608979 4608692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 4609572 4610225 gene locus_tag LOCUS_43210 4609572 4610225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 4610222 4610479 gene locus_tag LOCUS_43220 4610222 4610479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 4610671 4611195 gene locus_tag LOCUS_43230 4610671 4611195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 4611227 4611664 gene locus_tag LOCUS_43240 4611227 4611664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 4611657 4612688 gene locus_tag LOCUS_43250 4611657 4612688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 4613611 4612733 gene locus_tag LOCUS_43260 4613611 4612733 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015343.1 protein_id gnl|my_center|LOCUS_43260 4613610 4614392 gene locus_tag LOCUS_43270 4613610 4614392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 4614385 4614627 gene locus_tag LOCUS_43280 4614385 4614627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 4616265 4614715 gene locus_tag LOCUS_43290 gene qac 4616265 4614715 CDS product quaternary ammonium compound efflux MFS transporter QacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622776.1 protein_id gnl|my_center|LOCUS_43290 4616862 4616305 gene locus_tag LOCUS_43300 4616862 4616305 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_43300 4618314 4617028 gene locus_tag LOCUS_43310 4618314 4617028 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528603.1 protein_id gnl|my_center|LOCUS_43310 4618395 4618859 gene locus_tag LOCUS_43320 4618395 4618859 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 protein_id gnl|my_center|LOCUS_43320 4618910 4620187 gene locus_tag LOCUS_43330 4618910 4620187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 4620184 4620834 gene locus_tag LOCUS_43340 4620184 4620834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 4621949 4621050 gene locus_tag LOCUS_43350 4621949 4621050 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848494.1 protein_id gnl|my_center|LOCUS_43350 4622845 4621964 gene locus_tag LOCUS_43360 4622845 4621964 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731219.1 protein_id gnl|my_center|LOCUS_43360 4623014 4623379 gene locus_tag LOCUS_43370 4623014 4623379 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028376.1 protein_id gnl|my_center|LOCUS_43370 4623517 4623885 gene locus_tag LOCUS_43380 4623517 4623885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 4624718 4623882 gene locus_tag LOCUS_43390 4624718 4623882 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222343.1 protein_id gnl|my_center|LOCUS_43390 4624771 4625307 gene locus_tag LOCUS_43400 4624771 4625307 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222344.1 protein_id gnl|my_center|LOCUS_43400 4625384 4626112 gene locus_tag LOCUS_43410 4625384 4626112 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_43410 4627862 4626459 gene locus_tag LOCUS_43420 4627862 4626459 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181771043.1 protein_id gnl|my_center|LOCUS_43420 4627940 4628491 gene locus_tag LOCUS_43430 4627940 4628491 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224194.1 protein_id gnl|my_center|LOCUS_43430 4629561 4628557 gene locus_tag LOCUS_43440 4629561 4628557 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_43440 4629694 4630566 gene locus_tag LOCUS_43450 4629694 4630566 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976361.1 protein_id gnl|my_center|LOCUS_43450 4630605 4631183 gene locus_tag LOCUS_43460 4630605 4631183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 4631218 4631772 gene locus_tag LOCUS_43470 4631218 4631772 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_43470 4632942 4631698 gene locus_tag LOCUS_43480 4632942 4631698 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_43480 4631997 4632094 gene locus_tag LOCUS_t00350 4631997 4632094 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4634010 4633036 gene locus_tag LOCUS_43490 gene sigJ 4634010 4633036 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226028235.1 protein_id gnl|my_center|LOCUS_43490 4634600 4634031 gene locus_tag LOCUS_43500 4634600 4634031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 4635114 4634605 gene locus_tag LOCUS_43510 4635114 4634605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 4635431 4635117 gene locus_tag LOCUS_43520 4635431 4635117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 4635916 4635428 gene locus_tag LOCUS_43530 4635916 4635428 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976986.1 protein_id gnl|my_center|LOCUS_43530 4636124 4635942 gene locus_tag LOCUS_43540 4636124 4635942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 4636261 4636458 gene locus_tag LOCUS_43550 4636261 4636458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 4636455 4636844 gene locus_tag LOCUS_43560 4636455 4636844 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_43560 4637679 4636855 gene locus_tag LOCUS_43570 4637679 4636855 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226396.1 protein_id gnl|my_center|LOCUS_43570 4637788 4638144 gene locus_tag LOCUS_43580 4637788 4638144 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226395.1 protein_id gnl|my_center|LOCUS_43580 4639266 4638256 gene locus_tag LOCUS_43590 gene ilvC 4639266 4638256 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_43590 4639807 4639283 gene locus_tag LOCUS_43600 gene ilvN 4639807 4639283 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_43600 4641579 4639801 gene locus_tag LOCUS_43610 4641579 4639801 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728299.1 protein_id gnl|my_center|LOCUS_43610 4642040 4643554 gene locus_tag LOCUS_43620 4642040 4643554 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_43620 4646234 4643652 gene locus_tag LOCUS_43630 4646234 4643652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 4648225 4646381 gene locus_tag LOCUS_43640 gene ilvD 4648225 4646381 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 protein_id gnl|my_center|LOCUS_43640 4650358 4648298 gene locus_tag LOCUS_43650 4650358 4648298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 4651089 4650805 gene locus_tag LOCUS_43660 4651089 4650805 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223899.1 protein_id gnl|my_center|LOCUS_43660 4652196 4651096 gene locus_tag LOCUS_43670 4652196 4651096 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_43670 4652336 4652824 gene locus_tag LOCUS_43680 4652336 4652824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 4653735 4652818 gene locus_tag LOCUS_43690 4653735 4652818 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466703.1 protein_id gnl|my_center|LOCUS_43690 4653813 4654958 gene locus_tag LOCUS_43700 4653813 4654958 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049749196.1 protein_id gnl|my_center|LOCUS_43700 4655087 4656556 gene locus_tag LOCUS_43710 4655087 4656556 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 protein_id gnl|my_center|LOCUS_43710 4657350 4656553 gene locus_tag LOCUS_43720 4657350 4656553 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107019904.1 protein_id gnl|my_center|LOCUS_43720 4657396 4658211 gene locus_tag LOCUS_43730 4657396 4658211 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_43730 4659179 4658256 gene locus_tag LOCUS_43740 4659179 4658256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 4660209 4659202 gene locus_tag LOCUS_43750 4660209 4659202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 4661184 4660261 gene locus_tag LOCUS_43760 4661184 4660261 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027138.1 protein_id gnl|my_center|LOCUS_43760 4661796 4661197 gene locus_tag LOCUS_43770 4661796 4661197 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970775.1 protein_id gnl|my_center|LOCUS_43770 4662050 4662835 gene locus_tag LOCUS_43780 4662050 4662835 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285771.1 protein_id gnl|my_center|LOCUS_43780 4663965 4662934 gene locus_tag LOCUS_43790 4663965 4662934 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049749196.1 protein_id gnl|my_center|LOCUS_43790 4664979 4664083 gene locus_tag LOCUS_43800 4664979 4664083 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_43800 4665259 4665095 gene locus_tag LOCUS_43810 4665259 4665095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 4668244 4665266 gene locus_tag LOCUS_43820 4668244 4665266 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630643.1 protein_id gnl|my_center|LOCUS_43820 4669426 4668344 gene locus_tag LOCUS_43830 4669426 4668344 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893338.1 protein_id gnl|my_center|LOCUS_43830 4669553 4670797 gene locus_tag LOCUS_43840 4669553 4670797 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_43840 4671441 4670905 gene locus_tag LOCUS_43850 4671441 4670905 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_43850 4671732 4671577 gene locus_tag LOCUS_43860 4671732 4671577 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_43860 4671877 4673223 gene locus_tag LOCUS_43870 4671877 4673223 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_43870 4673522 4673277 gene locus_tag LOCUS_43880 4673522 4673277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 4673931 4673524 gene locus_tag LOCUS_43890 4673931 4673524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 4674334 4674011 gene locus_tag LOCUS_43900 4674334 4674011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 4676575 4674482 gene locus_tag LOCUS_43910 4676575 4674482 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742114.1 protein_id gnl|my_center|LOCUS_43910 4677757 4676648 gene locus_tag LOCUS_43920 gene gcvT 4677757 4676648 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729697.1 protein_id gnl|my_center|LOCUS_43920 4677847 4679319 gene locus_tag LOCUS_43930 4677847 4679319 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_43930 4679802 4680626 gene locus_tag LOCUS_43940 4679802 4680626 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_43940 4680637 4682373 gene locus_tag LOCUS_43950 4680637 4682373 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_43950 4682571 4684331 gene locus_tag LOCUS_43960 4682571 4684331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 4684423 4685028 gene locus_tag LOCUS_43970 4684423 4685028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 4687297 4685246 gene locus_tag LOCUS_43980 4687297 4685246 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222260.1 protein_id gnl|my_center|LOCUS_43980 4688327 4687374 gene locus_tag LOCUS_43990 4688327 4687374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 4689763 4688366 gene locus_tag LOCUS_44000 4689763 4688366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 4690039 4689812 gene locus_tag LOCUS_44010 4690039 4689812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 4690229 4691203 gene locus_tag LOCUS_44020 4690229 4691203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 4692084 4691212 gene locus_tag LOCUS_44030 4692084 4691212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031110.1 protein_id gnl|my_center|LOCUS_44030 4692372 4693136 gene locus_tag LOCUS_44040 4692372 4693136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 4693273 4694037 gene locus_tag LOCUS_44050 4693273 4694037 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484222.1 protein_id gnl|my_center|LOCUS_44050 4694264 4694034 gene locus_tag LOCUS_44060 4694264 4694034 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_44060 4694887 4694264 gene locus_tag LOCUS_44070 4694887 4694264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 4695104 4695874 gene locus_tag LOCUS_44080 4695104 4695874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 4696006 4696968 gene locus_tag LOCUS_44090 4696006 4696968 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_44090 4697640 4696993 gene locus_tag LOCUS_44100 4697640 4696993 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448454.1 protein_id gnl|my_center|LOCUS_44100 4697799 4699451 gene locus_tag LOCUS_44110 4697799 4699451 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_44110 4701114 4700098 gene locus_tag LOCUS_44120 4701114 4700098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 4701830 4702765 gene locus_tag LOCUS_44130 4701830 4702765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 4703464 4702898 gene locus_tag LOCUS_44140 4703464 4702898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 4706047 4703735 gene locus_tag LOCUS_44150 4706047 4703735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 4706936 4706499 gene locus_tag LOCUS_44160 4706936 4706499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 4707924 4706926 gene locus_tag LOCUS_44170 4707924 4706926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 4709560 4708709 gene locus_tag LOCUS_44180 4709560 4708709 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_44180 4709750 4710049 gene locus_tag LOCUS_44190 4709750 4710049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 4710654 4710358 gene locus_tag LOCUS_44200 4710654 4710358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 4710860 4711018 gene locus_tag LOCUS_44210 4710860 4711018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 4711075 4711755 gene locus_tag LOCUS_44220 4711075 4711755 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528490.1 protein_id gnl|my_center|LOCUS_44220 4713137 4712220 gene locus_tag LOCUS_44230 4713137 4712220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 4713439 4713134 gene locus_tag LOCUS_44240 4713439 4713134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 4714171 4714446 gene locus_tag LOCUS_44250 4714171 4714446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 4715825 4715637 gene locus_tag LOCUS_44260 4715825 4715637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 4716182 4716106 gene locus_tag LOCUS_t00360 4716182 4716106 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4717655 4716258 gene locus_tag LOCUS_44270 gene der 4717655 4716258 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467391.1 protein_id gnl|my_center|LOCUS_44270 4718329 4717652 gene locus_tag LOCUS_44280 gene cmk 4718329 4717652 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227793.1 protein_id gnl|my_center|LOCUS_44280 4719159 4718425 gene locus_tag LOCUS_44290 4719159 4718425 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408439.1 protein_id gnl|my_center|LOCUS_44290 4719934 4719149 gene locus_tag LOCUS_44300 4719934 4719149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 4720863 4719931 gene locus_tag LOCUS_44310 4720863 4719931 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227802.1 protein_id gnl|my_center|LOCUS_44310 4721852 4720923 gene locus_tag LOCUS_44320 4721852 4720923 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_44320 4722883 4721978 gene locus_tag LOCUS_44330 gene xerD 4722883 4721978 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_44330 4724001 4722886 gene locus_tag LOCUS_44340 gene ald 4724001 4722886 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_44340 4724750 4724184 gene locus_tag LOCUS_44350 4724750 4724184 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110861.1 protein_id gnl|my_center|LOCUS_44350 4726468 4724747 gene locus_tag LOCUS_44360 4726468 4724747 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_44360 4727182 4726577 gene locus_tag LOCUS_44370 4727182 4726577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 4728153 4727287 gene locus_tag LOCUS_44380 4728153 4727287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_44380 4729078 4728191 gene locus_tag LOCUS_44390 gene mctB 4729078 4728191 CDS product copper transporter MctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408390.1 protein_id gnl|my_center|LOCUS_44390 4730265 4729075 gene locus_tag LOCUS_44400 gene steA 4730265 4729075 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_44400 4732096 4730345 gene locus_tag LOCUS_44410 gene recN 4732096 4730345 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_44410 4733060 4732167 gene locus_tag LOCUS_44420 4733060 4732167 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_44420 4733875 4733057 gene locus_tag LOCUS_44430 4733875 4733057 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_44430 4734079 4733894 gene locus_tag LOCUS_44440 4734079 4733894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 4734547 4734083 gene locus_tag LOCUS_44450 4734547 4734083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 4734658 4734996 gene locus_tag LOCUS_44460 4734658 4734996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_44460 4736075 4734993 gene locus_tag LOCUS_44470 4736075 4734993 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804972.1 protein_id gnl|my_center|LOCUS_44470 4737265 4736072 gene locus_tag LOCUS_44480 4737265 4736072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 4737188 4738441 gene locus_tag LOCUS_44490 4737188 4738441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 4738695 4738590 gene locus_tag LOCUS_r00010 4738695 4738590 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4742031 4738894 gene locus_tag LOCUS_r00020 4742031 4738894 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4743905 4742389 gene locus_tag LOCUS_r00030 4743905 4742389 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4745671 4744421 gene locus_tag LOCUS_44500 gene tyrS 4745671 4744421 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_44500 4746318 4745668 gene locus_tag LOCUS_44510 4746318 4745668 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_44510 4748168 4746315 gene locus_tag LOCUS_44520 4748168 4746315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 4748339 4749526 gene locus_tag LOCUS_44530 4748339 4749526 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028892.1 protein_id gnl|my_center|LOCUS_44530 4749666 4750931 gene locus_tag LOCUS_44540 4749666 4750931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 4751108 4751575 gene locus_tag LOCUS_44550 4751108 4751575 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_44550 4752637 4751645 gene locus_tag LOCUS_44560 gene tatC 4752637 4751645 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729395.1 protein_id gnl|my_center|LOCUS_44560 4752925 4752662 gene locus_tag LOCUS_44570 gene tatA 4752925 4752662 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410768.1 protein_id gnl|my_center|LOCUS_44570 4753331 4753113 gene locus_tag LOCUS_44580 4753331 4753113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 4754349 4753396 gene locus_tag LOCUS_44590 4754349 4753396 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_44590 4755347 4754346 gene locus_tag LOCUS_44600 4755347 4754346 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_44600 4755402 4756523 gene locus_tag LOCUS_44610 4755402 4756523 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_44610 4756797 4756588 gene locus_tag LOCUS_44620 4756797 4756588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 4758034 4756811 gene locus_tag LOCUS_44630 gene pafA 4758034 4756811 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_44630 4759111 4758314 gene locus_tag LOCUS_44640 gene prcA 4759111 4758314 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_44640 4759910 4759158 gene locus_tag LOCUS_44650 gene prcB 4759910 4759158 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_44650 4760330 4760115 gene locus_tag LOCUS_44660 4760330 4760115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 4761964 4760444 gene locus_tag LOCUS_44670 gene dop 4761964 4760444 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_44670 4762154 4763128 gene locus_tag LOCUS_44680 gene galE 4762154 4763128 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_44680 4763125 4763520 gene locus_tag LOCUS_44690 4763125 4763520 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_44690 4764264 4763539 gene locus_tag LOCUS_44700 4764264 4763539 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978258.1 protein_id gnl|my_center|LOCUS_44700 4765454 4764324 gene locus_tag LOCUS_44710 4765454 4764324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191307645.1 protein_id gnl|my_center|LOCUS_44710 4766576 4765485 gene locus_tag LOCUS_44720 4766576 4765485 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228520.1 protein_id gnl|my_center|LOCUS_44720 4766886 4767140 gene locus_tag LOCUS_44730 4766886 4767140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 4767186 4767692 gene locus_tag LOCUS_44740 4767186 4767692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 4767801 4768268 gene locus_tag LOCUS_44750 4767801 4768268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 4770039 4768321 gene locus_tag LOCUS_44760 gene arc 4770039 4768321 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_44760 4770225 4770515 gene locus_tag LOCUS_44770 4770225 4770515 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977176.1 protein_id gnl|my_center|LOCUS_44770 4771396 4770512 gene locus_tag LOCUS_44780 4771396 4770512 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_44780 4772591 4771389 gene locus_tag LOCUS_44790 4772591 4771389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44790 4772647 4773450 gene locus_tag LOCUS_44800 4772647 4773450 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_44800 4773516 4774718 gene locus_tag LOCUS_44810 4773516 4774718 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031626.1 protein_id gnl|my_center|LOCUS_44810 4774774 4775976 gene locus_tag LOCUS_44820 4774774 4775976 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_44820 4775978 4776652 gene locus_tag LOCUS_44830 4775978 4776652 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_44830 4776879 4777649 gene locus_tag LOCUS_44840 4776879 4777649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_44840 4777652 4780216 gene locus_tag LOCUS_44850 4777652 4780216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_44850 4783100 4780275 gene locus_tag LOCUS_44860 4783100 4780275 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_44860 4784585 4783161 gene locus_tag LOCUS_44870 4784585 4783161 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775787.1 protein_id gnl|my_center|LOCUS_44870 4784727 4786160 gene locus_tag LOCUS_44880 4784727 4786160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 4787516 4786155 gene locus_tag LOCUS_44890 4787516 4786155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 4787635 4788144 gene locus_tag LOCUS_44900 4787635 4788144 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977430.1 protein_id gnl|my_center|LOCUS_44900 4788172 4788456 gene locus_tag LOCUS_44910 4788172 4788456 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_44910 4788475 4788858 gene locus_tag LOCUS_44920 4788475 4788858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 4788855 4789139 gene locus_tag LOCUS_44930 4788855 4789139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 4789211 4789855 gene locus_tag LOCUS_44940 gene pnuC 4789211 4789855 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_44940 4789852 4790931 gene locus_tag LOCUS_44950 4789852 4790931 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_44950 4791380 4790946 gene locus_tag LOCUS_44960 4791380 4790946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 4791502 4792515 gene locus_tag LOCUS_44970 4791502 4792515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 4792567 4792998 gene locus_tag LOCUS_44980 4792567 4792998 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_44980 4793243 4794541 gene locus_tag LOCUS_44990 4793243 4794541 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_44990 4794773 4794591 gene locus_tag LOCUS_45000 4794773 4794591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 4794703 4795218 gene locus_tag LOCUS_45010 4794703 4795218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940553.1 protein_id gnl|my_center|LOCUS_45010 4795320 4796282 gene locus_tag LOCUS_45020 4795320 4796282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 4797090 4796419 gene locus_tag LOCUS_45030 4797090 4796419 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080152.1 protein_id gnl|my_center|LOCUS_45030 4800729 4797208 gene locus_tag LOCUS_45040 gene metH 4800729 4797208 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226749.1 protein_id gnl|my_center|LOCUS_45040 4800888 4801697 gene locus_tag LOCUS_45050 4800888 4801697 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226750.1 protein_id gnl|my_center|LOCUS_45050 4803420 4801726 gene locus_tag LOCUS_45060 4803420 4801726 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051183874.1 protein_id gnl|my_center|LOCUS_45060 4804810 4803482 gene locus_tag LOCUS_45070 gene mshC 4804810 4803482 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226760.1 protein_id gnl|my_center|LOCUS_45070 4805682 4804846 gene locus_tag LOCUS_45080 4805682 4804846 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972097.1 protein_id gnl|my_center|LOCUS_45080 4805826 4806800 gene locus_tag LOCUS_45090 4805826 4806800 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_45090 4806912 4807805 gene locus_tag LOCUS_45100 4806912 4807805 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_45100 4808468 4807809 gene locus_tag LOCUS_45110 4808468 4807809 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087536.1 protein_id gnl|my_center|LOCUS_45110 4808586 4809503 gene locus_tag LOCUS_45120 4808586 4809503 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328866.1 protein_id gnl|my_center|LOCUS_45120 4809527 4810465 gene locus_tag LOCUS_45130 4809527 4810465 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849145.1 protein_id gnl|my_center|LOCUS_45130 4810856 4810569 gene locus_tag LOCUS_45140 4810856 4810569 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093387.1 protein_id gnl|my_center|LOCUS_45140 4811809 4810856 gene locus_tag LOCUS_45150 4811809 4810856 CDS product amonabactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705834.1 protein_id gnl|my_center|LOCUS_45150 4811894 4812943 gene locus_tag LOCUS_45160 4811894 4812943 CDS product amonabactin ABC transporter permease subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705838.1 protein_id gnl|my_center|LOCUS_45160 4812940 4813965 gene locus_tag LOCUS_45170 4812940 4813965 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226863.1 protein_id gnl|my_center|LOCUS_45170 4813969 4814745 gene locus_tag LOCUS_45180 4813969 4814745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_45180 4814873 4815619 gene locus_tag LOCUS_45190 gene dhbA 4814873 4815619 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100501.1 protein_id gnl|my_center|LOCUS_45190 4815651 4816796 gene locus_tag LOCUS_45200 gene dhbC 4815651 4816796 CDS product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 protein_id gnl|my_center|LOCUS_45200 4816768 4818321 gene locus_tag LOCUS_45210 4816768 4818321 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_45210 4818318 4819130 gene locus_tag LOCUS_45220 4818318 4819130 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007255.1 protein_id gnl|my_center|LOCUS_45220 4819127 4820170 gene locus_tag LOCUS_45230 4819127 4820170 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268074.1 protein_id gnl|my_center|LOCUS_45230 4820167 4824603 gene locus_tag LOCUS_45240 4820167 4824603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 4825749 4824727 gene locus_tag LOCUS_45250 4825749 4824727 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224496.1 protein_id gnl|my_center|LOCUS_45250 4826429 4825758 gene locus_tag LOCUS_45260 4826429 4825758 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 protein_id gnl|my_center|LOCUS_45260 4826775 4827635 gene locus_tag LOCUS_45270 4826775 4827635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 4829634 4827700 gene locus_tag LOCUS_45280 gene dxs 4829634 4827700 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224488.1 protein_id gnl|my_center|LOCUS_45280 4829802 4830839 gene locus_tag LOCUS_45290 4829802 4830839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 4832156 4830993 gene locus_tag LOCUS_45300 4832156 4830993 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_45300 4834120 4832153 gene locus_tag LOCUS_45310 4834120 4832153 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093687.1 protein_id gnl|my_center|LOCUS_45310 4834221 4834886 gene locus_tag LOCUS_45320 4834221 4834886 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851807.1 protein_id gnl|my_center|LOCUS_45320 4834886 4835554 gene locus_tag LOCUS_45330 4834886 4835554 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_45330 4836343 4835630 gene locus_tag LOCUS_45340 4836343 4835630 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 protein_id gnl|my_center|LOCUS_45340 4836743 4836360 gene locus_tag LOCUS_45350 4836743 4836360 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_45350 4837498 4836767 gene locus_tag LOCUS_45360 4837498 4836767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 4838007 4837501 gene locus_tag LOCUS_45370 gene dut 4838007 4837501 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_45370 4838056 4838562 gene locus_tag LOCUS_45380 4838056 4838562 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224477.1 protein_id gnl|my_center|LOCUS_45380 4838895 4838596 gene locus_tag LOCUS_45390 4838895 4838596 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057245.1 protein_id gnl|my_center|LOCUS_45390 4839132 4839650 gene locus_tag LOCUS_45400 4839132 4839650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 4839889 4841568 gene locus_tag LOCUS_45410 4839889 4841568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 4841837 4842076 gene locus_tag LOCUS_45420 4841837 4842076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 4843906 4842209 gene locus_tag LOCUS_45430 4843906 4842209 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089243049.1 protein_id gnl|my_center|LOCUS_45430 4844434 4844003 gene locus_tag LOCUS_45440 gene dtd 4844434 4844003 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_45440 4844503 4844868 gene locus_tag LOCUS_45450 4844503 4844868 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224443.1 protein_id gnl|my_center|LOCUS_45450 4844915 4845169 gene locus_tag LOCUS_45460 4844915 4845169 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_45460 4845206 4845817 gene locus_tag LOCUS_45470 4845206 4845817 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230062.1 protein_id gnl|my_center|LOCUS_45470 4846768 4845821 gene locus_tag LOCUS_45480 4846768 4845821 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729216.1 protein_id gnl|my_center|LOCUS_45480 4847193 4846771 gene locus_tag LOCUS_45490 4847193 4846771 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058519.1 protein_id gnl|my_center|LOCUS_45490 4847375 4848346 gene locus_tag LOCUS_45500 4847375 4848346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 4848538 4849224 gene locus_tag LOCUS_45510 4848538 4849224 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_45510 4850068 4849238 gene locus_tag LOCUS_45520 4850068 4849238 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229622.1 protein_id gnl|my_center|LOCUS_45520 4851743 4851114 gene locus_tag LOCUS_45530 4851743 4851114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 4853073 4851814 gene locus_tag LOCUS_45540 4853073 4851814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 4853713 4853066 gene locus_tag LOCUS_45550 4853713 4853066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45550 4853876 4855240 gene locus_tag LOCUS_45560 4853876 4855240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222294.1 protein_id gnl|my_center|LOCUS_45560 4855237 4856208 gene locus_tag LOCUS_45570 4855237 4856208 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_45570 4856208 4857383 gene locus_tag LOCUS_45580 4856208 4857383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_45580 4857702 4857436 gene locus_tag LOCUS_45590 4857702 4857436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 4857584 4859710 gene locus_tag LOCUS_45600 4857584 4859710 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45600 4859713 4860732 gene locus_tag LOCUS_45610 4859713 4860732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 4860729 4862006 gene locus_tag LOCUS_45620 4860729 4862006 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_45620 4862031 4862732 gene locus_tag LOCUS_45630 4862031 4862732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 4863885 4862734 gene locus_tag LOCUS_45640 4863885 4862734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 4866869 4864029 gene locus_tag LOCUS_45650 4866869 4864029 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_45650 4867475 4867005 gene locus_tag LOCUS_45660 gene nrdR 4867475 4867005 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413973.1 protein_id gnl|my_center|LOCUS_45660 4867858 4868541 gene locus_tag LOCUS_45670 gene lexA 4867858 4868541 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_45670 4869924 4868548 gene locus_tag LOCUS_45680 4869924 4868548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 4871458 4870058 gene locus_tag LOCUS_45690 gene hflX 4871458 4870058 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090287.1 protein_id gnl|my_center|LOCUS_45690 4871545 4872975 gene locus_tag LOCUS_45700 4871545 4872975 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230249.1 protein_id gnl|my_center|LOCUS_45700 4874027 4873041 gene locus_tag LOCUS_45710 4874027 4873041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 4874542 4874024 gene locus_tag LOCUS_45720 4874542 4874024 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_45720 4874658 4875062 gene locus_tag LOCUS_45730 4874658 4875062 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413336.1 protein_id gnl|my_center|LOCUS_45730 4875093 4875467 gene locus_tag LOCUS_45740 4875093 4875467 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027002.1 protein_id gnl|my_center|LOCUS_45740 4876305 4875490 gene locus_tag LOCUS_45750 gene dapF 4876305 4875490 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_45750 4876374 4877423 gene locus_tag LOCUS_45760 gene cobT 4876374 4877423 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110465.1 protein_id gnl|my_center|LOCUS_45760 4878177 4877575 gene locus_tag LOCUS_45770 4878177 4877575 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_45770 4879226 4878174 gene locus_tag LOCUS_45780 4879226 4878174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 4879687 4881333 gene locus_tag LOCUS_45790 4879687 4881333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 4882032 4881346 gene locus_tag LOCUS_45800 4882032 4881346 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228272.1 protein_id gnl|my_center|LOCUS_45800 4883256 4882072 gene locus_tag LOCUS_45810 4883256 4882072 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487607.1 protein_id gnl|my_center|LOCUS_45810 4884443 4883382 gene locus_tag LOCUS_45820 4884443 4883382 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727584.1 protein_id gnl|my_center|LOCUS_45820 4884576 4885457 gene locus_tag LOCUS_45830 4884576 4885457 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_45830 4885521 4886660 gene locus_tag LOCUS_45840 gene chrA 4885521 4886660 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_45840 4886713 4887324 gene locus_tag LOCUS_45850 4886713 4887324 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466502.1 protein_id gnl|my_center|LOCUS_45850 4887321 4888520 gene locus_tag LOCUS_45860 4887321 4888520 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230887.1 protein_id gnl|my_center|LOCUS_45860 4890436 4888517 gene locus_tag LOCUS_45870 4890436 4888517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 4890580 4893693 gene locus_tag LOCUS_45880 4890580 4893693 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_45880 4893686 4896811 gene locus_tag LOCUS_45890 4893686 4896811 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 protein_id gnl|my_center|LOCUS_45890 4897635 4896862 gene locus_tag LOCUS_45900 4897635 4896862 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_45900 4897759 4898589 gene locus_tag LOCUS_45910 4897759 4898589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 4898852 4899379 gene locus_tag LOCUS_45920 4898852 4899379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 4899650 4899994 gene locus_tag LOCUS_45930 4899650 4899994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 4900258 4900028 gene locus_tag LOCUS_45940 4900258 4900028 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 protein_id gnl|my_center|LOCUS_45940 4900996 4900376 gene locus_tag LOCUS_45950 4900996 4900376 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_45950 4901092 4902432 gene locus_tag LOCUS_45960 4901092 4902432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 4902497 4903480 gene locus_tag LOCUS_45970 4902497 4903480 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223022.1 protein_id gnl|my_center|LOCUS_45970 4903554 4904450 gene locus_tag LOCUS_45980 4903554 4904450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 4904473 4905651 gene locus_tag LOCUS_45990 gene moeZ 4904473 4905651 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_45990 4906498 4905758 gene locus_tag LOCUS_46000 4906498 4905758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 4907073 4906498 gene locus_tag LOCUS_46010 4907073 4906498 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_46010 4907892 4907269 gene locus_tag LOCUS_46020 4907892 4907269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 4908467 4907907 gene locus_tag LOCUS_46030 4908467 4907907 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 protein_id gnl|my_center|LOCUS_46030 4909407 4908592 gene locus_tag LOCUS_46040 gene ehuA 4909407 4908592 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896768.1 protein_id gnl|my_center|LOCUS_46040 4910122 4909394 gene locus_tag LOCUS_46050 gene ehuD 4910122 4909394 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804358.1 protein_id gnl|my_center|LOCUS_46050 4910862 4910122 gene locus_tag LOCUS_46060 gene ehuC 4910862 4910122 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896766.1 protein_id gnl|my_center|LOCUS_46060 4911791 4910877 gene locus_tag LOCUS_46070 4911791 4910877 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804356.1 protein_id gnl|my_center|LOCUS_46070 4912051 4912839 gene locus_tag LOCUS_46080 4912051 4912839 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229616.1 protein_id gnl|my_center|LOCUS_46080 4913451 4912843 gene locus_tag LOCUS_46090 4913451 4912843 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_46090 4913635 4915308 gene locus_tag LOCUS_46100 4913635 4915308 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223014.1 protein_id gnl|my_center|LOCUS_46100 4915322 4915564 gene locus_tag LOCUS_46110 4915322 4915564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 4916177 4915590 gene locus_tag LOCUS_46120 4916177 4915590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 4916340 4916708 gene locus_tag LOCUS_46130 4916340 4916708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 4917018 4916758 gene locus_tag LOCUS_46140 4917018 4916758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 4917633 4917028 gene locus_tag LOCUS_46150 4917633 4917028 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_46150 4918583 4917711 gene locus_tag LOCUS_46160 4918583 4917711 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222318.1 protein_id gnl|my_center|LOCUS_46160 4918636 4919082 gene locus_tag LOCUS_46170 4918636 4919082 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528223.1 protein_id gnl|my_center|LOCUS_46170 4920385 4919129 gene locus_tag LOCUS_46180 4920385 4919129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 4921285 4920479 gene locus_tag LOCUS_46190 4921285 4920479 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616157.1 protein_id gnl|my_center|LOCUS_46190 4921430 4922119 gene locus_tag LOCUS_46200 4921430 4922119 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230203.1 protein_id gnl|my_center|LOCUS_46200 4922116 4922409 gene locus_tag LOCUS_46210 4922116 4922409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 4923185 4922424 gene locus_tag LOCUS_46220 4923185 4922424 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 protein_id gnl|my_center|LOCUS_46220 4923257 4923835 gene locus_tag LOCUS_46230 4923257 4923835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 4924137 4923883 gene locus_tag LOCUS_46240 4924137 4923883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 4924248 4924652 gene locus_tag LOCUS_46250 4924248 4924652 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 protein_id gnl|my_center|LOCUS_46250 4924707 4925381 gene locus_tag LOCUS_46260 4924707 4925381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 4926234 4926398 gene locus_tag LOCUS_46270 4926234 4926398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 4928380 4926638 gene locus_tag LOCUS_46280 4928380 4926638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 4928830 4928384 gene locus_tag LOCUS_46290 4928830 4928384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 4930024 4929128 gene locus_tag LOCUS_46300 gene era 4930024 4929128 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_46300 4930347 4930021 gene locus_tag LOCUS_46310 4930347 4930021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228397.1 protein_id gnl|my_center|LOCUS_46310 4931612 4930347 gene locus_tag LOCUS_46320 4931612 4930347 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_46320 4932105 4931635 gene locus_tag LOCUS_46330 gene ybeY 4932105 4931635 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976270.1 protein_id gnl|my_center|LOCUS_46330 4933078 4932116 gene locus_tag LOCUS_46340 4933078 4932116 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_46340 4933735 4933313 gene locus_tag LOCUS_46350 4933735 4933313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 4934021 4933722 gene locus_tag LOCUS_46360 4934021 4933722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 4934145 4935371 gene locus_tag LOCUS_46370 gene kynU 4934145 4935371 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257142.1 protein_id gnl|my_center|LOCUS_46370 4936506 4935598 gene locus_tag LOCUS_46380 4936506 4935598 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223696.1 protein_id gnl|my_center|LOCUS_46380 4936587 4937087 gene locus_tag LOCUS_46390 4936587 4937087 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027181.1 protein_id gnl|my_center|LOCUS_46390 4937606 4937073 gene locus_tag LOCUS_46400 4937606 4937073 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_46400 4937742 4938746 gene locus_tag LOCUS_46410 4937742 4938746 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_46410 4938858 4940171 gene locus_tag LOCUS_46420 4938858 4940171 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847962.1 protein_id gnl|my_center|LOCUS_46420 4940233 4940685 gene locus_tag LOCUS_46430 4940233 4940685 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060114.1 protein_id gnl|my_center|LOCUS_46430 4940808 4942226 gene locus_tag LOCUS_46440 4940808 4942226 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_46440 4942963 4942325 gene locus_tag LOCUS_46450 4942963 4942325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 4943803 4943207 gene locus_tag LOCUS_46460 4943803 4943207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110159.1 protein_id gnl|my_center|LOCUS_46460 4944207 4943809 gene locus_tag LOCUS_46470 4944207 4943809 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_46470 4945883 4944207 gene locus_tag LOCUS_46480 gene ettA 4945883 4944207 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_46480 4946091 4947539 gene locus_tag LOCUS_46490 4946091 4947539 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062235.1 protein_id gnl|my_center|LOCUS_46490 4947659 4950262 gene locus_tag LOCUS_46500 gene otsB 4947659 4950262 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230393.1 protein_id gnl|my_center|LOCUS_46500 4950509 4951711 gene locus_tag LOCUS_46510 4950509 4951711 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222988.1 protein_id gnl|my_center|LOCUS_46510 4951708 4952607 gene locus_tag LOCUS_46520 4951708 4952607 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222989.1 protein_id gnl|my_center|LOCUS_46520 4952607 4953428 gene locus_tag LOCUS_46530 4952607 4953428 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222990.1 protein_id gnl|my_center|LOCUS_46530 4953434 4954600 gene locus_tag LOCUS_46540 gene ugpC 4953434 4954600 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222991.1 protein_id gnl|my_center|LOCUS_46540 4954772 4956091 gene locus_tag LOCUS_46550 4954772 4956091 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970996.1 protein_id gnl|my_center|LOCUS_46550 4956151 4957128 gene locus_tag LOCUS_46560 4956151 4957128 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127580519.1 protein_id gnl|my_center|LOCUS_46560 4957125 4958069 gene locus_tag LOCUS_46570 4957125 4958069 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_46570 4959123 4958164 gene locus_tag LOCUS_46580 4959123 4958164 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225829.1 protein_id gnl|my_center|LOCUS_46580 4960037 4959165 gene locus_tag LOCUS_46590 4960037 4959165 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974400.1 protein_id gnl|my_center|LOCUS_46590 4961234 4960041 gene locus_tag LOCUS_46600 4961234 4960041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 4962248 4961247 gene locus_tag LOCUS_46610 4962248 4961247 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970002.1 protein_id gnl|my_center|LOCUS_46610 4963258 4962245 gene locus_tag LOCUS_46620 4963258 4962245 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315915.1 protein_id gnl|my_center|LOCUS_46620 4964775 4963255 gene locus_tag LOCUS_46630 4964775 4963255 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_46630 4965876 4964776 gene locus_tag LOCUS_46640 4965876 4964776 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_46640 4965985 4967496 gene locus_tag LOCUS_46650 4965985 4967496 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223433.1 protein_id gnl|my_center|LOCUS_46650 4969050 4967503 gene locus_tag LOCUS_46660 4969050 4967503 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_46660 4969469 4969047 gene locus_tag LOCUS_46670 4969469 4969047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 4969676 4970818 gene locus_tag LOCUS_46680 4969676 4970818 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_46680 4970815 4971480 gene locus_tag LOCUS_46690 4970815 4971480 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972556.1 protein_id gnl|my_center|LOCUS_46690 4973027 4971948 gene locus_tag LOCUS_46700 gene cobA 4973027 4971948 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226827.1 protein_id gnl|my_center|LOCUS_46700 4973221 4975392 gene locus_tag LOCUS_46710 gene ponA2 4973221 4975392 CDS product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878583.1 protein_id gnl|my_center|LOCUS_46710 4976125 4975355 gene locus_tag LOCUS_46720 4976125 4975355 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_46720 4976197 4977564 gene locus_tag LOCUS_46730 4976197 4977564 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805011.1 protein_id gnl|my_center|LOCUS_46730 4978165 4977551 gene locus_tag LOCUS_46740 4978165 4977551 CDS product 4-amino-4-deoxychorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296643.1 protein_id gnl|my_center|LOCUS_46740 4978461 4978817 gene locus_tag LOCUS_46750 4978461 4978817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46750 4979089 4979754 gene locus_tag LOCUS_46760 4979089 4979754 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222233.1 protein_id gnl|my_center|LOCUS_46760 4982618 4979919 gene locus_tag LOCUS_46770 4982618 4979919 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228797.1 protein_id gnl|my_center|LOCUS_46770 4983361 4982717 gene locus_tag LOCUS_46780 4983361 4982717 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_46780 4983504 4983579 gene locus_tag LOCUS_t00370 4983504 4983579 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4983711 4984838 gene locus_tag LOCUS_46790 4983711 4984838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 4984907 4985344 gene locus_tag LOCUS_46800 gene merR 4984907 4985344 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_46800 4985382 4986371 gene locus_tag LOCUS_46810 4985382 4986371 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 protein_id gnl|my_center|LOCUS_46810 4986340 4987446 gene locus_tag LOCUS_46820 4986340 4987446 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222262.1 protein_id gnl|my_center|LOCUS_46820 4987657 4988961 gene locus_tag LOCUS_46830 gene ctpM 4987657 4988961 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_46830 4989314 4990012 gene locus_tag LOCUS_46840 4989314 4990012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 4990016 4991245 gene locus_tag LOCUS_46850 4990016 4991245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081535.1 protein_id gnl|my_center|LOCUS_46850 4991356 4991679 gene locus_tag LOCUS_46860 4991356 4991679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 4992481 4991756 gene locus_tag LOCUS_46870 4992481 4991756 CDS product fluoroquinolones efflux ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413897.1 protein_id gnl|my_center|LOCUS_46870 4993205 4992483 gene locus_tag LOCUS_46880 4993205 4992483 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727707.1 protein_id gnl|my_center|LOCUS_46880 4994065 4993202 gene locus_tag LOCUS_46890 4994065 4993202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139527.1 protein_id gnl|my_center|LOCUS_46890 4994545 4994072 gene locus_tag LOCUS_46900 gene mmpR5 4994545 4994072 CDS product siderophore transport transcriptional regulator MmpR5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403442.1 protein_id gnl|my_center|LOCUS_46900 4994683 4994919 gene locus_tag LOCUS_46910 4994683 4994919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 4994916 4995377 gene locus_tag LOCUS_46920 4994916 4995377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 4995381 4995650 gene locus_tag LOCUS_46930 4995381 4995650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 4995657 4997045 gene locus_tag LOCUS_46940 4995657 4997045 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226755.1 protein_id gnl|my_center|LOCUS_46940 4997214 4998338 gene locus_tag LOCUS_46950 4997214 4998338 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270408.1 protein_id gnl|my_center|LOCUS_46950 4998335 4999465 gene locus_tag LOCUS_46960 4998335 4999465 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270408.1 protein_id gnl|my_center|LOCUS_46960 5000532 4999510 gene locus_tag LOCUS_46970 5000532 4999510 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_46970 5000676 5002418 gene locus_tag LOCUS_46980 5000676 5002418 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972134.1 protein_id gnl|my_center|LOCUS_46980 5002431 5003804 gene locus_tag LOCUS_46990 5002431 5003804 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_46990 5003807 5004727 gene locus_tag LOCUS_47000 5003807 5004727 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_47000 5004724 5005602 gene locus_tag LOCUS_47010 5004724 5005602 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 protein_id gnl|my_center|LOCUS_47010 5007021 5005633 gene locus_tag LOCUS_47020 5007021 5005633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089046.1 protein_id gnl|my_center|LOCUS_47020 5007137 5007799 gene locus_tag LOCUS_47030 5007137 5007799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 5008320 5007796 gene locus_tag LOCUS_47040 5008320 5007796 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_47040 5008727 5008422 gene locus_tag LOCUS_47050 5008727 5008422 CDS product gas vesicle protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972470.1 protein_id gnl|my_center|LOCUS_47050 5008921 5008724 gene locus_tag LOCUS_47060 5008921 5008724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 5009682 5008918 gene locus_tag LOCUS_47070 5009682 5008918 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730760.1 protein_id gnl|my_center|LOCUS_47070 5010019 5009675 gene locus_tag LOCUS_47080 5010019 5009675 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978207.1 protein_id gnl|my_center|LOCUS_47080 5010360 5010016 gene locus_tag LOCUS_47090 gene gvpO 5010360 5010016 CDS product gas vesicle protein GvpO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904111.1 protein_id gnl|my_center|LOCUS_47090 5010612 5010367 gene locus_tag LOCUS_47100 5010612 5010367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 5011394 5010615 gene locus_tag LOCUS_47110 5011394 5010615 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_47110 5011798 5011391 gene locus_tag LOCUS_47120 5011798 5011391 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030969.1 protein_id gnl|my_center|LOCUS_47120 5012088 5011828 gene locus_tag LOCUS_47130 5012088 5011828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 5011976 5012860 gene locus_tag LOCUS_47140 5011976 5012860 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224285.1 protein_id gnl|my_center|LOCUS_47140 5012901 5013740 gene locus_tag LOCUS_47150 5012901 5013740 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_47150 5014326 5013700 gene locus_tag LOCUS_47160 5014326 5013700 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_47160 5014463 5015260 gene locus_tag LOCUS_47170 5014463 5015260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 5015327 5015857 gene locus_tag LOCUS_47180 5015327 5015857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 5016413 5015838 gene locus_tag LOCUS_47190 5016413 5015838 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_47190 5016522 5017031 gene locus_tag LOCUS_47200 5016522 5017031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 5017048 5017824 gene locus_tag LOCUS_47210 5017048 5017824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971044.1 protein_id gnl|my_center|LOCUS_47210 5019047 5017806 gene locus_tag LOCUS_47220 5019047 5017806 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132388.1 protein_id gnl|my_center|LOCUS_47220 5020210 5019044 gene locus_tag LOCUS_47230 gene cysK2 5020210 5019044 CDS product S-sulfocysteine synthase CysK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935595.1 protein_id gnl|my_center|LOCUS_47230 5020597 5020265 gene locus_tag LOCUS_47240 5020597 5020265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 5021598 5020648 gene locus_tag LOCUS_47250 5021598 5020648 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231049.1 protein_id gnl|my_center|LOCUS_47250 5021799 5022437 gene locus_tag LOCUS_47260 5021799 5022437 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 protein_id gnl|my_center|LOCUS_47260 5024065 5023184 gene locus_tag LOCUS_47270 5024065 5023184 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_47270 5026329 5024068 gene locus_tag LOCUS_47280 5026329 5024068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 5026958 5026326 gene locus_tag LOCUS_47290 5026958 5026326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 5027006 5027413 gene locus_tag LOCUS_47300 5027006 5027413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 5028211 5027555 gene locus_tag LOCUS_47310 5028211 5027555 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223288.1 protein_id gnl|my_center|LOCUS_47310 5029416 5028199 gene locus_tag LOCUS_47320 5029416 5028199 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223289.1 protein_id gnl|my_center|LOCUS_47320 5029596 5030696 gene locus_tag LOCUS_47330 5029596 5030696 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_47330 5030714 5032234 gene locus_tag LOCUS_47340 5030714 5032234 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031804.1 protein_id gnl|my_center|LOCUS_47340 5032312 5032818 gene locus_tag LOCUS_47350 5032312 5032818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 5033498 5032848 gene locus_tag LOCUS_47360 5033498 5032848 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976493.1 protein_id gnl|my_center|LOCUS_47360 5034112 5033561 gene locus_tag LOCUS_47370 5034112 5033561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 5034223 5035164 gene locus_tag LOCUS_47380 5034223 5035164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 5036702 5035191 gene locus_tag LOCUS_47390 5036702 5035191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 5037611 5036775 gene locus_tag LOCUS_47400 5037611 5036775 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 protein_id gnl|my_center|LOCUS_47400 5037638 5038195 gene locus_tag LOCUS_47410 5037638 5038195 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_47410 5038267 5039367 gene locus_tag LOCUS_47420 5038267 5039367 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031727.1 protein_id gnl|my_center|LOCUS_47420 5040043 5039429 gene locus_tag LOCUS_47430 5040043 5039429 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_47430 5040989 5040048 gene locus_tag LOCUS_47440 5040989 5040048 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227839.1 protein_id gnl|my_center|LOCUS_47440 5042054 5041116 gene locus_tag LOCUS_47450 5042054 5041116 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_47450 5042862 5042272 gene locus_tag LOCUS_47460 5042862 5042272 CDS product TetR/AcrR family transcriptional regulator C-terminal ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894516.1 protein_id gnl|my_center|LOCUS_47460 5042957 5044135 gene locus_tag LOCUS_47470 5042957 5044135 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776478.1 protein_id gnl|my_center|LOCUS_47470 5045142 5044414 gene locus_tag LOCUS_47480 5045142 5044414 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191067.1 protein_id gnl|my_center|LOCUS_47480 5045243 5045884 gene locus_tag LOCUS_47490 5045243 5045884 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222994.1 protein_id gnl|my_center|LOCUS_47490 5047236 5046292 gene locus_tag LOCUS_47500 5047236 5046292 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112734.1 protein_id gnl|my_center|LOCUS_47500 5047589 5047233 gene locus_tag LOCUS_47510 5047589 5047233 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_47510 5047713 5048378 gene locus_tag LOCUS_47520 5047713 5048378 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028218.1 protein_id gnl|my_center|LOCUS_47520 5048381 5048980 gene locus_tag LOCUS_47530 5048381 5048980 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_47530 5049578 5048988 gene locus_tag LOCUS_47540 5049578 5048988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 5049635 5050237 gene locus_tag LOCUS_47550 5049635 5050237 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_47550 5050620 5050312 gene locus_tag LOCUS_47560 5050620 5050312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 5050967 5051797 gene locus_tag LOCUS_47570 5050967 5051797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 5051781 5051954 gene locus_tag LOCUS_47580 5051781 5051954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 5052172 5054346 gene locus_tag LOCUS_47590 5052172 5054346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 5055319 5054351 gene locus_tag LOCUS_47600 5055319 5054351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 5055486 5056076 gene locus_tag LOCUS_47610 5055486 5056076 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227258.1 protein_id gnl|my_center|LOCUS_47610 5056210 5056614 gene locus_tag LOCUS_47620 5056210 5056614 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228426.1 protein_id gnl|my_center|LOCUS_47620 5056611 5057069 gene locus_tag LOCUS_47630 5056611 5057069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 5058108 5057098 gene locus_tag LOCUS_47640 5058108 5057098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 5059365 5058124 gene locus_tag LOCUS_47650 5059365 5058124 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_47650 5059796 5059404 gene locus_tag LOCUS_47660 5059796 5059404 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_47660 5060666 5059881 gene locus_tag LOCUS_47670 gene lieB 5060666 5059881 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_47670 5061559 5060663 gene locus_tag LOCUS_47680 5061559 5060663 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_47680 5061649 5062407 gene locus_tag LOCUS_47690 5061649 5062407 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777055.1 protein_id gnl|my_center|LOCUS_47690 5062758 5063732 gene locus_tag LOCUS_47700 5062758 5063732 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_47700 5064235 5063738 gene locus_tag LOCUS_47710 5064235 5063738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 5065297 5064245 gene locus_tag LOCUS_47720 5065297 5064245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 5065785 5065330 gene locus_tag LOCUS_47730 5065785 5065330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 5065975 5065793 gene locus_tag LOCUS_47740 5065975 5065793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 5066514 5066053 gene locus_tag LOCUS_47750 5066514 5066053 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_47750 5066684 5067094 gene locus_tag LOCUS_47760 5066684 5067094 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_47760 5067939 5067103 gene locus_tag LOCUS_47770 5067939 5067103 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_47770 5068003 5068503 gene locus_tag LOCUS_47780 5068003 5068503 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229404.1 protein_id gnl|my_center|LOCUS_47780 5068840 5068526 gene locus_tag LOCUS_47790 5068840 5068526 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226697.1 protein_id gnl|my_center|LOCUS_47790 5068913 5069521 gene locus_tag LOCUS_47800 5068913 5069521 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_47800 5069518 5069907 gene locus_tag LOCUS_47810 5069518 5069907 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_47810 5072167 5070677 gene locus_tag LOCUS_47820 5072167 5070677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 5072243 5072851 gene locus_tag LOCUS_47830 5072243 5072851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 5072917 5073711 gene locus_tag LOCUS_47840 5072917 5073711 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_47840 5073797 5074636 gene locus_tag LOCUS_47850 5073797 5074636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 5075326 5074640 gene locus_tag LOCUS_47860 gene actII 5075326 5074640 CDS product TetR family transcriptional regulator ActII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030045.1 protein_id gnl|my_center|LOCUS_47860 5075581 5077989 gene locus_tag LOCUS_47870 5075581 5077989 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316462.1 protein_id gnl|my_center|LOCUS_47870 5078063 5078716 gene locus_tag LOCUS_47880 5078063 5078716 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_47880 5079631 5078744 gene locus_tag LOCUS_47890 5079631 5078744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 5079753 5080622 gene locus_tag LOCUS_47900 5079753 5080622 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 protein_id gnl|my_center|LOCUS_47900 5081811 5080684 gene locus_tag LOCUS_47910 5081811 5080684 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163818369.1 protein_id gnl|my_center|LOCUS_47910 5081866 5082876 gene locus_tag LOCUS_47920 5081866 5082876 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226156.1 protein_id gnl|my_center|LOCUS_47920 5083310 5082852 gene locus_tag LOCUS_47930 5083310 5082852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 5083495 5085141 gene locus_tag LOCUS_47940 5083495 5085141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 5085289 5086146 gene locus_tag LOCUS_47950 5085289 5086146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 5086170 5086676 gene locus_tag LOCUS_47960 5086170 5086676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 5086792 5086718 gene locus_tag LOCUS_t00380 5086792 5086718 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5087314 5086850 gene locus_tag LOCUS_47970 5087314 5086850 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_47970 5087792 5087361 gene locus_tag LOCUS_47980 5087792 5087361 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224000.1 protein_id gnl|my_center|LOCUS_47980 5088001 5090760 gene locus_tag LOCUS_47990 gene aceE 5088001 5090760 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729733.1 protein_id gnl|my_center|LOCUS_47990 5091949 5091089 gene locus_tag LOCUS_48000 5091949 5091089 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_48000 5092067 5092729 gene locus_tag LOCUS_48010 5092067 5092729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 5093584 5092733 gene locus_tag LOCUS_48020 5093584 5092733 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029307.1 protein_id gnl|my_center|LOCUS_48020 5093742 5094752 gene locus_tag LOCUS_48030 5093742 5094752 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014022.1 protein_id gnl|my_center|LOCUS_48030 5095850 5095197 gene locus_tag LOCUS_48040 5095850 5095197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 5096401 5095931 gene locus_tag LOCUS_48050 5096401 5095931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 5097978 5096398 gene locus_tag LOCUS_48060 5097978 5096398 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950653.1 protein_id gnl|my_center|LOCUS_48060 5098302 5097997 gene locus_tag LOCUS_48070 5098302 5097997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 5100713 5098500 gene locus_tag LOCUS_48080 5100713 5098500 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_48080 5101076 5101462 gene locus_tag LOCUS_48090 5101076 5101462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 5101468 5101797 gene locus_tag LOCUS_48100 5101468 5101797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 5101806 5102807 gene locus_tag LOCUS_48110 5101806 5102807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 5102842 5104002 gene locus_tag LOCUS_48120 gene fasR 5102842 5104002 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_48120 5104107 5105030 gene locus_tag LOCUS_48130 5104107 5105030 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_48130 5105027 5105974 gene locus_tag LOCUS_48140 5105027 5105974 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_48140 5106006 5106254 gene locus_tag LOCUS_48150 5106006 5106254 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 protein_id gnl|my_center|LOCUS_48150 5106254 5107468 gene locus_tag LOCUS_48160 5106254 5107468 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_48160 5107479 5108906 gene locus_tag LOCUS_48170 5107479 5108906 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060587.1 protein_id gnl|my_center|LOCUS_48170 5109935 5108973 gene locus_tag LOCUS_48180 5109935 5108973 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227102.1 protein_id gnl|my_center|LOCUS_48180 5110068 5110211 gene locus_tag LOCUS_48190 5110068 5110211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 5110701 5110288 gene locus_tag LOCUS_48200 5110701 5110288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48200 5111435 5110698 gene locus_tag LOCUS_48210 5111435 5110698 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_48210 5112291 5111464 gene locus_tag LOCUS_48220 5112291 5111464 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_48220 5117837 5112288 gene locus_tag LOCUS_48230 5117837 5112288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 5118548 5117973 gene locus_tag LOCUS_48240 5118548 5117973 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227701.1 protein_id gnl|my_center|LOCUS_48240 5119744 5118545 gene locus_tag LOCUS_48250 5119744 5118545 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_48250 5120154 5120435 gene locus_tag LOCUS_48260 5120154 5120435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 5121791 5120445 gene locus_tag LOCUS_48270 gene glnA 5121791 5120445 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_48270 5121980 5122738 gene locus_tag LOCUS_48280 5121980 5122738 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_48280 5122937 5122743 gene locus_tag LOCUS_48290 5122937 5122743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 5123697 5122954 gene locus_tag LOCUS_48300 5123697 5122954 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974296.1 protein_id gnl|my_center|LOCUS_48300 5124714 5123872 gene locus_tag LOCUS_48310 gene panB 5124714 5123872 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_48310 5125844 5124810 gene locus_tag LOCUS_48320 5125844 5124810 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229618.1 protein_id gnl|my_center|LOCUS_48320 5126804 5125929 gene locus_tag LOCUS_48330 5126804 5125929 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_48330 5126964 5128595 gene locus_tag LOCUS_48340 5126964 5128595 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_48340 5129542 5128592 gene locus_tag LOCUS_48350 5129542 5128592 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 protein_id gnl|my_center|LOCUS_48350 5129860 5129663 gene locus_tag LOCUS_48360 5129860 5129663 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229193.1 protein_id gnl|my_center|LOCUS_48360 5131083 5129857 gene locus_tag LOCUS_48370 5131083 5129857 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_48370 5132011 5131175 gene locus_tag LOCUS_48380 5132011 5131175 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224066.1 protein_id gnl|my_center|LOCUS_48380 5132600 5132025 gene locus_tag LOCUS_48390 5132600 5132025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030213.1 protein_id gnl|my_center|LOCUS_48390 5132757 5133917 gene locus_tag LOCUS_48400 5132757 5133917 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_48400 5133919 5134551 gene locus_tag LOCUS_48410 5133919 5134551 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_48410 5134831 5135979 gene locus_tag LOCUS_48420 5134831 5135979 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_48420 5136829 5135969 gene locus_tag LOCUS_48430 5136829 5135969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_48430 5137736 5136816 gene locus_tag LOCUS_48440 5137736 5136816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_48440 5138884 5137781 gene locus_tag LOCUS_48450 5138884 5137781 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 protein_id gnl|my_center|LOCUS_48450 5139134 5140894 gene locus_tag LOCUS_48460 5139134 5140894 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230897.1 protein_id gnl|my_center|LOCUS_48460 5141010 5141654 gene locus_tag LOCUS_48470 5141010 5141654 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_48470 5141651 5142868 gene locus_tag LOCUS_48480 5141651 5142868 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_48480 5143508 5142870 gene locus_tag LOCUS_48490 5143508 5142870 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229511.1 protein_id gnl|my_center|LOCUS_48490 5144424 5143528 gene locus_tag LOCUS_48500 5144424 5143528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 5146261 5144498 gene locus_tag LOCUS_48510 5146261 5144498 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230897.1 protein_id gnl|my_center|LOCUS_48510 5146907 5146368 gene locus_tag LOCUS_48520 5146907 5146368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 5147845 5146913 gene locus_tag LOCUS_48530 5147845 5146913 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727373.1 protein_id gnl|my_center|LOCUS_48530 5148573 5147842 gene locus_tag LOCUS_48540 5148573 5147842 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_48540 5149435 5148668 gene locus_tag LOCUS_48550 5149435 5148668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 5150869 5149448 gene locus_tag LOCUS_48560 5150869 5149448 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224107.1 protein_id gnl|my_center|LOCUS_48560 5151704 5150910 gene locus_tag LOCUS_48570 5151704 5150910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_48570 5152460 5151777 gene locus_tag LOCUS_48580 5152460 5151777 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_48580 5152648 5154546 gene locus_tag LOCUS_48590 5152648 5154546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 5156563 5154554 gene locus_tag LOCUS_48600 5156563 5154554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 5156616 5158691 gene locus_tag LOCUS_48610 5156616 5158691 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_48610 5158723 5159523 gene locus_tag LOCUS_48620 5158723 5159523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48620 5159534 5160190 gene locus_tag LOCUS_48630 5159534 5160190 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804184.1 protein_id gnl|my_center|LOCUS_48630 5160289 5160741 gene locus_tag LOCUS_48640 5160289 5160741 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222821.1 protein_id gnl|my_center|LOCUS_48640 5160775 5161266 gene locus_tag LOCUS_48650 5160775 5161266 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762309.1 protein_id gnl|my_center|LOCUS_48650 5162465 5161275 gene locus_tag LOCUS_48660 5162465 5161275 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224417.1 protein_id gnl|my_center|LOCUS_48660 5163005 5162580 gene locus_tag LOCUS_48670 5163005 5162580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088530.1 protein_id gnl|my_center|LOCUS_48670 5164464 5163130 gene locus_tag LOCUS_48680 5164464 5163130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730421.1 protein_id gnl|my_center|LOCUS_48680 5164550 5165788 gene locus_tag LOCUS_48690 5164550 5165788 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_48690 5166713 5165823 gene locus_tag LOCUS_48700 5166713 5165823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 5167731 5166829 gene locus_tag LOCUS_48710 5167731 5166829 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_48710 5168213 5167767 gene locus_tag LOCUS_48720 5168213 5167767 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411354.1 protein_id gnl|my_center|LOCUS_48720 5168590 5168225 gene locus_tag LOCUS_48730 5168590 5168225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 5168722 5170524 gene locus_tag LOCUS_48740 5168722 5170524 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_48740 5170585 5172285 gene locus_tag LOCUS_48750 5170585 5172285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 5172292 5172960 gene locus_tag LOCUS_48760 5172292 5172960 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_48760 5173390 5172965 gene locus_tag LOCUS_48770 5173390 5172965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 5173525 5174211 gene locus_tag LOCUS_48780 5173525 5174211 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_48780 5174213 5175451 gene locus_tag LOCUS_48790 5174213 5175451 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 protein_id gnl|my_center|LOCUS_48790 5175537 5177453 gene locus_tag LOCUS_48800 5175537 5177453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 5178679 5177570 gene locus_tag LOCUS_48810 5178679 5177570 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_48810 5178596 5178985 gene locus_tag LOCUS_48820 5178596 5178985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 5180498 5179245 gene locus_tag LOCUS_48830 5180498 5179245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 5180619 5182142 gene locus_tag LOCUS_48840 5180619 5182142 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_48840 5182188 5182880 gene locus_tag LOCUS_48850 5182188 5182880 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076158225.1 protein_id gnl|my_center|LOCUS_48850 5182877 5183635 gene locus_tag LOCUS_48860 5182877 5183635 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_48860 5183761 5184801 gene locus_tag LOCUS_48870 5183761 5184801 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230685.1 protein_id gnl|my_center|LOCUS_48870 5184949 5186406 gene locus_tag LOCUS_48880 5184949 5186406 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_48880 5188132 5186492 gene locus_tag LOCUS_48890 5188132 5186492 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 protein_id gnl|my_center|LOCUS_48890 5189255 5188518 gene locus_tag LOCUS_48900 5189255 5188518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 5189838 5189440 gene locus_tag LOCUS_48910 5189838 5189440 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221993.1 protein_id gnl|my_center|LOCUS_48910 5190887 5189904 gene locus_tag LOCUS_48920 5190887 5189904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223096.1 protein_id gnl|my_center|LOCUS_48920 5191876 5190980 gene locus_tag LOCUS_48930 5191876 5190980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 5191992 5192633 gene locus_tag LOCUS_48940 gene lipB 5191992 5192633 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_48940 5193882 5192677 gene locus_tag LOCUS_48950 gene aspS 5193882 5192677 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193209104.1 protein_id gnl|my_center|LOCUS_48950 5193794 5194174 gene locus_tag LOCUS_48960 5193794 5194174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 5194830 5194402 gene locus_tag LOCUS_48970 5194830 5194402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 5195425 5195039 gene locus_tag LOCUS_48980 5195425 5195039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 5198804 5195535 gene locus_tag LOCUS_48990 5198804 5195535 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_48990 5198877 5199866 gene locus_tag LOCUS_49000 gene lipA 5198877 5199866 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223711.1 protein_id gnl|my_center|LOCUS_49000 5199892 5200590 gene locus_tag LOCUS_49010 5199892 5200590 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_49010 5201161 5200673 gene locus_tag LOCUS_49020 5201161 5200673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 5201274 5202698 gene locus_tag LOCUS_49030 gene glnA 5201274 5202698 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223133.1 protein_id gnl|my_center|LOCUS_49030 5203140 5202748 gene locus_tag LOCUS_49040 5203140 5202748 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_49040 5203354 5203623 gene locus_tag LOCUS_49050 5203354 5203623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 5203616 5205358 gene locus_tag LOCUS_49060 5203616 5205358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 5205355 5206020 gene locus_tag LOCUS_49070 5205355 5206020 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_49070 5206045 5206641 gene locus_tag LOCUS_49080 5206045 5206641 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_49080 5206665 5208872 gene locus_tag LOCUS_49090 5206665 5208872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 5208833 5210764 gene locus_tag LOCUS_49100 5208833 5210764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 5210875 5211054 gene locus_tag LOCUS_49110 5210875 5211054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 5213966 5211045 gene locus_tag LOCUS_49120 5213966 5211045 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_49120 5214393 5214199 gene locus_tag LOCUS_49130 5214393 5214199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 5215205 5214390 gene locus_tag LOCUS_49140 5215205 5214390 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_49140 5216003 5215329 gene locus_tag LOCUS_49150 5216003 5215329 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_49150 5217219 5216053 gene locus_tag LOCUS_49160 5217219 5216053 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029904.1 protein_id gnl|my_center|LOCUS_49160 5217362 5218294 gene locus_tag LOCUS_49170 5217362 5218294 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267274.1 protein_id gnl|my_center|LOCUS_49170 5218844 5218314 gene locus_tag LOCUS_49180 5218844 5218314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 5219039 5219560 gene locus_tag LOCUS_49190 5219039 5219560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 5219574 5220557 gene locus_tag LOCUS_49200 5219574 5220557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 5223453 5220601 gene locus_tag LOCUS_49210 gene leuS 5223453 5220601 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 protein_id gnl|my_center|LOCUS_49210 5223806 5224765 gene locus_tag LOCUS_49220 5223806 5224765 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_49220 5224772 5226070 gene locus_tag LOCUS_49230 5224772 5226070 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_49230 5226067 5228451 gene locus_tag LOCUS_49240 5226067 5228451 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_49240 5228733 5230220 gene locus_tag LOCUS_49250 5228733 5230220 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704269.1 protein_id gnl|my_center|LOCUS_49250 5230247 5230903 gene locus_tag LOCUS_49260 5230247 5230903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 5230923 5231942 gene locus_tag LOCUS_49270 5230923 5231942 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_49270 5232426 5232022 gene locus_tag LOCUS_49280 5232426 5232022 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228055.1 protein_id gnl|my_center|LOCUS_49280 5233764 5232532 gene locus_tag LOCUS_49290 gene dinB 5233764 5232532 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_49290 5234962 5233787 gene locus_tag LOCUS_49300 5234962 5233787 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_49300 5235102 5235683 gene locus_tag LOCUS_49310 5235102 5235683 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976769.1 protein_id gnl|my_center|LOCUS_49310 5235581 5236945 gene locus_tag LOCUS_49320 5235581 5236945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976770.1 protein_id gnl|my_center|LOCUS_49320 5237726 5236968 gene locus_tag LOCUS_49330 5237726 5236968 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_49330 5237786 5238442 gene locus_tag LOCUS_49340 5237786 5238442 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226486.1 protein_id gnl|my_center|LOCUS_49340 5238492 5239151 gene locus_tag LOCUS_49350 5238492 5239151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 5239181 5239624 gene locus_tag LOCUS_49360 5239181 5239624 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027656.1 protein_id gnl|my_center|LOCUS_49360 5241095 5239629 gene locus_tag LOCUS_49370 5241095 5239629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 5241206 5242375 gene locus_tag LOCUS_49380 5241206 5242375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 5242372 5243499 gene locus_tag LOCUS_49390 5242372 5243499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 5244699 5243503 gene locus_tag LOCUS_49400 5244699 5243503 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_49400 5245369 5244758 gene locus_tag LOCUS_49410 gene rpsD 5245369 5244758 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 protein_id gnl|my_center|LOCUS_49410 5245434 5246171 gene locus_tag LOCUS_49420 5245434 5246171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 5246930 5246193 gene locus_tag LOCUS_49430 5246930 5246193 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224330.1 protein_id gnl|my_center|LOCUS_49430 5247064 5247840 gene locus_tag LOCUS_49440 5247064 5247840 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_49440 5247837 5248364 gene locus_tag LOCUS_49450 5247837 5248364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 5248475 5249956 gene locus_tag LOCUS_49460 gene proP 5248475 5249956 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247708.1 protein_id gnl|my_center|LOCUS_49460 5250913 5250002 gene locus_tag LOCUS_49470 5250913 5250002 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028478.1 protein_id gnl|my_center|LOCUS_49470 5251030 5251551 gene locus_tag LOCUS_49480 5251030 5251551 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028479.1 protein_id gnl|my_center|LOCUS_49480 5251675 5252148 gene locus_tag LOCUS_49490 5251675 5252148 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111199.1 protein_id gnl|my_center|LOCUS_49490 5252768 5252145 gene locus_tag LOCUS_49500 5252768 5252145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 5254132 5252765 gene locus_tag LOCUS_49510 5254132 5252765 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_49510 5254307 5255362 gene locus_tag LOCUS_49520 5254307 5255362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 5255367 5256041 gene locus_tag LOCUS_49530 5255367 5256041 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_49530 5256158 5256439 gene locus_tag LOCUS_49540 5256158 5256439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 5257674 5256454 gene locus_tag LOCUS_49550 5257674 5256454 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228776.1 protein_id gnl|my_center|LOCUS_49550 5258072 5257749 gene locus_tag LOCUS_49560 5258072 5257749 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730191.1 protein_id gnl|my_center|LOCUS_49560 5259469 5258219 gene locus_tag LOCUS_49570 5259469 5258219 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_49570 5261727 5260489 gene locus_tag LOCUS_49580 5261727 5260489 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977378.1 protein_id gnl|my_center|LOCUS_49580 5261821 5263218 gene locus_tag LOCUS_49590 5261821 5263218 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977377.1 protein_id gnl|my_center|LOCUS_49590 5263412 5264050 gene locus_tag LOCUS_49600 5263412 5264050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079789.1 protein_id gnl|my_center|LOCUS_49600 5265827 5264067 gene locus_tag LOCUS_49610 5265827 5264067 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_49610 5266444 5265890 gene locus_tag LOCUS_49620 5266444 5265890 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831756.1 protein_id gnl|my_center|LOCUS_49620 5266964 5266638 gene locus_tag LOCUS_49630 5266964 5266638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 5268338 5267265 gene locus_tag LOCUS_49640 5268338 5267265 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_49640 5270124 5268418 gene locus_tag LOCUS_49650 gene phnE 5270124 5268418 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727091.1 protein_id gnl|my_center|LOCUS_49650 5271001 5270192 gene locus_tag LOCUS_49660 gene phnC 5271001 5270192 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727093.1 protein_id gnl|my_center|LOCUS_49660 5271978 5271034 gene locus_tag LOCUS_49670 5271978 5271034 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892069.1 protein_id gnl|my_center|LOCUS_49670 5272923 5272165 gene locus_tag LOCUS_49680 5272923 5272165 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_49680 5273791 5274243 gene locus_tag LOCUS_49690 5273791 5274243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 5274895 5274713 gene locus_tag LOCUS_49700 5274895 5274713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 5275002 5275517 gene locus_tag LOCUS_49710 5275002 5275517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 5278592 5275500 gene locus_tag LOCUS_49720 5278592 5275500 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227699.1 protein_id gnl|my_center|LOCUS_49720 5278747 5279403 gene locus_tag LOCUS_49730 5278747 5279403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 5280709 5279456 gene locus_tag LOCUS_49740 5280709 5279456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 5281015 5280716 gene locus_tag LOCUS_49750 5281015 5280716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 5282397 5281102 gene locus_tag LOCUS_49760 5282397 5281102 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_49760 5282619 5283728 gene locus_tag LOCUS_49770 5282619 5283728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 5284165 5283698 gene locus_tag LOCUS_49780 5284165 5283698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 5285327 5284230 gene locus_tag LOCUS_49790 5285327 5284230 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977723.1 protein_id gnl|my_center|LOCUS_49790 5285533 5286093 gene locus_tag LOCUS_49800 5285533 5286093 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930077.1 protein_id gnl|my_center|LOCUS_49800 5286090 5286458 gene locus_tag LOCUS_49810 5286090 5286458 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729249.1 protein_id gnl|my_center|LOCUS_49810 5286455 5286790 gene locus_tag LOCUS_49820 5286455 5286790 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225343.1 protein_id gnl|my_center|LOCUS_49820 5286907 5287611 gene locus_tag LOCUS_49830 5286907 5287611 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_49830 5288806 5287640 gene locus_tag LOCUS_49840 5288806 5287640 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163818369.1 protein_id gnl|my_center|LOCUS_49840 5289441 5288803 gene locus_tag LOCUS_49850 5289441 5288803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 5289505 5290230 gene locus_tag LOCUS_49860 5289505 5290230 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229957.1 protein_id gnl|my_center|LOCUS_49860 5290860 5290231 gene locus_tag LOCUS_49870 5290860 5290231 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 protein_id gnl|my_center|LOCUS_49870 5290952 5291329 gene locus_tag LOCUS_49880 5290952 5291329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 5291438 5292682 gene locus_tag LOCUS_49890 5291438 5292682 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_49890 5293048 5292590 gene locus_tag LOCUS_49900 5293048 5292590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 5293770 5293261 gene locus_tag LOCUS_49910 5293770 5293261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 5294601 5293996 gene locus_tag LOCUS_49920 5294601 5293996 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191313375.1 protein_id gnl|my_center|LOCUS_49920 5295524 5294688 gene locus_tag LOCUS_49930 5295524 5294688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 5296623 5295529 gene locus_tag LOCUS_49940 5296623 5295529 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223638.1 protein_id gnl|my_center|LOCUS_49940 5297635 5296640 gene locus_tag LOCUS_49950 5297635 5296640 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_49950 5298408 5297635 gene locus_tag LOCUS_49960 5298408 5297635 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_49960 5298545 5298772 gene locus_tag LOCUS_49970 5298545 5298772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 5298931 5300529 gene locus_tag LOCUS_49980 5298931 5300529 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_49980 5300540 5301148 gene locus_tag LOCUS_49990 5300540 5301148 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729044.1 protein_id gnl|my_center|LOCUS_49990 5301210 5301407 gene locus_tag LOCUS_50000 5301210 5301407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 5301574 5302404 gene locus_tag LOCUS_50010 5301574 5302404 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223623.1 protein_id gnl|my_center|LOCUS_50010 5302526 5303611 gene locus_tag LOCUS_50020 gene mraY 5302526 5303611 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_50020 5304246 5303689 gene locus_tag LOCUS_50030 5304246 5303689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 5305014 5304418 gene locus_tag LOCUS_50040 gene leuD 5305014 5304418 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775883.1 protein_id gnl|my_center|LOCUS_50040 5306442 5305030 gene locus_tag LOCUS_50050 gene leuC 5306442 5305030 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 protein_id gnl|my_center|LOCUS_50050 5306492 5307190 gene locus_tag LOCUS_50060 gene ndgR 5306492 5307190 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_50060 5308467 5307187 gene locus_tag LOCUS_50070 5308467 5307187 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_50070 5309827 5308475 gene locus_tag LOCUS_50080 5309827 5308475 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_50080 5311275 5309824 gene locus_tag LOCUS_50090 5311275 5309824 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_50090 5312888 5311293 gene locus_tag LOCUS_50100 gene aceB 5312888 5311293 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 protein_id gnl|my_center|LOCUS_50100 5313091 5314434 gene locus_tag LOCUS_50110 5313091 5314434 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121857.1 protein_id gnl|my_center|LOCUS_50110 5314469 5315662 gene locus_tag LOCUS_50120 5314469 5315662 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_50120 5315751 5316263 gene locus_tag LOCUS_50130 5315751 5316263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 5316832 5316488 gene locus_tag LOCUS_50140 5316832 5316488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 5317524 5317180 gene locus_tag LOCUS_50150 5317524 5317180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 5317699 5318025 gene locus_tag LOCUS_50160 5317699 5318025 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978605.1 protein_id gnl|my_center|LOCUS_50160 5318675 5318022 gene locus_tag LOCUS_50170 5318675 5318022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 5318961 5318680 gene locus_tag LOCUS_50180 5318961 5318680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 5318939 5319151 gene locus_tag LOCUS_50190 5318939 5319151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 5320076 5319195 gene locus_tag LOCUS_50200 5320076 5319195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 5320863 5320258 gene locus_tag LOCUS_50210 5320863 5320258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 5321100 5320885 gene locus_tag LOCUS_50220 5321100 5320885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 5321030 5321446 gene locus_tag LOCUS_50230 5321030 5321446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 5323644 5321641 gene locus_tag LOCUS_50240 5323644 5321641 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208109.1 protein_id gnl|my_center|LOCUS_50240 5324294 5323719 gene locus_tag LOCUS_50250 5324294 5323719 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284106.1 protein_id gnl|my_center|LOCUS_50250 5325753 5324329 gene locus_tag LOCUS_50260 5325753 5324329 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_50260 5326685 5325873 gene locus_tag LOCUS_50270 5326685 5325873 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_50270 5329658 5326908 gene locus_tag LOCUS_50280 5329658 5326908 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 protein_id gnl|my_center|LOCUS_50280 5329767 5330129 gene locus_tag LOCUS_50290 5329767 5330129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 5330131 5332284 gene locus_tag LOCUS_50300 5330131 5332284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 5333254 5332355 gene locus_tag LOCUS_50310 5333254 5332355 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029651.1 protein_id gnl|my_center|LOCUS_50310 5333315 5333665 gene locus_tag LOCUS_50320 5333315 5333665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 5334027 5333671 gene locus_tag LOCUS_50330 5334027 5333671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 5334130 5335017 gene locus_tag LOCUS_50340 5334130 5335017 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_50340 5335063 5336511 gene locus_tag LOCUS_50350 5335063 5336511 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030113.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50350 5337502 5336582 gene locus_tag LOCUS_50360 gene metF 5337502 5336582 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_50360 5337635 5338669 gene locus_tag LOCUS_50370 5337635 5338669 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_50370 5338682 5340178 gene locus_tag LOCUS_50380 5338682 5340178 CDS product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729668.1 protein_id gnl|my_center|LOCUS_50380 5340438 5340890 gene locus_tag LOCUS_50390 5340438 5340890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 5340961 5341977 gene locus_tag LOCUS_50400 5340961 5341977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 5342469 5341987 gene locus_tag LOCUS_50410 gene bfr 5342469 5341987 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976703.1 protein_id gnl|my_center|LOCUS_50410 5342819 5342550 gene locus_tag LOCUS_50420 5342819 5342550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 5342978 5344018 gene locus_tag LOCUS_50430 5342978 5344018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_50430 5344015 5345040 gene locus_tag LOCUS_50440 5344015 5345040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 5345185 5346363 gene locus_tag LOCUS_50450 5345185 5346363 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730643.1 protein_id gnl|my_center|LOCUS_50450 5347378 5346365 gene locus_tag LOCUS_50460 5347378 5346365 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618830.1 protein_id gnl|my_center|LOCUS_50460 5348844 5347450 gene locus_tag LOCUS_50470 5348844 5347450 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449604.1 protein_id gnl|my_center|LOCUS_50470 5348983 5349606 gene locus_tag LOCUS_50480 5348983 5349606 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 protein_id gnl|my_center|LOCUS_50480 5349606 5350436 gene locus_tag LOCUS_50490 5349606 5350436 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259122.1 protein_id gnl|my_center|LOCUS_50490 5350445 5350891 gene locus_tag LOCUS_50500 5350445 5350891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 5350902 5351462 gene locus_tag LOCUS_50510 5350902 5351462 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_50510 5351540 5353630 gene locus_tag LOCUS_50520 5351540 5353630 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764525.1 protein_id gnl|my_center|LOCUS_50520 5354494 5353634 gene locus_tag LOCUS_50530 5354494 5353634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50530 5354523 5355218 gene locus_tag LOCUS_50540 5354523 5355218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 5355674 5355234 gene locus_tag LOCUS_50550 5355674 5355234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 5355864 5356976 gene locus_tag LOCUS_50560 5355864 5356976 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029609.1 protein_id gnl|my_center|LOCUS_50560 5357103 5357495 gene locus_tag LOCUS_50570 5357103 5357495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 5357862 5357482 gene locus_tag LOCUS_50580 5357862 5357482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 5358955 5357930 gene locus_tag LOCUS_50590 5358955 5357930 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_50590 5359550 5359041 gene locus_tag LOCUS_50600 5359550 5359041 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224331.1 protein_id gnl|my_center|LOCUS_50600 5359681 5359941 gene locus_tag LOCUS_50610 5359681 5359941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 5359941 5360585 gene locus_tag LOCUS_50620 5359941 5360585 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081747.1 protein_id gnl|my_center|LOCUS_50620 5360753 5364247 gene locus_tag LOCUS_50630 gene dnaE 5360753 5364247 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224037.1 protein_id gnl|my_center|LOCUS_50630 5364550 5365116 gene locus_tag LOCUS_50640 5364550 5365116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 5366392 5365526 gene locus_tag LOCUS_50650 5366392 5365526 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_50650 5367177 5366428 gene locus_tag LOCUS_50660 5367177 5366428 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_50660 5368499 5367204 gene locus_tag LOCUS_50670 5368499 5367204 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876247.1 protein_id gnl|my_center|LOCUS_50670 5369861 5368515 gene locus_tag LOCUS_50680 5369861 5368515 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194588.1 protein_id gnl|my_center|LOCUS_50680 5369955 5370746 gene locus_tag LOCUS_50690 5369955 5370746 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027037.1 protein_id gnl|my_center|LOCUS_50690 5371254 5373503 gene locus_tag LOCUS_50700 gene metE 5371254 5373503 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 protein_id gnl|my_center|LOCUS_50700 5375617 5373617 gene locus_tag LOCUS_50710 5375617 5373617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50710 5375927 5378449 gene locus_tag LOCUS_50720 5375927 5378449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 5378517 5379443 gene locus_tag LOCUS_50730 5378517 5379443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 5379487 5380128 gene locus_tag LOCUS_50740 5379487 5380128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 protein_id gnl|my_center|LOCUS_50740 5381213 5380125 gene locus_tag LOCUS_50750 5381213 5380125 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_50750 5381314 5381763 gene locus_tag LOCUS_50760 5381314 5381763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 5381867 5382799 gene locus_tag LOCUS_50770 5381867 5382799 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027748.1 protein_id gnl|my_center|LOCUS_50770 5383467 5382805 gene locus_tag LOCUS_50780 5383467 5382805 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_50780 5384675 5383464 gene locus_tag LOCUS_50790 5384675 5383464 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_50790 5384803 5385312 gene locus_tag LOCUS_50800 5384803 5385312 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_50800 5385309 5386973 gene locus_tag LOCUS_50810 5385309 5386973 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_50810 5387929 5386952 gene locus_tag LOCUS_50820 5387929 5386952 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_50820 5388481 5387993 gene locus_tag LOCUS_50830 5388481 5387993 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976336.1 protein_id gnl|my_center|LOCUS_50830 5388597 5389313 gene locus_tag LOCUS_50840 5388597 5389313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 5389323 5389751 gene locus_tag LOCUS_50850 5389323 5389751 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312954.1 protein_id gnl|my_center|LOCUS_50850 5392239 5390098 gene locus_tag LOCUS_50860 5392239 5390098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 5392882 5392295 gene locus_tag LOCUS_50870 5392882 5392295 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504795.1 protein_id gnl|my_center|LOCUS_50870 5395428 5392939 gene locus_tag LOCUS_50880 5395428 5392939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 5396983 5395538 gene locus_tag LOCUS_50890 5396983 5395538 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742165.1 protein_id gnl|my_center|LOCUS_50890 5397368 5396994 gene locus_tag LOCUS_50900 5397368 5396994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 5397546 5398838 gene locus_tag LOCUS_50910 5397546 5398838 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_50910 5399530 5398835 gene locus_tag LOCUS_50920 5399530 5398835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 5399705 5400286 gene locus_tag LOCUS_50930 5399705 5400286 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411199.1 protein_id gnl|my_center|LOCUS_50930 5400346 5401215 gene locus_tag LOCUS_50940 5400346 5401215 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111446.1 protein_id gnl|my_center|LOCUS_50940 5402493 5401171 gene locus_tag LOCUS_50950 5402493 5401171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 5403863 5402598 gene locus_tag LOCUS_50960 5403863 5402598 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227778.1 protein_id gnl|my_center|LOCUS_50960 5404991 5404101 gene locus_tag LOCUS_50970 5404991 5404101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_50970 5405756 5405013 gene locus_tag LOCUS_50980 5405756 5405013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 5406315 5405803 gene locus_tag LOCUS_50990 5406315 5405803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50990 5406604 5406529 gene locus_tag LOCUS_t00390 5406604 5406529 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5407443 5406673 gene locus_tag LOCUS_51000 5407443 5406673 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977928.1 protein_id gnl|my_center|LOCUS_51000 5408500 5408000 gene locus_tag LOCUS_51010 5408500 5408000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 5409926 5408436 gene locus_tag LOCUS_51020 5409926 5408436 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226203.1 protein_id gnl|my_center|LOCUS_51020 5410666 5409965 gene locus_tag LOCUS_51030 5410666 5409965 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 protein_id gnl|my_center|LOCUS_51030 5410773 5411705 gene locus_tag LOCUS_51040 5410773 5411705 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226205.1 protein_id gnl|my_center|LOCUS_51040 5411698 5413512 gene locus_tag LOCUS_51050 5411698 5413512 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226206.1 protein_id gnl|my_center|LOCUS_51050 5414707 5413526 gene locus_tag LOCUS_51060 5414707 5413526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 5415770 5414859 gene locus_tag LOCUS_51070 5415770 5414859 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226103.1 protein_id gnl|my_center|LOCUS_51070 5416623 5415841 gene locus_tag LOCUS_51080 gene yaaA 5416623 5415841 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_51080 5416776 5417804 gene locus_tag LOCUS_51090 5416776 5417804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 5417998 5417801 gene locus_tag LOCUS_51100 5417998 5417801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 5418127 5419008 gene locus_tag LOCUS_51110 5418127 5419008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 5419047 5420045 gene locus_tag LOCUS_51120 5419047 5420045 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_51120 5420937 5420092 gene locus_tag LOCUS_51130 5420937 5420092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_51130 5421908 5420934 gene locus_tag LOCUS_51140 5421908 5420934 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_51140 5421973 5422644 gene locus_tag LOCUS_51150 gene tetR(B) 5421973 5422644 CDS product tetracycline resistance transcriptional repressor TetR(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322387.1 protein_id gnl|my_center|LOCUS_51150 5422687 5424009 gene locus_tag LOCUS_51160 5422687 5424009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 5424470 5424006 gene locus_tag LOCUS_51170 5424470 5424006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 5424790 5424533 gene locus_tag LOCUS_51180 5424790 5424533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 5424693 5426069 gene locus_tag LOCUS_51190 5424693 5426069 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028390.1 protein_id gnl|my_center|LOCUS_51190 5426072 5426404 gene locus_tag LOCUS_51200 5426072 5426404 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 protein_id gnl|my_center|LOCUS_51200 5427196 5426435 gene locus_tag LOCUS_51210 gene dapB 5427196 5426435 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030428.1 protein_id gnl|my_center|LOCUS_51210 5428536 5427220 gene locus_tag LOCUS_51220 5428536 5427220 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_51220 5431133 5428656 gene locus_tag LOCUS_51230 5431133 5428656 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_51230 5431636 5431367 gene locus_tag LOCUS_51240 gene rpsO 5431636 5431367 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804659.1 protein_id gnl|my_center|LOCUS_51240 5432676 5431741 gene locus_tag LOCUS_51250 5432676 5431741 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790919.1 protein_id gnl|my_center|LOCUS_51250 5433934 5432954 gene locus_tag LOCUS_51260 gene truB 5433934 5432954 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 protein_id gnl|my_center|LOCUS_51260 5434001 5434987 gene locus_tag LOCUS_51270 5434001 5434987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 5435352 5434984 gene locus_tag LOCUS_51280 5435352 5434984 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028253.1 protein_id gnl|my_center|LOCUS_51280 5435972 5435379 gene locus_tag LOCUS_51290 5435972 5435379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 5437349 5436180 gene locus_tag LOCUS_51300 gene ispG 5437349 5436180 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_51300 5438648 5437362 gene locus_tag LOCUS_51310 5438648 5437362 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_51310 5439902 5438685 gene locus_tag LOCUS_51320 gene dxr 5439902 5438685 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_51320 5442248 5439960 gene locus_tag LOCUS_51330 5442248 5439960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 5444533 5442251 gene locus_tag LOCUS_51340 5444533 5442251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_51340 5445216 5444533 gene locus_tag LOCUS_51350 5445216 5444533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110573.1 protein_id gnl|my_center|LOCUS_51350 5445802 5445386 gene locus_tag LOCUS_51360 5445802 5445386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 5446018 5446830 gene locus_tag LOCUS_51370 5446018 5446830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 5448005 5446869 gene locus_tag LOCUS_51380 5448005 5446869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 5450422 5448200 gene locus_tag LOCUS_51390 5450422 5448200 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_51390 5450549 5451316 gene locus_tag LOCUS_51400 5450549 5451316 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_51400 5451480 5453036 gene locus_tag LOCUS_51410 5451480 5453036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 5453069 5453974 gene locus_tag LOCUS_51420 5453069 5453974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403518.1 protein_id gnl|my_center|LOCUS_51420 5453971 5455047 gene locus_tag LOCUS_51430 5453971 5455047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 5455894 5455028 gene locus_tag LOCUS_51440 gene rsmI 5455894 5455028 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_51440 5456095 5456745 gene locus_tag LOCUS_51450 5456095 5456745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 5456892 5458073 gene locus_tag LOCUS_51460 5456892 5458073 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026981.1 protein_id gnl|my_center|LOCUS_51460 5458241 5458813 gene locus_tag LOCUS_51470 5458241 5458813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 5459474 5458896 gene locus_tag LOCUS_51480 5459474 5458896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 5459543 5460445 gene locus_tag LOCUS_51490 5459543 5460445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 5460442 5461068 gene locus_tag LOCUS_51500 5460442 5461068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 5461119 5463692 gene locus_tag LOCUS_51510 5461119 5463692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 5463689 5465635 gene locus_tag LOCUS_51520 5463689 5465635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 5467574 5465730 gene locus_tag LOCUS_51530 5467574 5465730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 5469248 5467749 gene locus_tag LOCUS_51540 5469248 5467749 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085588.1 protein_id gnl|my_center|LOCUS_51540 5469955 5469245 gene locus_tag LOCUS_51550 5469955 5469245 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_51550 5470220 5470567 gene locus_tag LOCUS_51560 5470220 5470567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 5470922 5474518 gene locus_tag LOCUS_51570 5470922 5474518 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467712.1 protein_id gnl|my_center|LOCUS_51570 5474525 5474710 gene locus_tag LOCUS_51580 5474525 5474710 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_51580 5474715 5475380 gene locus_tag LOCUS_51590 5474715 5475380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 5476376 5475387 gene locus_tag LOCUS_51600 5476376 5475387 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_51600 5477568 5476459 gene locus_tag LOCUS_51610 5477568 5476459 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_51610 5478234 5477578 gene locus_tag LOCUS_51620 5478234 5477578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 5478737 5478231 gene locus_tag LOCUS_51630 5478737 5478231 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467244.1 protein_id gnl|my_center|LOCUS_51630 5478854 5480221 gene locus_tag LOCUS_51640 5478854 5480221 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027886.1 protein_id gnl|my_center|LOCUS_51640 5481916 5480951 gene locus_tag LOCUS_51650 5481916 5480951 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_51650 5482196 5481927 gene locus_tag LOCUS_51660 5482196 5481927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 5482251 5482904 gene locus_tag LOCUS_51670 5482251 5482904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 5484061 5482901 gene locus_tag LOCUS_51680 5484061 5482901 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229700.1 protein_id gnl|my_center|LOCUS_51680 5484308 5484724 gene locus_tag LOCUS_51690 gene sodN 5484308 5484724 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_51690 5484795 5485187 gene locus_tag LOCUS_51700 5484795 5485187 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_51700 5485566 5485300 gene locus_tag LOCUS_51710 5485566 5485300 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_51710 5486771 5485845 gene locus_tag LOCUS_51720 5486771 5485845 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_51720 5486806 5487210 gene locus_tag LOCUS_51730 5486806 5487210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 5488138 5487233 gene locus_tag LOCUS_51740 5488138 5487233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 5488920 5488225 gene locus_tag LOCUS_51750 5488920 5488225 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_51750 5490762 5489056 gene locus_tag LOCUS_51760 5490762 5489056 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 protein_id gnl|my_center|LOCUS_51760 5491054 5492286 gene locus_tag LOCUS_51770 gene egtA 5491054 5492286 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226794.1 protein_id gnl|my_center|LOCUS_51770 5492288 5493601 gene locus_tag LOCUS_51780 gene egtB 5492288 5493601 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_51780 5493604 5494341 gene locus_tag LOCUS_51790 gene egtC 5493604 5494341 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226792.1 protein_id gnl|my_center|LOCUS_51790 5494357 5495316 gene locus_tag LOCUS_51800 gene egtD 5494357 5495316 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_51800 5495328 5495903 gene locus_tag LOCUS_51810 5495328 5495903 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_51810 5496259 5497719 gene locus_tag LOCUS_51820 5496259 5497719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51820 5497784 5498659 gene locus_tag LOCUS_51830 5497784 5498659 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224651.1 protein_id gnl|my_center|LOCUS_51830 5498656 5499333 gene locus_tag LOCUS_51840 5498656 5499333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 5500158 5499343 gene locus_tag LOCUS_51850 5500158 5499343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 5501671 5500193 gene locus_tag LOCUS_51860 5501671 5500193 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 protein_id gnl|my_center|LOCUS_51860 5502765 5501752 gene locus_tag LOCUS_51870 5502765 5501752 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 protein_id gnl|my_center|LOCUS_51870 5503567 5502773 gene locus_tag LOCUS_51880 5503567 5502773 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222049.1 protein_id gnl|my_center|LOCUS_51880 5504742 5503564 gene locus_tag LOCUS_51890 5504742 5503564 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728694.1 protein_id gnl|my_center|LOCUS_51890 5505382 5504735 gene locus_tag LOCUS_51900 5505382 5504735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_51900 5506743 5505712 gene locus_tag LOCUS_51910 5506743 5505712 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_51910 5506628 5506999 gene locus_tag LOCUS_51920 5506628 5506999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 5507204 5506989 gene locus_tag LOCUS_51930 5507204 5506989 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056341.1 protein_id gnl|my_center|LOCUS_51930 5507602 5508390 gene locus_tag LOCUS_51940 5507602 5508390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 5509997 5508420 gene locus_tag LOCUS_51950 5509997 5508420 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 protein_id gnl|my_center|LOCUS_51950 5510099 5510656 gene locus_tag LOCUS_51960 5510099 5510656 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 protein_id gnl|my_center|LOCUS_51960 5511021 5510653 gene locus_tag LOCUS_51970 5511021 5510653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 5511469 5511206 gene locus_tag LOCUS_51980 gene rsrA 5511469 5511206 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_51980 5512254 5511466 gene locus_tag LOCUS_51990 5512254 5511466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 5512913 5512578 gene locus_tag LOCUS_52000 5512913 5512578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 5513803 5513084 gene locus_tag LOCUS_52010 5513803 5513084 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_52010 5513852 5515147 gene locus_tag LOCUS_52020 gene aroA 5513852 5515147 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_52020 5515117 5516136 gene locus_tag LOCUS_52030 gene rsgA 5515117 5516136 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727982.1 protein_id gnl|my_center|LOCUS_52030 5516147 5516947 gene locus_tag LOCUS_52040 gene hisN 5516147 5516947 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_52040 5517092 5518060 gene locus_tag LOCUS_52050 5517092 5518060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030873.1 protein_id gnl|my_center|LOCUS_52050 5518343 5518065 gene locus_tag LOCUS_52060 5518343 5518065 CDS product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975653.1 protein_id gnl|my_center|LOCUS_52060 5518563 5519378 gene locus_tag LOCUS_52070 5518563 5519378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 5519466 5520302 gene locus_tag LOCUS_52080 5519466 5520302 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485387.1 protein_id gnl|my_center|LOCUS_52080 5520345 5521064 gene locus_tag LOCUS_52090 5520345 5521064 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_52090 5521136 5521210 gene locus_tag LOCUS_t00400 5521136 5521210 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5522264 5521419 gene locus_tag LOCUS_52100 gene purU 5522264 5521419 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 protein_id gnl|my_center|LOCUS_52100 5523510 5522329 gene locus_tag LOCUS_52110 5523510 5522329 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_52110 5523938 5523570 gene locus_tag LOCUS_52120 5523938 5523570 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228644.1 protein_id gnl|my_center|LOCUS_52120 5524381 5524040 gene locus_tag LOCUS_52130 5524381 5524040 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_52130 5525117 5524440 gene locus_tag LOCUS_52140 5525117 5524440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 5525977 5525180 gene locus_tag LOCUS_52150 5525977 5525180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 5528117 5526054 gene locus_tag LOCUS_52160 5528117 5526054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 5529967 5528114 gene locus_tag LOCUS_52170 5529967 5528114 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486780.1 protein_id gnl|my_center|LOCUS_52170 5531190 5530075 gene locus_tag LOCUS_52180 5531190 5530075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 5531397 5531846 gene locus_tag LOCUS_52190 5531397 5531846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 5532570 5531854 gene locus_tag LOCUS_52200 gene narI 5532570 5531854 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_52200 5533250 5532585 gene locus_tag LOCUS_52210 gene narJ 5533250 5532585 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029970.1 protein_id gnl|my_center|LOCUS_52210 5534905 5533247 gene locus_tag LOCUS_52220 gene narH 5534905 5533247 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_52220 5538570 5534929 gene locus_tag LOCUS_52230 5538570 5534929 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487114.1 protein_id gnl|my_center|LOCUS_52230 5538774 5539979 gene locus_tag LOCUS_52240 5538774 5539979 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730343.1 protein_id gnl|my_center|LOCUS_52240 5540556 5539990 gene locus_tag LOCUS_52250 5540556 5539990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 5540957 5540463 gene locus_tag LOCUS_52260 5540957 5540463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52260 5541136 5542032 gene locus_tag LOCUS_52270 5541136 5542032 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_52270 5543383 5542055 gene locus_tag LOCUS_52280 5543383 5542055 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006789594.1 protein_id gnl|my_center|LOCUS_52280 5544609 5543428 gene locus_tag LOCUS_52290 5544609 5543428 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229236.1 protein_id gnl|my_center|LOCUS_52290 5546318 5544612 gene locus_tag LOCUS_52300 5546318 5544612 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385682.1 protein_id gnl|my_center|LOCUS_52300 5548357 5546315 gene locus_tag LOCUS_52310 5548357 5546315 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_52310 5548516 5549172 gene locus_tag LOCUS_52320 5548516 5549172 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 protein_id gnl|my_center|LOCUS_52320 5549241 5549759 gene locus_tag LOCUS_52330 5549241 5549759 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_52330 5550812 5549766 gene locus_tag LOCUS_52340 5550812 5549766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 5551380 5550937 gene locus_tag LOCUS_52350 5551380 5550937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 5552424 5551474 gene locus_tag LOCUS_52360 5552424 5551474 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_52360 5552508 5553206 gene locus_tag LOCUS_52370 5552508 5553206 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_52370 5553203 5555143 gene locus_tag LOCUS_52380 5553203 5555143 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_52380 5555140 5555883 gene locus_tag LOCUS_52390 5555140 5555883 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027448.1 protein_id gnl|my_center|LOCUS_52390 5556023 5557123 gene locus_tag LOCUS_52400 5556023 5557123 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_52400 5557126 5557599 gene locus_tag LOCUS_52410 5557126 5557599 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523514.1 protein_id gnl|my_center|LOCUS_52410 5558414 5557533 gene locus_tag LOCUS_52420 5558414 5557533 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029684.1 protein_id gnl|my_center|LOCUS_52420 5558835 5558596 gene locus_tag LOCUS_52430 5558835 5558596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 5559779 5558832 gene locus_tag LOCUS_52440 5559779 5558832 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_52440 5559793 5560029 gene locus_tag LOCUS_52450 5559793 5560029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 5559998 5560402 gene locus_tag LOCUS_52460 5559998 5560402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 5560432 5561355 gene locus_tag LOCUS_52470 5560432 5561355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 5561525 5561698 gene locus_tag LOCUS_52480 5561525 5561698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 5562372 5561695 gene locus_tag LOCUS_52490 5562372 5561695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 5562693 5562400 gene locus_tag LOCUS_52500 5562693 5562400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 5562960 5564183 gene locus_tag LOCUS_52510 5562960 5564183 CDS product questin oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484207.1 protein_id gnl|my_center|LOCUS_52510 5564239 5565006 gene locus_tag LOCUS_52520 5564239 5565006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222220.1 protein_id gnl|my_center|LOCUS_52520 5566692 5565010 gene locus_tag LOCUS_52530 5566692 5565010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 5567849 5566788 gene locus_tag LOCUS_52540 5567849 5566788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 5568152 5569957 gene locus_tag LOCUS_52550 5568152 5569957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 5570080 5571378 gene locus_tag LOCUS_52560 5570080 5571378 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226013.1 protein_id gnl|my_center|LOCUS_52560 5572422 5571427 gene locus_tag LOCUS_52570 5572422 5571427 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270028.1 protein_id gnl|my_center|LOCUS_52570 5572559 5573149 gene locus_tag LOCUS_52580 5572559 5573149 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028285.1 protein_id gnl|my_center|LOCUS_52580 5573197 5573733 gene locus_tag LOCUS_52590 5573197 5573733 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_52590 5573735 5574166 gene locus_tag LOCUS_52600 5573735 5574166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 5575566 5574163 gene locus_tag LOCUS_52610 5575566 5574163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 5577955 5575712 gene locus_tag LOCUS_52620 5577955 5575712 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029390.1 protein_id gnl|my_center|LOCUS_52620 5579202 5577952 gene locus_tag LOCUS_52630 5579202 5577952 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029389.1 protein_id gnl|my_center|LOCUS_52630 5579327 5580346 gene locus_tag LOCUS_52640 5579327 5580346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224110.1 protein_id gnl|my_center|LOCUS_52640 5581979 5580333 gene locus_tag LOCUS_52650 5581979 5580333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 5582704 5581976 gene locus_tag LOCUS_52660 5582704 5581976 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_52660 5582814 5584388 gene locus_tag LOCUS_52670 5582814 5584388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 5585320 5584451 gene locus_tag LOCUS_52680 5585320 5584451 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 protein_id gnl|my_center|LOCUS_52680 5585928 5585350 gene locus_tag LOCUS_52690 gene thiE 5585928 5585350 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880880.1 protein_id gnl|my_center|LOCUS_52690 5586085 5586825 gene locus_tag LOCUS_52700 5586085 5586825 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027556.1 protein_id gnl|my_center|LOCUS_52700 5586860 5587585 gene locus_tag LOCUS_52710 5586860 5587585 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222383.1 protein_id gnl|my_center|LOCUS_52710 5588397 5587582 gene locus_tag LOCUS_52720 5588397 5587582 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976615.1 protein_id gnl|my_center|LOCUS_52720 5589318 5588659 gene locus_tag LOCUS_52730 5589318 5588659 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_52730 5590945 5589308 gene locus_tag LOCUS_52740 5590945 5589308 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003961897.1 protein_id gnl|my_center|LOCUS_52740 5591109 5592239 gene locus_tag LOCUS_52750 5591109 5592239 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 protein_id gnl|my_center|LOCUS_52750 5592236 5592892 gene locus_tag LOCUS_52760 5592236 5592892 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222882.1 protein_id gnl|my_center|LOCUS_52760 5593118 5594128 gene locus_tag LOCUS_52770 5593118 5594128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 5595128 5594082 gene locus_tag LOCUS_52780 5595128 5594082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 5595813 5595229 gene locus_tag LOCUS_52790 5595813 5595229 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222876.1 protein_id gnl|my_center|LOCUS_52790 5596576 5595977 gene locus_tag LOCUS_52800 5596576 5595977 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 protein_id gnl|my_center|LOCUS_52800 5596953 5596573 gene locus_tag LOCUS_52810 5596953 5596573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 5597507 5597088 gene locus_tag LOCUS_52820 5597507 5597088 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085368.1 protein_id gnl|my_center|LOCUS_52820 5600721 5597578 gene locus_tag LOCUS_52830 5600721 5597578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 5601175 5602266 gene locus_tag LOCUS_52840 5601175 5602266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 5602945 5602271 gene locus_tag LOCUS_52850 5602945 5602271 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224172.1 protein_id gnl|my_center|LOCUS_52850 5603093 5603959 gene locus_tag LOCUS_52860 5603093 5603959 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 protein_id gnl|my_center|LOCUS_52860 5604127 5604843 gene locus_tag LOCUS_52870 5604127 5604843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 5605462 5604797 gene locus_tag LOCUS_52880 5605462 5604797 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_52880 5606106 5605480 gene locus_tag LOCUS_52890 5606106 5605480 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 protein_id gnl|my_center|LOCUS_52890 5606588 5606178 gene locus_tag LOCUS_52900 5606588 5606178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 5608296 5606599 gene locus_tag LOCUS_52910 5608296 5606599 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_52910 5610710 5608293 gene locus_tag LOCUS_52920 5610710 5608293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 5612245 5610707 gene locus_tag LOCUS_52930 5612245 5610707 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_52930 5612784 5612242 gene locus_tag LOCUS_52940 5612784 5612242 CDS product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060787.1 protein_id gnl|my_center|LOCUS_52940 5612993 5612793 gene locus_tag LOCUS_52950 5612993 5612793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 5613721 5613059 gene locus_tag LOCUS_52960 5613721 5613059 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900903.1 protein_id gnl|my_center|LOCUS_52960 5616202 5613770 gene locus_tag LOCUS_52970 5616202 5613770 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831565.1 protein_id gnl|my_center|LOCUS_52970 5616453 5616232 gene locus_tag LOCUS_52980 5616453 5616232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52980 5616335 5616772 gene locus_tag LOCUS_52990 5616335 5616772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 5616808 5617266 gene locus_tag LOCUS_53000 5616808 5617266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 5618184 5617342 gene locus_tag LOCUS_53010 gene mutM 5618184 5617342 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_53010 5618845 5618210 gene locus_tag LOCUS_53020 5618845 5618210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 5619007 5620230 gene locus_tag LOCUS_53030 5619007 5620230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 5620822 5620280 gene locus_tag LOCUS_53040 5620822 5620280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 5621531 5620887 gene locus_tag LOCUS_53050 5621531 5620887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 5621590 5622174 gene locus_tag LOCUS_53060 5621590 5622174 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225073.1 protein_id gnl|my_center|LOCUS_53060 5623152 5622181 gene locus_tag LOCUS_53070 5623152 5622181 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111640.1 protein_id gnl|my_center|LOCUS_53070 5623996 5623241 gene locus_tag LOCUS_53080 5623996 5623241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53080 5624088 5624444 gene locus_tag LOCUS_53090 5624088 5624444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 5625151 5624453 gene locus_tag LOCUS_53100 5625151 5624453 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223069.1 protein_id gnl|my_center|LOCUS_53100 5625319 5625822 gene locus_tag LOCUS_53110 5625319 5625822 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_53110 5625831 5627216 gene locus_tag LOCUS_53120 5625831 5627216 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015481.1 protein_id gnl|my_center|LOCUS_53120 5628185 5627220 gene locus_tag LOCUS_53130 5628185 5627220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 5628258 5629037 gene locus_tag LOCUS_53140 5628258 5629037 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804593.1 protein_id gnl|my_center|LOCUS_53140 5629625 5629038 gene locus_tag LOCUS_53150 5629625 5629038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 5629783 5632074 gene locus_tag LOCUS_53160 5629783 5632074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 5633825 5632080 gene locus_tag LOCUS_53170 5633825 5632080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 5635125 5633914 gene locus_tag LOCUS_53180 5635125 5633914 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226073.1 protein_id gnl|my_center|LOCUS_53180 5635287 5637599 gene locus_tag LOCUS_53190 5635287 5637599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 5638576 5637593 gene locus_tag LOCUS_53200 5638576 5637593 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_53200 5638669 5639625 gene locus_tag LOCUS_53210 5638669 5639625 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_53210 5641746 5639638 gene locus_tag LOCUS_53220 5641746 5639638 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111053.1 protein_id gnl|my_center|LOCUS_53220 5641876 5642808 gene locus_tag LOCUS_53230 5641876 5642808 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030076.1 protein_id gnl|my_center|LOCUS_53230 5643797 5642832 gene locus_tag LOCUS_53240 5643797 5642832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 5644205 5643813 gene locus_tag LOCUS_53250 5644205 5643813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 5644360 5645091 gene locus_tag LOCUS_53260 5644360 5645091 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977652.1 protein_id gnl|my_center|LOCUS_53260 5646823 5645222 gene locus_tag LOCUS_53270 5646823 5645222 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_53270 5647467 5646820 gene locus_tag LOCUS_53280 5647467 5646820 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084755.1 protein_id gnl|my_center|LOCUS_53280 5648724 5647537 gene locus_tag LOCUS_53290 5648724 5647537 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112110.1 protein_id gnl|my_center|LOCUS_53290 5648814 5649407 gene locus_tag LOCUS_53300 5648814 5649407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 5650644 5649472 gene locus_tag LOCUS_53310 5650644 5649472 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_53310 5651359 5650694 gene locus_tag LOCUS_53320 5651359 5650694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 5651419 5652207 gene locus_tag LOCUS_53330 5651419 5652207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 5653498 5652185 gene locus_tag LOCUS_53340 gene cypC 5653498 5652185 CDS product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 protein_id gnl|my_center|LOCUS_53340 5653642 5654115 gene locus_tag LOCUS_53350 5653642 5654115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 5654194 5655099 gene locus_tag LOCUS_53360 5654194 5655099 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_53360 5655180 5655623 gene locus_tag LOCUS_53370 5655180 5655623 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113347.1 protein_id gnl|my_center|LOCUS_53370 5655628 5656056 gene locus_tag LOCUS_53380 5655628 5656056 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230586.1 protein_id gnl|my_center|LOCUS_53380 5656053 5657060 gene locus_tag LOCUS_53390 5656053 5657060 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_53390 5658084 5657131 gene locus_tag LOCUS_53400 5658084 5657131 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527120.1 protein_id gnl|my_center|LOCUS_53400 5659403 5658081 gene locus_tag LOCUS_53410 5659403 5658081 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_53410 5661367 5659484 gene locus_tag LOCUS_53420 5661367 5659484 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027517.1 protein_id gnl|my_center|LOCUS_53420 5662163 5661393 gene locus_tag LOCUS_53430 5662163 5661393 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_53430 5662617 5662240 gene locus_tag LOCUS_53440 5662617 5662240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 5662692 5663342 gene locus_tag LOCUS_53450 5662692 5663342 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223304.1 protein_id gnl|my_center|LOCUS_53450 5664102 5663245 gene locus_tag LOCUS_53460 5664102 5663245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_53460 5665192 5664107 gene locus_tag LOCUS_53470 5665192 5664107 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226863.1 protein_id gnl|my_center|LOCUS_53470 5666238 5665195 gene locus_tag LOCUS_53480 5666238 5665195 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226862.1 protein_id gnl|my_center|LOCUS_53480 5666318 5667334 gene locus_tag LOCUS_53490 5666318 5667334 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259666.1 protein_id gnl|my_center|LOCUS_53490 5668854 5667343 gene locus_tag LOCUS_53500 5668854 5667343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 5668998 5670302 gene locus_tag LOCUS_53510 gene aceA 5668998 5670302 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085937.1 protein_id gnl|my_center|LOCUS_53510 5670329 5671942 gene locus_tag LOCUS_53520 gene aceB 5670329 5671942 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223537.1 protein_id gnl|my_center|LOCUS_53520 5673319 5672063 gene locus_tag LOCUS_53530 5673319 5672063 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227533.1 protein_id gnl|my_center|LOCUS_53530 5673378 5674040 gene locus_tag LOCUS_53540 5673378 5674040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 5676887 5674104 gene locus_tag LOCUS_53550 5676887 5674104 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230662.1 protein_id gnl|my_center|LOCUS_53550 5677915 5677070 gene locus_tag LOCUS_53560 5677915 5677070 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227989.1 protein_id gnl|my_center|LOCUS_53560 5678094 5678777 gene locus_tag LOCUS_53570 5678094 5678777 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_53570 5678777 5680456 gene locus_tag LOCUS_53580 5678777 5680456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 5680466 5682784 gene locus_tag LOCUS_53590 5680466 5682784 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_53590 5684133 5682895 gene locus_tag LOCUS_53600 5684133 5682895 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 protein_id gnl|my_center|LOCUS_53600 5686888 5684186 gene locus_tag LOCUS_53610 5686888 5684186 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_53610 5686985 5687896 gene locus_tag LOCUS_53620 5686985 5687896 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976100.1 protein_id gnl|my_center|LOCUS_53620 5687972 5688130 gene locus_tag LOCUS_53630 5687972 5688130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 5688329 5689528 gene locus_tag LOCUS_53640 5688329 5689528 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_53640 5691602 5690250 gene locus_tag LOCUS_53650 5691602 5690250 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_53650 5691815 5692774 gene locus_tag LOCUS_53660 5691815 5692774 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230019.1 protein_id gnl|my_center|LOCUS_53660 5692767 5693807 gene locus_tag LOCUS_53670 gene vanA-Sc 5692767 5693807 CDS product D-alanine--(R)-lactate ligase VanA-Sc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029110.1 protein_id gnl|my_center|LOCUS_53670 5693804 5694412 gene locus_tag LOCUS_53680 gene vanX 5693804 5694412 CDS product D-Ala-D-Ala dipeptidase VanX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230017.1 protein_id gnl|my_center|LOCUS_53680 5694424 5694909 gene locus_tag LOCUS_53690 5694424 5694909 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206190.1 protein_id gnl|my_center|LOCUS_53690 5695035 5695562 gene locus_tag LOCUS_53700 5695035 5695562 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847367.1 protein_id gnl|my_center|LOCUS_53700 5695676 5698405 gene locus_tag LOCUS_53710 5695676 5698405 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_53710 5699273 5698392 gene locus_tag LOCUS_53720 5699273 5698392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 5699596 5699270 gene locus_tag LOCUS_53730 5699596 5699270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 5700176 5699640 gene locus_tag LOCUS_53740 5700176 5699640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 5701785 5700208 gene locus_tag LOCUS_53750 5701785 5700208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 5702228 5701800 gene locus_tag LOCUS_53760 5702228 5701800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 5702661 5702440 gene locus_tag LOCUS_53770 5702661 5702440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 5703294 5702674 gene locus_tag LOCUS_53780 5703294 5702674 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222876.1 protein_id gnl|my_center|LOCUS_53780 5703415 5704206 gene locus_tag LOCUS_53790 5703415 5704206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 5704786 5704298 gene locus_tag LOCUS_53800 5704786 5704298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 5705292 5706752 gene locus_tag LOCUS_53810 5705292 5706752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 5707568 5707179 gene locus_tag LOCUS_53820 5707568 5707179 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296233.1 protein_id gnl|my_center|LOCUS_53820 5707696 5709129 gene locus_tag LOCUS_53830 gene merA 5707696 5709129 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296234.1 protein_id gnl|my_center|LOCUS_53830 5709241 5709663 gene locus_tag LOCUS_53840 5709241 5709663 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537590.1 protein_id gnl|my_center|LOCUS_53840 5709730 5710380 gene locus_tag LOCUS_53850 gene merB 5709730 5710380 CDS product organomercurial lyase MerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790334.1 protein_id gnl|my_center|LOCUS_53850 5710488 5711132 gene locus_tag LOCUS_53860 5710488 5711132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 5712312 5711215 gene locus_tag LOCUS_53870 gene arsB 5712312 5711215 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031222.1 protein_id gnl|my_center|LOCUS_53870 5712593 5712309 gene locus_tag LOCUS_53880 5712593 5712309 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975238.1 protein_id gnl|my_center|LOCUS_53880 5712772 5713419 gene locus_tag LOCUS_53890 5712772 5713419 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 protein_id gnl|my_center|LOCUS_53890 5713498 5714145 gene locus_tag LOCUS_53900 5713498 5714145 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087078053.1 protein_id gnl|my_center|LOCUS_53900 5714505 5714152 gene locus_tag LOCUS_53910 5714505 5714152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 5714580 5715656 gene locus_tag LOCUS_53920 5714580 5715656 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653894.1 protein_id gnl|my_center|LOCUS_53920 5715732 5716199 gene locus_tag LOCUS_53930 5715732 5716199 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021744.1 protein_id gnl|my_center|LOCUS_53930 5716306 5716641 gene locus_tag LOCUS_53940 5716306 5716641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 5716638 5717087 gene locus_tag LOCUS_53950 gene merR 5716638 5717087 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_53950 5717362 5717694 gene locus_tag LOCUS_53960 5717362 5717694 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224704.1 protein_id gnl|my_center|LOCUS_53960 5718908 5717865 gene locus_tag LOCUS_53970 5718908 5717865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 5720217 5718967 gene locus_tag LOCUS_53980 5720217 5718967 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727468.1 protein_id gnl|my_center|LOCUS_53980 5721707 5720214 gene locus_tag LOCUS_53990 5721707 5720214 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777078.1 protein_id gnl|my_center|LOCUS_53990 5721816 5722151 gene locus_tag LOCUS_54000 5721816 5722151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 5723588 5722191 gene locus_tag LOCUS_54010 5723588 5722191 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_54010 5724398 5723787 gene locus_tag LOCUS_54020 5724398 5723787 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083597.1 protein_id gnl|my_center|LOCUS_54020 5725117 5724395 gene locus_tag LOCUS_54030 5725117 5724395 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 protein_id gnl|my_center|LOCUS_54030 5725479 5725117 gene locus_tag LOCUS_54040 5725479 5725117 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_54040 5725593 5726276 gene locus_tag LOCUS_54050 5725593 5726276 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086127.1 protein_id gnl|my_center|LOCUS_54050 5726331 5727218 gene locus_tag LOCUS_54060 5726331 5727218 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091887.1 protein_id gnl|my_center|LOCUS_54060 5732310 5727436 gene locus_tag LOCUS_54070 5732310 5727436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 5732635 5733006 gene locus_tag LOCUS_54080 5732635 5733006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 5733409 5733074 gene locus_tag LOCUS_54090 5733409 5733074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 5733336 5733500 gene locus_tag LOCUS_54100 5733336 5733500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 5734737 5733823 gene locus_tag LOCUS_54110 5734737 5733823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_54110 5734748 5734891 gene locus_tag LOCUS_54120 5734748 5734891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 5735348 5734881 gene locus_tag LOCUS_54130 5735348 5734881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 5736786 5735854 gene locus_tag LOCUS_54140 gene dprA 5736786 5735854 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_54140 5738315 5736783 gene locus_tag LOCUS_54150 5738315 5736783 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877410.1 protein_id gnl|my_center|LOCUS_54150 5739085 5739906 gene locus_tag LOCUS_54160 5739085 5739906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 5740600 5739992 gene locus_tag LOCUS_54170 5740600 5739992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 5742151 5740718 gene locus_tag LOCUS_54180 5742151 5740718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 5742755 5742558 gene locus_tag LOCUS_54190 5742755 5742558 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029720.1 protein_id gnl|my_center|LOCUS_54190 5743566 5742748 gene locus_tag LOCUS_54200 5743566 5742748 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028631.1 protein_id gnl|my_center|LOCUS_54200 5743788 5743973 gene locus_tag LOCUS_54210 5743788 5743973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 5744761 5743994 gene locus_tag LOCUS_54220 5744761 5743994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 5744902 5745225 gene locus_tag LOCUS_54230 5744902 5745225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 5745200 5745496 gene locus_tag LOCUS_54240 5745200 5745496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 5745644 5746159 gene locus_tag LOCUS_54250 5745644 5746159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 5746173 5746640 gene locus_tag LOCUS_54260 5746173 5746640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 5746637 5746852 gene locus_tag LOCUS_54270 5746637 5746852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 5746858 5747247 gene locus_tag LOCUS_54280 5746858 5747247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 5747385 5748551 gene locus_tag LOCUS_54290 5747385 5748551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 5748610 5748774 gene locus_tag LOCUS_54300 5748610 5748774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 5748756 5751662 gene locus_tag LOCUS_54310 5748756 5751662 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026974.1 protein_id gnl|my_center|LOCUS_54310 5751659 5752888 gene locus_tag LOCUS_54320 5751659 5752888 CDS product lanthionine synthetase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026975.1 protein_id gnl|my_center|LOCUS_54320 5752913 5753302 gene locus_tag LOCUS_54330 5752913 5753302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 5753312 5754154 gene locus_tag LOCUS_54340 5753312 5754154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 5754151 5754390 gene locus_tag LOCUS_54350 5754151 5754390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54350 5755036 5754419 gene locus_tag LOCUS_54360 5755036 5754419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 5755142 5755408 gene locus_tag LOCUS_54370 5755142 5755408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 5755408 5755992 gene locus_tag LOCUS_54380 5755408 5755992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 5756583 5757353 gene locus_tag LOCUS_54390 5756583 5757353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 5757991 5757452 gene locus_tag LOCUS_54400 5757991 5757452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 5758306 5758740 gene locus_tag LOCUS_54410 5758306 5758740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 5759921 5758872 gene locus_tag LOCUS_54420 5759921 5758872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 5760350 5760096 gene locus_tag LOCUS_54430 5760350 5760096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 5761090 5760581 gene locus_tag LOCUS_54440 5761090 5760581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 5761293 5761631 gene locus_tag LOCUS_54450 5761293 5761631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 5761660 5762379 gene locus_tag LOCUS_54460 5761660 5762379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 5762376 5763827 gene locus_tag LOCUS_54470 5762376 5763827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 5764090 5763911 gene locus_tag LOCUS_54480 5764090 5763911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 5764053 5765417 gene locus_tag LOCUS_54490 5764053 5765417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137309464.1 protein_id gnl|my_center|LOCUS_54490 5765432 5766979 gene locus_tag LOCUS_54500 5765432 5766979 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031263.1 protein_id gnl|my_center|LOCUS_54500 5766988 5768823 gene locus_tag LOCUS_54510 5766988 5768823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 5768820 5769635 gene locus_tag LOCUS_54520 5768820 5769635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 5769654 5770643 gene locus_tag LOCUS_54530 5769654 5770643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 5770640 5770891 gene locus_tag LOCUS_54540 5770640 5770891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 5771848 5770925 gene locus_tag LOCUS_54550 5771848 5770925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 5771843 5772028 gene locus_tag LOCUS_54560 5771843 5772028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 5772241 5772714 gene locus_tag LOCUS_54570 5772241 5772714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 5772720 5773844 gene locus_tag LOCUS_54580 5772720 5773844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 5774269 5773763 gene locus_tag LOCUS_54590 5774269 5773763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 5774538 5774464 gene locus_tag LOCUS_t00410 5774538 5774464 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5774633 5774560 gene locus_tag LOCUS_t00420 5774633 5774560 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5776327 5774705 gene locus_tag LOCUS_54600 5776327 5774705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 5776968 5776501 gene locus_tag LOCUS_54610 5776968 5776501 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859211.1 protein_id gnl|my_center|LOCUS_54610 5778164 5776977 gene locus_tag LOCUS_54620 5778164 5776977 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225994.1 protein_id gnl|my_center|LOCUS_54620 5778271 5780817 gene locus_tag LOCUS_54630 gene pepN 5778271 5780817 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_54630 5780973 5782322 gene locus_tag LOCUS_54640 5780973 5782322 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728405.1 protein_id gnl|my_center|LOCUS_54640 5782319 5782936 gene locus_tag LOCUS_54650 5782319 5782936 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_54650 5783331 5782933 gene locus_tag LOCUS_54660 5783331 5782933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 5783786 5783361 gene locus_tag LOCUS_54670 5783786 5783361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 5784022 5783783 gene locus_tag LOCUS_54680 5784022 5783783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 5784404 5784057 gene locus_tag LOCUS_54690 gene hinT 5784404 5784057 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532068.1 protein_id gnl|my_center|LOCUS_54690 5785294 5784401 gene locus_tag LOCUS_54700 5785294 5784401 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_54700 5785400 5786032 gene locus_tag LOCUS_54710 5785400 5786032 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971475.1 protein_id gnl|my_center|LOCUS_54710 5786038 5786604 gene locus_tag LOCUS_54720 5786038 5786604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040628.1 protein_id gnl|my_center|LOCUS_54720 5787777 5786608 gene locus_tag LOCUS_54730 gene dnaJ 5787777 5786608 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_54730 5788838 5787816 gene locus_tag LOCUS_54740 gene hrcA 5788838 5787816 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228404.1 protein_id gnl|my_center|LOCUS_54740 5788976 5789485 gene locus_tag LOCUS_54750 5788976 5789485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 5790702 5789482 gene locus_tag LOCUS_54760 gene hemW 5790702 5789482 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_54760 5790722 5791501 gene locus_tag LOCUS_54770 5790722 5791501 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_54770 5791951 5791502 gene locus_tag LOCUS_54780 5791951 5791502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 5793077 5791974 gene locus_tag LOCUS_54790 5793077 5791974 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_54790 5794644 5793169 gene locus_tag LOCUS_54800 5794644 5793169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030046.1 protein_id gnl|my_center|LOCUS_54800 5794817 5795758 gene locus_tag LOCUS_54810 5794817 5795758 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225042.1 protein_id gnl|my_center|LOCUS_54810 5796475 5796194 gene locus_tag LOCUS_54820 5796475 5796194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 5799059 5797203 gene locus_tag LOCUS_54830 gene lepA 5799059 5797203 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_54830 5799229 5800203 gene locus_tag LOCUS_54840 5799229 5800203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 5800284 5800550 gene locus_tag LOCUS_54850 gene rpsT 5800284 5800550 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_54850 5801616 5800657 gene locus_tag LOCUS_54860 gene holA 5801616 5800657 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228461.1 protein_id gnl|my_center|LOCUS_54860 5802436 5801666 gene locus_tag LOCUS_54870 5802436 5801666 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461211.1 protein_id gnl|my_center|LOCUS_54870 5805036 5802577 gene locus_tag LOCUS_54880 5805036 5802577 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_54880 5806506 5805619 gene locus_tag LOCUS_54890 5806506 5805619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 5807425 5806457 gene locus_tag LOCUS_54900 5807425 5806457 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_54900 5807911 5807492 gene locus_tag LOCUS_54910 5807911 5807492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 5808548 5807952 gene locus_tag LOCUS_54920 5808548 5807952 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_54920 5808970 5808545 gene locus_tag LOCUS_54930 gene rsfS 5808970 5808545 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_54930 5809663 5809040 gene locus_tag LOCUS_54940 gene nadD 5809663 5809040 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_54940 5812142 5809656 gene locus_tag LOCUS_54950 gene pepN 5812142 5809656 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_54950 5812375 5812270 gene locus_tag LOCUS_r00040 5812375 5812270 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5815711 5812574 gene locus_tag LOCUS_r00050 5815711 5812574 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5817585 5816069 gene locus_tag LOCUS_r00060 5817585 5816069 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5819559 5818117 gene locus_tag LOCUS_54960 gene obgE 5819559 5818117 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228478.1 protein_id gnl|my_center|LOCUS_54960 5819889 5819635 gene locus_tag LOCUS_54970 gene rpmA 5819889 5819635 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228479.1 protein_id gnl|my_center|LOCUS_54970 5820217 5819903 gene locus_tag LOCUS_54980 gene rplU 5820217 5819903 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067132.1 protein_id gnl|my_center|LOCUS_54980 5822502 5820349 gene locus_tag LOCUS_54990 5822502 5820349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 5823505 5822741 gene locus_tag LOCUS_55000 5823505 5822741 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_55000 5825463 5823502 gene locus_tag LOCUS_55010 5825463 5823502 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_55010 5825489 5826148 gene locus_tag LOCUS_55020 5825489 5826148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 5826309 5827202 gene locus_tag LOCUS_55030 5826309 5827202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 5827329 5828285 gene locus_tag LOCUS_55040 5827329 5828285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 5829197 5828355 gene locus_tag LOCUS_55050 5829197 5828355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177319594.1 protein_id gnl|my_center|LOCUS_55050 5829136 5829987 gene locus_tag LOCUS_55060 5829136 5829987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 5832060 5830789 gene locus_tag LOCUS_55070 5832060 5830789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 5833439 5832186 gene locus_tag LOCUS_55080 5833439 5832186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 5835220 5833535 gene locus_tag LOCUS_55090 5835220 5833535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 5835806 5835246 gene locus_tag LOCUS_55100 5835806 5835246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 5836125 5836565 gene locus_tag LOCUS_55110 5836125 5836565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 5838300 5836684 gene locus_tag LOCUS_55120 5838300 5836684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 5838751 5838305 gene locus_tag LOCUS_55130 5838751 5838305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 5839727 5838909 gene locus_tag LOCUS_55140 5839727 5838909 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_55140 5840782 5839955 gene locus_tag LOCUS_55150 5840782 5839955 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_55150 5841747 5841022 gene locus_tag LOCUS_55160 5841747 5841022 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074240.1 protein_id gnl|my_center|LOCUS_55160 5842820 5841744 gene locus_tag LOCUS_55170 gene dapE 5842820 5841744 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730316.1 protein_id gnl|my_center|LOCUS_55170 5842857 5843780 gene locus_tag LOCUS_55180 gene dapD 5842857 5843780 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 protein_id gnl|my_center|LOCUS_55180 5844862 5843777 gene locus_tag LOCUS_55190 5844862 5843777 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_55190 5845179 5844859 gene locus_tag LOCUS_55200 5845179 5844859 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_55200 5845707 5845258 gene locus_tag LOCUS_55210 5845707 5845258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 5846238 5845792 gene locus_tag LOCUS_55220 5846238 5845792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 5847151 5846261 gene locus_tag LOCUS_55230 gene mshB 5847151 5846261 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_55230 5848981 5847233 gene locus_tag LOCUS_55240 5848981 5847233 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 protein_id gnl|my_center|LOCUS_55240 5850191 5849124 gene locus_tag LOCUS_55250 5850191 5849124 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_55250 5851231 5850188 gene locus_tag LOCUS_55260 5851231 5850188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_55260 5852244 5851249 gene locus_tag LOCUS_55270 5852244 5851249 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 protein_id gnl|my_center|LOCUS_55270 5853266 5852277 gene locus_tag LOCUS_55280 5853266 5852277 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_55280 5854807 5853707 gene locus_tag LOCUS_55290 5854807 5853707 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_55290 5855861 5854800 gene locus_tag LOCUS_55300 5855861 5854800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_55300 5856800 5855871 gene locus_tag LOCUS_55310 5856800 5855871 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_55310 5857797 5856793 gene locus_tag LOCUS_55320 5857797 5856793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113014.1 protein_id gnl|my_center|LOCUS_55320 5859472 5857880 gene locus_tag LOCUS_55330 5859472 5857880 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086928.1 protein_id gnl|my_center|LOCUS_55330 5859892 5860704 gene locus_tag LOCUS_55340 5859892 5860704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224225.1 protein_id gnl|my_center|LOCUS_55340 5860721 5862646 gene locus_tag LOCUS_55350 5860721 5862646 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_55350 5862643 5863407 gene locus_tag LOCUS_55360 5862643 5863407 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_55360 5864972 5863464 gene locus_tag LOCUS_55370 5864972 5863464 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486261.1 protein_id gnl|my_center|LOCUS_55370 5865200 5866276 gene locus_tag LOCUS_55380 gene ychF 5865200 5866276 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_55380 5866386 5867555 gene locus_tag LOCUS_55390 5866386 5867555 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729758.1 protein_id gnl|my_center|LOCUS_55390 5867642 5868184 gene locus_tag LOCUS_55400 5867642 5868184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 5870804 5868231 gene locus_tag LOCUS_55410 5870804 5868231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 5871505 5870801 gene locus_tag LOCUS_55420 5871505 5870801 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_55420 5871958 5871605 gene locus_tag LOCUS_55430 5871958 5871605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 5872303 5874117 gene locus_tag LOCUS_55440 5872303 5874117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_55440 5874114 5875958 gene locus_tag LOCUS_55450 5874114 5875958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_55450 5876192 5875965 gene locus_tag LOCUS_55460 5876192 5875965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 5876875 5876228 gene locus_tag LOCUS_55470 5876875 5876228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 5876932 5879811 gene locus_tag LOCUS_55480 gene afsR 5876932 5879811 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_55480 5880755 5879799 gene locus_tag LOCUS_55490 5880755 5879799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 5881654 5880638 gene locus_tag LOCUS_55500 5881654 5880638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 5882435 5881749 gene locus_tag LOCUS_55510 5882435 5881749 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230282.1 protein_id gnl|my_center|LOCUS_55510 5882844 5882527 gene locus_tag LOCUS_55520 5882844 5882527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 5883193 5882849 gene locus_tag LOCUS_55530 5883193 5882849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 5884017 5883277 gene locus_tag LOCUS_55540 5884017 5883277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 5884072 5885208 gene locus_tag LOCUS_55550 5884072 5885208 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_55550 5885413 5885219 gene locus_tag LOCUS_55560 5885413 5885219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 5886459 5885482 gene locus_tag LOCUS_55570 5886459 5885482 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_55570 5886539 5887783 gene locus_tag LOCUS_55580 gene xseA 5886539 5887783 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_55580 5887787 5887987 gene locus_tag LOCUS_55590 5887787 5887987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 5888755 5887991 gene locus_tag LOCUS_55600 gene scbB 5888755 5887991 CDS product A-factor type gamma-butyrolactone 6-reductase ScbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030779.1 protein_id gnl|my_center|LOCUS_55600 5888934 5889416 gene locus_tag LOCUS_55610 5888934 5889416 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030130.1 protein_id gnl|my_center|LOCUS_55610 5890284 5889436 gene locus_tag LOCUS_55620 5890284 5889436 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_55620 5890378 5891769 gene locus_tag LOCUS_55630 5890378 5891769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 5892828 5891773 gene locus_tag LOCUS_55640 gene thrC 5892828 5891773 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_55640 5894108 5892804 gene locus_tag LOCUS_55650 5894108 5892804 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_55650 5895526 5894120 gene locus_tag LOCUS_55660 gene lysA 5895526 5894120 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_55660 5897178 5895526 gene locus_tag LOCUS_55670 gene argS 5897178 5895526 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406630.1 protein_id gnl|my_center|LOCUS_55670 5897344 5898501 gene locus_tag LOCUS_55680 5897344 5898501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 5899269 5898628 gene locus_tag LOCUS_55690 5899269 5898628 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_55690 5900455 5899325 gene locus_tag LOCUS_55700 5900455 5899325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 5900618 5900740 gene locus_tag LOCUS_55710 5900618 5900740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 5900757 5901533 gene locus_tag LOCUS_55720 5900757 5901533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776543.1 protein_id gnl|my_center|LOCUS_55720 5901548 5903524 gene locus_tag LOCUS_55730 5901548 5903524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 5904376 5903588 gene locus_tag LOCUS_55740 5904376 5903588 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_55740 5905357 5904422 gene locus_tag LOCUS_55750 5905357 5904422 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230546.1 protein_id gnl|my_center|LOCUS_55750 5905551 5906666 gene locus_tag LOCUS_55760 5905551 5906666 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406361.1 protein_id gnl|my_center|LOCUS_55760 5907400 5906717 gene locus_tag LOCUS_55770 5907400 5906717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 5908132 5907410 gene locus_tag LOCUS_55780 5908132 5907410 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_55780 5908276 5909589 gene locus_tag LOCUS_55790 5908276 5909589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 5909725 5911608 gene locus_tag LOCUS_55800 5909725 5911608 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_55800 5912325 5911651 gene locus_tag LOCUS_55810 5912325 5911651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 5912408 5912872 gene locus_tag LOCUS_55820 5912408 5912872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 5913414 5912839 gene locus_tag LOCUS_55830 5913414 5912839 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081691.1 protein_id gnl|my_center|LOCUS_55830 5914527 5913511 gene locus_tag LOCUS_55840 5914527 5913511 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_55840 5916761 5914524 gene locus_tag LOCUS_55850 5916761 5914524 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_55850 5917073 5917147 gene locus_tag LOCUS_t00430 5917073 5917147 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5917952 5917197 gene locus_tag LOCUS_55860 5917952 5917197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 5918724 5918059 gene locus_tag LOCUS_55870 5918724 5918059 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 protein_id gnl|my_center|LOCUS_55870 5918981 5918760 gene locus_tag LOCUS_55880 5918981 5918760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 5919106 5919702 gene locus_tag LOCUS_55890 5919106 5919702 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226530.1 protein_id gnl|my_center|LOCUS_55890 5919774 5920943 gene locus_tag LOCUS_55900 5919774 5920943 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144327.1 protein_id gnl|my_center|LOCUS_55900 5921719 5920940 gene locus_tag LOCUS_55910 5921719 5920940 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229990.1 protein_id gnl|my_center|LOCUS_55910 5921782 5923206 gene locus_tag LOCUS_55920 5921782 5923206 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_55920 5924110 5923145 gene locus_tag LOCUS_55930 5924110 5923145 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729469.1 protein_id gnl|my_center|LOCUS_55930 5925552 5924143 gene locus_tag LOCUS_55940 5925552 5924143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_55940 5925658 5926362 gene locus_tag LOCUS_55950 5925658 5926362 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531570.1 protein_id gnl|my_center|LOCUS_55950 5927855 5926359 gene locus_tag LOCUS_55960 5927855 5926359 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113065.1 protein_id gnl|my_center|LOCUS_55960 5928002 5929438 gene locus_tag LOCUS_55970 5928002 5929438 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 protein_id gnl|my_center|LOCUS_55970 5929520 5929999 gene locus_tag LOCUS_55980 5929520 5929999 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803676.1 protein_id gnl|my_center|LOCUS_55980 5930030 5931067 gene locus_tag LOCUS_55990 5930030 5931067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 5931210 5931362 gene locus_tag LOCUS_56000 5931210 5931362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 5932660 5931326 gene locus_tag LOCUS_56010 gene mgtE 5932660 5931326 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803803.1 protein_id gnl|my_center|LOCUS_56010 5933645 5932674 gene locus_tag LOCUS_56020 5933645 5932674 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125308321.1 protein_id gnl|my_center|LOCUS_56020 5933759 5934964 gene locus_tag LOCUS_56030 5933759 5934964 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093954241.1 protein_id gnl|my_center|LOCUS_56030 5935769 5934975 gene locus_tag LOCUS_56040 5935769 5934975 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_56040 5938191 5935780 gene locus_tag LOCUS_56050 5938191 5935780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 5938610 5938260 gene locus_tag LOCUS_56060 5938610 5938260 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975921.1 protein_id gnl|my_center|LOCUS_56060 5939443 5938658 gene locus_tag LOCUS_56070 5939443 5938658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_56070 5940423 5939440 gene locus_tag LOCUS_56080 5940423 5939440 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_56080 5941024 5940503 gene locus_tag LOCUS_56090 5941024 5940503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56090 5941173 5941799 gene locus_tag LOCUS_56100 5941173 5941799 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200072.1 protein_id gnl|my_center|LOCUS_56100 5941811 5943385 gene locus_tag LOCUS_56110 5941811 5943385 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227261.1 protein_id gnl|my_center|LOCUS_56110 5943497 5944939 gene locus_tag LOCUS_56120 5943497 5944939 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469007.1 protein_id gnl|my_center|LOCUS_56120 5944941 5946239 gene locus_tag LOCUS_56130 5944941 5946239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56130 5946236 5946883 gene locus_tag LOCUS_56140 5946236 5946883 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_56140 5946935 5947306 gene locus_tag LOCUS_56150 5946935 5947306 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403456.1 protein_id gnl|my_center|LOCUS_56150 5948511 5947366 gene locus_tag LOCUS_56160 5948511 5947366 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716613.1 protein_id gnl|my_center|LOCUS_56160 5948997 5948602 gene locus_tag LOCUS_56170 5948997 5948602 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225170.1 protein_id gnl|my_center|LOCUS_56170 5951294 5949000 gene locus_tag LOCUS_56180 5951294 5949000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 5952183 5951476 gene locus_tag LOCUS_56190 5952183 5951476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812846.1 protein_id gnl|my_center|LOCUS_56190 5953864 5952173 gene locus_tag LOCUS_56200 5953864 5952173 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350675.1 protein_id gnl|my_center|LOCUS_56200 5954742 5953864 gene locus_tag LOCUS_56210 5954742 5953864 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_56210 5956023 5954842 gene locus_tag LOCUS_56220 5956023 5954842 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_56220 5957251 5956241 gene locus_tag LOCUS_56230 5957251 5956241 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254327.1 protein_id gnl|my_center|LOCUS_56230 5958045 5957248 gene locus_tag LOCUS_56240 5958045 5957248 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970044.1 protein_id gnl|my_center|LOCUS_56240 5958836 5958042 gene locus_tag LOCUS_56250 5958836 5958042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384629.1 protein_id gnl|my_center|LOCUS_56250 5959639 5958833 gene locus_tag LOCUS_56260 5959639 5958833 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384630.1 protein_id gnl|my_center|LOCUS_56260 5960661 5959636 gene locus_tag LOCUS_56270 5960661 5959636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 5960833 5961840 gene locus_tag LOCUS_56280 5960833 5961840 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_56280 5962930 5961887 gene locus_tag LOCUS_56290 5962930 5961887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56290 5963858 5962977 gene locus_tag LOCUS_56300 5963858 5962977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 5964792 5963929 gene locus_tag LOCUS_56310 5964792 5963929 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225433.1 protein_id gnl|my_center|LOCUS_56310 5967518 5964897 gene locus_tag LOCUS_56320 gene ppsA 5967518 5964897 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231379.1 protein_id gnl|my_center|LOCUS_56320 5968351 5967665 gene locus_tag LOCUS_56330 5968351 5967665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 5968405 5969025 gene locus_tag LOCUS_56340 5968405 5969025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 5969141 5972434 gene locus_tag LOCUS_56350 5969141 5972434 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230443.1 protein_id gnl|my_center|LOCUS_56350 5972511 5973350 gene locus_tag LOCUS_56360 5972511 5973350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 5973469 5974839 gene locus_tag LOCUS_56370 5973469 5974839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 5975337 5974942 gene locus_tag LOCUS_56380 5975337 5974942 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972102.1 protein_id gnl|my_center|LOCUS_56380 5975421 5976887 gene locus_tag LOCUS_56390 5975421 5976887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229300.1 protein_id gnl|my_center|LOCUS_56390 5977542 5976955 gene locus_tag LOCUS_56400 5977542 5976955 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222865.1 protein_id gnl|my_center|LOCUS_56400 5977638 5979203 gene locus_tag LOCUS_56410 5977638 5979203 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727668.1 protein_id gnl|my_center|LOCUS_56410 5979476 5979913 gene locus_tag LOCUS_56420 5979476 5979913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 5980251 5979862 gene locus_tag LOCUS_56430 5980251 5979862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 5980349 5981071 gene locus_tag LOCUS_56440 5980349 5981071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 5981068 5981880 gene locus_tag LOCUS_56450 5981068 5981880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 5982719 5981898 gene locus_tag LOCUS_56460 5982719 5981898 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230013.1 protein_id gnl|my_center|LOCUS_56460 5983701 5982799 gene locus_tag LOCUS_56470 5983701 5982799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 5984426 5983713 gene locus_tag LOCUS_56480 5984426 5983713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 5984887 5984519 gene locus_tag LOCUS_56490 5984887 5984519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 5985156 5986769 gene locus_tag LOCUS_56500 5985156 5986769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 5987084 5986776 gene locus_tag LOCUS_56510 5987084 5986776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 5989315 5987081 gene locus_tag LOCUS_56520 5989315 5987081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 5990086 5989406 gene locus_tag LOCUS_56530 5990086 5989406 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977293.1 protein_id gnl|my_center|LOCUS_56530 5990206 5990904 gene locus_tag LOCUS_56540 5990206 5990904 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224434.1 protein_id gnl|my_center|LOCUS_56540 5990991 5992103 gene locus_tag LOCUS_56550 5990991 5992103 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876725.1 protein_id gnl|my_center|LOCUS_56550 5992246 5993691 gene locus_tag LOCUS_56560 5992246 5993691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 5994444 5993695 gene locus_tag LOCUS_56570 5994444 5993695 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094000.1 protein_id gnl|my_center|LOCUS_56570 5994499 5995542 gene locus_tag LOCUS_56580 5994499 5995542 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_56580 5995935 5995579 gene locus_tag LOCUS_56590 5995935 5995579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 5998324 5995982 gene locus_tag LOCUS_56600 5998324 5995982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 5999013 5998321 gene locus_tag LOCUS_56610 5999013 5998321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_56610 5999216 6000616 gene locus_tag LOCUS_56620 5999216 6000616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 6000690 6001367 gene locus_tag LOCUS_56630 6000690 6001367 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_56630 6002005 6001358 gene locus_tag LOCUS_56640 6002005 6001358 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_56640 6003245 6002127 gene locus_tag LOCUS_56650 6003245 6002127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 6004633 6003332 gene locus_tag LOCUS_56660 6004633 6003332 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 protein_id gnl|my_center|LOCUS_56660 6005590 6004781 gene locus_tag LOCUS_56670 6005590 6004781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 6006511 6005711 gene locus_tag LOCUS_56680 6006511 6005711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 6008188 6006560 gene locus_tag LOCUS_56690 6008188 6006560 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_56690 6009257 6008598 gene locus_tag LOCUS_56700 6009257 6008598 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225250.1 protein_id gnl|my_center|LOCUS_56700 6009336 6009767 gene locus_tag LOCUS_56710 6009336 6009767 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894320.1 protein_id gnl|my_center|LOCUS_56710 6009795 6010463 gene locus_tag LOCUS_56720 6009795 6010463 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015591.1 protein_id gnl|my_center|LOCUS_56720 6010835 6012184 gene locus_tag LOCUS_56730 6010835 6012184 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083337.1 protein_id gnl|my_center|LOCUS_56730 6012229 6012900 gene locus_tag LOCUS_56740 6012229 6012900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 6013072 6015060 gene locus_tag LOCUS_56750 6013072 6015060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 6015553 6015218 gene locus_tag LOCUS_56760 6015553 6015218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 6016140 6015550 gene locus_tag LOCUS_56770 6016140 6015550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 6016875 6016162 gene locus_tag LOCUS_56780 6016875 6016162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 6017209 6016880 gene locus_tag LOCUS_56790 6017209 6016880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 6017622 6017206 gene locus_tag LOCUS_56800 6017622 6017206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 6018502 6017786 gene locus_tag LOCUS_56810 6018502 6017786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 6019881 6018721 gene locus_tag LOCUS_56820 6019881 6018721 CDS product phosphonoacetaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202931.1 protein_id gnl|my_center|LOCUS_56820 6021092 6019971 gene locus_tag LOCUS_56830 gene aepY 6021092 6019971 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817136.1 protein_id gnl|my_center|LOCUS_56830 6022402 6021089 gene locus_tag LOCUS_56840 gene aepX 6022402 6021089 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202933.1 protein_id gnl|my_center|LOCUS_56840 6024229 6022544 gene locus_tag LOCUS_56850 6024229 6022544 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776625.1 protein_id gnl|my_center|LOCUS_56850 6026059 6024404 gene locus_tag LOCUS_56860 6026059 6024404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 6026768 6026064 gene locus_tag LOCUS_56870 6026768 6026064 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821673.1 protein_id gnl|my_center|LOCUS_56870 6027643 6026780 gene locus_tag LOCUS_56880 6027643 6026780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 6027820 6028581 gene locus_tag LOCUS_56890 6027820 6028581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 6028581 6030638 gene locus_tag LOCUS_56900 6028581 6030638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 6030988 6032769 gene locus_tag LOCUS_56910 6030988 6032769 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030600.1 protein_id gnl|my_center|LOCUS_56910 6032775 6034406 gene locus_tag LOCUS_56920 6032775 6034406 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030599.1 protein_id gnl|my_center|LOCUS_56920 6034403 6036691 gene locus_tag LOCUS_56930 6034403 6036691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 6036737 6038851 gene locus_tag LOCUS_56940 6036737 6038851 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030601.1 protein_id gnl|my_center|LOCUS_56940 6039449 6038871 gene locus_tag LOCUS_56950 6039449 6038871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 6040494 6039562 gene locus_tag LOCUS_56960 6040494 6039562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56960 6041978 6040554 gene locus_tag LOCUS_56970 6041978 6040554 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_56970 6042928 6042044 gene locus_tag LOCUS_56980 6042928 6042044 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_56980 6043970 6042915 gene locus_tag LOCUS_56990 6043970 6042915 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_56990 6044686 6043958 gene locus_tag LOCUS_57000 6044686 6043958 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_57000 6044881 6045906 gene locus_tag LOCUS_57010 6044881 6045906 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282906.1 protein_id gnl|my_center|LOCUS_57010 6046251 6046024 gene locus_tag LOCUS_57020 6046251 6046024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 6046411 6046713 gene locus_tag LOCUS_57030 6046411 6046713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 6048232 6046982 gene locus_tag LOCUS_57040 gene efeB 6048232 6046982 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 protein_id gnl|my_center|LOCUS_57040 6049384 6048254 gene locus_tag LOCUS_57050 6049384 6048254 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_57050 6050271 6049408 gene locus_tag LOCUS_57060 6050271 6049408 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229933.1 protein_id gnl|my_center|LOCUS_57060 6050449 6051636 gene locus_tag LOCUS_57070 6050449 6051636 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224039.1 protein_id gnl|my_center|LOCUS_57070 6051867 6051637 gene locus_tag LOCUS_57080 6051867 6051637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 6052407 6052979 gene locus_tag LOCUS_57090 6052407 6052979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 6053074 6053970 gene locus_tag LOCUS_57100 6053074 6053970 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029986.1 protein_id gnl|my_center|LOCUS_57100 6054793 6053975 gene locus_tag LOCUS_57110 6054793 6053975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_57110 6056085 6055285 gene locus_tag LOCUS_57120 6056085 6055285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 6056370 6056609 gene locus_tag LOCUS_57130 6056370 6056609 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222412.1 protein_id gnl|my_center|LOCUS_57130 6056698 6057333 gene locus_tag LOCUS_57140 6056698 6057333 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_57140 6057572 6058261 gene locus_tag LOCUS_57150 6057572 6058261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 6058258 6059604 gene locus_tag LOCUS_57160 6058258 6059604 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061882.1 protein_id gnl|my_center|LOCUS_57160 6059902 6059630 gene locus_tag LOCUS_57170 6059902 6059630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 6059807 6061321 gene locus_tag LOCUS_57180 6059807 6061321 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222417.1 protein_id gnl|my_center|LOCUS_57180 6061387 6062325 gene locus_tag LOCUS_57190 gene hemB 6061387 6062325 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 protein_id gnl|my_center|LOCUS_57190 6062162 6062247 gene locus_tag LOCUS_t00440 6062162 6062247 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6062339 6062836 gene locus_tag LOCUS_57200 6062339 6062836 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226865.1 protein_id gnl|my_center|LOCUS_57200 6063227 6062841 gene locus_tag LOCUS_57210 6063227 6062841 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224711.1 protein_id gnl|my_center|LOCUS_57210 6064210 6063251 gene locus_tag LOCUS_57220 6064210 6063251 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804021.1 protein_id gnl|my_center|LOCUS_57220 6064358 6065011 gene locus_tag LOCUS_57230 6064358 6065011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 6065612 6065094 gene locus_tag LOCUS_57240 6065612 6065094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 6065713 6067089 gene locus_tag LOCUS_57250 6065713 6067089 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_57250 6067660 6067046 gene locus_tag LOCUS_57260 6067660 6067046 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971624.1 protein_id gnl|my_center|LOCUS_57260 6068511 6067657 gene locus_tag LOCUS_57270 6068511 6067657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 6069702 6068938 gene locus_tag LOCUS_57280 6069702 6068938 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087166.1 protein_id gnl|my_center|LOCUS_57280 6069821 6070252 gene locus_tag LOCUS_57290 6069821 6070252 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_57290 6070249 6071283 gene locus_tag LOCUS_57300 6070249 6071283 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230728.1 protein_id gnl|my_center|LOCUS_57300 6072501 6071326 gene locus_tag LOCUS_57310 6072501 6071326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 6072677 6074353 gene locus_tag LOCUS_57320 6072677 6074353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 6074454 6075719 gene locus_tag LOCUS_57330 6074454 6075719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 6078079 6075779 gene locus_tag LOCUS_57340 6078079 6075779 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 protein_id gnl|my_center|LOCUS_57340 6078845 6078156 gene locus_tag LOCUS_57350 6078845 6078156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 6078984 6080528 gene locus_tag LOCUS_57360 6078984 6080528 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027698.1 protein_id gnl|my_center|LOCUS_57360 6080572 6082365 gene locus_tag LOCUS_57370 gene metG 6080572 6082365 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775786.1 protein_id gnl|my_center|LOCUS_57370 6083902 6082496 gene locus_tag LOCUS_57380 6083902 6082496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 6084741 6084103 gene locus_tag LOCUS_57390 6084741 6084103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 6084822 6085880 gene locus_tag LOCUS_57400 6084822 6085880 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_57400 6086892 6085951 gene locus_tag LOCUS_57410 6086892 6085951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 6087065 6088591 gene locus_tag LOCUS_57420 6087065 6088591 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_57420 6088659 6088732 gene locus_tag LOCUS_t00450 6088659 6088732 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6089304 6088789 gene locus_tag LOCUS_57430 6089304 6088789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57430 6089206 6089454 gene locus_tag LOCUS_57440 6089206 6089454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440 6090001 6089477 gene locus_tag LOCUS_57450 gene tamR 6090001 6089477 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_57450 6090084 6091112 gene locus_tag LOCUS_57460 6090084 6091112 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226051.1 protein_id gnl|my_center|LOCUS_57460 6092112 6091072 gene locus_tag LOCUS_57470 gene speB 6092112 6091072 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_57470 6092181 6093149 gene locus_tag LOCUS_57480 6092181 6093149 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_57480 6093202 6093543 gene locus_tag LOCUS_57490 6093202 6093543 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068923899.1 protein_id gnl|my_center|LOCUS_57490 6093540 6094049 gene locus_tag LOCUS_57500 6093540 6094049 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141436.1 protein_id gnl|my_center|LOCUS_57500 6094046 6094504 gene locus_tag LOCUS_57510 6094046 6094504 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 protein_id gnl|my_center|LOCUS_57510 6094536 6095519 gene locus_tag LOCUS_57520 6094536 6095519 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226026.1 protein_id gnl|my_center|LOCUS_57520 6095618 6096223 gene locus_tag LOCUS_57530 6095618 6096223 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532352.1 protein_id gnl|my_center|LOCUS_57530 6097182 6096220 gene locus_tag LOCUS_57540 6097182 6096220 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030711.1 protein_id gnl|my_center|LOCUS_57540 6097423 6097175 gene locus_tag LOCUS_57550 6097423 6097175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 6097522 6098121 gene locus_tag LOCUS_57560 6097522 6098121 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947468.1 protein_id gnl|my_center|LOCUS_57560 6098765 6098154 gene locus_tag LOCUS_57570 6098765 6098154 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254574.1 protein_id gnl|my_center|LOCUS_57570 6099254 6099496 gene locus_tag LOCUS_57580 6099254 6099496 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_57580 6099688 6100518 gene locus_tag LOCUS_57590 6099688 6100518 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_57590 6101420 6100578 gene locus_tag LOCUS_57600 6101420 6100578 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467855.1 protein_id gnl|my_center|LOCUS_57600 6103613 6101562 gene locus_tag LOCUS_57610 6103613 6101562 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227921.1 protein_id gnl|my_center|LOCUS_57610 6106324 6103613 gene locus_tag LOCUS_57620 6106324 6103613 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805171.1 protein_id gnl|my_center|LOCUS_57620 6107417 6106470 gene locus_tag LOCUS_57630 6107417 6106470 CDS product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804079.1 protein_id gnl|my_center|LOCUS_57630 6107752 6107414 gene locus_tag LOCUS_57640 6107752 6107414 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804080.1 protein_id gnl|my_center|LOCUS_57640 6107918 6108274 gene locus_tag LOCUS_57650 6107918 6108274 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974216.1 protein_id gnl|my_center|LOCUS_57650 6108294 6109610 gene locus_tag LOCUS_57660 6108294 6109610 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029845.1 protein_id gnl|my_center|LOCUS_57660 6109621 6110079 gene locus_tag LOCUS_57670 6109621 6110079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 6110549 6110076 gene locus_tag LOCUS_57680 6110549 6110076 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090553.1 protein_id gnl|my_center|LOCUS_57680 6110633 6111376 gene locus_tag LOCUS_57690 6110633 6111376 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065139.1 protein_id gnl|my_center|LOCUS_57690 6112229 6111390 gene locus_tag LOCUS_57700 6112229 6111390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 6112337 6112918 gene locus_tag LOCUS_57710 6112337 6112918 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230968.1 protein_id gnl|my_center|LOCUS_57710 6112915 6113445 gene locus_tag LOCUS_57720 6112915 6113445 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 protein_id gnl|my_center|LOCUS_57720 6114655 6113468 gene locus_tag LOCUS_57730 6114655 6113468 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031811.1 protein_id gnl|my_center|LOCUS_57730 6115890 6114889 gene locus_tag LOCUS_57740 6115890 6114889 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 protein_id gnl|my_center|LOCUS_57740 6116034 6117023 gene locus_tag LOCUS_57750 6116034 6117023 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804968.1 protein_id gnl|my_center|LOCUS_57750 6117020 6117901 gene locus_tag LOCUS_57760 6117020 6117901 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804067.1 protein_id gnl|my_center|LOCUS_57760 6117914 6119548 gene locus_tag LOCUS_57770 6117914 6119548 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179748936.1 protein_id gnl|my_center|LOCUS_57770 6119583 6120626 gene locus_tag LOCUS_57780 6119583 6120626 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976047.1 protein_id gnl|my_center|LOCUS_57780 6121404 6120598 gene locus_tag LOCUS_57790 6121404 6120598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_57790 6121503 6122231 gene locus_tag LOCUS_57800 6121503 6122231 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_57800 6122764 6122228 gene locus_tag LOCUS_57810 6122764 6122228 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_57810 6122897 6123817 gene locus_tag LOCUS_57820 6122897 6123817 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_57820 6124063 6123875 gene locus_tag LOCUS_57830 6124063 6123875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57830 6124902 6124117 gene locus_tag LOCUS_57840 6124902 6124117 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_57840 6125517 6126944 gene locus_tag LOCUS_57850 6125517 6126944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 6127090 6127299 gene locus_tag LOCUS_57860 6127090 6127299 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_57860 6127580 6128578 gene locus_tag LOCUS_57870 6127580 6128578 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_57870 6128583 6129413 gene locus_tag LOCUS_57880 6128583 6129413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 6129434 6129760 gene locus_tag LOCUS_57890 6129434 6129760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 6129754 6130500 gene locus_tag LOCUS_57900 6129754 6130500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 6130524 6131327 gene locus_tag LOCUS_57910 6130524 6131327 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_57910 6131550 6132065 gene locus_tag LOCUS_57920 6131550 6132065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 6132079 6132552 gene locus_tag LOCUS_57930 6132079 6132552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 6132561 6133733 gene locus_tag LOCUS_57940 6132561 6133733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57940 6133789 6134988 gene locus_tag LOCUS_57950 6133789 6134988 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892540.1 protein_id gnl|my_center|LOCUS_57950 6135086 6136468 gene locus_tag LOCUS_57960 6135086 6136468 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_57960 6136536 6136883 gene locus_tag LOCUS_57970 6136536 6136883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 6138133 6136880 gene locus_tag LOCUS_57980 6138133 6136880 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 protein_id gnl|my_center|LOCUS_57980 6139182 6138232 gene locus_tag LOCUS_57990 6139182 6138232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 6140271 6139216 gene locus_tag LOCUS_58000 6140271 6139216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 6140997 6140281 gene locus_tag LOCUS_58010 6140997 6140281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 6141647 6140892 gene locus_tag LOCUS_58020 6141647 6140892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 6141688 6142314 gene locus_tag LOCUS_58030 6141688 6142314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 6142319 6144928 gene locus_tag LOCUS_58040 6142319 6144928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 6144943 6145689 gene locus_tag LOCUS_58050 6144943 6145689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 6146163 6148238 gene locus_tag LOCUS_58060 6146163 6148238 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_58060 6148267 6149472 gene locus_tag LOCUS_58070 6148267 6149472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 6150270 6149461 gene locus_tag LOCUS_58080 6150270 6149461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 6150528 6151709 gene locus_tag LOCUS_58090 6150528 6151709 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256557.1 protein_id gnl|my_center|LOCUS_58090 6151714 6152358 gene locus_tag LOCUS_58100 6151714 6152358 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140352.1 protein_id gnl|my_center|LOCUS_58100 6153030 6152374 gene locus_tag LOCUS_58110 6153030 6152374 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975504.1 protein_id gnl|my_center|LOCUS_58110 6154316 6153117 gene locus_tag LOCUS_58120 6154316 6153117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 6154412 6155431 gene locus_tag LOCUS_58130 6154412 6155431 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_58130 6156107 6155388 gene locus_tag LOCUS_58140 6156107 6155388 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226466.1 protein_id gnl|my_center|LOCUS_58140 6156135 6156554 gene locus_tag LOCUS_58150 6156135 6156554 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189554466.1 protein_id gnl|my_center|LOCUS_58150 6156565 6157041 gene locus_tag LOCUS_58160 6156565 6157041 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921241.1 protein_id gnl|my_center|LOCUS_58160 6157176 6157547 gene locus_tag LOCUS_58170 6157176 6157547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 6158491 6157607 gene locus_tag LOCUS_58180 6158491 6157607 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229860.1 protein_id gnl|my_center|LOCUS_58180 6160942 6158600 gene locus_tag LOCUS_58190 6160942 6158600 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987096.1 protein_id gnl|my_center|LOCUS_58190 6161610 6161044 gene locus_tag LOCUS_58200 6161610 6161044 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 protein_id gnl|my_center|LOCUS_58200 6161718 6162293 gene locus_tag LOCUS_58210 6161718 6162293 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_58210 6162402 6162815 gene locus_tag LOCUS_58220 6162402 6162815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 6164028 6162841 gene locus_tag LOCUS_58230 6164028 6162841 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466963.1 protein_id gnl|my_center|LOCUS_58230 6164244 6165395 gene locus_tag LOCUS_58240 6164244 6165395 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_58240 6166375 6165485 gene locus_tag LOCUS_58250 6166375 6165485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 6167960 6166431 gene locus_tag LOCUS_58260 6167960 6166431 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_58260 6168187 6170931 gene locus_tag LOCUS_58270 gene ppc 6168187 6170931 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_58270 6172054 6170993 gene locus_tag LOCUS_58280 6172054 6170993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 6171942 6172166 gene locus_tag LOCUS_58290 6171942 6172166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 6172270 6173103 gene locus_tag LOCUS_58300 6172270 6173103 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_58300 6173205 6177266 gene locus_tag LOCUS_58310 6173205 6177266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 6177302 6178000 gene locus_tag LOCUS_58320 6177302 6178000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 6178002 6178976 gene locus_tag LOCUS_58330 6178002 6178976 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_58330 6179214 6179753 gene locus_tag LOCUS_58340 gene ectA 6179214 6179753 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449632.1 protein_id gnl|my_center|LOCUS_58340 6179850 6181109 gene locus_tag LOCUS_58350 gene ectB 6179850 6181109 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729399.1 protein_id gnl|my_center|LOCUS_58350 6181106 6181525 gene locus_tag LOCUS_58360 6181106 6181525 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976954.1 protein_id gnl|my_center|LOCUS_58360 6181542 6182432 gene locus_tag LOCUS_58370 gene thpD 6181542 6182432 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976953.1 protein_id gnl|my_center|LOCUS_58370 6182512 6183288 gene locus_tag LOCUS_58380 6182512 6183288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 6184644 6183364 gene locus_tag LOCUS_58390 gene eno 6184644 6183364 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229929.1 protein_id gnl|my_center|LOCUS_58390 6186346 6184736 gene locus_tag LOCUS_58400 6186346 6184736 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_58400 6186583 6187362 gene locus_tag LOCUS_58410 6186583 6187362 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_58410 6187533 6188432 gene locus_tag LOCUS_58420 6187533 6188432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 6188429 6188959 gene locus_tag LOCUS_58430 6188429 6188959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 6188963 6189469 gene locus_tag LOCUS_58440 6188963 6189469 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_58440 6189466 6190431 gene locus_tag LOCUS_58450 6189466 6190431 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_58450 6190565 6191101 gene locus_tag LOCUS_58460 6190565 6191101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 6191098 6191610 gene locus_tag LOCUS_58470 6191098 6191610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 6191612 6192727 gene locus_tag LOCUS_58480 6191612 6192727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 6193197 6192724 gene locus_tag LOCUS_58490 6193197 6192724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 6193355 6194185 gene locus_tag LOCUS_58500 6193355 6194185 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229662.1 protein_id gnl|my_center|LOCUS_58500 6194814 6194242 gene locus_tag LOCUS_58510 6194814 6194242 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225787.1 protein_id gnl|my_center|LOCUS_58510 6194913 6196100 gene locus_tag LOCUS_58520 6194913 6196100 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877690.1 protein_id gnl|my_center|LOCUS_58520 6196899 6196105 gene locus_tag LOCUS_58530 6196899 6196105 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031583.1 protein_id gnl|my_center|LOCUS_58530 6197570 6196980 gene locus_tag LOCUS_58540 6197570 6196980 CDS product immunity 21 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977534.1 protein_id gnl|my_center|LOCUS_58540 6198270 6197581 gene locus_tag LOCUS_58550 6198270 6197581 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_58550 6198843 6198307 gene locus_tag LOCUS_58560 6198843 6198307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_58560 6198996 6199634 gene locus_tag LOCUS_58570 6198996 6199634 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463838.1 protein_id gnl|my_center|LOCUS_58570 6200784 6199606 gene locus_tag LOCUS_58580 6200784 6199606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58580 6202718 6200940 gene locus_tag LOCUS_58590 6202718 6200940 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976911.1 protein_id gnl|my_center|LOCUS_58590 6205117 6202898 gene locus_tag LOCUS_58600 6205117 6202898 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_58600 6205413 6205159 gene locus_tag LOCUS_58610 6205413 6205159 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 protein_id gnl|my_center|LOCUS_58610 6206107 6205865 gene locus_tag LOCUS_58620 6206107 6205865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 6207644 6206349 gene locus_tag LOCUS_58630 6207644 6206349 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_58630 6207815 6208837 gene locus_tag LOCUS_58640 6207815 6208837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 6209427 6208834 gene locus_tag LOCUS_58650 6209427 6208834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 6209655 6210431 gene locus_tag LOCUS_58660 6209655 6210431 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977577.1 protein_id gnl|my_center|LOCUS_58660 6210556 6211203 gene locus_tag LOCUS_58670 6210556 6211203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 6211200 6211982 gene locus_tag LOCUS_58680 6211200 6211982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 6212304 6213413 gene locus_tag LOCUS_58690 6212304 6213413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 6213978 6213436 gene locus_tag LOCUS_58700 gene thpR 6213978 6213436 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_58700 6214388 6213975 gene locus_tag LOCUS_58710 6214388 6213975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 6215184 6214462 gene locus_tag LOCUS_58720 6215184 6214462 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031612.1 protein_id gnl|my_center|LOCUS_58720 6215396 6216673 gene locus_tag LOCUS_58730 6215396 6216673 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_58730 6217200 6216691 gene locus_tag LOCUS_58740 6217200 6216691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 6217160 6217414 gene locus_tag LOCUS_58750 6217160 6217414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 6217468 6218244 gene locus_tag LOCUS_58760 6217468 6218244 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777055.1 protein_id gnl|my_center|LOCUS_58760 6219393 6218302 gene locus_tag LOCUS_58770 gene sepH 6219393 6218302 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_58770 6219576 6219812 gene locus_tag LOCUS_58780 6219576 6219812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 6221202 6219766 gene locus_tag LOCUS_58790 6221202 6219766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 6221266 6221880 gene locus_tag LOCUS_58800 6221266 6221880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 6221877 6222671 gene locus_tag LOCUS_58810 6221877 6222671 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_58810 6222747 6224288 gene locus_tag LOCUS_58820 6222747 6224288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 6224378 6224812 gene locus_tag LOCUS_58830 6224378 6224812 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230216.1 protein_id gnl|my_center|LOCUS_58830 6225428 6224835 gene locus_tag LOCUS_58840 6225428 6224835 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044576605.1 protein_id gnl|my_center|LOCUS_58840 6225516 6226382 gene locus_tag LOCUS_58850 6225516 6226382 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_58850 6226991 6226431 gene locus_tag LOCUS_58860 6226991 6226431 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530706.1 protein_id gnl|my_center|LOCUS_58860 6227108 6227509 gene locus_tag LOCUS_58870 6227108 6227509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 6227897 6227514 gene locus_tag LOCUS_58880 6227897 6227514 CDS product flp pilus-assembly TadE/G-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731083.1 protein_id gnl|my_center|LOCUS_58880 6228301 6227894 gene locus_tag LOCUS_58890 6228301 6227894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 6228426 6228298 gene locus_tag LOCUS_58900 6228426 6228298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 6229654 6228992 gene locus_tag LOCUS_58910 6229654 6228992 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113077.1 protein_id gnl|my_center|LOCUS_58910 6230379 6229651 gene locus_tag LOCUS_58920 6230379 6229651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 6231677 6230376 gene locus_tag LOCUS_58930 6231677 6230376 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_58930 6232923 6231814 gene locus_tag LOCUS_58940 gene ssd 6232923 6231814 CDS product septum site-determining protein Ssd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900732.1 protein_id gnl|my_center|LOCUS_58940 6233275 6234033 gene locus_tag LOCUS_58950 6233275 6234033 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099222.1 protein_id gnl|my_center|LOCUS_58950 6234038 6234418 gene locus_tag LOCUS_58960 6234038 6234418 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224560.1 protein_id gnl|my_center|LOCUS_58960 6235593 6234799 gene locus_tag LOCUS_58970 6235593 6234799 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222282.1 protein_id gnl|my_center|LOCUS_58970 6235963 6237177 gene locus_tag LOCUS_58980 6235963 6237177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 6237333 6238973 gene locus_tag LOCUS_58990 6237333 6238973 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_58990 6239554 6239075 gene locus_tag LOCUS_59000 6239554 6239075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 6240632 6239631 gene locus_tag LOCUS_59010 6240632 6239631 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_59010 6241693 6240746 gene locus_tag LOCUS_59020 6241693 6240746 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_59020 6242077 6242373 gene locus_tag LOCUS_59030 6242077 6242373 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_59030 6242383 6242592 gene locus_tag LOCUS_59040 6242383 6242592 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_59040 6242595 6243506 gene locus_tag LOCUS_59050 6242595 6243506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091127472.1 protein_id gnl|my_center|LOCUS_59050 6244626 6243496 gene locus_tag LOCUS_59060 6244626 6243496 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207603.1 protein_id gnl|my_center|LOCUS_59060 6245612 6244623 gene locus_tag LOCUS_59070 6245612 6244623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 6245753 6245920 gene locus_tag LOCUS_59080 6245753 6245920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 6246003 6246536 gene locus_tag LOCUS_59090 6246003 6246536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 6247162 6246530 gene locus_tag LOCUS_59100 6247162 6246530 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_59100 6248171 6247320 gene locus_tag LOCUS_59110 6248171 6247320 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804841.1 protein_id gnl|my_center|LOCUS_59110 6249700 6248168 gene locus_tag LOCUS_59120 6249700 6248168 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 protein_id gnl|my_center|LOCUS_59120 6250912 6249704 gene locus_tag LOCUS_59130 6250912 6249704 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804843.1 protein_id gnl|my_center|LOCUS_59130 6251060 6252058 gene locus_tag LOCUS_59140 6251060 6252058 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_59140 6252069 6253592 gene locus_tag LOCUS_59150 6252069 6253592 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_59150 6254814 6253825 gene locus_tag LOCUS_59160 6254814 6253825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 6255775 6254903 gene locus_tag LOCUS_59170 6255775 6254903 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227669.1 protein_id gnl|my_center|LOCUS_59170 6256934 6255966 gene locus_tag LOCUS_59180 6256934 6255966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 6257501 6257067 gene locus_tag LOCUS_59190 6257501 6257067 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_59190 6257594 6258820 gene locus_tag LOCUS_59200 6257594 6258820 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223595.1 protein_id gnl|my_center|LOCUS_59200 6260109 6258817 gene locus_tag LOCUS_59210 6260109 6258817 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 protein_id gnl|my_center|LOCUS_59210 6260773 6260204 gene locus_tag LOCUS_59220 6260773 6260204 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 protein_id gnl|my_center|LOCUS_59220 6260978 6261598 gene locus_tag LOCUS_59230 6260978 6261598 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027261.1 protein_id gnl|my_center|LOCUS_59230 6261595 6262323 gene locus_tag LOCUS_59240 6261595 6262323 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229255.1 protein_id gnl|my_center|LOCUS_59240 6262328 6263638 gene locus_tag LOCUS_59250 6262328 6263638 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_59250 6264350 6263706 gene locus_tag LOCUS_59260 6264350 6263706 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978224.1 protein_id gnl|my_center|LOCUS_59260 6265924 6264398 gene locus_tag LOCUS_59270 6265924 6264398 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_59270 6266094 6266019 gene locus_tag LOCUS_t00460 6266094 6266019 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6266182 6266109 gene locus_tag LOCUS_t00470 6266182 6266109 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6267182 6266319 gene locus_tag LOCUS_59280 6267182 6266319 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_59280 6267282 6268145 gene locus_tag LOCUS_59290 6267282 6268145 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083218.1 protein_id gnl|my_center|LOCUS_59290 6268142 6268873 gene locus_tag LOCUS_59300 6268142 6268873 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113991.1 protein_id gnl|my_center|LOCUS_59300 6269887 6268883 gene locus_tag LOCUS_59310 6269887 6268883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 6269960 6272203 gene locus_tag LOCUS_59320 6269960 6272203 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_59320 6273128 6272250 gene locus_tag LOCUS_59330 6273128 6272250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 6273755 6273165 gene locus_tag LOCUS_59340 gene dcd 6273755 6273165 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_59340 6273846 6273919 gene locus_tag LOCUS_t00480 6273846 6273919 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6274721 6274005 gene locus_tag LOCUS_59350 6274721 6274005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 6275314 6274811 gene locus_tag LOCUS_59360 6275314 6274811 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223641.1 protein_id gnl|my_center|LOCUS_59360 6275539 6276657 gene locus_tag LOCUS_59370 6275539 6276657 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029660.1 protein_id gnl|my_center|LOCUS_59370 6277103 6278953 gene locus_tag LOCUS_59380 6277103 6278953 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_59380 6281807 6279024 gene locus_tag LOCUS_59390 6281807 6279024 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731616.1 protein_id gnl|my_center|LOCUS_59390 6282277 6281813 gene locus_tag LOCUS_59400 6282277 6281813 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731617.1 protein_id gnl|my_center|LOCUS_59400 6282489 6283085 gene locus_tag LOCUS_59410 6282489 6283085 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_59410 6283119 6284198 gene locus_tag LOCUS_59420 6283119 6284198 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_59420 6284361 6284510 gene locus_tag LOCUS_59430 6284361 6284510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 6284645 6284736 gene locus_tag LOCUS_t00490 6284645 6284736 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6285236 6284772 gene locus_tag LOCUS_59440 6285236 6284772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 6285418 6285549 gene locus_tag LOCUS_59450 6285418 6285549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 6285647 6285720 gene locus_tag LOCUS_t00500 6285647 6285720 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6286401 6285766 gene locus_tag LOCUS_59460 6286401 6285766 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038433.1 protein_id gnl|my_center|LOCUS_59460 6286477 6287919 gene locus_tag LOCUS_59470 6286477 6287919 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728978.1 protein_id gnl|my_center|LOCUS_59470 6287928 6289145 gene locus_tag LOCUS_59480 6287928 6289145 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030555.1 protein_id gnl|my_center|LOCUS_59480 6289211 6289858 gene locus_tag LOCUS_59490 6289211 6289858 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030760.1 protein_id gnl|my_center|LOCUS_59490 6290027 6290368 gene locus_tag LOCUS_59500 6290027 6290368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 6290548 6291351 gene locus_tag LOCUS_59510 6290548 6291351 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_59510 6291462 6292643 gene locus_tag LOCUS_59520 6291462 6292643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 6292670 6292963 gene locus_tag LOCUS_59530 6292670 6292963 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897230.1 protein_id gnl|my_center|LOCUS_59530 6292983 6293930 gene locus_tag LOCUS_59540 gene stgR 6292983 6293930 CDS product LysR family transcriptional regulator StgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028688.1 protein_id gnl|my_center|LOCUS_59540 6294022 6295674 gene locus_tag LOCUS_59550 6294022 6295674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 6297635 6295698 gene locus_tag LOCUS_59560 6297635 6295698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 6297668 6298234 gene locus_tag LOCUS_59570 6297668 6298234 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973495.1 protein_id gnl|my_center|LOCUS_59570 6298274 6299398 gene locus_tag LOCUS_59580 6298274 6299398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 6300536 6299334 gene locus_tag LOCUS_59590 6300536 6299334 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_59590 6301189 6300533 gene locus_tag LOCUS_59600 6301189 6300533 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_59600 6301355 6301831 gene locus_tag LOCUS_59610 6301355 6301831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230193.1 protein_id gnl|my_center|LOCUS_59610 6301831 6302976 gene locus_tag LOCUS_59620 6301831 6302976 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_59620 6302973 6303656 gene locus_tag LOCUS_59630 6302973 6303656 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_59630 6303653 6304930 gene locus_tag LOCUS_59640 6303653 6304930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_59640 6305786 6304980 gene locus_tag LOCUS_59650 6305786 6304980 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031782.1 protein_id gnl|my_center|LOCUS_59650 6306212 6307303 gene locus_tag LOCUS_59660 6306212 6307303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 6307387 6308355 gene locus_tag LOCUS_59670 6307387 6308355 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_59670 6308483 6309508 gene locus_tag LOCUS_59680 6308483 6309508 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850119.1 protein_id gnl|my_center|LOCUS_59680 6309618 6310397 gene locus_tag LOCUS_59690 6309618 6310397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 6310900 6310379 gene locus_tag LOCUS_59700 6310900 6310379 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_59700 6311403 6310897 gene locus_tag LOCUS_59710 6311403 6310897 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_59710 6313150 6311474 gene locus_tag LOCUS_59720 6313150 6311474 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_59720 6314154 6313402 gene locus_tag LOCUS_59730 6314154 6313402 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_59730 6314338 6315669 gene locus_tag LOCUS_59740 gene mshA 6314338 6315669 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_59740 6315680 6316159 gene locus_tag LOCUS_59750 6315680 6316159 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 protein_id gnl|my_center|LOCUS_59750 6316156 6317412 gene locus_tag LOCUS_59760 6316156 6317412 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031837.1 protein_id gnl|my_center|LOCUS_59760 6317968 6317402 gene locus_tag LOCUS_59770 6317968 6317402 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229100.1 protein_id gnl|my_center|LOCUS_59770 6318996 6318307 gene locus_tag LOCUS_59780 6318996 6318307 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_59780 6319230 6319868 gene locus_tag LOCUS_59790 6319230 6319868 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 protein_id gnl|my_center|LOCUS_59790 6319980 6320795 gene locus_tag LOCUS_59800 6319980 6320795 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 protein_id gnl|my_center|LOCUS_59800 6321260 6320874 gene locus_tag LOCUS_59810 gene rplL 6321260 6320874 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776391.1 protein_id gnl|my_center|LOCUS_59810 6321847 6321311 gene locus_tag LOCUS_59820 gene rplJ 6321847 6321311 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055400.1 protein_id gnl|my_center|LOCUS_59820 6322359 6322093 gene locus_tag LOCUS_59830 6322359 6322093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 6323105 6322395 gene locus_tag LOCUS_59840 gene rplA 6323105 6322395 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061480.1 protein_id gnl|my_center|LOCUS_59840 6323613 6323182 gene locus_tag LOCUS_59850 gene rplK 6323613 6323182 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_59850 6324548 6323739 gene locus_tag LOCUS_59860 gene nusG 6324548 6323739 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222524.1 protein_id gnl|my_center|LOCUS_59860 6325153 6324710 gene locus_tag LOCUS_59870 6325153 6324710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 6325320 6326000 gene locus_tag LOCUS_59880 6325320 6326000 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036339.1 protein_id gnl|my_center|LOCUS_59880 6326056 6326433 gene locus_tag LOCUS_59890 6326056 6326433 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_59890 6326424 6326990 gene locus_tag LOCUS_59900 6326424 6326990 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486629.1 protein_id gnl|my_center|LOCUS_59900 6326980 6328290 gene locus_tag LOCUS_59910 6326980 6328290 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_59910 6328297 6328917 gene locus_tag LOCUS_59920 6328297 6328917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59920 6328920 6329882 gene locus_tag LOCUS_59930 6328920 6329882 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_59930 6329955 6330083 gene locus_tag LOCUS_59940 6329955 6330083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 6331329 6330232 gene locus_tag LOCUS_59950 6331329 6330232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 6331838 6331326 gene locus_tag LOCUS_59960 6331838 6331326 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_59960 6333535 6331907 gene locus_tag LOCUS_59970 6333535 6331907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222854282.1 protein_id gnl|my_center|LOCUS_59970 6334550 6333708 gene locus_tag LOCUS_59980 6334550 6333708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59980 6334953 6334726 gene locus_tag LOCUS_59990 gene bldC 6334953 6334726 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_59990 6335975 6335061 gene locus_tag LOCUS_60000 6335975 6335061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_60000 6336139 6337221 gene locus_tag LOCUS_60010 6336139 6337221 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228727.1 protein_id gnl|my_center|LOCUS_60010 6337451 6337666 gene locus_tag LOCUS_60020 6337451 6337666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 6338128 6337724 gene locus_tag LOCUS_60030 6338128 6337724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 6338217 6338507 gene locus_tag LOCUS_60040 6338217 6338507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 6338919 6338485 gene locus_tag LOCUS_60050 6338919 6338485 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112945.1 protein_id gnl|my_center|LOCUS_60050 6339436 6338936 gene locus_tag LOCUS_60060 6339436 6338936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 6339973 6339521 gene locus_tag LOCUS_60070 6339973 6339521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 6341109 6339997 gene locus_tag LOCUS_60080 6341109 6339997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 6342579 6341203 gene locus_tag LOCUS_60090 6342579 6341203 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029441.1 protein_id gnl|my_center|LOCUS_60090 6342476 6342670 gene locus_tag LOCUS_60100 6342476 6342670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60100 6342814 6344217 gene locus_tag LOCUS_60110 6342814 6344217 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224833.1 protein_id gnl|my_center|LOCUS_60110 6344260 6344400 gene locus_tag LOCUS_60120 6344260 6344400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 6345022 6344423 gene locus_tag LOCUS_60130 6345022 6344423 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947468.1 protein_id gnl|my_center|LOCUS_60130 6345116 6345343 gene locus_tag LOCUS_60140 6345116 6345343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 6348045 6345421 gene locus_tag LOCUS_60150 6348045 6345421 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 protein_id gnl|my_center|LOCUS_60150 6348190 6348633 gene locus_tag LOCUS_60160 6348190 6348633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 6349633 6348689 gene locus_tag LOCUS_60170 6349633 6348689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 6349729 6350898 gene locus_tag LOCUS_60180 6349729 6350898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 6351834 6350911 gene locus_tag LOCUS_60190 gene meaB 6351834 6350911 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_60190 6353027 6351831 gene locus_tag LOCUS_60200 6353027 6351831 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_60200 6353124 6353507 gene locus_tag LOCUS_60210 gene mce 6353124 6353507 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406879.1 protein_id gnl|my_center|LOCUS_60210 6354349 6353504 gene locus_tag LOCUS_60220 6354349 6353504 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222914.1 protein_id gnl|my_center|LOCUS_60220 6354476 6354961 gene locus_tag LOCUS_60230 6354476 6354961 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230087.1 protein_id gnl|my_center|LOCUS_60230 6355493 6354972 gene locus_tag LOCUS_60240 6355493 6354972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 6355683 6356171 gene locus_tag LOCUS_60250 6355683 6356171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 6356181 6357086 gene locus_tag LOCUS_60260 6356181 6357086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 6358762 6357554 gene locus_tag LOCUS_60270 gene manA 6358762 6357554 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 protein_id gnl|my_center|LOCUS_60270 6359781 6358825 gene locus_tag LOCUS_60280 6359781 6358825 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_60280 6361026 6359827 gene locus_tag LOCUS_60290 6361026 6359827 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_60290 6361259 6361038 gene locus_tag LOCUS_60300 6361259 6361038 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229750.1 protein_id gnl|my_center|LOCUS_60300 6362639 6361275 gene locus_tag LOCUS_60310 6362639 6361275 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_60310 6363043 6362690 gene locus_tag LOCUS_60320 6363043 6362690 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086677666.1 protein_id gnl|my_center|LOCUS_60320 6363362 6363736 gene locus_tag LOCUS_60330 6363362 6363736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 6364817 6364329 gene locus_tag LOCUS_60340 6364817 6364329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60340 6365913 6364822 gene locus_tag LOCUS_60350 6365913 6364822 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_60350 6367253 6366111 gene locus_tag LOCUS_60360 6367253 6366111 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_60360 6368944 6367454 gene locus_tag LOCUS_60370 6368944 6367454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 6368930 6369160 gene locus_tag LOCUS_60380 6368930 6369160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 6371177 6369213 gene locus_tag LOCUS_60390 6371177 6369213 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225129.1 protein_id gnl|my_center|LOCUS_60390 6371293 6372072 gene locus_tag LOCUS_60400 6371293 6372072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60400 6372192 6373556 gene locus_tag LOCUS_60410 6372192 6373556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 6374860 6373628 gene locus_tag LOCUS_60420 6374860 6373628 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 protein_id gnl|my_center|LOCUS_60420 6374983 6375453 gene locus_tag LOCUS_60430 6374983 6375453 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224980.1 protein_id gnl|my_center|LOCUS_60430 6375396 6375677 gene locus_tag LOCUS_60440 6375396 6375677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 6376262 6375678 gene locus_tag LOCUS_60450 6376262 6375678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 6376498 6377880 gene locus_tag LOCUS_60460 6376498 6377880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 6377877 6378434 gene locus_tag LOCUS_60470 6377877 6378434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 6379011 6378436 gene locus_tag LOCUS_60480 6379011 6378436 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847367.1 protein_id gnl|my_center|LOCUS_60480 6379100 6379783 gene locus_tag LOCUS_60490 6379100 6379783 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467764.1 protein_id gnl|my_center|LOCUS_60490 6379776 6380879 gene locus_tag LOCUS_60500 6379776 6380879 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230016.1 protein_id gnl|my_center|LOCUS_60500 6382044 6380869 gene locus_tag LOCUS_60510 6382044 6380869 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_60510 6383011 6382202 gene locus_tag LOCUS_60520 6383011 6382202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60520 6383178 6384377 gene locus_tag LOCUS_60530 6383178 6384377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 6384277 6389049 gene locus_tag LOCUS_60540 6384277 6389049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 6389135 6390604 gene locus_tag LOCUS_60550 6389135 6390604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 6390629 6391240 gene locus_tag LOCUS_60560 6390629 6391240 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892887.1 protein_id gnl|my_center|LOCUS_60560 6393027 6391237 gene locus_tag LOCUS_60570 6393027 6391237 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_60570 6393141 6393962 gene locus_tag LOCUS_60580 6393141 6393962 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226536.1 protein_id gnl|my_center|LOCUS_60580 6394605 6394003 gene locus_tag LOCUS_60590 6394605 6394003 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866867.1 protein_id gnl|my_center|LOCUS_60590 6394684 6395421 gene locus_tag LOCUS_60600 6394684 6395421 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668774.1 protein_id gnl|my_center|LOCUS_60600 6395424 6396044 gene locus_tag LOCUS_60610 6395424 6396044 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262042.1 protein_id gnl|my_center|LOCUS_60610 6396551 6396093 gene locus_tag LOCUS_60620 6396551 6396093 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230140.1 protein_id gnl|my_center|LOCUS_60620 6396627 6397496 gene locus_tag LOCUS_60630 6396627 6397496 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090536.1 protein_id gnl|my_center|LOCUS_60630 6399456 6397549 gene locus_tag LOCUS_60640 6399456 6397549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 6399544 6400359 gene locus_tag LOCUS_60650 6399544 6400359 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083453073.1 protein_id gnl|my_center|LOCUS_60650 6400840 6400328 gene locus_tag LOCUS_60660 6400840 6400328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 6401892 6400828 gene locus_tag LOCUS_60670 6401892 6400828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 6402336 6401905 gene locus_tag LOCUS_60680 6402336 6401905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 6403610 6402336 gene locus_tag LOCUS_60690 6403610 6402336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 6403999 6403598 gene locus_tag LOCUS_60700 6403999 6403598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 6404934 6404077 gene locus_tag LOCUS_60710 6404934 6404077 CDS product RIO kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223947.1 protein_id gnl|my_center|LOCUS_60710 6405317 6406300 gene locus_tag LOCUS_60720 6405317 6406300 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028612.1 protein_id gnl|my_center|LOCUS_60720 6406282 6407229 gene locus_tag LOCUS_60730 6406282 6407229 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_60730 6407299 6408342 gene locus_tag LOCUS_60740 6407299 6408342 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085410.1 protein_id gnl|my_center|LOCUS_60740 6409079 6408354 gene locus_tag LOCUS_60750 6409079 6408354 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230750.1 protein_id gnl|my_center|LOCUS_60750 6409341 6410423 gene locus_tag LOCUS_60760 6409341 6410423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 6410904 6410431 gene locus_tag LOCUS_60770 6410904 6410431 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092949.1 protein_id gnl|my_center|LOCUS_60770 6412285 6410930 gene locus_tag LOCUS_60780 6412285 6410930 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227138.1 protein_id gnl|my_center|LOCUS_60780 6413214 6412339 gene locus_tag LOCUS_60790 6413214 6412339 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845312.1 protein_id gnl|my_center|LOCUS_60790 6414029 6413253 gene locus_tag LOCUS_60800 6414029 6413253 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223724.1 protein_id gnl|my_center|LOCUS_60800 6414839 6414033 gene locus_tag LOCUS_60810 6414839 6414033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 6415797 6414874 gene locus_tag LOCUS_60820 gene murQ 6415797 6414874 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_60820 6415965 6416585 gene locus_tag LOCUS_60830 6415965 6416585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125309575.1 protein_id gnl|my_center|LOCUS_60830 6418234 6416660 gene locus_tag LOCUS_60840 6418234 6416660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 6418122 6418334 gene locus_tag LOCUS_60850 6418122 6418334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60850 6418362 6420089 gene locus_tag LOCUS_60860 6418362 6420089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226856.1 protein_id gnl|my_center|LOCUS_60860 6420086 6421822 gene locus_tag LOCUS_60870 6420086 6421822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226857.1 protein_id gnl|my_center|LOCUS_60870 6422505 6422041 gene locus_tag LOCUS_60880 6422505 6422041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 6423142 6422633 gene locus_tag LOCUS_60890 6423142 6422633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 6423425 6424582 gene locus_tag LOCUS_60900 gene pdhA 6423425 6424582 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_60900 6424582 6425568 gene locus_tag LOCUS_60910 6424582 6425568 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_60910 6425580 6426989 gene locus_tag LOCUS_60920 6425580 6426989 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_60920 6427071 6427289 gene locus_tag LOCUS_60930 6427071 6427289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 6427558 6428937 gene locus_tag LOCUS_60940 6427558 6428937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 6429498 6428992 gene locus_tag LOCUS_60950 6429498 6428992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 6429625 6430617 gene locus_tag LOCUS_60960 6429625 6430617 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078330037.1 protein_id gnl|my_center|LOCUS_60960 6430690 6431553 gene locus_tag LOCUS_60970 6430690 6431553 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_60970 6431659 6432237 gene locus_tag LOCUS_60980 6431659 6432237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 6433571 6432537 gene locus_tag LOCUS_60990 6433571 6432537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 6434839 6433670 gene locus_tag LOCUS_61000 6434839 6433670 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973818.1 protein_id gnl|my_center|LOCUS_61000 6435320 6434901 gene locus_tag LOCUS_61010 6435320 6434901 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084105.1 protein_id gnl|my_center|LOCUS_61010 6436124 6435438 gene locus_tag LOCUS_61020 6436124 6435438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 6437270 6436419 gene locus_tag LOCUS_61030 gene larE 6437270 6436419 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224945.1 protein_id gnl|my_center|LOCUS_61030 6437778 6437413 gene locus_tag LOCUS_61040 6437778 6437413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61040 6438041 6437835 gene locus_tag LOCUS_61050 6438041 6437835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 6439237 6438038 gene locus_tag LOCUS_61060 6439237 6438038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 6439518 6440612 gene locus_tag LOCUS_61070 6439518 6440612 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222700.1 protein_id gnl|my_center|LOCUS_61070 6440609 6441262 gene locus_tag LOCUS_61080 6440609 6441262 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 protein_id gnl|my_center|LOCUS_61080 6441435 6442502 gene locus_tag LOCUS_61090 6441435 6442502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 6442780 6443043 gene locus_tag LOCUS_61100 6442780 6443043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61100 6443252 6443800 gene locus_tag LOCUS_61110 6443252 6443800 CDS product DUF1062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973073.1 protein_id gnl|my_center|LOCUS_61110 6443892 6446180 gene locus_tag LOCUS_61120 gene pcrA 6443892 6446180 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_61120 6446362 6447888 gene locus_tag LOCUS_61130 6446362 6447888 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_61130 6448140 6449636 gene locus_tag LOCUS_61140 6448140 6449636 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_61140 6449786 6451222 gene locus_tag LOCUS_61150 6449786 6451222 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_61150 6451349 6452845 gene locus_tag LOCUS_61160 6451349 6452845 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_61160 6454562 6452913 gene locus_tag LOCUS_61170 6454562 6452913 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 protein_id gnl|my_center|LOCUS_61170 6454776 6455618 gene locus_tag LOCUS_61180 6454776 6455618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 6455761 6456525 gene locus_tag LOCUS_61190 6455761 6456525 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978125.1 protein_id gnl|my_center|LOCUS_61190 6457538 6456522 gene locus_tag LOCUS_61200 6457538 6456522 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_61200 6457667 6458461 gene locus_tag LOCUS_61210 6457667 6458461 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978125.1 protein_id gnl|my_center|LOCUS_61210 6459455 6458544 gene locus_tag LOCUS_61220 6459455 6458544 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727260.1 protein_id gnl|my_center|LOCUS_61220 6460893 6459445 gene locus_tag LOCUS_61230 6460893 6459445 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727259.1 protein_id gnl|my_center|LOCUS_61230 6460967 6461920 gene locus_tag LOCUS_61240 6460967 6461920 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975185.1 protein_id gnl|my_center|LOCUS_61240 6461923 6462630 gene locus_tag LOCUS_61250 6461923 6462630 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804466.1 protein_id gnl|my_center|LOCUS_61250 6462914 6463870 gene locus_tag LOCUS_61260 6462914 6463870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 6463911 6465704 gene locus_tag LOCUS_61270 6463911 6465704 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227921.1 protein_id gnl|my_center|LOCUS_61270 6466609 6465701 gene locus_tag LOCUS_61280 6466609 6465701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 6467312 6468010 gene locus_tag LOCUS_61290 6467312 6468010 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165264447.1 protein_id gnl|my_center|LOCUS_61290 6468088 6469092 gene locus_tag LOCUS_61300 6468088 6469092 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_61300 6469129 6470142 gene locus_tag LOCUS_61310 6469129 6470142 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_61310 6470301 6471320 gene locus_tag LOCUS_61320 6470301 6471320 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_61320 6471333 6472349 gene locus_tag LOCUS_61330 6471333 6472349 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972532.1 protein_id gnl|my_center|LOCUS_61330 6472364 6473377 gene locus_tag LOCUS_61340 6472364 6473377 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_61340 6473427 6475154 gene locus_tag LOCUS_61350 gene paaN 6473427 6475154 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_61350 6475216 6475416 gene locus_tag LOCUS_61360 6475216 6475416 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_61360 6475506 6476402 gene locus_tag LOCUS_61370 6475506 6476402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 6476591 6478219 gene locus_tag LOCUS_61380 gene groL 6476591 6478219 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_61380 6479726 6478560 gene locus_tag LOCUS_61390 6479726 6478560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 6480235 6479723 gene locus_tag LOCUS_61400 6480235 6479723 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_61400 6480974 6480366 gene locus_tag LOCUS_61410 6480974 6480366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 6481495 6480971 gene locus_tag LOCUS_61420 6481495 6480971 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_61420 6481630 6482310 gene locus_tag LOCUS_61430 6481630 6482310 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029574.1 protein_id gnl|my_center|LOCUS_61430 6482355 6483563 gene locus_tag LOCUS_61440 6482355 6483563 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_61440 6483972 6483574 gene locus_tag LOCUS_61450 6483972 6483574 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971523.1 protein_id gnl|my_center|LOCUS_61450 6484155 6483982 gene locus_tag LOCUS_61460 6484155 6483982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61460 6484378 6485358 gene locus_tag LOCUS_61470 6484378 6485358 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_61470 6485621 6485373 gene locus_tag LOCUS_61480 6485621 6485373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61480 6486826 6485846 gene locus_tag LOCUS_61490 6486826 6485846 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_61490 6487711 6486878 gene locus_tag LOCUS_61500 6487711 6486878 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408456.1 protein_id gnl|my_center|LOCUS_61500 6487852 6488706 gene locus_tag LOCUS_61510 6487852 6488706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 6488990 6488664 gene locus_tag LOCUS_61520 6488990 6488664 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405420.1 protein_id gnl|my_center|LOCUS_61520 6489673 6489020 gene locus_tag LOCUS_61530 6489673 6489020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61530 6490292 6489597 gene locus_tag LOCUS_61540 6490292 6489597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 6490522 6490289 gene locus_tag LOCUS_61550 6490522 6490289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 6490728 6491672 gene locus_tag LOCUS_61560 6490728 6491672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_61560 6491672 6491953 gene locus_tag LOCUS_61570 6491672 6491953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 6491955 6492524 gene locus_tag LOCUS_61580 6491955 6492524 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030445363.1 protein_id gnl|my_center|LOCUS_61580 6492532 6493239 gene locus_tag LOCUS_61590 gene deoD 6492532 6493239 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898215.1 protein_id gnl|my_center|LOCUS_61590 6493241 6494029 gene locus_tag LOCUS_61600 6493241 6494029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 6495153 6494020 gene locus_tag LOCUS_61610 6495153 6494020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 6495412 6496698 gene locus_tag LOCUS_61620 6495412 6496698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 6496708 6497820 gene locus_tag LOCUS_61630 6496708 6497820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 6498919 6497840 gene locus_tag LOCUS_61640 gene purM 6498919 6497840 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863129.1 protein_id gnl|my_center|LOCUS_61640 6500526 6498916 gene locus_tag LOCUS_61650 gene purF 6500526 6498916 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 protein_id gnl|my_center|LOCUS_61650 6502399 6500633 gene locus_tag LOCUS_61660 6502399 6500633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 6502577 6502924 gene locus_tag LOCUS_61670 6502577 6502924 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 protein_id gnl|my_center|LOCUS_61670 6503066 6504301 gene locus_tag LOCUS_61680 gene purD 6503066 6504301 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230794.1 protein_id gnl|my_center|LOCUS_61680 6504330 6506402 gene locus_tag LOCUS_61690 6504330 6506402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61690 6506446 6506796 gene locus_tag LOCUS_61700 6506446 6506796 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975320.1 protein_id gnl|my_center|LOCUS_61700 6506804 6507403 gene locus_tag LOCUS_61710 gene recR 6506804 6507403 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_61710 6507525 6509228 gene locus_tag LOCUS_61720 6507525 6509228 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 protein_id gnl|my_center|LOCUS_61720 6509309 6510316 gene locus_tag LOCUS_61730 6509309 6510316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 protein_id gnl|my_center|LOCUS_61730 6510316 6511272 gene locus_tag LOCUS_61740 6510316 6511272 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 protein_id gnl|my_center|LOCUS_61740 6511277 6512281 gene locus_tag LOCUS_61750 6511277 6512281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230614.1 protein_id gnl|my_center|LOCUS_61750 6512224 6513306 gene locus_tag LOCUS_61760 6512224 6513306 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230613.1 protein_id gnl|my_center|LOCUS_61760 6513495 6513620 gene locus_tag LOCUS_61770 6513495 6513620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 6514290 6513586 gene locus_tag LOCUS_61780 6514290 6513586 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028043.1 protein_id gnl|my_center|LOCUS_61780 6514393 6515004 gene locus_tag LOCUS_61790 6514393 6515004 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530144.1 protein_id gnl|my_center|LOCUS_61790 6515754 6515023 gene locus_tag LOCUS_61800 6515754 6515023 CDS product DUF2262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964099.1 protein_id gnl|my_center|LOCUS_61800 6515922 6516530 gene locus_tag LOCUS_61810 6515922 6516530 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230218.1 protein_id gnl|my_center|LOCUS_61810 6516601 6517032 gene locus_tag LOCUS_61820 6516601 6517032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029371.1 protein_id gnl|my_center|LOCUS_61820 6519013 6517526 gene locus_tag LOCUS_61830 6519013 6517526 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173309.1 protein_id gnl|my_center|LOCUS_61830 6520473 6519010 gene locus_tag LOCUS_61840 6520473 6519010 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978555.1 protein_id gnl|my_center|LOCUS_61840 6521811 6520483 gene locus_tag LOCUS_61850 6521811 6520483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 6522287 6521874 gene locus_tag LOCUS_61860 6522287 6521874 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199881.1 protein_id gnl|my_center|LOCUS_61860 6522368 6523930 gene locus_tag LOCUS_61870 6522368 6523930 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227261.1 protein_id gnl|my_center|LOCUS_61870 6523969 6525084 gene locus_tag LOCUS_61880 gene menC 6523969 6525084 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_61880 6526302 6525094 gene locus_tag LOCUS_61890 6526302 6525094 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_61890 6527179 6526373 gene locus_tag LOCUS_61900 6527179 6526373 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029342.1 protein_id gnl|my_center|LOCUS_61900 6527991 6527176 gene locus_tag LOCUS_61910 6527991 6527176 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_61910 6529312 6528044 gene locus_tag LOCUS_61920 gene serS 6529312 6528044 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897822.1 protein_id gnl|my_center|LOCUS_61920 6529367 6529708 gene locus_tag LOCUS_61930 6529367 6529708 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087492.1 protein_id gnl|my_center|LOCUS_61930 6529714 6530349 gene locus_tag LOCUS_61940 6529714 6530349 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224664.1 protein_id gnl|my_center|LOCUS_61940 6531164 6530355 gene locus_tag LOCUS_61950 6531164 6530355 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_61950 6532072 6531182 gene locus_tag LOCUS_61960 6532072 6531182 CDS product glycolipid sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898849.1 protein_id gnl|my_center|LOCUS_61960 6532260 6532727 gene locus_tag LOCUS_61970 6532260 6532727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 6533520 6532786 gene locus_tag LOCUS_61980 6533520 6532786 CDS product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 protein_id gnl|my_center|LOCUS_61980 6533611 6534768 gene locus_tag LOCUS_61990 6533611 6534768 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230387.1 protein_id gnl|my_center|LOCUS_61990 6536803 6534728 gene locus_tag LOCUS_62000 6536803 6534728 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 protein_id gnl|my_center|LOCUS_62000 6536954 6537442 gene locus_tag LOCUS_62010 6536954 6537442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 6537524 6537991 gene locus_tag LOCUS_62020 6537524 6537991 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925634.1 protein_id gnl|my_center|LOCUS_62020 6538028 6538495 gene locus_tag LOCUS_62030 6538028 6538495 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143451.1 protein_id gnl|my_center|LOCUS_62030 6538871 6538500 gene locus_tag LOCUS_62040 6538871 6538500 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 protein_id gnl|my_center|LOCUS_62040 6540292 6538919 gene locus_tag LOCUS_62050 6540292 6538919 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_62050 6540560 6541027 gene locus_tag LOCUS_62060 6540560 6541027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62060 6542181 6541024 gene locus_tag LOCUS_62070 6542181 6541024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 6542294 6542857 gene locus_tag LOCUS_62080 6542294 6542857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 6543754 6542921 gene locus_tag LOCUS_62090 6543754 6542921 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_62090 6543812 6544780 gene locus_tag LOCUS_62100 6543812 6544780 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030927.1 protein_id gnl|my_center|LOCUS_62100 6545426 6544764 gene locus_tag LOCUS_62110 6545426 6544764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 6545981 6545481 gene locus_tag LOCUS_62120 6545981 6545481 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055566559.1 protein_id gnl|my_center|LOCUS_62120 6547174 6546035 gene locus_tag LOCUS_62130 6547174 6546035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 6547618 6547184 gene locus_tag LOCUS_62140 6547618 6547184 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229412.1 protein_id gnl|my_center|LOCUS_62140 6549164 6547656 gene locus_tag LOCUS_62150 6549164 6547656 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031707.1 protein_id gnl|my_center|LOCUS_62150 6550594 6549323 gene locus_tag LOCUS_62160 6550594 6549323 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027328.1 protein_id gnl|my_center|LOCUS_62160 6551114 6550710 gene locus_tag LOCUS_62170 6551114 6550710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 6551375 6551596 gene locus_tag LOCUS_62180 6551375 6551596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 6552661 6551642 gene locus_tag LOCUS_62190 6552661 6551642 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_62190 6552753 6553334 gene locus_tag LOCUS_62200 6552753 6553334 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_62200 6554193 6553348 gene locus_tag LOCUS_62210 6554193 6553348 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230706.1 protein_id gnl|my_center|LOCUS_62210 6555763 6554288 gene locus_tag LOCUS_62220 6555763 6554288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 6556264 6555848 gene locus_tag LOCUS_62230 6556264 6555848 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226161.1 protein_id gnl|my_center|LOCUS_62230 6556862 6556377 gene locus_tag LOCUS_62240 6556862 6556377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 6557325 6557053 gene locus_tag LOCUS_62250 6557325 6557053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62250 6557999 6557595 gene locus_tag LOCUS_62260 6557999 6557595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 6558126 6558407 gene locus_tag LOCUS_62270 6558126 6558407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 6559369 6558404 gene locus_tag LOCUS_62280 6559369 6558404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 6560272 6559430 gene locus_tag LOCUS_62290 6560272 6559430 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727631.1 protein_id gnl|my_center|LOCUS_62290 6561204 6560278 gene locus_tag LOCUS_62300 6561204 6560278 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 protein_id gnl|my_center|LOCUS_62300 6562310 6561201 gene locus_tag LOCUS_62310 gene nagA 6562310 6561201 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_62310 6563215 6562307 gene locus_tag LOCUS_62320 6563215 6562307 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 protein_id gnl|my_center|LOCUS_62320 6564081 6563212 gene locus_tag LOCUS_62330 6564081 6563212 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_62330 6564214 6564999 gene locus_tag LOCUS_62340 6564214 6564999 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_62340 6567662 6566202 gene locus_tag LOCUS_62350 6567662 6566202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 6568284 6567775 gene locus_tag LOCUS_62360 6568284 6567775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62360 6568799 6568290 gene locus_tag LOCUS_62370 gene folK 6568799 6568290 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897502.1 protein_id gnl|my_center|LOCUS_62370 6569167 6568796 gene locus_tag LOCUS_62380 gene folB 6569167 6568796 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230465.1 protein_id gnl|my_center|LOCUS_62380 6570080 6569205 gene locus_tag LOCUS_62390 gene folP 6570080 6569205 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_62390 6571049 6570219 gene locus_tag LOCUS_62400 6571049 6570219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 6571859 6571455 gene locus_tag LOCUS_62410 6571859 6571455 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_62410 6572068 6573174 gene locus_tag LOCUS_62420 6572068 6573174 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978774.1 protein_id gnl|my_center|LOCUS_62420 6573171 6573764 gene locus_tag LOCUS_62430 6573171 6573764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 6574782 6573784 gene locus_tag LOCUS_62440 6574782 6573784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 6575658 6574825 gene locus_tag LOCUS_62450 6575658 6574825 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224356.1 protein_id gnl|my_center|LOCUS_62450 6576162 6577586 gene locus_tag LOCUS_62460 6576162 6577586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 6578119 6577640 gene locus_tag LOCUS_62470 6578119 6577640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 6579857 6578205 gene locus_tag LOCUS_62480 6579857 6578205 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_62480 6580435 6579827 gene locus_tag LOCUS_62490 6580435 6579827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 6581721 6580420 gene locus_tag LOCUS_62500 6581721 6580420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62500 6581904 6582416 gene locus_tag LOCUS_62510 6581904 6582416 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230477.1 protein_id gnl|my_center|LOCUS_62510 6582494 6583333 gene locus_tag LOCUS_62520 6582494 6583333 CDS product phospholipid scramblase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223563.1 protein_id gnl|my_center|LOCUS_62520 6584941 6583334 gene locus_tag LOCUS_62530 6584941 6583334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 6585523 6584987 gene locus_tag LOCUS_62540 6585523 6584987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 6585673 6585748 gene locus_tag LOCUS_t00510 6585673 6585748 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6585847 6587391 gene locus_tag LOCUS_62550 6585847 6587391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62550 6587930 6588397 gene locus_tag LOCUS_62560 6587930 6588397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 6589002 6588394 gene locus_tag LOCUS_62570 6589002 6588394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 6590090 6589053 gene locus_tag LOCUS_62580 6590090 6589053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 6591218 6590145 gene locus_tag LOCUS_62590 6591218 6590145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 6591370 6591612 gene locus_tag LOCUS_62600 6591370 6591612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 6593163 6591619 gene locus_tag LOCUS_62610 6593163 6591619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 6593554 6593153 gene locus_tag LOCUS_62620 6593554 6593153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 6594549 6594190 gene locus_tag LOCUS_62630 6594549 6594190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 6594844 6594542 gene locus_tag LOCUS_62640 6594844 6594542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 6595934 6594912 gene locus_tag LOCUS_62650 6595934 6594912 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 protein_id gnl|my_center|LOCUS_62650 6597202 6595946 gene locus_tag LOCUS_62660 6597202 6595946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 6597817 6597401 gene locus_tag LOCUS_62670 6597817 6597401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 6598178 6598534 gene locus_tag LOCUS_62680 6598178 6598534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62680 6598534 6598989 gene locus_tag LOCUS_62690 6598534 6598989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62690 6598986 6599471 gene locus_tag LOCUS_62700 6598986 6599471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 6599468 6599872 gene locus_tag LOCUS_62710 6599468 6599872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 6599869 6600099 gene locus_tag LOCUS_62720 6599869 6600099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 6600133 6600564 gene locus_tag LOCUS_62730 6600133 6600564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 6600594 6600962 gene locus_tag LOCUS_62740 6600594 6600962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 6600997 6602229 gene locus_tag LOCUS_62750 6600997 6602229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 6602229 6602498 gene locus_tag LOCUS_62760 6602229 6602498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 6602495 6603058 gene locus_tag LOCUS_62770 6602495 6603058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62770 6603086 6603469 gene locus_tag LOCUS_62780 6603086 6603469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 6603476 6604987 gene locus_tag LOCUS_62790 6603476 6604987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 6605057 6607183 gene locus_tag LOCUS_62800 6605057 6607183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 6607217 6607399 gene locus_tag LOCUS_62810 6607217 6607399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 6607512 6607838 gene locus_tag LOCUS_62820 6607512 6607838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 6607919 6608401 gene locus_tag LOCUS_62830 6607919 6608401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 6608394 6608672 gene locus_tag LOCUS_62840 6608394 6608672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 6608707 6608985 gene locus_tag LOCUS_62850 6608707 6608985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 6609106 6609471 gene locus_tag LOCUS_62860 6609106 6609471 CDS product DUF4326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076534005.1 protein_id gnl|my_center|LOCUS_62860 6609458 6610783 gene locus_tag LOCUS_62870 gene dnaB 6609458 6610783 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082792.1 protein_id gnl|my_center|LOCUS_62870 6610801 6611793 gene locus_tag LOCUS_62880 6610801 6611793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 6611825 6612004 gene locus_tag LOCUS_62890 6611825 6612004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 6612001 6613659 gene locus_tag LOCUS_62900 6612001 6613659 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222300.1 protein_id gnl|my_center|LOCUS_62900 6613656 6614657 gene locus_tag LOCUS_62910 6613656 6614657 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861113.1 protein_id gnl|my_center|LOCUS_62910 6614722 6615309 gene locus_tag LOCUS_62920 6614722 6615309 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227956.1 protein_id gnl|my_center|LOCUS_62920 6615479 6616243 gene locus_tag LOCUS_62930 6615479 6616243 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_62930 6617305 6616220 gene locus_tag LOCUS_62940 6617305 6616220 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899456.1 protein_id gnl|my_center|LOCUS_62940 6617385 6617648 gene locus_tag LOCUS_62950 6617385 6617648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 6618042 6617785 gene locus_tag LOCUS_62960 6618042 6617785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62960 6618463 6620058 gene locus_tag LOCUS_62970 6618463 6620058 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_62970 6620465 6620061 gene locus_tag LOCUS_62980 6620465 6620061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 6620519 6621175 gene locus_tag LOCUS_62990 6620519 6621175 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730269.1 protein_id gnl|my_center|LOCUS_62990 6622169 6621153 gene locus_tag LOCUS_63000 6622169 6621153 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976006.1 protein_id gnl|my_center|LOCUS_63000 6623673 6622282 gene locus_tag LOCUS_63010 6623673 6622282 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_63010 6624524 6623670 gene locus_tag LOCUS_63020 6624524 6623670 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_63020 6625450 6624521 gene locus_tag LOCUS_63030 6625450 6624521 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_63030 6626748 6625447 gene locus_tag LOCUS_63040 6626748 6625447 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229857.1 protein_id gnl|my_center|LOCUS_63040 6628194 6627019 gene locus_tag LOCUS_63050 gene aztD 6628194 6627019 CDS product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027144.1 protein_id gnl|my_center|LOCUS_63050 6629155 6628241 gene locus_tag LOCUS_63060 gene aztC 6629155 6628241 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027145.1 protein_id gnl|my_center|LOCUS_63060 6630300 6629161 gene locus_tag LOCUS_63070 6630300 6629161 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027146.1 protein_id gnl|my_center|LOCUS_63070 6631175 6630297 gene locus_tag LOCUS_63080 gene aztB 6631175 6630297 CDS product zinc ABC transporter permease AztB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 protein_id gnl|my_center|LOCUS_63080 6631225 6632019 gene locus_tag LOCUS_63090 gene aztA 6631225 6632019 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027147.1 protein_id gnl|my_center|LOCUS_63090 6632745 6632032 gene locus_tag LOCUS_63100 6632745 6632032 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974777.1 protein_id gnl|my_center|LOCUS_63100 6632822 6634576 gene locus_tag LOCUS_63110 6632822 6634576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_63110 6634573 6636369 gene locus_tag LOCUS_63120 6634573 6636369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_63120 6637180 6636398 gene locus_tag LOCUS_63130 6637180 6636398 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776254.1 protein_id gnl|my_center|LOCUS_63130 6637536 6637207 gene locus_tag LOCUS_63140 6637536 6637207 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068923899.1 protein_id gnl|my_center|LOCUS_63140 6637957 6637526 gene locus_tag LOCUS_63150 6637957 6637526 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400553.1 protein_id gnl|my_center|LOCUS_63150 6638134 6639318 gene locus_tag LOCUS_63160 6638134 6639318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 6639438 6639719 gene locus_tag LOCUS_63170 6639438 6639719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 6639716 6640942 gene locus_tag LOCUS_63180 6639716 6640942 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014221.1 protein_id gnl|my_center|LOCUS_63180 6641875 6640991 gene locus_tag LOCUS_63190 6641875 6640991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_63190 6642848 6641862 gene locus_tag LOCUS_63200 6642848 6641862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_63200 6643822 6642848 gene locus_tag LOCUS_63210 6643822 6642848 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 protein_id gnl|my_center|LOCUS_63210 6644112 6645761 gene locus_tag LOCUS_63220 6644112 6645761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 6646525 6645917 gene locus_tag LOCUS_63230 6646525 6645917 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 protein_id gnl|my_center|LOCUS_63230 6646694 6647479 gene locus_tag LOCUS_63240 6646694 6647479 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_63240 6647494 6647739 gene locus_tag LOCUS_63250 6647494 6647739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 6648392 6647622 gene locus_tag LOCUS_63260 6648392 6647622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 6648464 6649630 gene locus_tag LOCUS_63270 gene amrS 6648464 6649630 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_63270 6649635 6650399 gene locus_tag LOCUS_63280 gene amrB 6649635 6650399 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_63280 6650775 6650581 gene locus_tag LOCUS_63290 6650775 6650581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 6650824 6651615 gene locus_tag LOCUS_63300 6650824 6651615 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727800.1 protein_id gnl|my_center|LOCUS_63300 6651682 6653187 gene locus_tag LOCUS_63310 gene lysS 6651682 6653187 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_63310 6653340 6653705 gene locus_tag LOCUS_63320 6653340 6653705 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_63320 6654060 6656561 gene locus_tag LOCUS_63330 6654060 6656561 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_63330 6657721 6656765 gene locus_tag LOCUS_63340 6657721 6656765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 6658179 6659393 gene locus_tag LOCUS_63350 6658179 6659393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 6660145 6659390 gene locus_tag LOCUS_63360 6660145 6659390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 6660318 6660686 gene locus_tag LOCUS_63370 6660318 6660686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 6661801 6660671 gene locus_tag LOCUS_63380 6661801 6660671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 6664075 6662903 gene locus_tag LOCUS_63390 6664075 6662903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 6664958 6664155 gene locus_tag LOCUS_63400 6664958 6664155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 6665693 6665076 gene locus_tag LOCUS_63410 6665693 6665076 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104413.1 protein_id gnl|my_center|LOCUS_63410 6666955 6665693 gene locus_tag LOCUS_63420 6666955 6665693 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_63420 6667883 6666987 gene locus_tag LOCUS_63430 gene galU 6667883 6666987 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_63430 6670003 6667955 gene locus_tag LOCUS_63440 6670003 6667955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 6670236 6670736 gene locus_tag LOCUS_63450 6670236 6670736 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_63450 6670853 6671179 gene locus_tag LOCUS_63460 6670853 6671179 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230041.1 protein_id gnl|my_center|LOCUS_63460 6673124 6671301 gene locus_tag LOCUS_63470 6673124 6671301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63470 6673683 6673207 gene locus_tag LOCUS_63480 6673683 6673207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 6674600 6673749 gene locus_tag LOCUS_63490 6674600 6673749 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 protein_id gnl|my_center|LOCUS_63490 6675640 6674597 gene locus_tag LOCUS_63500 6675640 6674597 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_63500 6676579 6675686 gene locus_tag LOCUS_63510 6676579 6675686 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_63510 6677823 6676843 gene locus_tag LOCUS_63520 6677823 6676843 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804931.1 protein_id gnl|my_center|LOCUS_63520 6678061 6678522 gene locus_tag LOCUS_63530 gene moaC 6678061 6678522 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230248.1 protein_id gnl|my_center|LOCUS_63530 6678507 6678992 gene locus_tag LOCUS_63540 6678507 6678992 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878425.1 protein_id gnl|my_center|LOCUS_63540 6679005 6680192 gene locus_tag LOCUS_63550 6679005 6680192 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_63550 6680189 6680602 gene locus_tag LOCUS_63560 6680189 6680602 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730722.1 protein_id gnl|my_center|LOCUS_63560 6680610 6680852 gene locus_tag LOCUS_63570 6680610 6680852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 6681243 6682388 gene locus_tag LOCUS_63580 6681243 6682388 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031650.1 protein_id gnl|my_center|LOCUS_63580 6682805 6682395 gene locus_tag LOCUS_63590 6682805 6682395 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_63590 6683253 6682816 gene locus_tag LOCUS_63600 6683253 6682816 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_63600 6683286 6683963 gene locus_tag LOCUS_63610 6683286 6683963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63610 6686278 6683960 gene locus_tag LOCUS_63620 6686278 6683960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 6686720 6689023 gene locus_tag LOCUS_63630 6686720 6689023 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_63630 6689037 6690830 gene locus_tag LOCUS_63640 6689037 6690830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 6690895 6691530 gene locus_tag LOCUS_63650 6690895 6691530 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192970.1 protein_id gnl|my_center|LOCUS_63650 6691527 6692333 gene locus_tag LOCUS_63660 6691527 6692333 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192322.1 protein_id gnl|my_center|LOCUS_63660 6695665 6692591 gene locus_tag LOCUS_63670 6695665 6692591 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_63670 6695757 6696140 gene locus_tag LOCUS_63680 6695757 6696140 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028745.1 protein_id gnl|my_center|LOCUS_63680 6696189 6697094 gene locus_tag LOCUS_63690 6696189 6697094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63690 6698594 6697980 gene locus_tag LOCUS_63700 6698594 6697980 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230112.1 protein_id gnl|my_center|LOCUS_63700 6699494 6698730 gene locus_tag LOCUS_63710 6699494 6698730 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230111.1 protein_id gnl|my_center|LOCUS_63710 6700769 6699510 gene locus_tag LOCUS_63720 6700769 6699510 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_63720 6700932 6701630 gene locus_tag LOCUS_63730 6700932 6701630 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230108.1 protein_id gnl|my_center|LOCUS_63730 6702254 6701694 gene locus_tag LOCUS_63740 6702254 6701694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 6703513 6702500 gene locus_tag LOCUS_63750 6703513 6702500 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976978.1 protein_id gnl|my_center|LOCUS_63750 6703569 6705047 gene locus_tag LOCUS_63760 6703569 6705047 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_63760 6706041 6705034 gene locus_tag LOCUS_63770 6706041 6705034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63770 6707290 6706148 gene locus_tag LOCUS_63780 6707290 6706148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63780 6709190 6707376 gene locus_tag LOCUS_63790 6709190 6707376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 6709849 6709346 gene locus_tag LOCUS_63800 gene soxR 6709849 6709346 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 protein_id gnl|my_center|LOCUS_63800 6709848 6710519 gene locus_tag LOCUS_63810 6709848 6710519 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_63810 6710525 6711448 gene locus_tag LOCUS_63820 6710525 6711448 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_63820 6712290 6711523 gene locus_tag LOCUS_63830 6712290 6711523 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_63830 6713062 6712667 gene locus_tag LOCUS_63840 6713062 6712667 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_63840 6713460 6713059 gene locus_tag LOCUS_63850 6713460 6713059 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_63850 6713638 6713468 gene locus_tag LOCUS_63860 gene rpmG 6713638 6713468 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_63860 6713845 6713772 gene locus_tag LOCUS_t00520 6713845 6713772 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6713957 6713884 gene locus_tag LOCUS_t00530 6713957 6713884 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6716550 6714028 gene locus_tag LOCUS_63870 6716550 6714028 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222516.1 protein_id gnl|my_center|LOCUS_63870 6717053 6717862 gene locus_tag LOCUS_63880 6717053 6717862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 6719826 6717913 gene locus_tag LOCUS_63890 6719826 6717913 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031541.1 protein_id gnl|my_center|LOCUS_63890 6720668 6719922 gene locus_tag LOCUS_63900 6720668 6719922 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 protein_id gnl|my_center|LOCUS_63900 6721532 6720699 gene locus_tag LOCUS_63910 6721532 6720699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 6721414 6721734 gene locus_tag LOCUS_63920 6721414 6721734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63920 6721765 6722475 gene locus_tag LOCUS_63930 gene glnR 6721765 6722475 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_63930 6722498 6722899 gene locus_tag LOCUS_63940 6722498 6722899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 6722899 6726039 gene locus_tag LOCUS_63950 6722899 6726039 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_63950 6726766 6726023 gene locus_tag LOCUS_63960 6726766 6726023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221978.1 protein_id gnl|my_center|LOCUS_63960 6727704 6726763 gene locus_tag LOCUS_63970 6727704 6726763 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_63970 6728694 6727774 gene locus_tag LOCUS_63980 gene mshD 6728694 6727774 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_63980 6730781 6728901 gene locus_tag LOCUS_63990 6730781 6728901 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027279.1 protein_id gnl|my_center|LOCUS_63990 6730952 6731641 gene locus_tag LOCUS_64000 6730952 6731641 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_64000 6731673 6732080 gene locus_tag LOCUS_64010 6731673 6732080 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971536.1 protein_id gnl|my_center|LOCUS_64010 6732186 6732815 gene locus_tag LOCUS_64020 6732186 6732815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64020 6733293 6732871 gene locus_tag LOCUS_64030 6733293 6732871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64030 6734959 6733316 gene locus_tag LOCUS_64040 6734959 6733316 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_64040 6736067 6735009 gene locus_tag LOCUS_64050 6736067 6735009 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973639.1 protein_id gnl|my_center|LOCUS_64050 6737213 6736233 gene locus_tag LOCUS_64060 6737213 6736233 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486597.1 protein_id gnl|my_center|LOCUS_64060 6738566 6737418 gene locus_tag LOCUS_64070 6738566 6737418 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804560.1 protein_id gnl|my_center|LOCUS_64070 6740203 6738635 gene locus_tag LOCUS_64080 6740203 6738635 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_64080 6741745 6740297 gene locus_tag LOCUS_64090 6741745 6740297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 6741852 6742955 gene locus_tag LOCUS_64100 6741852 6742955 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 protein_id gnl|my_center|LOCUS_64100 6744190 6742922 gene locus_tag LOCUS_64110 6744190 6742922 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222495.1 protein_id gnl|my_center|LOCUS_64110 6744894 6744187 gene locus_tag LOCUS_64120 6744894 6744187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 6744975 6745427 gene locus_tag LOCUS_64130 6744975 6745427 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486342.1 protein_id gnl|my_center|LOCUS_64130 6745775 6747100 gene locus_tag LOCUS_64140 6745775 6747100 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_64140 6748030 6747122 gene locus_tag LOCUS_64150 6748030 6747122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64150 6748592 6748071 gene locus_tag LOCUS_64160 6748592 6748071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64160 6748856 6749263 gene locus_tag LOCUS_64170 6748856 6749263 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_64170 6750629 6749337 gene locus_tag LOCUS_64180 6750629 6749337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 6750799 6751593 gene locus_tag LOCUS_64190 6750799 6751593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222384.1 protein_id gnl|my_center|LOCUS_64190 6751688 6752014 gene locus_tag LOCUS_64200 6751688 6752014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 6752250 6752672 gene locus_tag LOCUS_64210 gene arfB 6752250 6752672 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_64210 6753598 6752681 gene locus_tag LOCUS_64220 gene pheA 6753598 6752681 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222131.1 protein_id gnl|my_center|LOCUS_64220 6754049 6753621 gene locus_tag LOCUS_64230 6754049 6753621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 6755172 6754165 gene locus_tag LOCUS_64240 6755172 6754165 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777114.1 protein_id gnl|my_center|LOCUS_64240 6756527 6755169 gene locus_tag LOCUS_64250 6756527 6755169 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_64250 6758840 6756564 gene locus_tag LOCUS_64260 gene purL 6758840 6756564 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730824.1 protein_id gnl|my_center|LOCUS_64260 6759517 6758837 gene locus_tag LOCUS_64270 gene purQ 6759517 6758837 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_64270 6759792 6759517 gene locus_tag LOCUS_64280 gene purS 6759792 6759517 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_64280 6761351 6759933 gene locus_tag LOCUS_64290 gene purB 6761351 6759933 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_64290 6763182 6761425 gene locus_tag LOCUS_64300 6763182 6761425 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972257.1 protein_id gnl|my_center|LOCUS_64300 6764021 6763728 gene locus_tag LOCUS_64310 6764021 6763728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 6764165 6765538 gene locus_tag LOCUS_64320 6764165 6765538 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_64320 6767705 6765528 gene locus_tag LOCUS_64330 6767705 6765528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222074.1 protein_id gnl|my_center|LOCUS_64330 6768478 6767702 gene locus_tag LOCUS_64340 6768478 6767702 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_64340 6768769 6769659 gene locus_tag LOCUS_64350 6768769 6769659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 6769774 6771294 gene locus_tag LOCUS_64360 6769774 6771294 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886744.1 protein_id gnl|my_center|LOCUS_64360 6771321 6772475 gene locus_tag LOCUS_64370 6771321 6772475 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976021.1 protein_id gnl|my_center|LOCUS_64370 6773354 6772503 gene locus_tag LOCUS_64380 6773354 6772503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 6773886 6773518 gene locus_tag LOCUS_64390 6773886 6773518 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112711.1 protein_id gnl|my_center|LOCUS_64390 6774530 6774006 gene locus_tag LOCUS_64400 gene pyrE 6774530 6774006 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085722.1 protein_id gnl|my_center|LOCUS_64400 6775422 6774643 gene locus_tag LOCUS_64410 6775422 6774643 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_64410 6776236 6775478 gene locus_tag LOCUS_64420 6776236 6775478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 6776926 6776246 gene locus_tag LOCUS_64430 6776926 6776246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 6777769 6776996 gene locus_tag LOCUS_64440 6777769 6776996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 6778100 6778444 gene locus_tag LOCUS_64450 6778100 6778444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 6778450 6778914 gene locus_tag LOCUS_64460 6778450 6778914 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_64460 6779872 6778919 gene locus_tag LOCUS_64470 6779872 6778919 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_64470 6781113 6779869 gene locus_tag LOCUS_64480 6781113 6779869 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_64480 6781289 6781834 gene locus_tag LOCUS_64490 6781289 6781834 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_64490 6781869 6782189 gene locus_tag LOCUS_64500 6781869 6782189 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222326.1 protein_id gnl|my_center|LOCUS_64500 6782566 6782246 gene locus_tag LOCUS_64510 gene trxA 6782566 6782246 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_64510 6783522 6782590 gene locus_tag LOCUS_64520 gene trxB 6783522 6782590 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_64520 6784364 6783627 gene locus_tag LOCUS_64530 6784364 6783627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 6784999 6784361 gene locus_tag LOCUS_64540 gene sigM 6784999 6784361 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_64540 6786444 6785011 gene locus_tag LOCUS_64550 6786444 6785011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 6788259 6786634 gene locus_tag LOCUS_64560 6788259 6786634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 6788365 6789747 gene locus_tag LOCUS_64570 6788365 6789747 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400120.1 protein_id gnl|my_center|LOCUS_64570 6789819 6790334 gene locus_tag LOCUS_64580 6789819 6790334 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_64580 6790437 6792479 gene locus_tag LOCUS_64590 6790437 6792479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 6793315 6792476 gene locus_tag LOCUS_64600 6793315 6792476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 6793518 6794453 gene locus_tag LOCUS_64610 6793518 6794453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 6794559 6796394 gene locus_tag LOCUS_64620 6794559 6796394 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731217.1 protein_id gnl|my_center|LOCUS_64620 6796426 6796848 gene locus_tag LOCUS_64630 6796426 6796848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030827.1 protein_id gnl|my_center|LOCUS_64630 6796889 6797431 gene locus_tag LOCUS_64640 6796889 6797431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64640 6797572 6797952 gene locus_tag LOCUS_64650 6797572 6797952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64650 6797953 6798162 gene locus_tag LOCUS_64660 6797953 6798162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 6798832 6799782 gene locus_tag LOCUS_64670 6798832 6799782 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731487.1 protein_id gnl|my_center|LOCUS_64670 6800259 6799831 gene locus_tag LOCUS_64680 6800259 6799831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64680 6800313 6801518 gene locus_tag LOCUS_64690 gene arcA 6800313 6801518 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082883.1 protein_id gnl|my_center|LOCUS_64690 6801762 6802514 gene locus_tag LOCUS_64700 6801762 6802514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 6802511 6802990 gene locus_tag LOCUS_64710 6802511 6802990 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222237.1 protein_id gnl|my_center|LOCUS_64710 6803277 6802987 gene locus_tag LOCUS_64720 6803277 6802987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64720 6803421 6803999 gene locus_tag LOCUS_64730 6803421 6803999 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467889.1 protein_id gnl|my_center|LOCUS_64730 6804790 6803996 gene locus_tag LOCUS_64740 6804790 6803996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 6804866 6806098 gene locus_tag LOCUS_64750 6804866 6806098 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112960.1 protein_id gnl|my_center|LOCUS_64750 6807748 6806159 gene locus_tag LOCUS_64760 gene ambL 6807748 6806159 CDS product aminobenozate:CoA ligase AmbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485583.1 protein_id gnl|my_center|LOCUS_64760 6807857 6808639 gene locus_tag LOCUS_64770 6807857 6808639 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230091.1 protein_id gnl|my_center|LOCUS_64770 6809637 6808708 gene locus_tag LOCUS_64780 6809637 6808708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64780 6810392 6809634 gene locus_tag LOCUS_64790 6810392 6809634 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_64790 6810509 6813103 gene locus_tag LOCUS_64800 gene clpB 6810509 6813103 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230863.1 protein_id gnl|my_center|LOCUS_64800 6814685 6813603 gene locus_tag LOCUS_64810 6814685 6813603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64810 6815884 6814682 gene locus_tag LOCUS_64820 gene larC 6815884 6814682 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015146.1 protein_id gnl|my_center|LOCUS_64820 6816461 6816027 gene locus_tag LOCUS_64830 6816461 6816027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 6817240 6816458 gene locus_tag LOCUS_64840 gene larB 6817240 6816458 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_64840 6817305 6818018 gene locus_tag LOCUS_64850 6817305 6818018 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_64850 6818221 6818715 gene locus_tag LOCUS_64860 6818221 6818715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 6818712 6819599 gene locus_tag LOCUS_64870 6818712 6819599 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_64870 6819662 6820888 gene locus_tag LOCUS_64880 6819662 6820888 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030387.1 protein_id gnl|my_center|LOCUS_64880 6820950 6821330 gene locus_tag LOCUS_64890 6820950 6821330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64890 6822614 6821394 gene locus_tag LOCUS_64900 6822614 6821394 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222108.1 protein_id gnl|my_center|LOCUS_64900 6821517 6821604 gene locus_tag LOCUS_t00540 6821517 6821604 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6822707 6823528 gene locus_tag LOCUS_64910 6822707 6823528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 protein_id gnl|my_center|LOCUS_64910 6823534 6824748 gene locus_tag LOCUS_64920 gene fahA 6823534 6824748 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 protein_id gnl|my_center|LOCUS_64920 6826638 6824797 gene locus_tag LOCUS_64930 gene pknB 6826638 6824797 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_64930 6828162 6826672 gene locus_tag LOCUS_64940 6828162 6826672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 6829711 6828233 gene locus_tag LOCUS_64950 6829711 6828233 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222005.1 protein_id gnl|my_center|LOCUS_64950 6831297 6829708 gene locus_tag LOCUS_64960 6831297 6829708 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_64960 6832700 6831309 gene locus_tag LOCUS_64970 6832700 6831309 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082863.1 protein_id gnl|my_center|LOCUS_64970 6833173 6832697 gene locus_tag LOCUS_64980 6833173 6832697 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003079002.1 protein_id gnl|my_center|LOCUS_64980 6833970 6833230 gene locus_tag LOCUS_64990 6833970 6833230 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392424.1 protein_id gnl|my_center|LOCUS_64990 6834294 6834377 gene locus_tag LOCUS_t00550 6834294 6834377 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6834441 6834517 gene locus_tag LOCUS_t00560 6834441 6834517 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6835122 6834574 gene locus_tag LOCUS_65000 6835122 6834574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 6835825 6835268 gene locus_tag LOCUS_65010 6835825 6835268 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 protein_id gnl|my_center|LOCUS_65010 6836964 6835888 gene locus_tag LOCUS_65020 6836964 6835888 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_65020 6837890 6836964 gene locus_tag LOCUS_65030 6837890 6836964 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225439919.1 protein_id gnl|my_center|LOCUS_65030 6838763 6838122 gene locus_tag LOCUS_65040 gene rsmG 6838763 6838122 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130546.1 protein_id gnl|my_center|LOCUS_65040 6839124 6838774 gene locus_tag LOCUS_65050 6839124 6838774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 6839014 6839277 gene locus_tag LOCUS_65060 6839014 6839277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 6840388 6839288 gene locus_tag LOCUS_65070 6840388 6839288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 6840926 6840657 gene locus_tag LOCUS_65080 6840926 6840657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 6841168 6841031 gene locus_tag LOCUS_65090 gene rpmH 6841168 6841031 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 protein_id gnl|my_center|LOCUS_65090