>Feature sequence1 85 1455 gene locus_tag LOCUS_00010 gene dnaA 85 1455 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255915.1 protein_id gnl|my_center|LOCUS_00010 1468 2256 gene locus_tag LOCUS_00020 1468 2256 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_00020 2349 3311 gene locus_tag LOCUS_00030 2349 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3796 3308 gene locus_tag LOCUS_00040 gene coaD 3796 3308 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_00040 3916 4698 gene locus_tag LOCUS_00050 3916 4698 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460373.1 protein_id gnl|my_center|LOCUS_00050 4723 6393 gene locus_tag LOCUS_00060 4723 6393 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_00060 7883 6390 gene locus_tag LOCUS_00070 gene lysS 7883 6390 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_00070 8368 7889 gene locus_tag LOCUS_00080 gene greA 8368 7889 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257112.1 protein_id gnl|my_center|LOCUS_00080 10581 8527 gene locus_tag LOCUS_00090 10581 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10710 11282 gene locus_tag LOCUS_00100 10710 11282 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_00100 11353 11622 gene locus_tag LOCUS_00110 11353 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11705 12451 gene locus_tag LOCUS_00120 gene fabG 11705 12451 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_00120 12472 13434 gene locus_tag LOCUS_00130 gene fabD 12472 13434 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258269.1 protein_id gnl|my_center|LOCUS_00130 13450 14691 gene locus_tag LOCUS_00140 gene fabF 13450 14691 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412652.1 protein_id gnl|my_center|LOCUS_00140 16133 14871 gene locus_tag LOCUS_00150 16133 14871 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_00150 17238 16288 gene locus_tag LOCUS_00160 17238 16288 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258060.1 protein_id gnl|my_center|LOCUS_00160 18696 17239 gene locus_tag LOCUS_00170 gene glmU 18696 17239 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_00170 18677 18886 gene locus_tag LOCUS_00180 18677 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18876 19841 gene locus_tag LOCUS_00190 18876 19841 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_00190 20545 19874 gene locus_tag LOCUS_00200 20545 19874 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_00200 21451 20558 gene locus_tag LOCUS_00210 21451 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22881 21634 gene locus_tag LOCUS_00220 gene fabF 22881 21634 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438103.1 protein_id gnl|my_center|LOCUS_00220 23338 22871 gene locus_tag LOCUS_00230 23338 22871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24563 23367 gene locus_tag LOCUS_00240 24563 23367 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_00240 25477 24584 gene locus_tag LOCUS_00250 25477 24584 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318575.1 protein_id gnl|my_center|LOCUS_00250 26640 25480 gene locus_tag LOCUS_00260 gene recF 26640 25480 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_00260 27081 26737 gene locus_tag LOCUS_00270 27081 26737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29099 27108 gene locus_tag LOCUS_00280 gene ispG 29099 27108 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986827.1 protein_id gnl|my_center|LOCUS_00280 29352 30197 gene locus_tag LOCUS_00290 gene thyX 29352 30197 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939529.1 protein_id gnl|my_center|LOCUS_00290 30405 30202 gene locus_tag LOCUS_00300 30405 30202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30764 30432 gene locus_tag LOCUS_00310 30764 30432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 30921 32183 gene locus_tag LOCUS_00320 30921 32183 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_00320 34319 32238 gene locus_tag LOCUS_00330 34319 32238 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_00330 34968 34408 gene locus_tag LOCUS_00340 gene hpt 34968 34408 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 protein_id gnl|my_center|LOCUS_00340 35135 35800 gene locus_tag LOCUS_00350 gene yqeC 35135 35800 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_00350 36427 35801 gene locus_tag LOCUS_00360 gene pdxT 36427 35801 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_00360 37332 36451 gene locus_tag LOCUS_00370 gene pdxS 37332 36451 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_00370 37541 38287 gene locus_tag LOCUS_00380 37541 38287 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403200.1 protein_id gnl|my_center|LOCUS_00380 38399 38956 gene locus_tag LOCUS_00390 gene cysC 38399 38956 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256588.1 protein_id gnl|my_center|LOCUS_00390 38994 40172 gene locus_tag LOCUS_00400 gene sat 38994 40172 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_00400 40228 41121 gene locus_tag LOCUS_00410 40228 41121 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027988.1 protein_id gnl|my_center|LOCUS_00410 41109 42176 gene locus_tag LOCUS_00420 41109 42176 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111816.1 protein_id gnl|my_center|LOCUS_00420 44989 42389 gene locus_tag LOCUS_00430 44989 42389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 46183 45176 gene locus_tag LOCUS_00440 gene tsaD 46183 45176 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_00440 46901 46206 gene locus_tag LOCUS_00450 gene rimI 46901 46206 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258576.1 protein_id gnl|my_center|LOCUS_00450 47622 46948 gene locus_tag LOCUS_00460 gene tsaB 47622 46948 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_00460 48147 47623 gene locus_tag LOCUS_00470 gene tsaE 48147 47623 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_00470 48272 48484 gene locus_tag LOCUS_00480 48272 48484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 48547 49023 gene locus_tag LOCUS_00490 gene nrdR 48547 49023 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565887.1 protein_id gnl|my_center|LOCUS_00490 49160 51595 gene locus_tag LOCUS_00500 49160 51595 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_00500 52013 51642 gene locus_tag LOCUS_00510 52013 51642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 52138 52377 gene locus_tag LOCUS_00520 52138 52377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 52894 54816 gene locus_tag LOCUS_00530 gene gyrB 52894 54816 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_00530 54946 55962 gene locus_tag LOCUS_00540 gene plsX 54946 55962 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_00540 55964 56734 gene locus_tag LOCUS_00550 55964 56734 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_00550 57312 58607 gene locus_tag LOCUS_00560 gene eno 57312 58607 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_00560 59530 59114 gene locus_tag LOCUS_00570 59530 59114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 61076 59592 gene locus_tag LOCUS_00580 gene gatA 61076 59592 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_00580 61362 61066 gene locus_tag LOCUS_00590 gene gatC 61362 61066 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257310.1 protein_id gnl|my_center|LOCUS_00590 62529 61408 gene locus_tag LOCUS_00600 62529 61408 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256594.1 protein_id gnl|my_center|LOCUS_00600 63580 62567 gene locus_tag LOCUS_00610 63580 62567 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_00610 64125 63703 gene locus_tag LOCUS_00620 64125 63703 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_00620 65623 64208 gene locus_tag LOCUS_00630 gene atpD 65623 64208 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_00630 66540 65665 gene locus_tag LOCUS_00640 66540 65665 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_00640 68131 66605 gene locus_tag LOCUS_00650 gene atpA 68131 66605 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_00650 68697 68158 gene locus_tag LOCUS_00660 gene atpH 68697 68158 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403676.1 protein_id gnl|my_center|LOCUS_00660 69217 68690 gene locus_tag LOCUS_00670 gene atpF 69217 68690 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699938.1 protein_id gnl|my_center|LOCUS_00670 69635 69324 gene locus_tag LOCUS_00680 69635 69324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 70535 69681 gene locus_tag LOCUS_00690 gene atpB 70535 69681 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768272.1 protein_id gnl|my_center|LOCUS_00690 72571 70892 gene locus_tag LOCUS_00700 72571 70892 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_00700 73238 72591 gene locus_tag LOCUS_00710 73238 72591 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_00710 74069 73308 gene locus_tag LOCUS_00720 74069 73308 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_00720 75096 74062 gene locus_tag LOCUS_00730 gene recA 75096 74062 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257243.1 protein_id gnl|my_center|LOCUS_00730 75320 75135 gene locus_tag LOCUS_00740 75320 75135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 75307 75729 gene locus_tag LOCUS_00750 75307 75729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 75821 77821 gene locus_tag LOCUS_00760 75821 77821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 79308 77824 gene locus_tag LOCUS_00770 gene gltX 79308 77824 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_00770 79436 80785 gene locus_tag LOCUS_00780 79436 80785 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508792.1 protein_id gnl|my_center|LOCUS_00780 80951 82498 gene locus_tag LOCUS_00790 gene secD 80951 82498 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258879.1 protein_id gnl|my_center|LOCUS_00790 82519 83472 gene locus_tag LOCUS_00800 gene secF 82519 83472 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_00800 83548 85662 gene locus_tag LOCUS_00810 83548 85662 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_00810 85876 87069 gene locus_tag LOCUS_00820 85876 87069 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_00820 87188 93910 gene locus_tag LOCUS_00830 87188 93910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 93938 94540 gene locus_tag LOCUS_00840 gene dcd 93938 94540 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061156.1 protein_id gnl|my_center|LOCUS_00840 95077 94586 gene locus_tag LOCUS_00850 95077 94586 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_00850 95189 95767 gene locus_tag LOCUS_00860 gene ruvA 95189 95767 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_00860 95778 96719 gene locus_tag LOCUS_00870 95778 96719 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_00870 97165 96716 gene locus_tag LOCUS_00880 gene ruvX 97165 96716 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141132.1 protein_id gnl|my_center|LOCUS_00880 99615 97174 gene locus_tag LOCUS_00890 gene alaS 99615 97174 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_00890 100139 101128 gene locus_tag LOCUS_00900 gene pdhA 100139 101128 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257841.1 protein_id gnl|my_center|LOCUS_00900 101129 102103 gene locus_tag LOCUS_00910 101129 102103 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_00910 102136 103377 gene locus_tag LOCUS_00920 102136 103377 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_00920 103429 104463 gene locus_tag LOCUS_00930 gene bfmBAA 103429 104463 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852548.1 protein_id gnl|my_center|LOCUS_00930 104464 105450 gene locus_tag LOCUS_00940 104464 105450 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257563.1 protein_id gnl|my_center|LOCUS_00940 105483 106745 gene locus_tag LOCUS_00950 105483 106745 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931696.1 protein_id gnl|my_center|LOCUS_00950 106758 107669 gene locus_tag LOCUS_00960 gene lipA 106758 107669 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166373.1 protein_id gnl|my_center|LOCUS_00960 107924 108373 gene locus_tag LOCUS_00970 107924 108373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 108455 109741 gene locus_tag LOCUS_00980 108455 109741 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259400.1 protein_id gnl|my_center|LOCUS_00980 111180 109849 gene locus_tag LOCUS_00990 111180 109849 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_00990 111270 113369 gene locus_tag LOCUS_01000 111270 113369 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_01000 113686 113393 gene locus_tag LOCUS_01010 113686 113393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 113952 114188 gene locus_tag LOCUS_01020 113952 114188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 115201 114191 gene locus_tag LOCUS_01030 gene dprA 115201 114191 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_01030 115384 116151 gene locus_tag LOCUS_01040 115384 116151 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_01040 116155 116487 gene locus_tag LOCUS_01050 116155 116487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 116484 117356 gene locus_tag LOCUS_01060 116484 117356 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_01060 117638 118735 gene locus_tag LOCUS_01070 gene aroA 117638 118735 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545275.1 protein_id gnl|my_center|LOCUS_01070 118739 119614 gene locus_tag LOCUS_01080 118739 119614 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 protein_id gnl|my_center|LOCUS_01080 119607 120761 gene locus_tag LOCUS_01090 gene aroC 119607 120761 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_01090 121084 120758 gene locus_tag LOCUS_01100 121084 120758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 121195 121530 gene locus_tag LOCUS_01110 121195 121530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 121535 121894 gene locus_tag LOCUS_01120 121535 121894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 122026 122511 gene locus_tag LOCUS_01130 gene tmung 122026 122511 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081422.1 protein_id gnl|my_center|LOCUS_01130 122578 122653 gene locus_tag LOCUS_t00010 122578 122653 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 122660 122745 gene locus_tag LOCUS_t00020 122660 122745 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 122933 123967 gene locus_tag LOCUS_01140 122933 123967 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257903.1 protein_id gnl|my_center|LOCUS_01140 124030 124833 gene locus_tag LOCUS_01150 124030 124833 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945998.1 protein_id gnl|my_center|LOCUS_01150 124912 126336 gene locus_tag LOCUS_01160 124912 126336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 126794 126345 gene locus_tag LOCUS_01170 126794 126345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 130315 129404 gene locus_tag LOCUS_01180 gene thrB 130315 129404 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_01180 131598 130312 gene locus_tag LOCUS_01190 gene thrC 131598 130312 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_01190 132155 131613 gene locus_tag LOCUS_01200 132155 131613 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807773.1 protein_id gnl|my_center|LOCUS_01200 133975 132185 gene locus_tag LOCUS_01210 gene thrS 133975 132185 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608336.1 protein_id gnl|my_center|LOCUS_01210 134750 134310 gene locus_tag LOCUS_01220 134750 134310 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_01220 134913 135194 gene locus_tag LOCUS_01230 134913 135194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 135988 135224 gene locus_tag LOCUS_01240 135988 135224 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975929.1 protein_id gnl|my_center|LOCUS_01240 136521 136099 gene locus_tag LOCUS_01250 136521 136099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 138507 137074 gene locus_tag LOCUS_01260 138507 137074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 138635 139672 gene locus_tag LOCUS_01270 138635 139672 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700809.1 protein_id gnl|my_center|LOCUS_01270 139745 140383 gene locus_tag LOCUS_01280 139745 140383 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_01280 140376 141392 gene locus_tag LOCUS_01290 140376 141392 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887570.1 protein_id gnl|my_center|LOCUS_01290 141836 142675 gene locus_tag LOCUS_01300 141836 142675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 143176 142760 gene locus_tag LOCUS_01310 143176 142760 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899923.1 protein_id gnl|my_center|LOCUS_01310 143444 143142 gene locus_tag LOCUS_01320 143444 143142 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_01320 144812 143445 gene locus_tag LOCUS_01330 gene gcvPA 144812 143445 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_01330 144937 145479 gene locus_tag LOCUS_01340 144937 145479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 146241 145483 gene locus_tag LOCUS_01350 146241 145483 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_01350 146862 146251 gene locus_tag LOCUS_01360 146862 146251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01360 146960 147280 gene locus_tag LOCUS_01370 146960 147280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 147834 149153 gene locus_tag LOCUS_01380 147834 149153 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969771.1 protein_id gnl|my_center|LOCUS_01380 149220 150176 gene locus_tag LOCUS_01390 gene pfkB 149220 150176 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_01390 150177 151241 gene locus_tag LOCUS_01400 150177 151241 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582768.1 protein_id gnl|my_center|LOCUS_01400 151234 152214 gene locus_tag LOCUS_01410 151234 152214 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061486.1 protein_id gnl|my_center|LOCUS_01410 152655 152221 gene locus_tag LOCUS_01420 152655 152221 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_01420 152885 152658 gene locus_tag LOCUS_01430 152885 152658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 153037 154203 gene locus_tag LOCUS_01440 gene cdaR 153037 154203 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 protein_id gnl|my_center|LOCUS_01440 154317 154913 gene locus_tag LOCUS_01450 gene gmhA 154317 154913 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566736.1 protein_id gnl|my_center|LOCUS_01450 154903 155517 gene locus_tag LOCUS_01460 gene gmhB 154903 155517 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_01460 155545 157032 gene locus_tag LOCUS_01470 gene rfaE1 155545 157032 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_01470 157035 158120 gene locus_tag LOCUS_01480 157035 158120 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226109.1 protein_id gnl|my_center|LOCUS_01480 158117 159163 gene locus_tag LOCUS_01490 158117 159163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 159182 160240 gene locus_tag LOCUS_01500 159182 160240 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188715.1 protein_id gnl|my_center|LOCUS_01500 160254 161198 gene locus_tag LOCUS_01510 160254 161198 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529463.1 protein_id gnl|my_center|LOCUS_01510 161198 162502 gene locus_tag LOCUS_01520 161198 162502 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523315.1 protein_id gnl|my_center|LOCUS_01520 162489 163232 gene locus_tag LOCUS_01530 162489 163232 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187868.1 protein_id gnl|my_center|LOCUS_01530 163262 164305 gene locus_tag LOCUS_01540 163262 164305 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_01540 164302 164919 gene locus_tag LOCUS_01550 164302 164919 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_01550 165097 166095 gene locus_tag LOCUS_01560 165097 166095 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972408.1 protein_id gnl|my_center|LOCUS_01560 166131 167321 gene locus_tag LOCUS_01570 166131 167321 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_01570 167414 168220 gene locus_tag LOCUS_01580 167414 168220 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929513.1 protein_id gnl|my_center|LOCUS_01580 168248 169600 gene locus_tag LOCUS_01590 168248 169600 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_01590 170251 171702 gene locus_tag LOCUS_01600 170251 171702 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_01600 171702 172967 gene locus_tag LOCUS_01610 171702 172967 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_01610 172968 174311 gene locus_tag LOCUS_01620 172968 174311 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_01620 174340 175530 gene locus_tag LOCUS_01630 174340 175530 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_01630 175546 176451 gene locus_tag LOCUS_01640 175546 176451 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_01640 176533 176458 gene locus_tag LOCUS_t00030 176533 176458 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 176576 177094 gene locus_tag LOCUS_01650 176576 177094 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_01650 177168 177686 gene locus_tag LOCUS_01660 177168 177686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 177683 178183 gene locus_tag LOCUS_01670 177683 178183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 179433 180560 gene locus_tag LOCUS_01680 gene rlmD 179433 180560 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_01680 180650 180576 gene locus_tag LOCUS_t00040 180650 180576 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 180769 180693 gene locus_tag LOCUS_t00050 180769 180693 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 181692 183632 gene locus_tag LOCUS_01690 gene ftsH 181692 183632 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030322.1 protein_id gnl|my_center|LOCUS_01690 184003 183644 gene locus_tag LOCUS_01700 184003 183644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 185419 184034 gene locus_tag LOCUS_01710 gene kaiC 185419 184034 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125574.1 protein_id gnl|my_center|LOCUS_01710 186165 185572 gene locus_tag LOCUS_01720 186165 185572 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 protein_id gnl|my_center|LOCUS_01720 187817 186231 gene locus_tag LOCUS_01730 gene metG 187817 186231 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_01730 189499 188243 gene locus_tag LOCUS_01740 189499 188243 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_01740 190748 189483 gene locus_tag LOCUS_01750 190748 189483 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_01750 191874 190870 gene locus_tag LOCUS_01760 gene aph(9)-Ia 191874 190870 CDS product aminoglycoside O-phosphotransferase APH(9)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947221.1 protein_id gnl|my_center|LOCUS_01760 192375 191896 gene locus_tag LOCUS_01770 192375 191896 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221050.1 protein_id gnl|my_center|LOCUS_01770 192521 194788 gene locus_tag LOCUS_01780 192521 194788 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_01780 194812 195408 gene locus_tag LOCUS_01790 194812 195408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 195622 196911 gene locus_tag LOCUS_01800 195622 196911 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258532.1 protein_id gnl|my_center|LOCUS_01800 196956 197948 gene locus_tag LOCUS_01810 196956 197948 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229175.1 protein_id gnl|my_center|LOCUS_01810 197953 198858 gene locus_tag LOCUS_01820 197953 198858 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_01820 199425 201155 gene locus_tag LOCUS_01830 gene ilvB 199425 201155 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256073.1 protein_id gnl|my_center|LOCUS_01830 201152 201676 gene locus_tag LOCUS_01840 gene ilvN 201152 201676 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_01840 201699 202706 gene locus_tag LOCUS_01850 gene ilvC 201699 202706 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_01850 202742 202885 gene locus_tag LOCUS_01860 202742 202885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 202895 204076 gene locus_tag LOCUS_01870 202895 204076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 204102 205070 gene locus_tag LOCUS_01880 204102 205070 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_01880 205133 206254 gene locus_tag LOCUS_01890 gene leuB 205133 206254 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399139.1 protein_id gnl|my_center|LOCUS_01890 206278 207876 gene locus_tag LOCUS_01900 gene cimA 206278 207876 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146979.1 protein_id gnl|my_center|LOCUS_01900 207908 209317 gene locus_tag LOCUS_01910 gene leuC 207908 209317 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 protein_id gnl|my_center|LOCUS_01910 209321 209914 gene locus_tag LOCUS_01920 gene leuD 209321 209914 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704393.1 protein_id gnl|my_center|LOCUS_01920 211692 209992 gene locus_tag LOCUS_01930 gene ilvD 211692 209992 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_01930 211854 212372 gene locus_tag LOCUS_01940 211854 212372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 212374 212868 gene locus_tag LOCUS_01950 212374 212868 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096670.1 protein_id gnl|my_center|LOCUS_01950 212889 213224 gene locus_tag LOCUS_01960 212889 213224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 213227 213412 gene locus_tag LOCUS_01970 213227 213412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 213495 214469 gene locus_tag LOCUS_01980 gene axeA 213495 214469 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_01980 214487 215431 gene locus_tag LOCUS_01990 214487 215431 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640552.1 protein_id gnl|my_center|LOCUS_01990 215582 217738 gene locus_tag LOCUS_02000 215582 217738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 217848 218909 gene locus_tag LOCUS_02010 217848 218909 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_02010 219918 219589 gene locus_tag LOCUS_02020 219918 219589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 221206 220361 gene locus_tag LOCUS_02030 221206 220361 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_02030 222210 221203 gene locus_tag LOCUS_02040 222210 221203 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584152.1 protein_id gnl|my_center|LOCUS_02040 223628 222264 gene locus_tag LOCUS_02050 223628 222264 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_02050 224645 223851 gene locus_tag LOCUS_02060 224645 223851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028332.1 protein_id gnl|my_center|LOCUS_02060 225640 224795 gene locus_tag LOCUS_02070 225640 224795 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066690.1 protein_id gnl|my_center|LOCUS_02070 228025 225659 gene locus_tag LOCUS_02080 228025 225659 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_02080 229555 228101 gene locus_tag LOCUS_02090 229555 228101 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_02090 230224 229685 gene locus_tag LOCUS_02100 230224 229685 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810481.1 protein_id gnl|my_center|LOCUS_02100 231664 230294 gene locus_tag LOCUS_02110 231664 230294 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_02110 232074 231685 gene locus_tag LOCUS_02120 232074 231685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 233466 232141 gene locus_tag LOCUS_02130 gene melA 233466 232141 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312416.1 protein_id gnl|my_center|LOCUS_02130 233613 234647 gene locus_tag LOCUS_02140 233613 234647 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_02140 234790 235332 gene locus_tag LOCUS_02150 234790 235332 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168139.1 protein_id gnl|my_center|LOCUS_02150 237258 235372 gene locus_tag LOCUS_02160 237258 235372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 237733 238794 gene locus_tag LOCUS_02170 237733 238794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 238823 240118 gene locus_tag LOCUS_02180 238823 240118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 240175 241359 gene locus_tag LOCUS_02190 240175 241359 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_02190 242695 241364 gene locus_tag LOCUS_02200 gene murA 242695 241364 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_02200 243116 242889 gene locus_tag LOCUS_02210 243116 242889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 244498 243530 gene locus_tag LOCUS_02220 244498 243530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 244693 245700 gene locus_tag LOCUS_02230 244693 245700 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031570.1 protein_id gnl|my_center|LOCUS_02230 246703 245642 gene locus_tag LOCUS_02240 gene ltaE 246703 245642 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_02240 246864 248039 gene locus_tag LOCUS_02250 246864 248039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 248039 248866 gene locus_tag LOCUS_02260 248039 248866 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808734.1 protein_id gnl|my_center|LOCUS_02260 248856 249671 gene locus_tag LOCUS_02270 248856 249671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222208.1 protein_id gnl|my_center|LOCUS_02270 250420 250268 gene locus_tag LOCUS_02280 250420 250268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 252099 252536 gene locus_tag LOCUS_02290 252099 252536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 252586 253437 gene locus_tag LOCUS_02300 252586 253437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 253460 254419 gene locus_tag LOCUS_02310 253460 254419 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767549.1 protein_id gnl|my_center|LOCUS_02310 254462 254902 gene locus_tag LOCUS_02320 254462 254902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 254967 255683 gene locus_tag LOCUS_02330 254967 255683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_02330 255680 256351 gene locus_tag LOCUS_02340 255680 256351 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_02340 256356 257075 gene locus_tag LOCUS_02350 gene ccsA 256356 257075 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_02350 257068 257223 gene locus_tag LOCUS_02360 257068 257223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 257246 257812 gene locus_tag LOCUS_02370 257246 257812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 257834 258766 gene locus_tag LOCUS_02380 257834 258766 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_02380 258928 259290 gene locus_tag LOCUS_02390 258928 259290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 259542 259297 gene locus_tag LOCUS_02400 259542 259297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 259790 261304 gene locus_tag LOCUS_02410 gene malQ 259790 261304 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_02410 262001 261288 gene locus_tag LOCUS_02420 262001 261288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 262624 261998 gene locus_tag LOCUS_02430 262624 261998 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_02430 262800 263273 gene locus_tag LOCUS_02440 262800 263273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 265184 263289 gene locus_tag LOCUS_02450 265184 263289 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_02450 266122 265211 gene locus_tag LOCUS_02460 266122 265211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 266252 267427 gene locus_tag LOCUS_02470 266252 267427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 267402 267722 gene locus_tag LOCUS_02480 267402 267722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 268269 267736 gene locus_tag LOCUS_02490 268269 267736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 269459 268374 gene locus_tag LOCUS_02500 269459 268374 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256253.1 protein_id gnl|my_center|LOCUS_02500 270092 269580 gene locus_tag LOCUS_02510 270092 269580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 271360 270152 gene locus_tag LOCUS_02520 271360 270152 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_02520 271451 272611 gene locus_tag LOCUS_02530 271451 272611 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021821.1 protein_id gnl|my_center|LOCUS_02530 272601 273221 gene locus_tag LOCUS_02540 272601 273221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 274945 273224 gene locus_tag LOCUS_02550 gene ybaL 274945 273224 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114136.1 protein_id gnl|my_center|LOCUS_02550 275567 276103 gene locus_tag LOCUS_02560 275567 276103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 276170 276298 gene locus_tag LOCUS_02570 276170 276298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 277640 278863 gene locus_tag LOCUS_02580 277640 278863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 279368 279934 gene locus_tag LOCUS_02590 279368 279934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 279959 280882 gene locus_tag LOCUS_02600 279959 280882 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_02600 281011 282543 gene locus_tag LOCUS_02610 281011 282543 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256966.1 protein_id gnl|my_center|LOCUS_02610 282639 284888 gene locus_tag LOCUS_02620 282639 284888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_02620 286286 284958 gene locus_tag LOCUS_02630 286286 284958 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_02630 287088 286336 gene locus_tag LOCUS_02640 287088 286336 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_02640 287937 287095 gene locus_tag LOCUS_02650 287937 287095 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_02650 288928 287954 gene locus_tag LOCUS_02660 288928 287954 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_02660 290094 288931 gene locus_tag LOCUS_02670 290094 288931 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401256.1 protein_id gnl|my_center|LOCUS_02670 290193 291161 gene locus_tag LOCUS_02680 290193 291161 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031473.1 protein_id gnl|my_center|LOCUS_02680 291265 292053 gene locus_tag LOCUS_02690 291265 292053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 292059 293096 gene locus_tag LOCUS_02700 292059 293096 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_02700 293351 294496 gene locus_tag LOCUS_02710 293351 294496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 294518 297415 gene locus_tag LOCUS_02720 294518 297415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 297412 298416 gene locus_tag LOCUS_02730 297412 298416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_02730 298413 299171 gene locus_tag LOCUS_02740 298413 299171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_02740 299249 299494 gene locus_tag LOCUS_02750 299249 299494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 300057 299491 gene locus_tag LOCUS_02760 300057 299491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 300905 300102 gene locus_tag LOCUS_02770 300905 300102 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_02770 302731 300929 gene locus_tag LOCUS_02780 302731 300929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_02780 304542 302728 gene locus_tag LOCUS_02790 304542 302728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257958.1 protein_id gnl|my_center|LOCUS_02790 305732 304707 gene locus_tag LOCUS_02800 305732 304707 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227634.1 protein_id gnl|my_center|LOCUS_02800 307101 305809 gene locus_tag LOCUS_02810 gene hemL 307101 305809 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797681.1 protein_id gnl|my_center|LOCUS_02810 308341 307082 gene locus_tag LOCUS_02820 gene hemA 308341 307082 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258452.1 protein_id gnl|my_center|LOCUS_02820 309120 308422 gene locus_tag LOCUS_02830 gene rpe 309120 308422 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_02830 310028 309192 gene locus_tag LOCUS_02840 gene sucD 310028 309192 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256597.1 protein_id gnl|my_center|LOCUS_02840 311243 310095 gene locus_tag LOCUS_02850 gene sucC 311243 310095 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_02850 312365 311364 gene locus_tag LOCUS_02860 312365 311364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 312497 313933 gene locus_tag LOCUS_02870 gene rpoN 312497 313933 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462176.1 protein_id gnl|my_center|LOCUS_02870 314224 314039 gene locus_tag LOCUS_02880 314224 314039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 314772 315608 gene locus_tag LOCUS_02890 314772 315608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 315681 316463 gene locus_tag LOCUS_02900 315681 316463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 316872 316528 gene locus_tag LOCUS_02910 gene speD 316872 316528 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_02910 318042 316882 gene locus_tag LOCUS_02920 318042 316882 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870180.1 protein_id gnl|my_center|LOCUS_02920 318653 318054 gene locus_tag LOCUS_02930 gene recR 318653 318054 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_02930 319460 318777 gene locus_tag LOCUS_02940 319460 318777 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_02940 320118 319483 gene locus_tag LOCUS_02950 320118 319483 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_02950 320229 320903 gene locus_tag LOCUS_02960 320229 320903 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_02960 320910 323156 gene locus_tag LOCUS_02970 320910 323156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 323589 324815 gene locus_tag LOCUS_02980 323589 324815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 324891 325889 gene locus_tag LOCUS_02990 324891 325889 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_02990 325937 326512 gene locus_tag LOCUS_03000 325937 326512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 326571 326644 gene locus_tag LOCUS_t00060 326571 326644 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 327670 326813 gene locus_tag LOCUS_03010 327670 326813 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 protein_id gnl|my_center|LOCUS_03010 328173 327682 gene locus_tag LOCUS_03020 gene msrA 328173 327682 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_03020 329228 328305 gene locus_tag LOCUS_03030 329228 328305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_03030 329369 332164 gene locus_tag LOCUS_03040 gene ppc 329369 332164 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_03040 334316 332211 gene locus_tag LOCUS_03050 334316 332211 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_03050 334633 335244 gene locus_tag LOCUS_03060 334633 335244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 335774 335247 gene locus_tag LOCUS_03070 335774 335247 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_03070 336457 335861 gene locus_tag LOCUS_03080 gene trmH 336457 335861 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 protein_id gnl|my_center|LOCUS_03080 336912 338165 gene locus_tag LOCUS_03090 gene argG 336912 338165 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112429425.1 protein_id gnl|my_center|LOCUS_03090 338158 339504 gene locus_tag LOCUS_03100 gene argH 338158 339504 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082327.1 protein_id gnl|my_center|LOCUS_03100 339518 339703 gene locus_tag LOCUS_03110 gene lysW 339518 339703 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229005.1 protein_id gnl|my_center|LOCUS_03110 339789 340637 gene locus_tag LOCUS_03120 gene lysX 339789 340637 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_03120 340634 341680 gene locus_tag LOCUS_03130 340634 341680 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_03130 341686 342552 gene locus_tag LOCUS_03140 gene lysX 341686 342552 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_03140 342581 343624 gene locus_tag LOCUS_03150 gene argC 342581 343624 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229001.1 protein_id gnl|my_center|LOCUS_03150 343645 344439 gene locus_tag LOCUS_03160 343645 344439 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_03160 344453 345628 gene locus_tag LOCUS_03170 344453 345628 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909458.1 protein_id gnl|my_center|LOCUS_03170 345653 346723 gene locus_tag LOCUS_03180 345653 346723 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976168.1 protein_id gnl|my_center|LOCUS_03180 346720 348330 gene locus_tag LOCUS_03190 346720 348330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 348346 349557 gene locus_tag LOCUS_03200 348346 349557 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_03200 349604 350734 gene locus_tag LOCUS_03210 349604 350734 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056427.1 protein_id gnl|my_center|LOCUS_03210 351097 350720 gene locus_tag LOCUS_03220 351097 350720 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_03220 353309 351114 gene locus_tag LOCUS_03230 gene glgB 353309 351114 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337498.1 protein_id gnl|my_center|LOCUS_03230 355472 353340 gene locus_tag LOCUS_03240 gene glgX 355472 353340 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_03240 356926 355469 gene locus_tag LOCUS_03250 356926 355469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 358578 356923 gene locus_tag LOCUS_03260 358578 356923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03260 360558 358585 gene locus_tag LOCUS_03270 360558 358585 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_03270 362014 360764 gene locus_tag LOCUS_03280 gene odhB 362014 360764 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259557.1 protein_id gnl|my_center|LOCUS_03280 364841 362004 gene locus_tag LOCUS_03290 364841 362004 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259558.1 protein_id gnl|my_center|LOCUS_03290 365078 366901 gene locus_tag LOCUS_03300 365078 366901 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_03300 366905 367957 gene locus_tag LOCUS_03310 366905 367957 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_03310 368752 367958 gene locus_tag LOCUS_03320 368752 367958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 369161 368775 gene locus_tag LOCUS_03330 369161 368775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 370093 369164 gene locus_tag LOCUS_03340 gene draG 370093 369164 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_03340 370461 370090 gene locus_tag LOCUS_03350 370461 370090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255011.1 protein_id gnl|my_center|LOCUS_03350 371198 370587 gene locus_tag LOCUS_03360 371198 370587 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_03360 371785 371330 gene locus_tag LOCUS_03370 371785 371330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 372631 372116 gene locus_tag LOCUS_03380 372631 372116 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_03380 372999 373178 gene locus_tag LOCUS_03390 372999 373178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 373227 373886 gene locus_tag LOCUS_03400 373227 373886 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402845.1 protein_id gnl|my_center|LOCUS_03400 376262 373917 gene locus_tag LOCUS_03410 376262 373917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 376441 376812 gene locus_tag LOCUS_03420 376441 376812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 376936 377385 gene locus_tag LOCUS_03430 gene perR 376936 377385 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002038.1 protein_id gnl|my_center|LOCUS_03430 377378 378121 gene locus_tag LOCUS_03440 377378 378121 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_03440 378962 378111 gene locus_tag LOCUS_03450 378962 378111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 379996 379037 gene locus_tag LOCUS_03460 379996 379037 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228198.1 protein_id gnl|my_center|LOCUS_03460 380120 380941 gene locus_tag LOCUS_03470 380120 380941 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_03470 381028 382395 gene locus_tag LOCUS_03480 381028 382395 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_03480 382410 383339 gene locus_tag LOCUS_03490 382410 383339 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102952112.1 protein_id gnl|my_center|LOCUS_03490 383419 384345 gene locus_tag LOCUS_03500 gene rbsK 383419 384345 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212251.1 protein_id gnl|my_center|LOCUS_03500 384481 385221 gene locus_tag LOCUS_03510 384481 385221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 385835 385218 gene locus_tag LOCUS_03520 385835 385218 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081572.1 protein_id gnl|my_center|LOCUS_03520 385965 387698 gene locus_tag LOCUS_03530 385965 387698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 389971 391296 gene locus_tag LOCUS_03540 389971 391296 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109948.1 protein_id gnl|my_center|LOCUS_03540 392055 391813 gene locus_tag LOCUS_03550 392055 391813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 392381 393253 gene locus_tag LOCUS_03560 392381 393253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 394384 393254 gene locus_tag LOCUS_03570 394384 393254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 394774 395994 gene locus_tag LOCUS_03580 394774 395994 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_03580 396007 397194 gene locus_tag LOCUS_03590 396007 397194 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_03590 397199 398359 gene locus_tag LOCUS_03600 397199 398359 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_03600 398490 399506 gene locus_tag LOCUS_03610 gene rpoD 398490 399506 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258920.1 protein_id gnl|my_center|LOCUS_03610 399527 400540 gene locus_tag LOCUS_03620 399527 400540 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_03620 400870 401217 gene locus_tag LOCUS_03630 400870 401217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 401391 401236 gene locus_tag LOCUS_03640 401391 401236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 401558 403264 gene locus_tag LOCUS_03650 401558 403264 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_03650 403265 404026 gene locus_tag LOCUS_03660 403265 404026 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392229.1 protein_id gnl|my_center|LOCUS_03660 404077 404889 gene locus_tag LOCUS_03670 404077 404889 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392230.1 protein_id gnl|my_center|LOCUS_03670 405339 404914 gene locus_tag LOCUS_03680 405339 404914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 405470 405889 gene locus_tag LOCUS_03690 405470 405889 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_03690 405908 407341 gene locus_tag LOCUS_03700 405908 407341 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_03700 407562 408275 gene locus_tag LOCUS_03710 gene purU 407562 408275 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_03710 408847 408281 gene locus_tag LOCUS_03720 408847 408281 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_03720 409868 408936 gene locus_tag LOCUS_03730 gene yedA 409868 408936 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 protein_id gnl|my_center|LOCUS_03730 410302 410057 gene locus_tag LOCUS_03740 410302 410057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 411396 410404 gene locus_tag LOCUS_03750 411396 410404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256950.1 protein_id gnl|my_center|LOCUS_03750 411589 411750 gene locus_tag LOCUS_03760 411589 411750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 411835 412092 gene locus_tag LOCUS_03770 411835 412092 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077315.1 protein_id gnl|my_center|LOCUS_03770 412284 412574 gene locus_tag LOCUS_03780 412284 412574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 412593 413069 gene locus_tag LOCUS_03790 412593 413069 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_03790 413159 413665 gene locus_tag LOCUS_03800 413159 413665 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258738.1 protein_id gnl|my_center|LOCUS_03800 413866 414675 gene locus_tag LOCUS_03810 gene pphC 413866 414675 CDS product protein-serine/threonine phosphatase PphC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119041.1 protein_id gnl|my_center|LOCUS_03810 414783 415808 gene locus_tag LOCUS_03820 414783 415808 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258491.1 protein_id gnl|my_center|LOCUS_03820 416282 415821 gene locus_tag LOCUS_03830 416282 415821 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_03830 416400 416879 gene locus_tag LOCUS_03840 416400 416879 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 protein_id gnl|my_center|LOCUS_03840 416872 417351 gene locus_tag LOCUS_03850 416872 417351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 417348 418805 gene locus_tag LOCUS_03860 417348 418805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 420883 418802 gene locus_tag LOCUS_03870 420883 418802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 421201 420959 gene locus_tag LOCUS_03880 421201 420959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 422345 421302 gene locus_tag LOCUS_03890 422345 421302 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_03890 422524 423654 gene locus_tag LOCUS_03900 422524 423654 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_03900 423765 424328 gene locus_tag LOCUS_03910 423765 424328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 424364 425230 gene locus_tag LOCUS_03920 424364 425230 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_03920 425794 427362 gene locus_tag LOCUS_03930 425794 427362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 427432 428370 gene locus_tag LOCUS_03940 427432 428370 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_03940 428367 429227 gene locus_tag LOCUS_03950 428367 429227 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_03950 429333 429944 gene locus_tag LOCUS_03960 429333 429944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 429941 431404 gene locus_tag LOCUS_03970 429941 431404 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_03970 432390 431500 gene locus_tag LOCUS_03980 432390 431500 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_03980 433418 432603 gene locus_tag LOCUS_03990 433418 432603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_03990 434135 433719 gene locus_tag LOCUS_04000 434135 433719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 434373 435275 gene locus_tag LOCUS_04010 434373 435275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 435296 436318 gene locus_tag LOCUS_04020 435296 436318 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_04020 437066 436308 gene locus_tag LOCUS_04030 437066 436308 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333546.1 protein_id gnl|my_center|LOCUS_04030 437561 437088 gene locus_tag LOCUS_04040 437561 437088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 437654 439075 gene locus_tag LOCUS_04050 437654 439075 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545342.1 protein_id gnl|my_center|LOCUS_04050 439099 440250 gene locus_tag LOCUS_04060 439099 440250 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_04060 441780 440290 gene locus_tag LOCUS_04070 gene xylB 441780 440290 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_04070 442601 441864 gene locus_tag LOCUS_04080 gene pgl 442601 441864 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_04080 444178 442634 gene locus_tag LOCUS_04090 gene zwf 444178 442634 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_04090 445791 444271 gene locus_tag LOCUS_04100 445791 444271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04100 447104 445929 gene locus_tag LOCUS_04110 447104 445929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04110 449001 447127 gene locus_tag LOCUS_04120 449001 447127 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_04120 450512 449118 gene locus_tag LOCUS_04130 450512 449118 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015563.1 protein_id gnl|my_center|LOCUS_04130 450594 451103 gene locus_tag LOCUS_04140 450594 451103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 451422 453290 gene locus_tag LOCUS_04150 451422 453290 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_04150 453431 454354 gene locus_tag LOCUS_04160 gene oppB 453431 454354 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_04160 454377 455318 gene locus_tag LOCUS_04170 454377 455318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256917.1 protein_id gnl|my_center|LOCUS_04170 455454 456755 gene locus_tag LOCUS_04180 455454 456755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 456772 458190 gene locus_tag LOCUS_04190 456772 458190 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_04190 459236 458217 gene locus_tag LOCUS_04200 gene sppA 459236 458217 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 protein_id gnl|my_center|LOCUS_04200 459908 459249 gene locus_tag LOCUS_04210 459908 459249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 460921 459908 gene locus_tag LOCUS_04220 460921 459908 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_04220 462225 461080 gene locus_tag LOCUS_04230 462225 461080 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_04230 462651 464144 gene locus_tag LOCUS_04240 462651 464144 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584079.1 protein_id gnl|my_center|LOCUS_04240 464211 465143 gene locus_tag LOCUS_04250 464211 465143 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776905.1 protein_id gnl|my_center|LOCUS_04250 465165 466028 gene locus_tag LOCUS_04260 465165 466028 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_04260 466067 468838 gene locus_tag LOCUS_04270 466067 468838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 469082 470593 gene locus_tag LOCUS_04280 469082 470593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 470676 472802 gene locus_tag LOCUS_04290 470676 472802 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392879.1 protein_id gnl|my_center|LOCUS_04290 472829 473836 gene locus_tag LOCUS_04300 472829 473836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 473858 475039 gene locus_tag LOCUS_04310 473858 475039 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_04310 475824 475120 gene locus_tag LOCUS_04320 475824 475120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 477154 476684 gene locus_tag LOCUS_04330 gene dtd 477154 476684 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_04330 477505 477200 gene locus_tag LOCUS_04340 477505 477200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 477660 479465 gene locus_tag LOCUS_04350 gene argS 477660 479465 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_04350 479548 480756 gene locus_tag LOCUS_04360 479548 480756 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_04360 480757 482052 gene locus_tag LOCUS_04370 480757 482052 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_04370 484493 482049 gene locus_tag LOCUS_04380 484493 482049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 484726 490083 gene locus_tag LOCUS_04390 484726 490083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 490105 490989 gene locus_tag LOCUS_04400 490105 490989 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868073.1 protein_id gnl|my_center|LOCUS_04400 491086 491370 gene locus_tag LOCUS_04410 491086 491370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 491425 491500 gene locus_tag LOCUS_t00070 491425 491500 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 493494 491848 gene locus_tag LOCUS_04420 493494 491848 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_04420 493826 494920 gene locus_tag LOCUS_04430 493826 494920 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_04430 494913 495533 gene locus_tag LOCUS_04440 494913 495533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 495543 496415 gene locus_tag LOCUS_04450 495543 496415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 499588 496493 gene locus_tag LOCUS_04460 499588 496493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 499887 500822 gene locus_tag LOCUS_04470 gene selD 499887 500822 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301201.1 protein_id gnl|my_center|LOCUS_04470 501817 500798 gene locus_tag LOCUS_04480 501817 500798 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888257.1 protein_id gnl|my_center|LOCUS_04480 502667 501888 gene locus_tag LOCUS_04490 502667 501888 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033687802.1 protein_id gnl|my_center|LOCUS_04490 504318 502660 gene locus_tag LOCUS_04500 504318 502660 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_04500 505532 504564 gene locus_tag LOCUS_04510 505532 504564 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 protein_id gnl|my_center|LOCUS_04510 506951 505548 gene locus_tag LOCUS_04520 gene hslU 506951 505548 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_04520 507503 507015 gene locus_tag LOCUS_04530 gene hslV 507503 507015 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_04530 507911 507681 gene locus_tag LOCUS_04540 507911 507681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 509557 507908 gene locus_tag LOCUS_04550 509557 507908 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257261.1 protein_id gnl|my_center|LOCUS_04550 509705 510238 gene locus_tag LOCUS_04560 509705 510238 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392473.1 protein_id gnl|my_center|LOCUS_04560 510457 511350 gene locus_tag LOCUS_04570 510457 511350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 511437 512354 gene locus_tag LOCUS_04580 511437 512354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888944.1 protein_id gnl|my_center|LOCUS_04580 512351 513193 gene locus_tag LOCUS_04590 512351 513193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888943.1 protein_id gnl|my_center|LOCUS_04590 513764 513264 gene locus_tag LOCUS_04600 513764 513264 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_04600 514018 515643 gene locus_tag LOCUS_04610 gene ggt 514018 515643 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_04610 515691 516788 gene locus_tag LOCUS_04620 515691 516788 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_04620 516795 517280 gene locus_tag LOCUS_04630 516795 517280 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_04630 517994 517341 gene locus_tag LOCUS_04640 517994 517341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 519035 518538 gene locus_tag LOCUS_04650 519035 518538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 520570 519071 gene locus_tag LOCUS_04660 gene glpK 520570 519071 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_04660 522244 520601 gene locus_tag LOCUS_04670 gene glpD 522244 520601 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_04670 523584 522298 gene locus_tag LOCUS_04680 523584 522298 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064606.1 protein_id gnl|my_center|LOCUS_04680 525373 523904 gene locus_tag LOCUS_04690 525373 523904 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_04690 529940 525363 gene locus_tag LOCUS_04700 gene gltB 529940 525363 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_04700 531268 530525 gene locus_tag LOCUS_04710 531268 530525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 532287 531265 gene locus_tag LOCUS_04720 532287 531265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028123.1 protein_id gnl|my_center|LOCUS_04720 533422 532244 gene locus_tag LOCUS_04730 533422 532244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 536428 533570 gene locus_tag LOCUS_04740 536428 533570 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056205.1 protein_id gnl|my_center|LOCUS_04740 536620 536429 gene locus_tag LOCUS_04750 536620 536429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 538123 538533 gene locus_tag LOCUS_04760 538123 538533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 539275 538778 gene locus_tag LOCUS_04770 539275 538778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04770 540051 539791 gene locus_tag LOCUS_04780 540051 539791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 540383 540766 gene locus_tag LOCUS_04790 540383 540766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 543019 540884 gene locus_tag LOCUS_04800 gene topA 543019 540884 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_04800 544249 543179 gene locus_tag LOCUS_04810 544249 543179 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_04810 544452 545306 gene locus_tag LOCUS_04820 544452 545306 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_04820 545405 545716 gene locus_tag LOCUS_04830 gene rplU 545405 545716 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_04830 545736 545996 gene locus_tag LOCUS_04840 gene rpmA 545736 545996 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258180.1 protein_id gnl|my_center|LOCUS_04840 546025 546309 gene locus_tag LOCUS_04850 546025 546309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 546414 546956 gene locus_tag LOCUS_04860 546414 546956 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_04860 548385 546943 gene locus_tag LOCUS_04870 548385 546943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 549585 548389 gene locus_tag LOCUS_04880 549585 548389 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257931.1 protein_id gnl|my_center|LOCUS_04880 550533 549592 gene locus_tag LOCUS_04890 550533 549592 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_04890 550664 552991 gene locus_tag LOCUS_04900 550664 552991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 555348 553051 gene locus_tag LOCUS_04910 555348 553051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 555561 556034 gene locus_tag LOCUS_04920 555561 556034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 557001 556036 gene locus_tag LOCUS_04930 557001 556036 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_04930 557577 557017 gene locus_tag LOCUS_04940 557577 557017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 557790 559262 gene locus_tag LOCUS_04950 gene guaB 557790 559262 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583116.1 protein_id gnl|my_center|LOCUS_04950 559271 560119 gene locus_tag LOCUS_04960 559271 560119 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582623.1 protein_id gnl|my_center|LOCUS_04960 560433 562214 gene locus_tag LOCUS_04970 gene glmS 560433 562214 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 protein_id gnl|my_center|LOCUS_04970 562211 562939 gene locus_tag LOCUS_04980 gene ubiE 562211 562939 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 protein_id gnl|my_center|LOCUS_04980 562936 563637 gene locus_tag LOCUS_04990 562936 563637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 563640 564167 gene locus_tag LOCUS_05000 563640 564167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 565067 564183 gene locus_tag LOCUS_05010 565067 564183 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225104.1 protein_id gnl|my_center|LOCUS_05010 565999 565064 gene locus_tag LOCUS_05020 565999 565064 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_05020 567578 566034 gene locus_tag LOCUS_05030 567578 566034 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225106.1 protein_id gnl|my_center|LOCUS_05030 567707 568231 gene locus_tag LOCUS_05040 567707 568231 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888275.1 protein_id gnl|my_center|LOCUS_05040 568360 568435 gene locus_tag LOCUS_t00080 568360 568435 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 569008 568793 gene locus_tag LOCUS_05050 569008 568793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 569620 569384 gene locus_tag LOCUS_05060 569620 569384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 570677 569745 gene locus_tag LOCUS_05070 570677 569745 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_05070 570849 571358 gene locus_tag LOCUS_05080 570849 571358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 571473 572132 gene locus_tag LOCUS_05090 571473 572132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 572107 572637 gene locus_tag LOCUS_05100 572107 572637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 573883 572621 gene locus_tag LOCUS_05110 573883 572621 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_05110 574350 577754 gene locus_tag LOCUS_05120 574350 577754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 577759 578133 gene locus_tag LOCUS_05130 577759 578133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 579371 579613 gene locus_tag LOCUS_05140 579371 579613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 580101 580385 gene locus_tag LOCUS_05150 580101 580385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 580382 580753 gene locus_tag LOCUS_05160 580382 580753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 581622 581446 gene locus_tag LOCUS_05170 581622 581446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 582086 581850 gene locus_tag LOCUS_05180 582086 581850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 582328 582140 gene locus_tag LOCUS_05190 582328 582140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 582491 582772 gene locus_tag LOCUS_05200 582491 582772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 584091 585218 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgtccccacacgcgtgggggtgaaccg 585449 586912 gene locus_tag LOCUS_05210 585449 586912 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_05210 589022 586956 gene locus_tag LOCUS_05220 589022 586956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 589102 589755 gene locus_tag LOCUS_05230 589102 589755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 589922 590296 gene locus_tag LOCUS_05240 589922 590296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 590296 591906 gene locus_tag LOCUS_05250 590296 591906 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_05250 592161 591949 gene locus_tag LOCUS_05260 592161 591949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 592418 593605 gene locus_tag LOCUS_05270 592418 593605 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258067.1 protein_id gnl|my_center|LOCUS_05270 593691 594362 gene locus_tag LOCUS_05280 593691 594362 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258881.1 protein_id gnl|my_center|LOCUS_05280 596848 594422 gene locus_tag LOCUS_05290 gene lon 596848 594422 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_05290 597288 596866 gene locus_tag LOCUS_05300 597288 596866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 598063 597317 gene locus_tag LOCUS_05310 598063 597317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 598661 598176 gene locus_tag LOCUS_05320 598661 598176 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_05320 598856 599710 gene locus_tag LOCUS_05330 598856 599710 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_05330 599796 600860 gene locus_tag LOCUS_05340 599796 600860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 600883 601635 gene locus_tag LOCUS_05350 600883 601635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 602353 601637 gene locus_tag LOCUS_05360 602353 601637 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_05360 603167 602523 gene locus_tag LOCUS_05370 603167 602523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 603781 603182 gene locus_tag LOCUS_05380 603781 603182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 604896 603862 gene locus_tag LOCUS_05390 604896 603862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 606412 604979 gene locus_tag LOCUS_05400 606412 604979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 606632 606814 gene locus_tag LOCUS_05410 606632 606814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 607847 607230 gene locus_tag LOCUS_05420 607847 607230 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_05420 608033 608188 gene locus_tag LOCUS_05430 608033 608188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 609083 608190 gene locus_tag LOCUS_05440 609083 608190 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_05440 609223 610269 gene locus_tag LOCUS_05450 609223 610269 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258178.1 protein_id gnl|my_center|LOCUS_05450 612904 611693 gene locus_tag LOCUS_05460 gene galK 612904 611693 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_05460 613890 612901 gene locus_tag LOCUS_05470 gene galT 613890 612901 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583557.1 protein_id gnl|my_center|LOCUS_05470 614056 613883 gene locus_tag LOCUS_05480 614056 613883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 614228 614605 gene locus_tag LOCUS_05490 614228 614605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 614701 615780 gene locus_tag LOCUS_05500 614701 615780 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_05500 615833 616492 gene locus_tag LOCUS_05510 615833 616492 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313905.1 protein_id gnl|my_center|LOCUS_05510 618005 616503 gene locus_tag LOCUS_05520 618005 616503 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_05520 618130 618879 gene locus_tag LOCUS_05530 618130 618879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 620036 619134 gene locus_tag LOCUS_05540 620036 619134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 621785 620166 gene locus_tag LOCUS_05550 gene groL 621785 620166 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_05550 622128 621820 gene locus_tag LOCUS_05560 gene groES 622128 621820 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174076.1 protein_id gnl|my_center|LOCUS_05560 622351 623712 gene locus_tag LOCUS_05570 gene arcA 622351 623712 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682331.1 protein_id gnl|my_center|LOCUS_05570 624521 623709 gene locus_tag LOCUS_05580 624521 623709 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_05580 624914 625579 gene locus_tag LOCUS_05590 624914 625579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 626679 625597 gene locus_tag LOCUS_05600 626679 625597 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_05600 626973 627941 gene locus_tag LOCUS_05610 626973 627941 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_05610 627989 629122 gene locus_tag LOCUS_05620 627989 629122 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256386.1 protein_id gnl|my_center|LOCUS_05620 629555 629187 gene locus_tag LOCUS_05630 629555 629187 CDS product SaoD/DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258649.1 protein_id gnl|my_center|LOCUS_05630 630768 629818 gene locus_tag LOCUS_05640 630768 629818 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_05640 631051 631833 gene locus_tag LOCUS_05650 631051 631833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 631998 632648 gene locus_tag LOCUS_05660 631998 632648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 632715 633473 gene locus_tag LOCUS_05670 632715 633473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 633492 633947 gene locus_tag LOCUS_05680 633492 633947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 634265 634999 gene locus_tag LOCUS_05690 634265 634999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 635637 635059 gene locus_tag LOCUS_05700 635637 635059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 635804 637246 gene locus_tag LOCUS_05710 635804 637246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 637449 638129 gene locus_tag LOCUS_05720 637449 638129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 638126 638920 gene locus_tag LOCUS_05730 638126 638920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 638970 639380 gene locus_tag LOCUS_05740 638970 639380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 639400 640077 gene locus_tag LOCUS_05750 639400 640077 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259479.1 protein_id gnl|my_center|LOCUS_05750 641584 640079 gene locus_tag LOCUS_05760 641584 640079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 641816 641971 gene locus_tag LOCUS_05770 641816 641971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 642009 643106 gene locus_tag LOCUS_05780 642009 643106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 643180 644103 gene locus_tag LOCUS_05790 643180 644103 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525638.1 protein_id gnl|my_center|LOCUS_05790 644116 645312 gene locus_tag LOCUS_05800 644116 645312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 645325 646092 gene locus_tag LOCUS_05810 645325 646092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_05810 646161 646868 gene locus_tag LOCUS_05820 646161 646868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_05820 646873 647118 gene locus_tag LOCUS_05830 646873 647118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 647132 647371 gene locus_tag LOCUS_05840 647132 647371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 647472 648269 gene locus_tag LOCUS_05850 647472 648269 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224195.1 protein_id gnl|my_center|LOCUS_05850 648450 649829 gene locus_tag LOCUS_05860 648450 649829 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 protein_id gnl|my_center|LOCUS_05860 649940 652243 gene locus_tag LOCUS_05870 649940 652243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 652218 652943 gene locus_tag LOCUS_05880 652218 652943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 655305 652948 gene locus_tag LOCUS_05890 655305 652948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 655445 656935 gene locus_tag LOCUS_05900 655445 656935 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265630.1 protein_id gnl|my_center|LOCUS_05900 657412 657753 gene locus_tag LOCUS_05910 657412 657753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 658670 657750 gene locus_tag LOCUS_05920 658670 657750 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_05920 658945 658700 gene locus_tag LOCUS_05930 658945 658700 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_05930 659768 658989 gene locus_tag LOCUS_05940 659768 658989 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_05940 659971 660795 gene locus_tag LOCUS_05950 659971 660795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 661610 660801 gene locus_tag LOCUS_05960 661610 660801 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_05960 663126 661603 gene locus_tag LOCUS_05970 663126 661603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 663703 663146 gene locus_tag LOCUS_05980 663703 663146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 664563 663700 gene locus_tag LOCUS_05990 664563 663700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 665056 664655 gene locus_tag LOCUS_06000 665056 664655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 665910 665041 gene locus_tag LOCUS_06010 665910 665041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 666152 665931 gene locus_tag LOCUS_06020 666152 665931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 667088 666159 gene locus_tag LOCUS_06030 667088 666159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 667939 667100 gene locus_tag LOCUS_06040 667939 667100 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_06040 671295 667939 gene locus_tag LOCUS_06050 gene fdh 671295 667939 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:complement(670699..670701),aa:Sec) note codon on position 199 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_06050 672898 671417 gene locus_tag LOCUS_06060 672898 671417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 673394 672903 gene locus_tag LOCUS_06070 673394 672903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 674691 673411 gene locus_tag LOCUS_06080 674691 673411 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258332.1 protein_id gnl|my_center|LOCUS_06080 675430 674702 gene locus_tag LOCUS_06090 675430 674702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 675654 675728 gene locus_tag LOCUS_t00090 675654 675728 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 675827 677350 gene locus_tag LOCUS_06100 675827 677350 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_06100 677887 677387 gene locus_tag LOCUS_06110 677887 677387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 678920 677901 gene locus_tag LOCUS_06120 678920 677901 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_06120 680296 678932 gene locus_tag LOCUS_06130 680296 678932 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_06130 681176 680331 gene locus_tag LOCUS_06140 681176 680331 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_06140 681287 682402 gene locus_tag LOCUS_06150 681287 682402 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_06150 683212 682667 gene locus_tag LOCUS_06160 683212 682667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 683844 683185 gene locus_tag LOCUS_06170 683844 683185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 684430 683861 gene locus_tag LOCUS_06180 684430 683861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 684739 684494 gene locus_tag LOCUS_06190 684739 684494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 684970 685161 gene locus_tag LOCUS_06200 684970 685161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 686026 685352 gene locus_tag LOCUS_06210 686026 685352 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_06210 687217 686039 gene locus_tag LOCUS_06220 687217 686039 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048134.1 protein_id gnl|my_center|LOCUS_06220 687822 688088 gene locus_tag LOCUS_06230 687822 688088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 688643 688567 gene locus_tag LOCUS_t00100 688643 688567 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 688916 688725 gene locus_tag LOCUS_06240 688916 688725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 690698 688929 gene locus_tag LOCUS_06250 690698 688929 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_06250 690779 690853 gene locus_tag LOCUS_t00110 690779 690853 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 691754 692092 gene locus_tag LOCUS_06260 691754 692092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 692182 693357 gene locus_tag LOCUS_06270 692182 693357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 693755 693390 gene locus_tag LOCUS_06280 693755 693390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 695418 694066 gene locus_tag LOCUS_06290 695418 694066 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_06290 696670 695477 gene locus_tag LOCUS_06300 696670 695477 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082601.1 protein_id gnl|my_center|LOCUS_06300 697260 698141 gene locus_tag LOCUS_06310 697260 698141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 698713 698162 gene locus_tag LOCUS_06320 698713 698162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 698841 703787 gene locus_tag LOCUS_06330 698841 703787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 703953 704645 gene locus_tag LOCUS_06340 703953 704645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 704816 705007 gene locus_tag LOCUS_06350 704816 705007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 705264 705956 gene locus_tag LOCUS_06360 gene tenA 705264 705956 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144491.1 protein_id gnl|my_center|LOCUS_06360 705944 706594 gene locus_tag LOCUS_06370 gene thiE 705944 706594 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_06370 706591 707595 gene locus_tag LOCUS_06380 gene thiL 706591 707595 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_06380 707602 708396 gene locus_tag LOCUS_06390 gene thiD 707602 708396 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_06390 708414 709214 gene locus_tag LOCUS_06400 gene thiM 708414 709214 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256281.1 protein_id gnl|my_center|LOCUS_06400 709629 711485 gene locus_tag LOCUS_06410 709629 711485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 711461 712162 gene locus_tag LOCUS_06420 711461 712162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 712584 712303 gene locus_tag LOCUS_06430 712584 712303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 712971 712717 gene locus_tag LOCUS_06440 712971 712717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 714076 713075 gene locus_tag LOCUS_06450 714076 713075 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_06450 714822 715742 gene locus_tag LOCUS_06460 714822 715742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 716739 715756 gene locus_tag LOCUS_06470 716739 715756 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877364.1 protein_id gnl|my_center|LOCUS_06470 717512 716736 gene locus_tag LOCUS_06480 717512 716736 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_06480 717928 717626 gene locus_tag LOCUS_06490 717928 717626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 718124 719434 gene locus_tag LOCUS_06500 718124 719434 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_06500 719547 720425 gene locus_tag LOCUS_06510 gene hisG 719547 720425 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_06510 720443 721744 gene locus_tag LOCUS_06520 gene hisD 720443 721744 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 protein_id gnl|my_center|LOCUS_06520 721744 722856 gene locus_tag LOCUS_06530 gene hisC 721744 722856 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_06530 722860 723450 gene locus_tag LOCUS_06540 gene hisB 722860 723450 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_06540 723456 724097 gene locus_tag LOCUS_06550 gene hisH 723456 724097 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560360.1 protein_id gnl|my_center|LOCUS_06550 724094 724825 gene locus_tag LOCUS_06560 gene hisA 724094 724825 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140708.1 protein_id gnl|my_center|LOCUS_06560 724832 725587 gene locus_tag LOCUS_06570 gene hisF 724832 725587 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921564.1 protein_id gnl|my_center|LOCUS_06570 725563 726465 gene locus_tag LOCUS_06580 725563 726465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 726490 727134 gene locus_tag LOCUS_06590 726490 727134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 727737 727195 gene locus_tag LOCUS_06600 727737 727195 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976524.1 protein_id gnl|my_center|LOCUS_06600 728306 727818 gene locus_tag LOCUS_06610 728306 727818 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_06610 730588 728402 gene locus_tag LOCUS_06620 gene vpr 730588 728402 CDS product serine protease Vpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227419.1 protein_id gnl|my_center|LOCUS_06620 731696 730740 gene locus_tag LOCUS_06630 731696 730740 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_06630 732486 731824 gene locus_tag LOCUS_06640 732486 731824 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660596.1 protein_id gnl|my_center|LOCUS_06640 732970 732533 gene locus_tag LOCUS_06650 732970 732533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 734088 732997 gene locus_tag LOCUS_06660 gene rpoD 734088 732997 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_06660 735376 734297 gene locus_tag LOCUS_06670 735376 734297 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250406.1 protein_id gnl|my_center|LOCUS_06670 735482 736627 gene locus_tag LOCUS_06680 735482 736627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 736644 737459 gene locus_tag LOCUS_06690 736644 737459 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_06690 737475 737915 gene locus_tag LOCUS_06700 gene fabZ 737475 737915 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_06700 737919 739016 gene locus_tag LOCUS_06710 737919 739016 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525200.1 protein_id gnl|my_center|LOCUS_06710 739000 740214 gene locus_tag LOCUS_06720 739000 740214 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_06720 740489 740211 gene locus_tag LOCUS_06730 740489 740211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 741356 741027 gene locus_tag LOCUS_06740 741356 741027 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258098.1 protein_id gnl|my_center|LOCUS_06740 742003 741353 gene locus_tag LOCUS_06750 gene tmk 742003 741353 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_06750 743660 742005 gene locus_tag LOCUS_06760 743660 742005 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_06760 744385 743684 gene locus_tag LOCUS_06770 744385 743684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 745324 744818 gene locus_tag LOCUS_06780 745324 744818 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_06780 746045 745317 gene locus_tag LOCUS_06790 746045 745317 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_06790 746752 746036 gene locus_tag LOCUS_06800 gene cmk 746752 746036 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_06800 747447 746686 gene locus_tag LOCUS_06810 747447 746686 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880947.1 protein_id gnl|my_center|LOCUS_06810 748204 747440 gene locus_tag LOCUS_06820 748204 747440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 748515 749000 gene locus_tag LOCUS_06830 gene smpB 748515 749000 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_06830 749016 749371 gene locus_tag LOCUS_tm00010 749016 749371 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 749672 749589 gene locus_tag LOCUS_t00120 749672 749589 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 751164 749725 gene locus_tag LOCUS_06840 751164 749725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 751361 751963 gene locus_tag LOCUS_06850 751361 751963 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_06850 751953 753470 gene locus_tag LOCUS_06860 751953 753470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 754443 753457 gene locus_tag LOCUS_06870 754443 753457 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 protein_id gnl|my_center|LOCUS_06870 756343 754487 gene locus_tag LOCUS_06880 756343 754487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 757503 756340 gene locus_tag LOCUS_06890 757503 756340 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583973.1 protein_id gnl|my_center|LOCUS_06890 757632 759011 gene locus_tag LOCUS_06900 757632 759011 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_06900 759140 760912 gene locus_tag LOCUS_06910 759140 760912 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868765.1 protein_id gnl|my_center|LOCUS_06910 760926 761861 gene locus_tag LOCUS_06920 gene oppB 760926 761861 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_06920 761872 762789 gene locus_tag LOCUS_06930 761872 762789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256682.1 protein_id gnl|my_center|LOCUS_06930 762871 762943 gene locus_tag LOCUS_t00130 762871 762943 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 762953 763028 gene locus_tag LOCUS_t00140 762953 763028 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 764366 763416 gene locus_tag LOCUS_06940 764366 763416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 765644 764781 gene locus_tag LOCUS_06950 765644 764781 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_06950 765822 766076 gene locus_tag LOCUS_06960 765822 766076 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720260.1 protein_id gnl|my_center|LOCUS_06960 766845 766117 gene locus_tag LOCUS_06970 gene trmD 766845 766117 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_06970 768392 766848 gene locus_tag LOCUS_06980 gene murJ 768392 766848 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_06980 768593 772204 gene locus_tag LOCUS_06990 768593 772204 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256763.1 protein_id gnl|my_center|LOCUS_06990 772223 776449 gene locus_tag LOCUS_07000 gene rpoC 772223 776449 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256762.1 protein_id gnl|my_center|LOCUS_07000 776566 776991 gene locus_tag LOCUS_07010 gene rpsL 776566 776991 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_07010 777020 777493 gene locus_tag LOCUS_07020 gene rpsG 777020 777493 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_07020 777533 779626 gene locus_tag LOCUS_07030 gene fusA 777533 779626 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_07030 779677 780879 gene locus_tag LOCUS_07040 gene tuf 779677 780879 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258047.1 protein_id gnl|my_center|LOCUS_07040 780993 781301 gene locus_tag LOCUS_07050 gene rpsJ 780993 781301 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_07050 781312 781926 gene locus_tag LOCUS_07060 gene rplC 781312 781926 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_07060 781951 782622 gene locus_tag LOCUS_07070 gene rplD 781951 782622 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_07070 782622 782921 gene locus_tag LOCUS_07080 gene rplW 782622 782921 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_07080 782991 783767 gene locus_tag LOCUS_07090 gene rplB 782991 783767 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_07090 783781 784065 gene locus_tag LOCUS_07100 gene rpsS 783781 784065 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_07100 784076 784408 gene locus_tag LOCUS_07110 gene rplV 784076 784408 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148025.1 protein_id gnl|my_center|LOCUS_07110 784436 785116 gene locus_tag LOCUS_07120 gene rpsC 784436 785116 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258237.1 protein_id gnl|my_center|LOCUS_07120 785149 785583 gene locus_tag LOCUS_07130 gene rplP 785149 785583 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_07130 785602 785793 gene locus_tag LOCUS_07140 gene rpmC 785602 785793 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258239.1 protein_id gnl|my_center|LOCUS_07140 785802 786059 gene locus_tag LOCUS_07150 gene rpsQ 785802 786059 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301190.1 protein_id gnl|my_center|LOCUS_07150 786061 786429 gene locus_tag LOCUS_07160 gene rplN 786061 786429 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_07160 786504 786821 gene locus_tag LOCUS_07170 gene rplX 786504 786821 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_07170 786832 787386 gene locus_tag LOCUS_07180 gene rplE 786832 787386 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_07180 787603 788007 gene locus_tag LOCUS_07190 gene rpsH 787603 788007 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_07190 788027 788581 gene locus_tag LOCUS_07200 gene rplF 788027 788581 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_07200 788597 788974 gene locus_tag LOCUS_07210 gene rplR 788597 788974 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_07210 788984 789556 gene locus_tag LOCUS_07220 gene rpsE 788984 789556 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_07220 789546 789734 gene locus_tag LOCUS_07230 gene rpmD 789546 789734 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053043.1 protein_id gnl|my_center|LOCUS_07230 789757 790218 gene locus_tag LOCUS_07240 gene rplO 789757 790218 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_07240 790221 791522 gene locus_tag LOCUS_07250 gene secY 790221 791522 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_07250 791531 792199 gene locus_tag LOCUS_07260 791531 792199 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_07260 792226 792972 gene locus_tag LOCUS_07270 gene map 792226 792972 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_07270 792993 793214 gene locus_tag LOCUS_07280 gene infA 792993 793214 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258253.1 protein_id gnl|my_center|LOCUS_07280 793362 793736 gene locus_tag LOCUS_07290 gene rpsM 793362 793736 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_07290 793786 794190 gene locus_tag LOCUS_07300 gene rpsK 793786 794190 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_07300 794293 795333 gene locus_tag LOCUS_07310 794293 795333 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_07310 795336 795692 gene locus_tag LOCUS_07320 gene rplQ 795336 795692 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806934.1 protein_id gnl|my_center|LOCUS_07320 795720 796442 gene locus_tag LOCUS_07330 gene truA 795720 796442 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258260.1 protein_id gnl|my_center|LOCUS_07330 796436 796885 gene locus_tag LOCUS_07340 gene rplM 796436 796885 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258261.1 protein_id gnl|my_center|LOCUS_07340 796903 797307 gene locus_tag LOCUS_07350 gene rpsI 796903 797307 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258262.1 protein_id gnl|my_center|LOCUS_07350 798064 797405 gene locus_tag LOCUS_07360 798064 797405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 799101 798085 gene locus_tag LOCUS_07370 gene prfB 799101 798085 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_07370 799984 799220 gene locus_tag LOCUS_07380 799984 799220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 801124 800000 gene locus_tag LOCUS_07390 801124 800000 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_07390 801230 802705 gene locus_tag LOCUS_07400 801230 802705 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_07400 802734 803885 gene locus_tag LOCUS_07410 gene queG 802734 803885 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 protein_id gnl|my_center|LOCUS_07410 804838 804284 gene locus_tag LOCUS_07420 804838 804284 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729630.1 protein_id gnl|my_center|LOCUS_07420 805093 804860 gene locus_tag LOCUS_07430 805093 804860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 805700 805086 gene locus_tag LOCUS_07440 gene sigR 805700 805086 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_07440 806804 805824 gene locus_tag LOCUS_07450 806804 805824 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257903.1 protein_id gnl|my_center|LOCUS_07450 807061 807849 gene locus_tag LOCUS_07460 807061 807849 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_07460 807878 808306 gene locus_tag LOCUS_07470 807878 808306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 808368 809081 gene locus_tag LOCUS_07480 808368 809081 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_07480 809870 809121 gene locus_tag LOCUS_07490 809870 809121 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233185.1 protein_id gnl|my_center|LOCUS_07490 810580 809870 gene locus_tag LOCUS_07500 810580 809870 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_07500 813722 810795 gene locus_tag LOCUS_r00010 813722 810795 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 813893 813819 gene locus_tag LOCUS_t00150 813893 813819 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 813976 813901 gene locus_tag LOCUS_t00160 813976 813901 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 815522 814020 gene locus_tag LOCUS_r00020 815522 814020 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 816952 815687 gene locus_tag LOCUS_07510 816952 815687 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_07510 818302 816986 gene locus_tag LOCUS_07520 818302 816986 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459114.1 protein_id gnl|my_center|LOCUS_07520 818241 818393 gene locus_tag LOCUS_07530 818241 818393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 818822 821596 gene locus_tag LOCUS_07540 gene polA 818822 821596 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256248.1 protein_id gnl|my_center|LOCUS_07540 821722 822273 gene locus_tag LOCUS_07550 821722 822273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 822461 822826 gene locus_tag LOCUS_07560 gene rplT 822461 822826 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_07560 823028 823648 gene locus_tag LOCUS_07570 823028 823648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 823652 824662 gene locus_tag LOCUS_07580 gene pheS 823652 824662 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_07580 824700 827129 gene locus_tag LOCUS_07590 gene pheT 824700 827129 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256770.1 protein_id gnl|my_center|LOCUS_07590 827137 828162 gene locus_tag LOCUS_07600 gene hisC 827137 828162 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_07600 828905 828168 gene locus_tag LOCUS_07610 gene rph 828905 828168 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256154.1 protein_id gnl|my_center|LOCUS_07610 829544 828927 gene locus_tag LOCUS_07620 829544 828927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 831387 829546 gene locus_tag LOCUS_07630 gene uvrC 831387 829546 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_07630 831484 832428 gene locus_tag LOCUS_07640 gene ftsY 831484 832428 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232026.1 protein_id gnl|my_center|LOCUS_07640 832444 833769 gene locus_tag LOCUS_07650 gene ffh 832444 833769 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_07650 833869 834165 gene locus_tag LOCUS_07660 gene rpsF 833869 834165 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_07660 834183 834626 gene locus_tag LOCUS_07670 834183 834626 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256912.1 protein_id gnl|my_center|LOCUS_07670 834651 835001 gene locus_tag LOCUS_07680 834651 835001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 835084 836280 gene locus_tag LOCUS_07690 835084 836280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 836362 837330 gene locus_tag LOCUS_07700 836362 837330 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_07700 838118 837654 gene locus_tag LOCUS_07710 838118 837654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 838838 838140 gene locus_tag LOCUS_07720 838838 838140 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228693.1 protein_id gnl|my_center|LOCUS_07720 840597 838867 gene locus_tag LOCUS_07730 gene sdhA 840597 838867 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228694.1 protein_id gnl|my_center|LOCUS_07730 840989 840609 gene locus_tag LOCUS_07740 840989 840609 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936281.1 protein_id gnl|my_center|LOCUS_07740 841362 841003 gene locus_tag LOCUS_07750 gene sdhC 841362 841003 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974113.1 protein_id gnl|my_center|LOCUS_07750 842527 841442 gene locus_tag LOCUS_07760 842527 841442 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_07760 843451 842615 gene locus_tag LOCUS_07770 843451 842615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 844860 843460 gene locus_tag LOCUS_07780 gene atoC 844860 843460 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 protein_id gnl|my_center|LOCUS_07780 845845 844955 gene locus_tag LOCUS_07790 845845 844955 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183422.1 protein_id gnl|my_center|LOCUS_07790 845920 846444 gene locus_tag LOCUS_07800 gene apt 845920 846444 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_07800 846496 847728 gene locus_tag LOCUS_07810 gene ahcY 846496 847728 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_07810 847754 849178 gene locus_tag LOCUS_07820 847754 849178 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404928.1 protein_id gnl|my_center|LOCUS_07820 849189 849848 gene locus_tag LOCUS_07830 849189 849848 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_07830 849950 851554 gene locus_tag LOCUS_07840 849950 851554 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_07840 852270 853772 gene locus_tag LOCUS_07850 852270 853772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 853822 854865 gene locus_tag LOCUS_07860 gene degS 853822 854865 CDS product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 protein_id gnl|my_center|LOCUS_07860 854885 855565 gene locus_tag LOCUS_07870 854885 855565 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258485.1 protein_id gnl|my_center|LOCUS_07870 857332 855572 gene locus_tag LOCUS_07880 gene mutL 857332 855572 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_07880 857365 858129 gene locus_tag LOCUS_07890 gene recO 857365 858129 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775744.1 protein_id gnl|my_center|LOCUS_07890 858627 858133 gene locus_tag LOCUS_07900 858627 858133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 859369 858629 gene locus_tag LOCUS_07910 859369 858629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 859473 860924 gene locus_tag LOCUS_07920 gene gatB 859473 860924 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_07920 861033 862292 gene locus_tag LOCUS_07930 861033 862292 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257569.1 protein_id gnl|my_center|LOCUS_07930 862953 862297 gene locus_tag LOCUS_07940 862953 862297 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_07940 863377 862964 gene locus_tag LOCUS_07950 863377 862964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 864120 863395 gene locus_tag LOCUS_07960 864120 863395 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_07960 864189 864470 gene locus_tag LOCUS_07970 864189 864470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 864487 865119 gene locus_tag LOCUS_07980 864487 865119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 867855 865156 gene locus_tag LOCUS_07990 gene secA 867855 865156 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_07990 868481 869557 gene locus_tag LOCUS_08000 gene selA 868481 869557 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_08000 869919 870545 gene locus_tag LOCUS_08010 869919 870545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 870564 871808 gene locus_tag LOCUS_08020 870564 871808 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969746.1 protein_id gnl|my_center|LOCUS_08020 872007 872927 gene locus_tag LOCUS_08030 872007 872927 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_08030 873528 872932 gene locus_tag LOCUS_08040 873528 872932 CDS product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765863.1 protein_id gnl|my_center|LOCUS_08040 873790 874770 gene locus_tag LOCUS_08050 873790 874770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_08050 874772 875860 gene locus_tag LOCUS_08060 874772 875860 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_08060 875909 876550 gene locus_tag LOCUS_08070 875909 876550 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372459.1 protein_id gnl|my_center|LOCUS_08070 877047 877772 gene locus_tag LOCUS_08080 877047 877772 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259072.1 protein_id gnl|my_center|LOCUS_08080 877765 878346 gene locus_tag LOCUS_08090 gene scpB 877765 878346 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_08090 879139 878321 gene locus_tag LOCUS_08100 879139 878321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 880222 879446 gene locus_tag LOCUS_08110 880222 879446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 880727 880251 gene locus_tag LOCUS_08120 880727 880251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 880853 881230 gene locus_tag LOCUS_08130 gene folB 880853 881230 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391948.1 protein_id gnl|my_center|LOCUS_08130 881986 883311 gene locus_tag LOCUS_08140 881986 883311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 883414 884412 gene locus_tag LOCUS_08150 883414 884412 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765639.1 protein_id gnl|my_center|LOCUS_08150 884746 886026 gene locus_tag LOCUS_08160 884746 886026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 886090 887019 gene locus_tag LOCUS_08170 886090 887019 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_08170 887985 888935 gene locus_tag LOCUS_08180 887985 888935 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338290.1 protein_id gnl|my_center|LOCUS_08180 889087 890559 gene locus_tag LOCUS_08190 gene gndA 889087 890559 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141117.1 protein_id gnl|my_center|LOCUS_08190 891850 890594 gene locus_tag LOCUS_08200 gene lysA 891850 890594 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_08200 891922 892524 gene locus_tag LOCUS_08210 gene pdxH 891922 892524 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_08210 892668 895208 gene locus_tag LOCUS_08220 gene lon 892668 895208 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_08220 895268 895981 gene locus_tag LOCUS_08230 895268 895981 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_08230 897346 896000 gene locus_tag LOCUS_08240 897346 896000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 897470 898978 gene locus_tag LOCUS_08250 897470 898978 CDS product glycosyltransferase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877359.1 protein_id gnl|my_center|LOCUS_08250 898981 899784 gene locus_tag LOCUS_08260 gene otsB 898981 899784 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877362.1 protein_id gnl|my_center|LOCUS_08260 899798 900751 gene locus_tag LOCUS_08270 gene ala 899798 900751 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_08270 901040 902191 gene locus_tag LOCUS_08280 901040 902191 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392821.1 protein_id gnl|my_center|LOCUS_08280 902226 903632 gene locus_tag LOCUS_08290 902226 903632 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_08290 903636 904712 gene locus_tag LOCUS_08300 903636 904712 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259177.1 protein_id gnl|my_center|LOCUS_08300 904718 905773 gene locus_tag LOCUS_08310 gene asd 904718 905773 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_08310 906623 905775 gene locus_tag LOCUS_08320 906623 905775 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_08320 906825 906983 gene locus_tag LOCUS_08330 906825 906983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 907923 907057 gene locus_tag LOCUS_08340 907923 907057 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_08340 908016 908222 gene locus_tag LOCUS_08350 908016 908222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 908621 908259 gene locus_tag LOCUS_08360 908621 908259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 909300 908680 gene locus_tag LOCUS_08370 909300 908680 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692227.1 protein_id gnl|my_center|LOCUS_08370 910127 909288 gene locus_tag LOCUS_08380 910127 909288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 910919 910269 gene locus_tag LOCUS_08390 910919 910269 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064925.1 protein_id gnl|my_center|LOCUS_08390 911581 910922 gene locus_tag LOCUS_08400 911581 910922 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928746.1 protein_id gnl|my_center|LOCUS_08400 912266 911634 gene locus_tag LOCUS_08410 912266 911634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 912639 912286 gene locus_tag LOCUS_08420 912639 912286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 912702 913322 gene locus_tag LOCUS_08430 912702 913322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 913410 914621 gene locus_tag LOCUS_08440 913410 914621 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_08440 915790 914669 gene locus_tag LOCUS_08450 915790 914669 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_08450 916137 919256 gene locus_tag LOCUS_08460 gene fdh 916137 919256 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:916671..916673,aa:Sec) note codon on position 179 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_08460 919262 920074 gene locus_tag LOCUS_08470 919262 920074 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_08470 920088 921071 gene locus_tag LOCUS_08480 gene nrfD 920088 921071 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727950.1 protein_id gnl|my_center|LOCUS_08480 921068 921868 gene locus_tag LOCUS_08490 921068 921868 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_08490 922540 921863 gene locus_tag LOCUS_08500 gene mtnX 922540 921863 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 protein_id gnl|my_center|LOCUS_08500 923043 924464 gene locus_tag LOCUS_08510 923043 924464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 924589 925011 gene locus_tag LOCUS_08520 924589 925011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 925605 925012 gene locus_tag LOCUS_08530 925605 925012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 925875 927077 gene locus_tag LOCUS_08540 925875 927077 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_08540 927508 927104 gene locus_tag LOCUS_08550 gene nifU 927508 927104 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_08550 929096 927510 gene locus_tag LOCUS_08560 gene pruA 929096 927510 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 protein_id gnl|my_center|LOCUS_08560 929814 929119 gene locus_tag LOCUS_08570 gene nfi 929814 929119 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082416.1 protein_id gnl|my_center|LOCUS_08570 929913 930782 gene locus_tag LOCUS_08580 gene xerD 929913 930782 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_08580 930896 931282 gene locus_tag LOCUS_08590 930896 931282 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_08590 931307 931534 gene locus_tag LOCUS_08600 931307 931534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 931531 932784 gene locus_tag LOCUS_08610 931531 932784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 932835 933482 gene locus_tag LOCUS_08620 932835 933482 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416612.1 protein_id gnl|my_center|LOCUS_08620 934350 933484 gene locus_tag LOCUS_08630 gene pheA 934350 933484 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_08630 934518 936590 gene locus_tag LOCUS_08640 934518 936590 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_08640 937543 936656 gene locus_tag LOCUS_08650 gene htpX 937543 936656 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545548.1 protein_id gnl|my_center|LOCUS_08650 938019 937609 gene locus_tag LOCUS_08660 938019 937609 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_08660 938141 940123 gene locus_tag LOCUS_08670 gene acs 938141 940123 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_08670 940275 941540 gene locus_tag LOCUS_08680 940275 941540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 941911 941660 gene locus_tag LOCUS_08690 941911 941660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 942045 942398 gene locus_tag LOCUS_08700 942045 942398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 942410 943177 gene locus_tag LOCUS_08710 942410 943177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542058.1 protein_id gnl|my_center|LOCUS_08710 944002 943253 gene locus_tag LOCUS_08720 944002 943253 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256951.1 protein_id gnl|my_center|LOCUS_08720 944183 945085 gene locus_tag LOCUS_08730 944183 945085 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_08730 945231 945806 gene locus_tag LOCUS_08740 945231 945806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 946761 945826 gene locus_tag LOCUS_08750 gene parJ 946761 945826 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_08750 947180 947665 gene locus_tag LOCUS_08760 947180 947665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 950414 947667 gene locus_tag LOCUS_08770 950414 947667 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_08770 950552 951718 gene locus_tag LOCUS_08780 950552 951718 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706990.1 protein_id gnl|my_center|LOCUS_08780 951889 952512 gene locus_tag LOCUS_08790 951889 952512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 952641 952937 gene locus_tag LOCUS_08800 952641 952937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 953855 953028 gene locus_tag LOCUS_08810 953855 953028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 954096 954941 gene locus_tag LOCUS_08820 954096 954941 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_08820 955067 956149 gene locus_tag LOCUS_08830 955067 956149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148691226.1 protein_id gnl|my_center|LOCUS_08830 956153 957064 gene locus_tag LOCUS_08840 956153 957064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_08840 957065 958144 gene locus_tag LOCUS_08850 957065 958144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_08850 958125 959162 gene locus_tag LOCUS_08860 958125 959162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_08860 959165 959344 gene locus_tag LOCUS_08870 959165 959344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 959800 961491 gene locus_tag LOCUS_08880 959800 961491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 962167 961538 gene locus_tag LOCUS_08890 962167 961538 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287303.1 protein_id gnl|my_center|LOCUS_08890 962603 963223 gene locus_tag LOCUS_08900 962603 963223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 963248 963988 gene locus_tag LOCUS_08910 963248 963988 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313622.1 protein_id gnl|my_center|LOCUS_08910 963985 964755 gene locus_tag LOCUS_08920 963985 964755 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894626.1 protein_id gnl|my_center|LOCUS_08920 966302 964782 gene locus_tag LOCUS_08930 966302 964782 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_08930 967283 966381 gene locus_tag LOCUS_08940 967283 966381 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_08940 968265 967360 gene locus_tag LOCUS_08950 gene truB 968265 967360 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917926.1 protein_id gnl|my_center|LOCUS_08950 968605 968240 gene locus_tag LOCUS_08960 gene rbfA 968605 968240 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776442.1 protein_id gnl|my_center|LOCUS_08960 970580 968607 gene locus_tag LOCUS_08970 gene infB 970580 968607 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258865.1 protein_id gnl|my_center|LOCUS_08970 972069 970951 gene locus_tag LOCUS_08980 gene nusA 972069 970951 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258863.1 protein_id gnl|my_center|LOCUS_08980 972317 973327 gene locus_tag LOCUS_08990 gene gap 972317 973327 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_08990 973329 974498 gene locus_tag LOCUS_09000 973329 974498 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_09000 974491 975243 gene locus_tag LOCUS_09010 gene tpiA 974491 975243 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_09010 975285 975506 gene locus_tag LOCUS_09020 975285 975506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 975542 975730 gene locus_tag LOCUS_09030 975542 975730 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_09030 975803 976618 gene locus_tag LOCUS_09040 975803 976618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 976636 977178 gene locus_tag LOCUS_09050 976636 977178 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_09050 977191 977895 gene locus_tag LOCUS_09060 gene rnc 977191 977895 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882136.1 protein_id gnl|my_center|LOCUS_09060 977916 978539 gene locus_tag LOCUS_09070 977916 978539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 979229 978534 gene locus_tag LOCUS_09080 979229 978534 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_09080 979325 979250 gene locus_tag LOCUS_t00170 979325 979250 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 979428 979503 gene locus_tag LOCUS_t00180 979428 979503 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 980696 979605 gene locus_tag LOCUS_09090 980696 979605 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_09090 981499 981197 gene locus_tag LOCUS_09100 981499 981197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 983586 981496 gene locus_tag LOCUS_09110 983586 981496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 983844 983668 gene locus_tag LOCUS_09120 983844 983668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 984104 984181 gene locus_tag LOCUS_t00190 984104 984181 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 984944 986479 gene locus_tag LOCUS_09130 984944 986479 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257484.1 protein_id gnl|my_center|LOCUS_09130 986551 987615 gene locus_tag LOCUS_09140 gene ruvB 986551 987615 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_09140 987838 988848 gene locus_tag LOCUS_09150 gene queA 987838 988848 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830755.1 protein_id gnl|my_center|LOCUS_09150 988857 990041 gene locus_tag LOCUS_09160 gene tgt 988857 990041 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_09160 990063 990467 gene locus_tag LOCUS_09170 gene acpS 990063 990467 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_09170 990472 992025 gene locus_tag LOCUS_09180 990472 992025 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_09180 992049 993179 gene locus_tag LOCUS_09190 gene alr 992049 993179 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09190 993197 993808 gene locus_tag LOCUS_09200 993197 993808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 993913 995403 gene locus_tag LOCUS_09210 993913 995403 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_09210 995450 996358 gene locus_tag LOCUS_09220 995450 996358 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_09220 996361 997080 gene locus_tag LOCUS_09230 996361 997080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 997077 997766 gene locus_tag LOCUS_09240 997077 997766 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_09240 998992 997763 gene locus_tag LOCUS_09250 998992 997763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 999774 998989 gene locus_tag LOCUS_09260 999774 998989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1000012 1000785 gene locus_tag LOCUS_09270 1000012 1000785 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_09270 1001699 1000722 gene locus_tag LOCUS_09280 gene fmt 1001699 1000722 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255944.1 protein_id gnl|my_center|LOCUS_09280 1005356 1005928 gene locus_tag LOCUS_09290 1005356 1005928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1006192 1005995 gene locus_tag LOCUS_09300 1006192 1005995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1006702 1006469 gene locus_tag LOCUS_09310 1006702 1006469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1007180 1007001 gene locus_tag LOCUS_09320 1007180 1007001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1007700 1008149 gene locus_tag LOCUS_09330 1007700 1008149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1008231 1008307 gene locus_tag LOCUS_t00200 1008231 1008307 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1008319 1008392 gene locus_tag LOCUS_t00210 1008319 1008392 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1008877 1009698 gene locus_tag LOCUS_09340 1008877 1009698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1009997 1009695 gene locus_tag LOCUS_09350 1009997 1009695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1010295 1011977 gene locus_tag LOCUS_09360 gene lepA 1010295 1011977 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_09360 1011974 1013485 gene locus_tag LOCUS_09370 gene mazG 1011974 1013485 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099544.1 protein_id gnl|my_center|LOCUS_09370 1013486 1015297 gene locus_tag LOCUS_09380 gene aspS 1013486 1015297 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_09380 1016832 1015306 gene locus_tag LOCUS_09390 1016832 1015306 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_09390 1017745 1016837 gene locus_tag LOCUS_09400 1017745 1016837 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258205.1 protein_id gnl|my_center|LOCUS_09400 1019479 1017767 gene locus_tag LOCUS_09410 1019479 1017767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258206.1 protein_id gnl|my_center|LOCUS_09410 1019633 1019484 gene locus_tag LOCUS_09420 1019633 1019484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1020543 1019692 gene locus_tag LOCUS_09430 1020543 1019692 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_09430 1021369 1020536 gene locus_tag LOCUS_09440 1021369 1020536 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_09440 1021881 1021366 gene locus_tag LOCUS_09450 gene ruvC 1021881 1021366 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_09450 1022643 1021885 gene locus_tag LOCUS_09460 1022643 1021885 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256931.1 protein_id gnl|my_center|LOCUS_09460 1022818 1024413 gene locus_tag LOCUS_09470 gene guaA 1022818 1024413 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_09470 1024413 1025705 gene locus_tag LOCUS_09480 gene purD 1024413 1025705 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228217.1 protein_id gnl|my_center|LOCUS_09480 1025749 1025676 gene locus_tag LOCUS_t00220 1025749 1025676 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1025825 1026175 gene locus_tag LOCUS_09490 1025825 1026175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1027097 1026258 gene locus_tag LOCUS_09500 1027097 1026258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1028408 1027110 gene locus_tag LOCUS_09510 gene miaB 1028408 1027110 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_09510 1029766 1028528 gene locus_tag LOCUS_09520 1029766 1028528 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_09520 1030147 1029836 gene locus_tag LOCUS_09530 1030147 1029836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1030988 1030233 gene locus_tag LOCUS_09540 gene fabL 1030988 1030233 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_09540 1031136 1032293 gene locus_tag LOCUS_09550 1031136 1032293 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263749.1 protein_id gnl|my_center|LOCUS_09550 1033454 1032339 gene locus_tag LOCUS_09560 1033454 1032339 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_09560 1033568 1033906 gene locus_tag LOCUS_09570 1033568 1033906 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 protein_id gnl|my_center|LOCUS_09570 1033929 1035047 gene locus_tag LOCUS_09580 1033929 1035047 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020242.1 protein_id gnl|my_center|LOCUS_09580 1035051 1036208 gene locus_tag LOCUS_09590 1035051 1036208 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257321.1 protein_id gnl|my_center|LOCUS_09590 1037164 1036217 gene locus_tag LOCUS_09600 1037164 1036217 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_09600 1038354 1037260 gene locus_tag LOCUS_09610 1038354 1037260 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_09610 1038552 1039952 gene locus_tag LOCUS_09620 1038552 1039952 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939066.1 protein_id gnl|my_center|LOCUS_09620 1040106 1041377 gene locus_tag LOCUS_09630 1040106 1041377 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_09630 1044580 1041431 gene locus_tag LOCUS_09640 gene ileS 1044580 1041431 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_09640 1045596 1046867 gene locus_tag LOCUS_09650 gene serS 1045596 1046867 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_09650 1046914 1047000 gene locus_tag LOCUS_t00230 1046914 1047000 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1047050 1047142 gene locus_tag LOCUS_t00240 1047050 1047142 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1048425 1047085 gene locus_tag LOCUS_09660 1048425 1047085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1049643 1048645 gene locus_tag LOCUS_09670 1049643 1048645 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_09670 1050307 1049705 gene locus_tag LOCUS_09680 1050307 1049705 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545392.1 protein_id gnl|my_center|LOCUS_09680 1051148 1051480 gene locus_tag LOCUS_09690 gene trxA 1051148 1051480 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258400.1 protein_id gnl|my_center|LOCUS_09690 1051556 1052014 gene locus_tag LOCUS_09700 1051556 1052014 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_09700 1052596 1052018 gene locus_tag LOCUS_09710 1052596 1052018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1052595 1053767 gene locus_tag LOCUS_09720 gene xylA 1052595 1053767 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_09720 1054641 1053817 gene locus_tag LOCUS_09730 1054641 1053817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1054718 1055518 gene locus_tag LOCUS_09740 1054718 1055518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1055511 1056299 gene locus_tag LOCUS_09750 1055511 1056299 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_09750 1056296 1057957 gene locus_tag LOCUS_09760 1056296 1057957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1057991 1058731 gene locus_tag LOCUS_09770 gene nadE 1057991 1058731 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_09770 1058807 1059937 gene locus_tag LOCUS_09780 gene dnaN 1058807 1059937 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_09780 1060715 1059972 gene locus_tag LOCUS_09790 1060715 1059972 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_09790 1062029 1060872 gene locus_tag LOCUS_09800 gene mrfB 1062029 1060872 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_09800 1062259 1062894 gene locus_tag LOCUS_09810 1062259 1062894 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908282.1 protein_id gnl|my_center|LOCUS_09810 1063038 1064090 gene locus_tag LOCUS_09820 1063038 1064090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1064280 1066445 gene locus_tag LOCUS_09830 1064280 1066445 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_09830 1066558 1067430 gene locus_tag LOCUS_09840 1066558 1067430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1068383 1067439 gene locus_tag LOCUS_09850 1068383 1067439 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259101.1 protein_id gnl|my_center|LOCUS_09850 1068982 1068398 gene locus_tag LOCUS_09860 1068982 1068398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1069690 1069043 gene locus_tag LOCUS_09870 gene lexA 1069690 1069043 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256381.1 protein_id gnl|my_center|LOCUS_09870 1069879 1072761 gene locus_tag LOCUS_09880 1069879 1072761 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_09880 1073847 1072741 gene locus_tag LOCUS_09890 1073847 1072741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1074027 1074569 gene locus_tag LOCUS_09900 1074027 1074569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1074598 1074870 gene locus_tag LOCUS_09910 1074598 1074870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1075003 1077879 gene locus_tag LOCUS_09920 gene uvrA 1075003 1077879 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_09920 1078829 1077876 gene locus_tag LOCUS_09930 1078829 1077876 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814645.1 protein_id gnl|my_center|LOCUS_09930 1079015 1079090 gene locus_tag LOCUS_t00250 1079015 1079090 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1079245 1081695 gene locus_tag LOCUS_09940 gene leuS 1079245 1081695 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_09940 1082468 1081692 gene locus_tag LOCUS_09950 1082468 1081692 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 protein_id gnl|my_center|LOCUS_09950 1082591 1083886 gene locus_tag LOCUS_09960 gene purB 1082591 1083886 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545083.1 protein_id gnl|my_center|LOCUS_09960 1083883 1084773 gene locus_tag LOCUS_09970 1083883 1084773 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_09970 1084770 1085027 gene locus_tag LOCUS_09980 gene purS 1084770 1085027 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722248.1 protein_id gnl|my_center|LOCUS_09980 1085029 1085730 gene locus_tag LOCUS_09990 gene purQ 1085029 1085730 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933006.1 protein_id gnl|my_center|LOCUS_09990 1085727 1087937 gene locus_tag LOCUS_10000 gene purL 1085727 1087937 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_10000 1088704 1087934 gene locus_tag LOCUS_10010 1088704 1087934 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257704.1 protein_id gnl|my_center|LOCUS_10010 1090777 1088846 gene locus_tag LOCUS_10020 1090777 1088846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1091787 1090777 gene locus_tag LOCUS_10030 1091787 1090777 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_10030 1093219 1091801 gene locus_tag LOCUS_10040 1093219 1091801 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_10040 1094502 1093240 gene locus_tag LOCUS_10050 1094502 1093240 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_10050 1095305 1094529 gene locus_tag LOCUS_10060 1095305 1094529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1096873 1095401 gene locus_tag LOCUS_10070 1096873 1095401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1097277 1096870 gene locus_tag LOCUS_10080 1097277 1096870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1097725 1097288 gene locus_tag LOCUS_10090 1097725 1097288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1097939 1097748 gene locus_tag LOCUS_10100 1097939 1097748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1098251 1098033 gene locus_tag LOCUS_10110 1098251 1098033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1098918 1098367 gene locus_tag LOCUS_10120 1098918 1098367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1100020 1101045 gene locus_tag LOCUS_10130 1100020 1101045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1101118 1102542 gene locus_tag LOCUS_10140 1101118 1102542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1102558 1102911 gene locus_tag LOCUS_10150 1102558 1102911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1104766 1102913 gene locus_tag LOCUS_10160 1104766 1102913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1106799 1105198 gene locus_tag LOCUS_10170 1106799 1105198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1107012 1108079 gene locus_tag LOCUS_10180 gene mnmA 1107012 1108079 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_10180 1108173 1108544 gene locus_tag LOCUS_10190 1108173 1108544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1108534 1108710 gene locus_tag LOCUS_10200 1108534 1108710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1111000 1111530 gene locus_tag LOCUS_10210 1111000 1111530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1112555 1113013 gene locus_tag LOCUS_10220 1112555 1113013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1113719 1114066 gene locus_tag LOCUS_10230 1113719 1114066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1114069 1114908 gene locus_tag LOCUS_10240 1114069 1114908 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_10240 1114940 1115620 gene locus_tag LOCUS_10250 1114940 1115620 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_10250 1116943 1115588 gene locus_tag LOCUS_10260 1116943 1115588 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256342.1 protein_id gnl|my_center|LOCUS_10260 1117969 1116950 gene locus_tag LOCUS_10270 1117969 1116950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1118086 1120101 gene locus_tag LOCUS_10280 1118086 1120101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1120133 1120933 gene locus_tag LOCUS_10290 1120133 1120933 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_10290 1123020 1120930 gene locus_tag LOCUS_10300 gene fusA 1123020 1120930 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_10300 1123245 1123502 gene locus_tag LOCUS_10310 1123245 1123502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1123486 1124151 gene locus_tag LOCUS_10320 1123486 1124151 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_10320 1124484 1124116 gene locus_tag LOCUS_10330 1124484 1124116 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 protein_id gnl|my_center|LOCUS_10330 1125445 1124471 gene locus_tag LOCUS_10340 1125445 1124471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1125622 1125470 gene locus_tag LOCUS_10350 1125622 1125470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1125774 1125848 gene locus_tag LOCUS_t00260 1125774 1125848 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1125887 1125961 gene locus_tag LOCUS_t00270 1125887 1125961 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1127434 1127252 gene locus_tag LOCUS_10360 1127434 1127252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1127566 1129512 gene locus_tag LOCUS_10370 gene ftsH 1127566 1129512 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_10370 1129612 1130280 gene locus_tag LOCUS_10380 1129612 1130280 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_10380 1130292 1130495 gene locus_tag LOCUS_10390 1130292 1130495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1130488 1130829 gene locus_tag LOCUS_10400 1130488 1130829 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_10400 1130942 1131142 gene locus_tag LOCUS_10410 gene rpsU 1130942 1131142 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_10410 1131162 1131611 gene locus_tag LOCUS_10420 1131162 1131611 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_10420 1131621 1132109 gene locus_tag LOCUS_10430 1131621 1132109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1133213 1132095 gene locus_tag LOCUS_10440 1133213 1132095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1133826 1133203 gene locus_tag LOCUS_10450 1133826 1133203 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257587.1 protein_id gnl|my_center|LOCUS_10450 1133946 1134021 gene locus_tag LOCUS_t00280 1133946 1134021 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1134323 1134721 gene locus_tag LOCUS_10460 1134323 1134721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1134708 1135436 gene locus_tag LOCUS_10470 1134708 1135436 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_10470 1135439 1136803 gene locus_tag LOCUS_10480 1135439 1136803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081492.1 protein_id gnl|my_center|LOCUS_10480 1139945 1137018 gene locus_tag LOCUS_r00030 1139945 1137018 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1140116 1140042 gene locus_tag LOCUS_t00290 1140116 1140042 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1140199 1140124 gene locus_tag LOCUS_t00300 1140199 1140124 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1141745 1140243 gene locus_tag LOCUS_r00040 1141745 1140243 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1142325 1142888 gene locus_tag LOCUS_10490 1142325 1142888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1143505 1142885 gene locus_tag LOCUS_10500 gene nadD 1143505 1142885 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_10500 1144300 1143515 gene locus_tag LOCUS_10510 1144300 1143515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1146824 1144395 gene locus_tag LOCUS_10520 gene gyrA 1146824 1144395 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_10520 1146999 1148285 gene locus_tag LOCUS_10530 1146999 1148285 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_10530 1149295 1148282 gene locus_tag LOCUS_10540 1149295 1148282 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_10540 1150034 1149429 gene locus_tag LOCUS_10550 1150034 1149429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1150844 1150128 gene locus_tag LOCUS_10560 1150844 1150128 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583597.1 protein_id gnl|my_center|LOCUS_10560 1151905 1150841 gene locus_tag LOCUS_10570 1151905 1150841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1153313 1151922 gene locus_tag LOCUS_10580 1153313 1151922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1153718 1157260 gene locus_tag LOCUS_10590 1153718 1157260 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_10590 1158993 1157257 gene locus_tag LOCUS_10600 gene polX 1158993 1157257 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_10600 1159118 1160074 gene locus_tag LOCUS_10610 1159118 1160074 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_10610 1160093 1161373 gene locus_tag LOCUS_10620 1160093 1161373 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_10620 1161370 1163958 gene locus_tag LOCUS_10630 1161370 1163958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1164304 1163972 gene locus_tag LOCUS_10640 1164304 1163972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1165592 1164732 gene locus_tag LOCUS_10650 1165592 1164732 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_10650 1166184 1165669 gene locus_tag LOCUS_10660 1166184 1165669 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403782.1 protein_id gnl|my_center|LOCUS_10660 1166262 1166711 gene locus_tag LOCUS_10670 1166262 1166711 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531012.1 protein_id gnl|my_center|LOCUS_10670 1167027 1168553 gene locus_tag LOCUS_10680 1167027 1168553 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111158892.1 protein_id gnl|my_center|LOCUS_10680 1169261 1168569 gene locus_tag LOCUS_10690 1169261 1168569 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_10690 1169431 1169634 gene locus_tag LOCUS_10700 1169431 1169634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1170083 1169637 gene locus_tag LOCUS_10710 1170083 1169637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1171360 1170080 gene locus_tag LOCUS_10720 1171360 1170080 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315676.1 protein_id gnl|my_center|LOCUS_10720 1171464 1173851 gene locus_tag LOCUS_10730 1171464 1173851 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583217.1 protein_id gnl|my_center|LOCUS_10730 1173897 1174256 gene locus_tag LOCUS_10740 1173897 1174256 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_10740 1175735 1174317 gene locus_tag LOCUS_10750 1175735 1174317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1177554 1175713 gene locus_tag LOCUS_10760 1177554 1175713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1178520 1177579 gene locus_tag LOCUS_10770 1178520 1177579 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 protein_id gnl|my_center|LOCUS_10770 1179455 1178532 gene locus_tag LOCUS_10780 1179455 1178532 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_10780 1181044 1179452 gene locus_tag LOCUS_10790 1181044 1179452 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_10790 1181835 1181287 gene locus_tag LOCUS_10800 1181835 1181287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1183308 1181935 gene locus_tag LOCUS_10810 1183308 1181935 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_10810 1184051 1183365 gene locus_tag LOCUS_10820 1184051 1183365 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_10820 1184491 1185615 gene locus_tag LOCUS_10830 1184491 1185615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1188796 1185599 gene locus_tag LOCUS_10840 1188796 1185599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1190580 1188877 gene locus_tag LOCUS_10850 1190580 1188877 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_10850 1191493 1190612 gene locus_tag LOCUS_10860 1191493 1190612 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_10860 1192481 1191510 gene locus_tag LOCUS_10870 1192481 1191510 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_10870 1193210 1192608 gene locus_tag LOCUS_10880 1193210 1192608 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814029.1 protein_id gnl|my_center|LOCUS_10880 1193407 1194564 gene locus_tag LOCUS_10890 1193407 1194564 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085624.1 protein_id gnl|my_center|LOCUS_10890 1194579 1195742 gene locus_tag LOCUS_10900 1194579 1195742 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972772.1 protein_id gnl|my_center|LOCUS_10900 1195748 1196569 gene locus_tag LOCUS_10910 1195748 1196569 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228703.1 protein_id gnl|my_center|LOCUS_10910 1196680 1198074 gene locus_tag LOCUS_10920 1196680 1198074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1198052 1198708 gene locus_tag LOCUS_10930 1198052 1198708 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_10930 1198829 1200154 gene locus_tag LOCUS_10940 1198829 1200154 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 protein_id gnl|my_center|LOCUS_10940 1200141 1201154 gene locus_tag LOCUS_10950 1200141 1201154 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_10950 1201957 1201178 gene locus_tag LOCUS_10960 1201957 1201178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1202806 1201973 gene locus_tag LOCUS_10970 1202806 1201973 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_10970 1205999 1202808 gene locus_tag LOCUS_10980 1205999 1202808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1206187 1206696 gene locus_tag LOCUS_10990 1206187 1206696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1207365 1206724 gene locus_tag LOCUS_11000 1207365 1206724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1207529 1207750 gene locus_tag LOCUS_11010 1207529 1207750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1208750 1207755 gene locus_tag LOCUS_11020 1208750 1207755 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966741.1 protein_id gnl|my_center|LOCUS_11020 1210773 1208755 gene locus_tag LOCUS_11030 1210773 1208755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1211467 1210811 gene locus_tag LOCUS_11040 1211467 1210811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1211934 1211506 gene locus_tag LOCUS_11050 1211934 1211506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1212082 1212648 gene locus_tag LOCUS_11060 1212082 1212648 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466502.1 protein_id gnl|my_center|LOCUS_11060 1212651 1213613 gene locus_tag LOCUS_11070 1212651 1213613 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461138.1 protein_id gnl|my_center|LOCUS_11070 1213639 1214412 gene locus_tag LOCUS_11080 1213639 1214412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_11080 1216857 1214407 gene locus_tag LOCUS_11090 1216857 1214407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1217120 1217797 gene locus_tag LOCUS_11100 1217120 1217797 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_11100 1219757 1217871 gene locus_tag LOCUS_11110 1219757 1217871 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582880.1 protein_id gnl|my_center|LOCUS_11110 1220876 1219782 gene locus_tag LOCUS_11120 1220876 1219782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1221604 1222689 gene locus_tag LOCUS_11130 1221604 1222689 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530527.1 protein_id gnl|my_center|LOCUS_11130 1223432 1222863 gene locus_tag LOCUS_11140 1223432 1222863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1224871 1223510 gene locus_tag LOCUS_11150 1224871 1223510 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_11150 1225073 1227355 gene locus_tag LOCUS_11160 1225073 1227355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1227352 1227996 gene locus_tag LOCUS_11170 gene narL 1227352 1227996 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_11170 1228156 1228518 gene locus_tag LOCUS_11180 1228156 1228518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1228715 1229416 gene locus_tag LOCUS_11190 1228715 1229416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1229436 1230119 gene locus_tag LOCUS_11200 1229436 1230119 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460434.1 protein_id gnl|my_center|LOCUS_11200 1230453 1231481 gene locus_tag LOCUS_11210 1230453 1231481 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510026.1 protein_id gnl|my_center|LOCUS_11210 1231635 1232003 gene locus_tag LOCUS_11220 1231635 1232003 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 protein_id gnl|my_center|LOCUS_11220 1231996 1234134 gene locus_tag LOCUS_11230 1231996 1234134 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_11230 1234615 1235427 gene locus_tag LOCUS_11240 1234615 1235427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1237855 1235534 gene locus_tag LOCUS_11250 1237855 1235534 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_11250 1239186 1237939 gene locus_tag LOCUS_11260 1239186 1237939 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_11260 1240081 1239179 gene locus_tag LOCUS_11270 1240081 1239179 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_11270 1240362 1244171 gene locus_tag LOCUS_11280 1240362 1244171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1244588 1244887 gene locus_tag LOCUS_11290 1244588 1244887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1245168 1245296 gene locus_tag LOCUS_11300 1245168 1245296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1245337 1245606 gene locus_tag LOCUS_11310 1245337 1245606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11310 1245722 1246066 gene locus_tag LOCUS_11320 1245722 1246066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1245982 1246374 gene locus_tag LOCUS_11330 1245982 1246374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11330 1246571 1246936 gene locus_tag LOCUS_11340 1246571 1246936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1247003 1247335 gene locus_tag LOCUS_11350 1247003 1247335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1247705 1247866 gene locus_tag LOCUS_11360 1247705 1247866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1248641 1248288 gene locus_tag LOCUS_11370 1248641 1248288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1249045 1248794 gene locus_tag LOCUS_11380 1249045 1248794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1249626 1249078 gene locus_tag LOCUS_11390 1249626 1249078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11390 1250045 1249623 gene locus_tag LOCUS_11400 1250045 1249623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1251798 1250206 gene locus_tag LOCUS_11410 1251798 1250206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11410 1253507 1251876 gene locus_tag LOCUS_11420 1253507 1251876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_11420 1253506 1253640 gene locus_tag LOCUS_11430 1253506 1253640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1255951 1253972 gene locus_tag LOCUS_11440 1255951 1253972 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_11440 1256756 1256421 gene locus_tag LOCUS_11450 1256756 1256421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1257160 1257450 gene locus_tag LOCUS_11460 1257160 1257450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1257612 1257818 gene locus_tag LOCUS_11470 1257612 1257818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1258150 1257914 gene locus_tag LOCUS_11480 1258150 1257914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1258440 1259102 gene locus_tag LOCUS_11490 1258440 1259102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1259466 1259179 gene locus_tag LOCUS_11500 1259466 1259179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1259540 1260109 gene locus_tag LOCUS_11510 1259540 1260109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1260046 1260312 gene locus_tag LOCUS_11520 1260046 1260312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11520 1261907 1261029 gene locus_tag LOCUS_11530 1261907 1261029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1261976 1262293 gene locus_tag LOCUS_11540 1261976 1262293 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233591.1 protein_id gnl|my_center|LOCUS_11540 1262290 1263708 gene locus_tag LOCUS_11550 1262290 1263708 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_11550 1265018 1263705 gene locus_tag LOCUS_11560 1265018 1263705 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_11560 1265197 1265033 gene locus_tag LOCUS_11570 1265197 1265033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1266764 1265166 gene locus_tag LOCUS_11580 1266764 1265166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257958.1 protein_id gnl|my_center|LOCUS_11580 1268733 1266952 gene locus_tag LOCUS_11590 1268733 1266952 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872038.1 protein_id gnl|my_center|LOCUS_11590 1268906 1269583 gene locus_tag LOCUS_11600 1268906 1269583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1270620 1269586 gene locus_tag LOCUS_11610 gene corA 1270620 1269586 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821727.1 protein_id gnl|my_center|LOCUS_11610 1271385 1270735 gene locus_tag LOCUS_11620 1271385 1270735 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020434.1 protein_id gnl|my_center|LOCUS_11620 1272160 1271375 gene locus_tag LOCUS_11630 1272160 1271375 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_11630 1273166 1272171 gene locus_tag LOCUS_11640 1273166 1272171 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_11640 1274419 1273244 gene locus_tag LOCUS_11650 1274419 1273244 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119434.1 protein_id gnl|my_center|LOCUS_11650 1275774 1274419 gene locus_tag LOCUS_11660 1275774 1274419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1276580 1275843 gene locus_tag LOCUS_11670 1276580 1275843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1277141 1277329 gene locus_tag LOCUS_11680 1277141 1277329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1278460 1278912 gene locus_tag LOCUS_11690 1278460 1278912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1280170 1278881 gene locus_tag LOCUS_11700 1280170 1278881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1280975 1280205 gene locus_tag LOCUS_11710 1280975 1280205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1283083 1281560 gene locus_tag LOCUS_11720 1283083 1281560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1283843 1283106 gene locus_tag LOCUS_11730 1283843 1283106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1284033 1285001 gene locus_tag LOCUS_11740 1284033 1285001 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744700.1 protein_id gnl|my_center|LOCUS_11740 1285026 1286198 gene locus_tag LOCUS_11750 1285026 1286198 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_11750 1287232 1286195 gene locus_tag LOCUS_11760 1287232 1286195 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435274.1 protein_id gnl|my_center|LOCUS_11760 1287569 1287243 gene locus_tag LOCUS_11770 1287569 1287243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1288841 1287597 gene locus_tag LOCUS_11780 gene metK 1288841 1287597 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258872.1 protein_id gnl|my_center|LOCUS_11780 1289167 1291056 gene locus_tag LOCUS_11790 1289167 1291056 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_11790 1291073 1293376 gene locus_tag LOCUS_11800 gene metE 1291073 1293376 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404021.1 protein_id gnl|my_center|LOCUS_11800 1294617 1293430 gene locus_tag LOCUS_11810 gene citZ 1294617 1293430 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_11810 1294720 1295514 gene locus_tag LOCUS_11820 1294720 1295514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329945.1 protein_id gnl|my_center|LOCUS_11820 1296996 1295539 gene locus_tag LOCUS_11830 gene purF 1296996 1295539 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_11830 1297558 1298136 gene locus_tag LOCUS_11840 1297558 1298136 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392990.1 protein_id gnl|my_center|LOCUS_11840 1298760 1298140 gene locus_tag LOCUS_11850 1298760 1298140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1300087 1299209 gene locus_tag LOCUS_11860 1300087 1299209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1300473 1300697 gene locus_tag LOCUS_11870 1300473 1300697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1301528 1302397 gene locus_tag LOCUS_11880 1301528 1302397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1303391 1302447 gene locus_tag LOCUS_11890 1303391 1302447 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_11890 1303601 1303401 gene locus_tag LOCUS_11900 1303601 1303401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1303909 1303709 gene locus_tag LOCUS_11910 1303909 1303709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1305606 1304560 gene locus_tag LOCUS_11920 1305606 1304560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210193.1 protein_id gnl|my_center|LOCUS_11920 1305671 1307455 gene locus_tag LOCUS_11930 1305671 1307455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_11930 1307564 1308571 gene locus_tag LOCUS_11940 gene moaA 1307564 1308571 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_11940 1309017 1308568 gene locus_tag LOCUS_11950 1309017 1308568 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_11950 1309635 1309024 gene locus_tag LOCUS_11960 gene def 1309635 1309024 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258946.1 protein_id gnl|my_center|LOCUS_11960 1310297 1309665 gene locus_tag LOCUS_11970 1310297 1309665 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_11970 1310430 1311608 gene locus_tag LOCUS_11980 gene cysS 1310430 1311608 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_11980 1313526 1311676 gene locus_tag LOCUS_11990 1313526 1311676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1314311 1313640 gene locus_tag LOCUS_12000 1314311 1313640 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_12000 1315074 1314325 gene locus_tag LOCUS_12010 1315074 1314325 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362617.1 protein_id gnl|my_center|LOCUS_12010 1316142 1315168 gene locus_tag LOCUS_12020 1316142 1315168 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557566.1 protein_id gnl|my_center|LOCUS_12020 1316251 1316637 gene locus_tag LOCUS_12030 1316251 1316637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1317903 1316692 gene locus_tag LOCUS_12040 gene megL 1317903 1316692 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_12040 1318931 1317897 gene locus_tag LOCUS_12050 1318931 1317897 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_12050 1320529 1318946 gene locus_tag LOCUS_12060 1320529 1318946 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_12060 1320723 1321028 gene locus_tag LOCUS_12070 1320723 1321028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1321053 1323656 gene locus_tag LOCUS_12080 gene clpB 1321053 1323656 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_12080 1324991 1323693 gene locus_tag LOCUS_12090 1324991 1323693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943876.1 protein_id gnl|my_center|LOCUS_12090 1325201 1325374 gene locus_tag LOCUS_12100 1325201 1325374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1325815 1326585 gene locus_tag LOCUS_12110 1325815 1326585 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_12110 1326818 1327606 gene locus_tag LOCUS_12120 1326818 1327606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 protein_id gnl|my_center|LOCUS_12120 1327572 1328351 gene locus_tag LOCUS_12130 1327572 1328351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172561.1 protein_id gnl|my_center|LOCUS_12130 1328360 1329442 gene locus_tag LOCUS_12140 1328360 1329442 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256331.1 protein_id gnl|my_center|LOCUS_12140 1329591 1330244 gene locus_tag LOCUS_12150 gene thiE 1329591 1330244 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_12150 1333009 1330265 gene locus_tag LOCUS_12160 gene acnA 1333009 1330265 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_12160 1333722 1333030 gene locus_tag LOCUS_12170 1333722 1333030 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583622.1 protein_id gnl|my_center|LOCUS_12170 1334703 1333726 gene locus_tag LOCUS_12180 gene trxB 1334703 1333726 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_12180 1334893 1335984 gene locus_tag LOCUS_12190 1334893 1335984 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_12190 1336796 1335999 gene locus_tag LOCUS_12200 1336796 1335999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1337247 1336786 gene locus_tag LOCUS_12210 1337247 1336786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1339217 1338312 gene locus_tag LOCUS_12220 1339217 1338312 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_12220 1340059 1339244 gene locus_tag LOCUS_12230 gene menB 1340059 1339244 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_12230 1342686 1340923 gene locus_tag LOCUS_12240 gene menD 1342686 1340923 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 protein_id gnl|my_center|LOCUS_12240 1344092 1342695 gene locus_tag LOCUS_12250 1344092 1342695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1345213 1344149 gene locus_tag LOCUS_12260 1345213 1344149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1345362 1346081 gene locus_tag LOCUS_12270 1345362 1346081 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_12270 1346283 1348097 gene locus_tag LOCUS_12280 1346283 1348097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1348216 1349277 gene locus_tag LOCUS_12290 1348216 1349277 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256958.1 protein_id gnl|my_center|LOCUS_12290 1349319 1350803 gene locus_tag LOCUS_12300 1349319 1350803 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_12300 1352153 1350834 gene locus_tag LOCUS_12310 gene hisS 1352153 1350834 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258794.1 protein_id gnl|my_center|LOCUS_12310 1352268 1353353 gene locus_tag LOCUS_12320 gene aroB 1352268 1353353 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257969.1 protein_id gnl|my_center|LOCUS_12320 1353350 1353787 gene locus_tag LOCUS_12330 gene aroQ 1353350 1353787 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256299.1 protein_id gnl|my_center|LOCUS_12330 1353816 1354109 gene locus_tag LOCUS_12340 1353816 1354109 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942472.1 protein_id gnl|my_center|LOCUS_12340 1354106 1354561 gene locus_tag LOCUS_12350 1354106 1354561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1354582 1354869 gene locus_tag LOCUS_12360 1354582 1354869 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259430.1 protein_id gnl|my_center|LOCUS_12360 1354892 1356547 gene locus_tag LOCUS_12370 1354892 1356547 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_12370 1357618 1356581 gene locus_tag LOCUS_12380 gene aroF 1357618 1356581 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_12380 1358499 1357651 gene locus_tag LOCUS_12390 gene trpA 1358499 1357651 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546593.1 protein_id gnl|my_center|LOCUS_12390 1359721 1358492 gene locus_tag LOCUS_12400 gene trpB 1359721 1358492 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_12400 1360344 1359718 gene locus_tag LOCUS_12410 1360344 1359718 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_12410 1361140 1360328 gene locus_tag LOCUS_12420 gene trpC 1361140 1360328 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 protein_id gnl|my_center|LOCUS_12420 1362192 1361146 gene locus_tag LOCUS_12430 gene trpS 1362192 1361146 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_12430 1363254 1362214 gene locus_tag LOCUS_12440 gene trpD 1363254 1362214 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_12440 1363854 1363258 gene locus_tag LOCUS_12450 1363854 1363258 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_12450 1365337 1363835 gene locus_tag LOCUS_12460 gene trpE 1365337 1363835 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_12460 1366258 1365722 gene locus_tag LOCUS_12470 1366258 1365722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1367008 1366292 gene locus_tag LOCUS_12480 1367008 1366292 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_12480 1368205 1367036 gene locus_tag LOCUS_12490 1368205 1367036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1369915 1368233 gene locus_tag LOCUS_12500 1369915 1368233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1371144 1370413 gene locus_tag LOCUS_12510 1371144 1370413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1371525 1371166 gene locus_tag LOCUS_12520 1371525 1371166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1371695 1372006 gene locus_tag LOCUS_12530 1371695 1372006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1372116 1372853 gene locus_tag LOCUS_12540 1372116 1372853 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_12540 1374047 1372854 gene locus_tag LOCUS_12550 gene coaBC 1374047 1372854 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259488.1 protein_id gnl|my_center|LOCUS_12550 1374828 1374040 gene locus_tag LOCUS_12560 1374828 1374040 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_12560 1375701 1374832 gene locus_tag LOCUS_12570 gene panC 1375701 1374832 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_12570 1376036 1375698 gene locus_tag LOCUS_12580 1376036 1375698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1376542 1376324 gene locus_tag LOCUS_12590 1376542 1376324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1376742 1377944 gene locus_tag LOCUS_12600 1376742 1377944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1377989 1378927 gene locus_tag LOCUS_12610 1377989 1378927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1378918 1379517 gene locus_tag LOCUS_12620 1378918 1379517 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258667.1 protein_id gnl|my_center|LOCUS_12620 1379544 1380266 gene locus_tag LOCUS_12630 1379544 1380266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1380640 1380263 gene locus_tag LOCUS_12640 1380640 1380263 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_12640 1381292 1380633 gene locus_tag LOCUS_12650 1381292 1380633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1381659 1381303 gene locus_tag LOCUS_12660 gene rplS 1381659 1381303 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257535.1 protein_id gnl|my_center|LOCUS_12660 1381884 1382333 gene locus_tag LOCUS_12670 1381884 1382333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1383151 1382339 gene locus_tag LOCUS_12680 1383151 1382339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1383322 1383534 gene locus_tag LOCUS_12690 1383322 1383534 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909342.1 protein_id gnl|my_center|LOCUS_12690 1383531 1384883 gene locus_tag LOCUS_12700 1383531 1384883 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057231.1 protein_id gnl|my_center|LOCUS_12700 1385680 1384895 gene locus_tag LOCUS_12710 1385680 1384895 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_12710 1387672 1385696 gene locus_tag LOCUS_12720 gene uvrB 1387672 1385696 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256952.1 protein_id gnl|my_center|LOCUS_12720 1388390 1387836 gene locus_tag LOCUS_12730 1388390 1387836 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_12730 1388548 1388850 gene locus_tag LOCUS_12740 1388548 1388850 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357080.1 protein_id gnl|my_center|LOCUS_12740 1390813 1388942 gene locus_tag LOCUS_12750 1390813 1388942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_12750 1391597 1390806 gene locus_tag LOCUS_12760 1391597 1390806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1391809 1391967 gene locus_tag LOCUS_12770 1391809 1391967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1392558 1392085 gene locus_tag LOCUS_12780 1392558 1392085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1392844 1394325 gene locus_tag LOCUS_12790 1392844 1394325 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_12790 1395582 1394368 gene locus_tag LOCUS_12800 1395582 1394368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1396744 1395575 gene locus_tag LOCUS_12810 gene solA 1396744 1395575 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_12810 1397667 1396852 gene locus_tag LOCUS_12820 1397667 1396852 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726998.1 protein_id gnl|my_center|LOCUS_12820 1398553 1397660 gene locus_tag LOCUS_12830 1398553 1397660 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624137.1 protein_id gnl|my_center|LOCUS_12830 1399746 1398565 gene locus_tag LOCUS_12840 1399746 1398565 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726997.1 protein_id gnl|my_center|LOCUS_12840 1402837 1400096 gene locus_tag LOCUS_12850 1402837 1400096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1403062 1403856 gene locus_tag LOCUS_12860 gene pyrF 1403062 1403856 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931823.1 protein_id gnl|my_center|LOCUS_12860 1404843 1403875 gene locus_tag LOCUS_12870 gene corA 1404843 1403875 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_12870 1406131 1404911 gene locus_tag LOCUS_12880 1406131 1404911 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_12880 1406320 1407429 gene locus_tag LOCUS_12890 1406320 1407429 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 protein_id gnl|my_center|LOCUS_12890 1408255 1407467 gene locus_tag LOCUS_12900 1408255 1407467 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 protein_id gnl|my_center|LOCUS_12900 1409973 1408273 gene locus_tag LOCUS_12910 1409973 1408273 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034312.1 protein_id gnl|my_center|LOCUS_12910 1410052 1410867 gene locus_tag LOCUS_12920 1410052 1410867 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_12920 1411380 1411775 gene locus_tag LOCUS_12930 1411380 1411775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1413472 1413107 gene locus_tag LOCUS_12940 1413472 1413107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1414826 1413834 gene locus_tag LOCUS_12950 1414826 1413834 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_12950 1415239 1414982 gene locus_tag LOCUS_12960 1415239 1414982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1415907 1415236 gene locus_tag LOCUS_12970 1415907 1415236 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227967.1 protein_id gnl|my_center|LOCUS_12970 1417284 1415944 gene locus_tag LOCUS_12980 1417284 1415944 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933564.1 protein_id gnl|my_center|LOCUS_12980 1417731 1417375 gene locus_tag LOCUS_12990 1417731 1417375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1418194 1417754 gene locus_tag LOCUS_13000 1418194 1417754 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_13000 1418714 1418217 gene locus_tag LOCUS_13010 1418714 1418217 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262519.1 protein_id gnl|my_center|LOCUS_13010 1420134 1418788 gene locus_tag LOCUS_13020 1420134 1418788 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 protein_id gnl|my_center|LOCUS_13020 1421068 1420202 gene locus_tag LOCUS_13030 1421068 1420202 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 protein_id gnl|my_center|LOCUS_13030 1422248 1421154 gene locus_tag LOCUS_13040 1422248 1421154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1423273 1422305 gene locus_tag LOCUS_13050 1423273 1422305 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_13050 1423487 1423942 gene locus_tag LOCUS_13060 1423487 1423942 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_13060 1424184 1425068 gene locus_tag LOCUS_13070 1424184 1425068 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227725.1 protein_id gnl|my_center|LOCUS_13070 1425188 1425625 gene locus_tag LOCUS_13080 1425188 1425625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1425813 1426370 gene locus_tag LOCUS_13090 1425813 1426370 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258349.1 protein_id gnl|my_center|LOCUS_13090 1426354 1427172 gene locus_tag LOCUS_13100 gene modA 1426354 1427172 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_13100 1427187 1428050 gene locus_tag LOCUS_13110 1427187 1428050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_13110 1428160 1428084 gene locus_tag LOCUS_t00310 1428160 1428084 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1429198 1428359 gene locus_tag LOCUS_13120 1429198 1428359 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_13120 1430191 1429217 gene locus_tag LOCUS_13130 1430191 1429217 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_13130 1430383 1430601 gene locus_tag LOCUS_13140 1430383 1430601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1430585 1431712 gene locus_tag LOCUS_13150 1430585 1431712 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284240.1 protein_id gnl|my_center|LOCUS_13150 1433077 1431689 gene locus_tag LOCUS_13160 1433077 1431689 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880656.1 protein_id gnl|my_center|LOCUS_13160 1433191 1433409 gene locus_tag LOCUS_13170 1433191 1433409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1434714 1433413 gene locus_tag LOCUS_13180 1434714 1433413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_13180 1434869 1435858 gene locus_tag LOCUS_13190 1434869 1435858 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_13190 1435880 1436251 gene locus_tag LOCUS_13200 1435880 1436251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1436328 1437299 gene locus_tag LOCUS_13210 1436328 1437299 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_13210 1438971 1437328 gene locus_tag LOCUS_13220 gene mutL 1438971 1437328 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_13220 1441849 1439057 gene locus_tag LOCUS_13230 gene mutS 1441849 1439057 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_13230 1442181 1443815 gene locus_tag LOCUS_13240 1442181 1443815 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119621.1 protein_id gnl|my_center|LOCUS_13240 1443815 1445005 gene locus_tag LOCUS_13250 1443815 1445005 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_13250 1445013 1445384 gene locus_tag LOCUS_13260 1445013 1445384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1446083 1445448 gene locus_tag LOCUS_13270 1446083 1445448 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887569.1 protein_id gnl|my_center|LOCUS_13270 1446509 1446291 gene locus_tag LOCUS_13280 1446509 1446291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1447092 1449020 gene locus_tag LOCUS_13290 1447092 1449020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1450051 1449038 gene locus_tag LOCUS_13300 gene hemB 1450051 1449038 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_13300 1450876 1450076 gene locus_tag LOCUS_13310 1450876 1450076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1451805 1450897 gene locus_tag LOCUS_13320 gene hemC 1451805 1450897 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933094.1 protein_id gnl|my_center|LOCUS_13320 1451882 1453051 gene locus_tag LOCUS_13330 gene nifS 1451882 1453051 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_13330 1453981 1453040 gene locus_tag LOCUS_13340 1453981 1453040 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_13340 1454495 1453959 gene locus_tag LOCUS_13350 gene lspA 1454495 1453959 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_13350 1454882 1454502 gene locus_tag LOCUS_13360 1454882 1454502 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871759.1 protein_id gnl|my_center|LOCUS_13360 1455000 1456148 gene locus_tag LOCUS_13370 gene murG 1455000 1456148 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_13370 1457549 1456167 gene locus_tag LOCUS_13380 gene radA 1457549 1456167 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_13380 1460105 1457643 gene locus_tag LOCUS_13390 1460105 1457643 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_13390 1461542 1460247 gene locus_tag LOCUS_13400 gene rpsA 1461542 1460247 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_13400 1462787 1461696 gene locus_tag LOCUS_13410 1462787 1461696 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582464.1 protein_id gnl|my_center|LOCUS_13410 1462919 1464235 gene locus_tag LOCUS_13420 1462919 1464235 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255920.1 protein_id gnl|my_center|LOCUS_13420 1464219 1464779 gene locus_tag LOCUS_13430 1464219 1464779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1464772 1465353 gene locus_tag LOCUS_13440 gene pth 1464772 1465353 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_13440 1465740 1468862 gene locus_tag LOCUS_13450 gene mfd 1465740 1468862 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_13450 1471233 1468849 gene locus_tag LOCUS_13460 1471233 1468849 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_13460 1471348 1472799 gene locus_tag LOCUS_13470 gene gcvPB 1471348 1472799 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_13470 1472844 1474265 gene locus_tag LOCUS_13480 gene fabF 1472844 1474265 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257800.1 protein_id gnl|my_center|LOCUS_13480 1474271 1475017 gene locus_tag LOCUS_13490 1474271 1475017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1475031 1476068 gene locus_tag LOCUS_13500 gene holB 1475031 1476068 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_13500 1476065 1476640 gene locus_tag LOCUS_13510 1476065 1476640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1476883 1476623 gene locus_tag LOCUS_13520 1476883 1476623 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258553.1 protein_id gnl|my_center|LOCUS_13520 1477909 1476947 gene locus_tag LOCUS_13530 gene hemW 1477909 1476947 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256118.1 protein_id gnl|my_center|LOCUS_13530 1478246 1479724 gene locus_tag LOCUS_13540 gene pepA 1478246 1479724 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487984.1 protein_id gnl|my_center|LOCUS_13540 1479748 1480716 gene locus_tag LOCUS_13550 gene sds 1479748 1480716 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_13550 1482360 1480699 gene locus_tag LOCUS_13560 1482360 1480699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1482471 1482680 gene locus_tag LOCUS_13570 1482471 1482680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1483257 1482670 gene locus_tag LOCUS_13580 gene pyrE 1483257 1482670 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083096.1 protein_id gnl|my_center|LOCUS_13580 1484146 1483265 gene locus_tag LOCUS_13590 gene cax 1484146 1483265 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482137.1 protein_id gnl|my_center|LOCUS_13590 1487646 1484359 gene locus_tag LOCUS_13600 gene carB 1487646 1484359 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_13600 1488752 1487646 gene locus_tag LOCUS_13610 1488752 1487646 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 protein_id gnl|my_center|LOCUS_13610 1490083 1488737 gene locus_tag LOCUS_13620 1490083 1488737 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257761.1 protein_id gnl|my_center|LOCUS_13620 1491011 1490076 gene locus_tag LOCUS_13630 1491011 1490076 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257760.1 protein_id gnl|my_center|LOCUS_13630 1492376 1491015 gene locus_tag LOCUS_13640 1492376 1491015 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972735.1 protein_id gnl|my_center|LOCUS_13640 1492939 1492379 gene locus_tag LOCUS_13650 gene pyrR 1492939 1492379 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_13650 1494550 1493105 gene locus_tag LOCUS_13660 1494550 1493105 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963828.1 protein_id gnl|my_center|LOCUS_13660 1496064 1494745 gene locus_tag LOCUS_13670 1496064 1494745 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259723.1 protein_id gnl|my_center|LOCUS_13670 1496182 1496511 gene locus_tag LOCUS_13680 1496182 1496511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1497271 1496516 gene locus_tag LOCUS_13690 1497271 1496516 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_13690 1497384 1497689 gene locus_tag LOCUS_13700 1497384 1497689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1497705 1500293 gene locus_tag LOCUS_13710 gene mutS 1497705 1500293 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_13710 1500745 1500290 gene locus_tag LOCUS_13720 gene ndk 1500745 1500290 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_13720 1501050 1500835 gene locus_tag LOCUS_13730 1501050 1500835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1502209 1501043 gene locus_tag LOCUS_13740 1502209 1501043 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256151.1 protein_id gnl|my_center|LOCUS_13740 1504087 1502228 gene locus_tag LOCUS_13750 gene selB 1504087 1502228 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_13750 1504234 1505886 gene locus_tag LOCUS_13760 gene dnaX 1504234 1505886 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458896.1 protein_id gnl|my_center|LOCUS_13760 1505883 1506182 gene locus_tag LOCUS_13770 1505883 1506182 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256425.1 protein_id gnl|my_center|LOCUS_13770 1506272 1507753 gene locus_tag LOCUS_13780 1506272 1507753 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256402.1 protein_id gnl|my_center|LOCUS_13780 1507874 1509226 gene locus_tag LOCUS_13790 gene glnA 1507874 1509226 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259233.1 protein_id gnl|my_center|LOCUS_13790 1509436 1510893 gene locus_tag LOCUS_13800 gene glnA 1509436 1510893 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_13800 1512702 1510942 gene locus_tag LOCUS_13810 1512702 1510942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1515220 1512818 gene locus_tag LOCUS_13820 gene lon 1515220 1512818 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460911.1 protein_id gnl|my_center|LOCUS_13820 1515946 1515464 gene locus_tag LOCUS_13830 gene moaC 1515946 1515464 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461493.1 protein_id gnl|my_center|LOCUS_13830 1517231 1515939 gene locus_tag LOCUS_13840 1517231 1515939 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963689.1 protein_id gnl|my_center|LOCUS_13840 1518039 1517551 gene locus_tag LOCUS_13850 1518039 1517551 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_13850 1519054 1518053 gene locus_tag LOCUS_13860 1519054 1518053 CDS product bifunctional ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258219.1 protein_id gnl|my_center|LOCUS_13860 1519308 1519051 gene locus_tag LOCUS_13870 1519308 1519051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1520330 1519542 gene locus_tag LOCUS_13880 1520330 1519542 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_13880 1520723 1520352 gene locus_tag LOCUS_13890 1520723 1520352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1520908 1523355 gene locus_tag LOCUS_13900 1520908 1523355 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_13900 1523508 1525259 gene locus_tag LOCUS_13910 1523508 1525259 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583146.1 protein_id gnl|my_center|LOCUS_13910 1525285 1526388 gene locus_tag LOCUS_13920 1525285 1526388 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_13920 1527285 1526431 gene locus_tag LOCUS_13930 gene panB 1527285 1526431 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_13930 1527376 1528533 gene locus_tag LOCUS_13940 gene rlmN 1527376 1528533 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_13940 1528505 1529719 gene locus_tag LOCUS_13950 gene larC 1528505 1529719 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_13950 1529710 1530168 gene locus_tag LOCUS_13960 gene purE 1529710 1530168 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880741.1 protein_id gnl|my_center|LOCUS_13960 1531799 1530249 gene locus_tag LOCUS_13970 gene purH 1531799 1530249 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_13970 1532409 1531801 gene locus_tag LOCUS_13980 gene purN 1532409 1531801 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880522.1 protein_id gnl|my_center|LOCUS_13980 1533843 1532518 gene locus_tag LOCUS_13990 gene hflX 1533843 1532518 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_13990 1534702 1533911 gene locus_tag LOCUS_14000 gene miaA 1534702 1533911 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256258.1 protein_id gnl|my_center|LOCUS_14000 1535008 1535943 gene locus_tag LOCUS_14010 gene mltG 1535008 1535943 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933876.1 protein_id gnl|my_center|LOCUS_14010 1535940 1536563 gene locus_tag LOCUS_14020 1535940 1536563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1536565 1537035 gene locus_tag LOCUS_14030 1536565 1537035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1537118 1537474 gene locus_tag LOCUS_14040 1537118 1537474 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_14040 1538129 1537590 gene locus_tag LOCUS_14050 1538129 1537590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1538350 1538964 gene locus_tag LOCUS_14060 gene mocA 1538350 1538964 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459387.1 protein_id gnl|my_center|LOCUS_14060 1539053 1539457 gene locus_tag LOCUS_14070 1539053 1539457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1539461 1540489 gene locus_tag LOCUS_14080 1539461 1540489 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938852.1 protein_id gnl|my_center|LOCUS_14080 1540486 1544031 gene locus_tag LOCUS_14090 gene smc 1540486 1544031 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287897.1 protein_id gnl|my_center|LOCUS_14090 1544082 1544155 gene locus_tag LOCUS_t00320 1544082 1544155 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1545033 1544194 gene locus_tag LOCUS_14100 1545033 1544194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 protein_id gnl|my_center|LOCUS_14100 1545815 1545030 gene locus_tag LOCUS_14110 1545815 1545030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1547263 1546124 gene locus_tag LOCUS_14120 1547263 1546124 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867634.1 protein_id gnl|my_center|LOCUS_14120 1548098 1548394 gene locus_tag LOCUS_14130 1548098 1548394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1548472 1549500 gene locus_tag LOCUS_14140 1548472 1549500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1549528 1550283 gene locus_tag LOCUS_14150 1549528 1550283 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_14150 1550258 1551115 gene locus_tag LOCUS_14160 1550258 1551115 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_14160 1553015 1551162 gene locus_tag LOCUS_14170 1553015 1551162 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256943.1 protein_id gnl|my_center|LOCUS_14170 1553542 1553105 gene locus_tag LOCUS_14180 1553542 1553105 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357360.1 protein_id gnl|my_center|LOCUS_14180 1554299 1553562 gene locus_tag LOCUS_14190 1554299 1553562 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_14190 1555520 1554327 gene locus_tag LOCUS_14200 gene clpX 1555520 1554327 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_14200 1556242 1555610 gene locus_tag LOCUS_14210 1556242 1555610 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257401.1 protein_id gnl|my_center|LOCUS_14210 1557844 1556342 gene locus_tag LOCUS_14220 gene tig 1557844 1556342 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_14220 1558197 1557964 gene locus_tag LOCUS_14230 1558197 1557964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1559336 1558485 gene locus_tag LOCUS_14240 gene prmC 1559336 1558485 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_14240 1559471 1559380 gene locus_tag LOCUS_t00330 1559471 1559380 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1559584 1559498 gene locus_tag LOCUS_t00340 1559584 1559498 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1560627 1559629 gene locus_tag LOCUS_14250 1560627 1559629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1560765 1561208 gene locus_tag LOCUS_14260 1560765 1561208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1561902 1561201 gene locus_tag LOCUS_14270 1561902 1561201 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_14270 1562036 1563610 gene locus_tag LOCUS_14280 gene serA 1562036 1563610 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_14280 1563627 1564472 gene locus_tag LOCUS_14290 gene proC 1563627 1564472 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_14290 1565352 1564531 gene locus_tag LOCUS_14300 1565352 1564531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211329.1 protein_id gnl|my_center|LOCUS_14300 1566276 1565377 gene locus_tag LOCUS_14310 1566276 1565377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1566624 1566698 gene locus_tag LOCUS_t00350 1566624 1566698 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1566964 1567344 gene locus_tag LOCUS_14320 1566964 1567344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1567446 1568426 gene locus_tag LOCUS_14330 1567446 1568426 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259152.1 protein_id gnl|my_center|LOCUS_14330 1568423 1569226 gene locus_tag LOCUS_14340 1568423 1569226 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259153.1 protein_id gnl|my_center|LOCUS_14340 1569228 1570013 gene locus_tag LOCUS_14350 1569228 1570013 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259154.1 protein_id gnl|my_center|LOCUS_14350 1571166 1570027 gene locus_tag LOCUS_14360 1571166 1570027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1571530 1571138 gene locus_tag LOCUS_14370 1571530 1571138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1572933 1571635 gene locus_tag LOCUS_14380 1572933 1571635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1573285 1573211 gene locus_tag LOCUS_t00360 1573285 1573211 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1574258 1573485 gene locus_tag LOCUS_14390 1574258 1573485 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_14390 1575093 1574236 gene locus_tag LOCUS_14400 gene yidA 1575093 1574236 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295119.1 protein_id gnl|my_center|LOCUS_14400 1576352 1575108 gene locus_tag LOCUS_14410 1576352 1575108 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_14410 1576854 1576435 gene locus_tag LOCUS_14420 1576854 1576435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1578279 1576879 gene locus_tag LOCUS_14430 gene lpdA 1578279 1576879 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_14430 1579531 1578323 gene locus_tag LOCUS_14440 1579531 1578323 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_14440 1579659 1580513 gene locus_tag LOCUS_14450 1579659 1580513 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_14450 1581295 1580510 gene locus_tag LOCUS_14460 1581295 1580510 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976119.1 protein_id gnl|my_center|LOCUS_14460 1581420 1581899 gene locus_tag LOCUS_14470 gene rnhA 1581420 1581899 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_14470 1582474 1581896 gene locus_tag LOCUS_14480 gene bcrC 1582474 1581896 CDS product undecaprenyl-diphosphate phosphatase BcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243362.1 protein_id gnl|my_center|LOCUS_14480 1583259 1582570 gene locus_tag LOCUS_14490 gene rpiA 1583259 1582570 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140034.1 protein_id gnl|my_center|LOCUS_14490 1583408 1583686 gene locus_tag LOCUS_14500 1583408 1583686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1584290 1585156 gene locus_tag LOCUS_14510 1584290 1585156 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_14510 1586395 1585790 gene locus_tag LOCUS_14520 1586395 1585790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1586988 1586611 gene locus_tag LOCUS_14530 1586988 1586611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583072.1 protein_id gnl|my_center|LOCUS_14530 1587904 1587014 gene locus_tag LOCUS_14540 1587904 1587014 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880080.1 protein_id gnl|my_center|LOCUS_14540 1588403 1588939 gene locus_tag LOCUS_14550 1588403 1588939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1588976 1590013 gene locus_tag LOCUS_14560 1588976 1590013 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_14560 1590077 1590628 gene locus_tag LOCUS_14570 1590077 1590628 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_14570 1590654 1591463 gene locus_tag LOCUS_14580 1590654 1591463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1591568 1592569 gene locus_tag LOCUS_14590 1591568 1592569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1593071 1593484 gene locus_tag LOCUS_14600 1593071 1593484 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727892.1 protein_id gnl|my_center|LOCUS_14600 1594366 1593536 gene locus_tag LOCUS_14610 1594366 1593536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1595196 1594384 gene locus_tag LOCUS_14620 1595196 1594384 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082697.1 protein_id gnl|my_center|LOCUS_14620 1596009 1598012 gene locus_tag LOCUS_14630 1596009 1598012 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775952.1 protein_id gnl|my_center|LOCUS_14630 1598034 1599695 gene locus_tag LOCUS_14640 1598034 1599695 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_14640 1599685 1600449 gene locus_tag LOCUS_14650 gene yjjG 1599685 1600449 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095482.1 protein_id gnl|my_center|LOCUS_14650 1600795 1600457 gene locus_tag LOCUS_14660 1600795 1600457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1601084 1600929 gene locus_tag LOCUS_14670 1601084 1600929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1601225 1602439 gene locus_tag LOCUS_14680 1601225 1602439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556091.1 protein_id gnl|my_center|LOCUS_14680 1603627 1602512 gene locus_tag LOCUS_14690 1603627 1602512 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845572.1 protein_id gnl|my_center|LOCUS_14690 1604085 1604816 gene locus_tag LOCUS_14700 1604085 1604816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1604856 1605695 gene locus_tag LOCUS_14710 1604856 1605695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1605984 1606232 gene locus_tag LOCUS_14720 1605984 1606232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1606632 1609307 gene locus_tag LOCUS_14730 1606632 1609307 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_14730 1609356 1610603 gene locus_tag LOCUS_14740 1609356 1610603 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248983.1 protein_id gnl|my_center|LOCUS_14740 1610603 1611856 gene locus_tag LOCUS_14750 1610603 1611856 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_14750 1611862 1613169 gene locus_tag LOCUS_14760 1611862 1613169 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_14760 1613296 1615290 gene locus_tag LOCUS_14770 1613296 1615290 CDS product DUF505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880454.1 protein_id gnl|my_center|LOCUS_14770 1615658 1615365 gene locus_tag LOCUS_14780 1615658 1615365 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530150.1 protein_id gnl|my_center|LOCUS_14780 1616217 1616142 gene locus_tag LOCUS_t00370 1616217 1616142 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1617077 1616259 gene locus_tag LOCUS_14790 1617077 1616259 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_14790 1617707 1618510 gene locus_tag LOCUS_14800 1617707 1618510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1618922 1618641 gene locus_tag LOCUS_14810 1618922 1618641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1619534 1619917 gene locus_tag LOCUS_14820 1619534 1619917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1620739 1620038 gene locus_tag LOCUS_14830 1620739 1620038 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_14830 1621152 1620736 gene locus_tag LOCUS_14840 1621152 1620736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1621984 1621154 gene locus_tag LOCUS_14850 1621984 1621154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1623139 1624254 gene locus_tag LOCUS_14860 gene gcvT 1623139 1624254 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_14860 1624251 1624631 gene locus_tag LOCUS_14870 gene gcvH 1624251 1624631 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_14870 1624840 1624767 gene locus_tag LOCUS_t00380 1624840 1624767 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1625082 1624873 gene locus_tag LOCUS_14880 1625082 1624873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1625575 1625757 gene locus_tag LOCUS_14890 1625575 1625757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1625797 1627569 gene locus_tag LOCUS_14900 1625797 1627569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1630890 1627660 gene locus_tag LOCUS_14910 1630890 1627660 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584105.1 protein_id gnl|my_center|LOCUS_14910 1634032 1631570 gene locus_tag LOCUS_14920 1634032 1631570 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_14920 1634433 1634059 gene locus_tag LOCUS_14930 1634433 1634059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1636324 1634456 gene locus_tag LOCUS_14940 1636324 1634456 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227849.1 protein_id gnl|my_center|LOCUS_14940 1636654 1637094 gene locus_tag LOCUS_14950 1636654 1637094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1637091 1639148 gene locus_tag LOCUS_14960 1637091 1639148 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_14960 1639135 1639659 gene locus_tag LOCUS_14970 1639135 1639659 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337622.1 protein_id gnl|my_center|LOCUS_14970 1639653 1641047 gene locus_tag LOCUS_14980 1639653 1641047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1641032 1642234 gene locus_tag LOCUS_14990 1641032 1642234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1643138 1642239 gene locus_tag LOCUS_15000 1643138 1642239 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_15000 1644054 1643131 gene locus_tag LOCUS_15010 gene murQ 1644054 1643131 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 protein_id gnl|my_center|LOCUS_15010 1645128 1644073 gene locus_tag LOCUS_15020 1645128 1644073 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_15020 1646178 1646507 gene locus_tag LOCUS_15030 1646178 1646507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1646991 1646500 gene locus_tag LOCUS_15040 1646991 1646500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1648023 1647319 gene locus_tag LOCUS_15050 1648023 1647319 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_15050 1648577 1648020 gene locus_tag LOCUS_15060 gene frr 1648577 1648020 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259405.1 protein_id gnl|my_center|LOCUS_15060 1649327 1648617 gene locus_tag LOCUS_15070 gene pyrH 1649327 1648617 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057330.1 protein_id gnl|my_center|LOCUS_15070 1649885 1649427 gene locus_tag LOCUS_15080 1649885 1649427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1650858 1649989 gene locus_tag LOCUS_15090 gene rpsB 1650858 1649989 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259402.1 protein_id gnl|my_center|LOCUS_15090 1651929 1651045 gene locus_tag LOCUS_15100 gene iolE 1651929 1651045 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356924.1 protein_id gnl|my_center|LOCUS_15100 1652212 1651949 gene locus_tag LOCUS_15110 1652212 1651949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1653263 1652229 gene locus_tag LOCUS_15120 gene iolG 1653263 1652229 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_15120 1655112 1653226 gene locus_tag LOCUS_15130 gene iolD 1655112 1653226 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_15130 1655938 1655102 gene locus_tag LOCUS_15140 gene iolB 1655938 1655102 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_15140 1656973 1655966 gene locus_tag LOCUS_15150 gene iolG 1656973 1655966 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_15150 1657925 1656966 gene locus_tag LOCUS_15160 1657925 1656966 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_15160 1658815 1657922 gene locus_tag LOCUS_15170 1658815 1657922 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421354.1 protein_id gnl|my_center|LOCUS_15170 1659308 1659183 gene locus_tag LOCUS_15180 1659308 1659183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1659434 1661389 gene locus_tag LOCUS_15190 1659434 1661389 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582700.1 protein_id gnl|my_center|LOCUS_15190 1662909 1661461 gene locus_tag LOCUS_15200 1662909 1661461 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258761.1 protein_id gnl|my_center|LOCUS_15200 1664491 1662956 gene locus_tag LOCUS_15210 1664491 1662956 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_15210 1666410 1664524 gene locus_tag LOCUS_15220 gene nuoL 1666410 1664524 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_15220 1666719 1666414 gene locus_tag LOCUS_15230 gene nuoK 1666719 1666414 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_15230 1667243 1666722 gene locus_tag LOCUS_15240 1667243 1666722 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087674.1 protein_id gnl|my_center|LOCUS_15240 1667758 1667246 gene locus_tag LOCUS_15250 1667758 1667246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1668826 1667801 gene locus_tag LOCUS_15260 gene nuoH 1668826 1667801 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_15260 1670748 1668841 gene locus_tag LOCUS_15270 1670748 1668841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1673240 1671498 gene locus_tag LOCUS_15280 gene nuoF 1673240 1671498 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_15280 1673757 1673233 gene locus_tag LOCUS_15290 1673757 1673233 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530346.1 protein_id gnl|my_center|LOCUS_15290 1674983 1673781 gene locus_tag LOCUS_15300 gene nuoD 1674983 1673781 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_15300 1675537 1674998 gene locus_tag LOCUS_15310 1675537 1674998 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_15310 1676030 1675503 gene locus_tag LOCUS_15320 1676030 1675503 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597491.1 protein_id gnl|my_center|LOCUS_15320 1676377 1676021 gene locus_tag LOCUS_15330 1676377 1676021 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_15330 1677413 1676517 gene locus_tag LOCUS_15340 1677413 1676517 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 protein_id gnl|my_center|LOCUS_15340 1677919 1677413 gene locus_tag LOCUS_15350 1677919 1677413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1678911 1679486 gene locus_tag LOCUS_15360 1678911 1679486 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932755.1 protein_id gnl|my_center|LOCUS_15360 1679483 1680436 gene locus_tag LOCUS_15370 gene nadA 1679483 1680436 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_15370 1680436 1681299 gene locus_tag LOCUS_15380 gene nadC 1680436 1681299 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_15380 1681314 1682861 gene locus_tag LOCUS_15390 gene nadB 1681314 1682861 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137375.1 protein_id gnl|my_center|LOCUS_15390 1682854 1684005 gene locus_tag LOCUS_15400 1682854 1684005 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_15400 1684059 1684913 gene locus_tag LOCUS_15410 1684059 1684913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1685097 1685474 gene locus_tag LOCUS_15420 gene crcB 1685097 1685474 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_15420 1685492 1686691 gene locus_tag LOCUS_15430 1685492 1686691 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_15430 1686817 1687638 gene locus_tag LOCUS_15440 1686817 1687638 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_15440 1687628 1688197 gene locus_tag LOCUS_15450 1687628 1688197 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_15450 1689818 1688199 gene locus_tag LOCUS_15460 1689818 1688199 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_15460 1690026 1691555 gene locus_tag LOCUS_15470 gene rny 1690026 1691555 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258580.1 protein_id gnl|my_center|LOCUS_15470 1692100 1691621 gene locus_tag LOCUS_15480 gene ispF 1692100 1691621 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_15480 1692819 1692118 gene locus_tag LOCUS_15490 gene ispD 1692819 1692118 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_15490 1693889 1692816 gene locus_tag LOCUS_15500 1693889 1692816 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942743.1 protein_id gnl|my_center|LOCUS_15500 1694788 1693925 gene locus_tag LOCUS_15510 1694788 1693925 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_15510 1696101 1694920 gene locus_tag LOCUS_15520 1696101 1694920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1698496 1696184 gene locus_tag LOCUS_15530 1698496 1696184 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_15530 1698921 1698997 gene locus_tag LOCUS_t00390 1698921 1698997 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1701723 1699669 gene locus_tag LOCUS_15540 1701723 1699669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1702183 1701914 gene locus_tag LOCUS_15550 1702183 1701914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1703253 1702180 gene locus_tag LOCUS_15560 1703253 1702180 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_15560 1703366 1703440 gene locus_tag LOCUS_t00400 1703366 1703440 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1704075 1703653 gene locus_tag LOCUS_15570 1704075 1703653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1704312 1705307 gene locus_tag LOCUS_15580 1704312 1705307 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_15580 1705345 1706478 gene locus_tag LOCUS_15590 1705345 1706478 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_15590 1706555 1707661 gene locus_tag LOCUS_15600 1706555 1707661 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_15600 1707698 1708930 gene locus_tag LOCUS_15610 1707698 1708930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777043.1 protein_id gnl|my_center|LOCUS_15610 1709138 1708896 gene locus_tag LOCUS_15620 1709138 1708896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1709484 1709227 gene locus_tag LOCUS_15630 1709484 1709227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1710438 1709713 gene locus_tag LOCUS_15640 1710438 1709713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1710570 1711013 gene locus_tag LOCUS_15650 1710570 1711013 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964989.1 protein_id gnl|my_center|LOCUS_15650 1711254 1711964 gene locus_tag LOCUS_15660 1711254 1711964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1711955 1712722 gene locus_tag LOCUS_15670 1711955 1712722 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_15670 1712732 1713574 gene locus_tag LOCUS_15680 1712732 1713574 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613815.1 protein_id gnl|my_center|LOCUS_15680 1713713 1714462 gene locus_tag LOCUS_15690 1713713 1714462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1714657 1715379 gene locus_tag LOCUS_15700 1714657 1715379 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_15700 1715372 1716691 gene locus_tag LOCUS_15710 1715372 1716691 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030679.1 protein_id gnl|my_center|LOCUS_15710 1716714 1717601 gene locus_tag LOCUS_15720 1716714 1717601 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_15720 1718143 1717718 gene locus_tag LOCUS_15730 1718143 1717718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1718847 1718143 gene locus_tag LOCUS_15740 1718847 1718143 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_15740 1720486 1718840 gene locus_tag LOCUS_15750 gene ctaD 1720486 1718840 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_15750 1721542 1720514 gene locus_tag LOCUS_15760 gene coxB 1721542 1720514 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_15760 1722408 1721545 gene locus_tag LOCUS_15770 1722408 1721545 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_15770 1722893 1722405 gene locus_tag LOCUS_15780 1722893 1722405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1723376 1723672 gene locus_tag LOCUS_15790 1723376 1723672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1724642 1724118 gene locus_tag LOCUS_15800 1724642 1724118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1725267 1724722 gene locus_tag LOCUS_15810 1725267 1724722 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_15810 1726655 1725264 gene locus_tag LOCUS_15820 gene nrfD 1726655 1725264 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_15820 1729613 1726659 gene locus_tag LOCUS_15830 1729613 1726659 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_15830 1730288 1729638 gene locus_tag LOCUS_15840 1730288 1729638 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_15840 1730551 1730628 gene locus_tag LOCUS_t00410 1730551 1730628 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1731097 1732530 gene locus_tag LOCUS_15850 1731097 1732530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1732517 1733281 gene locus_tag LOCUS_15860 1732517 1733281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1734858 1733380 gene locus_tag LOCUS_15870 1734858 1733380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1734908 1735093 gene locus_tag LOCUS_15880 1734908 1735093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1736322 1735204 gene locus_tag LOCUS_15890 gene ftsZ 1736322 1735204 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_15890 1737615 1736365 gene locus_tag LOCUS_15900 gene ftsA 1737615 1736365 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_15900 1738497 1737727 gene locus_tag LOCUS_15910 1738497 1737727 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256644.1 protein_id gnl|my_center|LOCUS_15910 1739587 1738499 gene locus_tag LOCUS_15920 1739587 1738499 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234325.1 protein_id gnl|my_center|LOCUS_15920 1740402 1739587 gene locus_tag LOCUS_15930 gene murB 1740402 1739587 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256646.1 protein_id gnl|my_center|LOCUS_15930 1741853 1740495 gene locus_tag LOCUS_15940 gene murC 1741853 1740495 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033908872.1 protein_id gnl|my_center|LOCUS_15940 1742467 1741859 gene locus_tag LOCUS_15950 1742467 1741859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1743657 1742467 gene locus_tag LOCUS_15960 gene ftsW 1743657 1742467 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256650.1 protein_id gnl|my_center|LOCUS_15960 1745074 1743650 gene locus_tag LOCUS_15970 gene murD 1745074 1743650 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256652.1 protein_id gnl|my_center|LOCUS_15970 1746152 1745109 gene locus_tag LOCUS_15980 1746152 1745109 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_15980 1747725 1746181 gene locus_tag LOCUS_15990 gene murJ 1747725 1746181 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_15990 1748858 1747746 gene locus_tag LOCUS_16000 1748858 1747746 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_16000 1749921 1748887 gene locus_tag LOCUS_16010 gene mraY 1749921 1748887 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_16010 1751309 1749918 gene locus_tag LOCUS_16020 1751309 1749918 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_16020 1753065 1751317 gene locus_tag LOCUS_16030 1753065 1751317 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256655.1 protein_id gnl|my_center|LOCUS_16030 1753483 1753052 gene locus_tag LOCUS_16040 1753483 1753052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1754425 1753511 gene locus_tag LOCUS_16050 gene rsmH 1754425 1753511 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_16050 1754870 1754436 gene locus_tag LOCUS_16060 gene mraZ 1754870 1754436 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256658.1 protein_id gnl|my_center|LOCUS_16060 1755035 1755262 gene locus_tag LOCUS_16070 1755035 1755262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1757011 1755266 gene locus_tag LOCUS_16080 gene accC 1757011 1755266 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257262.1 protein_id gnl|my_center|LOCUS_16080 1757210 1756986 gene locus_tag LOCUS_16090 1757210 1756986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1758732 1757191 gene locus_tag LOCUS_16100 1758732 1757191 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_16100 1760316 1758751 gene locus_tag LOCUS_16110 1760316 1758751 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_16110 1760756 1760346 gene locus_tag LOCUS_16120 gene mce 1760756 1760346 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_16120 1762972 1760756 gene locus_tag LOCUS_16130 1762972 1760756 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256023.1 protein_id gnl|my_center|LOCUS_16130 1763472 1762969 gene locus_tag LOCUS_16140 1763472 1762969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1764198 1763482 gene locus_tag LOCUS_16150 1764198 1763482 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392510.1 protein_id gnl|my_center|LOCUS_16150 1765271 1764201 gene locus_tag LOCUS_16160 1765271 1764201 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_16160 1766439 1765609 gene locus_tag LOCUS_16170 gene mreC 1766439 1765609 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945174.1 protein_id gnl|my_center|LOCUS_16170 1767521 1766454 gene locus_tag LOCUS_16180 1767521 1766454 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_16180 1767724 1768428 gene locus_tag LOCUS_16190 gene radC 1767724 1768428 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_16190 1769398 1768466 gene locus_tag LOCUS_16200 1769398 1768466 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_16200 1769859 1769401 gene locus_tag LOCUS_16210 gene rimM 1769859 1769401 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813199.1 protein_id gnl|my_center|LOCUS_16210 1770166 1769921 gene locus_tag LOCUS_16220 1770166 1769921 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_16220 1770462 1770172 gene locus_tag LOCUS_16230 gene rpsP 1770462 1770172 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_16230 1770631 1771248 gene locus_tag LOCUS_16240 1770631 1771248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1771639 1771310 gene locus_tag LOCUS_16250 1771639 1771310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1771908 1772417 gene locus_tag LOCUS_16260 1771908 1772417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1773033 1772407 gene locus_tag LOCUS_16270 1773033 1772407 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_16270 1773087 1774808 gene locus_tag LOCUS_16280 1773087 1774808 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257427.1 protein_id gnl|my_center|LOCUS_16280 1775564 1774815 gene locus_tag LOCUS_16290 gene tatC 1775564 1774815 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259255.1 protein_id gnl|my_center|LOCUS_16290 1775895 1775647 gene locus_tag LOCUS_16300 gene acpP 1775895 1775647 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_16300 1776427 1775966 gene locus_tag LOCUS_16310 gene nusB 1776427 1775966 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_16310 1777797 1776436 gene locus_tag LOCUS_16320 gene accC 1777797 1776436 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_16320 1778729 1777800 gene locus_tag LOCUS_16330 gene fabD 1778729 1777800 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_16330 1779753 1778719 gene locus_tag LOCUS_16340 1779753 1778719 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_16340 1780577 1780017 gene locus_tag LOCUS_16350 1780577 1780017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1781121 1780654 gene locus_tag LOCUS_16360 1781121 1780654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1781811 1781242 gene locus_tag LOCUS_16370 gene rsmD 1781811 1781242 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258263.1 protein_id gnl|my_center|LOCUS_16370 1784171 1781811 gene locus_tag LOCUS_16380 gene recG 1784171 1781811 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_16380 1785009 1784161 gene locus_tag LOCUS_16390 1785009 1784161 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_16390 1786656 1785019 gene locus_tag LOCUS_16400 gene fakA 1786656 1785019 CDS product fatty acid kinase catalytic subunit FakA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623903.1 protein_id gnl|my_center|LOCUS_16400 1786819 1787040 gene locus_tag LOCUS_16410 gene rpmB 1786819 1787040 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256168.1 protein_id gnl|my_center|LOCUS_16410 1788155 1787091 gene locus_tag LOCUS_16420 gene prfA 1788155 1787091 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256395.1 protein_id gnl|my_center|LOCUS_16420 1788758 1788174 gene locus_tag LOCUS_16430 gene thpR 1788758 1788174 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_16430 1788871 1788969 gene locus_tag LOCUS_t00420 1788871 1788969 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1790513 1789050 gene locus_tag LOCUS_16440 1790513 1789050 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763187.1 protein_id gnl|my_center|LOCUS_16440 1790757 1791761 gene locus_tag LOCUS_16450 1790757 1791761 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259095.1 protein_id gnl|my_center|LOCUS_16450 1791835 1792620 gene locus_tag LOCUS_16460 1791835 1792620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1792673 1793782 gene locus_tag LOCUS_16470 1792673 1793782 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_16470 1793799 1794359 gene locus_tag LOCUS_16480 gene efp 1793799 1794359 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_16480 1794361 1794888 gene locus_tag LOCUS_16490 gene accB 1794361 1794888 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_16490 1794906 1796114 gene locus_tag LOCUS_16500 gene xseA 1794906 1796114 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259569.1 protein_id gnl|my_center|LOCUS_16500 1796120 1796425 gene locus_tag LOCUS_16510 1796120 1796425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1796443 1797591 gene locus_tag LOCUS_16520 gene dgoD 1796443 1797591 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_16520 1799070 1797619 gene locus_tag LOCUS_16530 gene proS 1799070 1797619 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_16530 1799299 1799057 gene locus_tag LOCUS_16540 1799299 1799057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1801175 1799442 gene locus_tag LOCUS_16550 gene recN 1801175 1799442 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_16550 1801975 1801442 gene locus_tag LOCUS_16560 1801975 1801442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1803468 1802848 gene locus_tag LOCUS_16570 1803468 1802848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1803791 1804699 gene locus_tag LOCUS_16580 1803791 1804699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_16580 1804712 1805545 gene locus_tag LOCUS_16590 1804712 1805545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1805567 1806412 gene locus_tag LOCUS_16600 1805567 1806412 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_16600 1806513 1808225 gene locus_tag LOCUS_16610 1806513 1808225 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_16610 1808363 1808824 gene locus_tag LOCUS_16620 1808363 1808824 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_16620 1808829 1809767 gene locus_tag LOCUS_16630 gene meaB 1808829 1809767 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_16630 1810758 1811210 gene locus_tag LOCUS_16640 1810758 1811210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1811665 1811207 gene locus_tag LOCUS_16650 gene bcp 1811665 1811207 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_16650 1812407 1811655 gene locus_tag LOCUS_16660 gene larB 1812407 1811655 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_16660 1813370 1812411 gene locus_tag LOCUS_16670 1813370 1812411 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218045413.1 protein_id gnl|my_center|LOCUS_16670 1815390 1815478 gene locus_tag LOCUS_t00430 1815390 1815478 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1815502 1815577 gene locus_tag LOCUS_t00440 1815502 1815577 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1815601 1815676 gene locus_tag LOCUS_t00450 1815601 1815676 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1816257 1818152 gene locus_tag LOCUS_16680 1816257 1818152 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_16680 1819299 1818127 gene locus_tag LOCUS_16690 1819299 1818127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1820795 1819854 gene locus_tag LOCUS_16700 1820795 1819854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1823217 1820887 gene locus_tag LOCUS_16710 1823217 1820887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1823605 1823931 gene locus_tag LOCUS_16720 1823605 1823931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1825526 1826416 gene locus_tag LOCUS_16730 1825526 1826416 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902092.1 protein_id gnl|my_center|LOCUS_16730 1826400 1827128 gene locus_tag LOCUS_16740 1826400 1827128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1827164 1827403 gene locus_tag LOCUS_16750 1827164 1827403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1827761 1827390 gene locus_tag LOCUS_16760 1827761 1827390 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389363.1 protein_id gnl|my_center|LOCUS_16760 1827846 1828271 gene locus_tag LOCUS_16770 1827846 1828271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1828237 1830540 gene locus_tag LOCUS_16780 1828237 1830540 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_16780 1831248 1830517 gene locus_tag LOCUS_16790 1831248 1830517 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_16790 1831961 1831311 gene locus_tag LOCUS_16800 1831961 1831311 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_16800 1832635 1832318 gene locus_tag LOCUS_16810 1832635 1832318 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_16810 1833073 1832687 gene locus_tag LOCUS_16820 1833073 1832687 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_16820 1834366 1833113 gene locus_tag LOCUS_16830 1834366 1833113 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_16830 1835676 1834372 gene locus_tag LOCUS_16840 gene sufD 1835676 1834372 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_16840 1837167 1835758 gene locus_tag LOCUS_16850 gene sufB 1837167 1835758 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_16850 1837984 1837211 gene locus_tag LOCUS_16860 gene sufC 1837984 1837211 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_16860 1838550 1838014 gene locus_tag LOCUS_16870 1838550 1838014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1838678 1840114 gene locus_tag LOCUS_16880 gene pyk 1838678 1840114 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_16880 1840153 1841688 gene locus_tag LOCUS_16890 gene gpmI 1840153 1841688 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257028.1 protein_id gnl|my_center|LOCUS_16890 1841816 1842292 gene locus_tag LOCUS_16900 1841816 1842292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1842354 1843565 gene locus_tag LOCUS_16910 1842354 1843565 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_16910 1843576 1844637 gene locus_tag LOCUS_16920 1843576 1844637 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259411.1 protein_id gnl|my_center|LOCUS_16920 1844687 1845154 gene locus_tag LOCUS_16930 1844687 1845154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1845184 1845993 gene locus_tag LOCUS_16940 1845184 1845993 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_16940 1846030 1846866 gene locus_tag LOCUS_16950 gene larE 1846030 1846866 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_16950 1848671 1846887 gene locus_tag LOCUS_16960 1848671 1846887 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_16960 1848829 1849809 gene locus_tag LOCUS_16970 1848829 1849809 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_16970 1849806 1850798 gene locus_tag LOCUS_16980 gene gmd 1849806 1850798 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_16980 1850831 1852459 gene locus_tag LOCUS_16990 1850831 1852459 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_16990 1852479 1853525 gene locus_tag LOCUS_17000 1852479 1853525 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_17000 1853602 1854870 gene locus_tag LOCUS_17010 gene tyrS 1853602 1854870 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_17010 1854873 1855427 gene locus_tag LOCUS_17020 1854873 1855427 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_17020 1856650 1855670 gene locus_tag LOCUS_17030 1856650 1855670 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080650.1 protein_id gnl|my_center|LOCUS_17030 1858297 1856948 gene locus_tag LOCUS_17040 gene lat 1858297 1856948 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403564.1 protein_id gnl|my_center|LOCUS_17040 1858525 1859826 gene locus_tag LOCUS_17050 1858525 1859826 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_17050 1860268 1861530 gene locus_tag LOCUS_17060 1860268 1861530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1861607 1862557 gene locus_tag LOCUS_17070 1861607 1862557 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_17070 1862490 1862996 gene locus_tag LOCUS_17080 1862490 1862996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1863018 1863737 gene locus_tag LOCUS_17090 1863018 1863737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_17090 1865015 1863888 gene locus_tag LOCUS_17100 1865015 1863888 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392745.1 protein_id gnl|my_center|LOCUS_17100 1865136 1865429 gene locus_tag LOCUS_17110 1865136 1865429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1865495 1865923 gene locus_tag LOCUS_17120 1865495 1865923 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939712.1 protein_id gnl|my_center|LOCUS_17120 1865924 1866184 gene locus_tag LOCUS_17130 1865924 1866184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1866168 1866530 gene locus_tag LOCUS_17140 1866168 1866530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1866558 1866836 gene locus_tag LOCUS_17150 1866558 1866836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921333.1 protein_id gnl|my_center|LOCUS_17150 1866939 1867811 gene locus_tag LOCUS_17160 1866939 1867811 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889481.1 protein_id gnl|my_center|LOCUS_17160 1870282 1867763 gene locus_tag LOCUS_17170 1870282 1867763 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116585.1 protein_id gnl|my_center|LOCUS_17170 1870844 1870287 gene locus_tag LOCUS_17180 1870844 1870287 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028739.1 protein_id gnl|my_center|LOCUS_17180 1870973 1871785 gene locus_tag LOCUS_17190 gene lgt 1870973 1871785 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_17190 1871795 1872490 gene locus_tag LOCUS_17200 1871795 1872490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1872500 1872937 gene locus_tag LOCUS_17210 1872500 1872937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1875690 1872934 gene locus_tag LOCUS_17220 1875690 1872934 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258962.1 protein_id gnl|my_center|LOCUS_17220 1877501 1875687 gene locus_tag LOCUS_17230 1877501 1875687 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259247.1 protein_id gnl|my_center|LOCUS_17230 1878418 1877507 gene locus_tag LOCUS_17240 1878418 1877507 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_17240 1879424 1878423 gene locus_tag LOCUS_17250 1879424 1878423 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_17250 1881091 1879421 gene locus_tag LOCUS_17260 1881091 1879421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1882095 1881091 gene locus_tag LOCUS_17270 1882095 1881091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257907.1 protein_id gnl|my_center|LOCUS_17270 1883063 1882098 gene locus_tag LOCUS_17280 1883063 1882098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_17280 1885053 1883056 gene locus_tag LOCUS_17290 1885053 1883056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256858.1 protein_id gnl|my_center|LOCUS_17290 1885433 1885134 gene locus_tag LOCUS_17300 1885433 1885134 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_17300 1886457 1885567 gene locus_tag LOCUS_17310 1886457 1885567 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404481.1 protein_id gnl|my_center|LOCUS_17310 1887681 1886500 gene locus_tag LOCUS_17320 1887681 1886500 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_17320 1887978 1887745 gene locus_tag LOCUS_17330 1887978 1887745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1888219 1888488 gene locus_tag LOCUS_17340 1888219 1888488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_17340 1888754 1889788 gene locus_tag LOCUS_17350 gene hrcA 1888754 1889788 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_17350 1889807 1890412 gene locus_tag LOCUS_17360 gene grpE 1889807 1890412 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_17360 1890432 1892345 gene locus_tag LOCUS_17370 gene dnaK 1890432 1892345 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_17370 1892458 1893588 gene locus_tag LOCUS_17380 gene dnaJ 1892458 1893588 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_17380 1893901 1893617 gene locus_tag LOCUS_17390 1893901 1893617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1894185 1894553 gene locus_tag LOCUS_17400 gene rsfS 1894185 1894553 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674576.1 protein_id gnl|my_center|LOCUS_17400 1894567 1894752 gene locus_tag LOCUS_17410 1894567 1894752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1895389 1894763 gene locus_tag LOCUS_17420 gene upp 1895389 1894763 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_17420 1895426 1895911 gene locus_tag LOCUS_17430 1895426 1895911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1896504 1895908 gene locus_tag LOCUS_17440 gene plsY 1896504 1895908 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_17440 1897853 1896507 gene locus_tag LOCUS_17450 gene der 1897853 1896507 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_17450 1898077 1898289 gene locus_tag LOCUS_17460 1898077 1898289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1898273 1900237 gene locus_tag LOCUS_17470 1898273 1900237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1901409 1902169 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcacccccacgcgtgtggggacaat 1903085 1902789 gene locus_tag LOCUS_17480 1903085 1902789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1903821 1903231 gene locus_tag LOCUS_17490 1903821 1903231 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204186.1 protein_id gnl|my_center|LOCUS_17490 1904538 1903822 gene locus_tag LOCUS_17500 1904538 1903822 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_17500 1905146 1904553 gene locus_tag LOCUS_17510 1905146 1904553 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256689.1 protein_id gnl|my_center|LOCUS_17510 1905590 1908886 gene locus_tag LOCUS_17520 1905590 1908886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1909777 1909178 gene locus_tag LOCUS_17530 1909777 1909178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1910408 1909833 gene locus_tag LOCUS_17540 1910408 1909833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1911311 1910421 gene locus_tag LOCUS_17550 1911311 1910421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130336.1 protein_id gnl|my_center|LOCUS_17550 1912630 1911323 gene locus_tag LOCUS_17560 1912630 1911323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1912963 1912634 gene locus_tag LOCUS_17570 1912963 1912634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1913378 1913217 gene locus_tag LOCUS_17580 1913378 1913217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1913885 1913448 gene locus_tag LOCUS_17590 1913885 1913448 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129831.1 protein_id gnl|my_center|LOCUS_17590 1915794 1914154 gene locus_tag LOCUS_17600 1915794 1914154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1916727 1915813 gene locus_tag LOCUS_17610 1916727 1915813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626569.1 protein_id gnl|my_center|LOCUS_17610 1917478 1916711 gene locus_tag LOCUS_17620 1917478 1916711 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224576.1 protein_id gnl|my_center|LOCUS_17620 1918686 1918826 gene locus_tag LOCUS_17630 1918686 1918826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1919263 1919511 gene locus_tag LOCUS_17640 1919263 1919511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1919643 1920548 gene locus_tag LOCUS_17650 1919643 1920548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1920622 1920942 gene locus_tag LOCUS_17660 1920622 1920942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1921412 1920984 gene locus_tag LOCUS_17670 1921412 1920984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1921300 1922505 gene locus_tag LOCUS_17680 1921300 1922505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1923905 1923729 gene locus_tag LOCUS_17690 1923905 1923729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1924369 1924133 gene locus_tag LOCUS_17700 1924369 1924133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1924611 1924423 gene locus_tag LOCUS_17710 1924611 1924423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1925304 1925942 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgtccccacacgcgtgggggtgaaccg 1926699 1926364 gene locus_tag LOCUS_17720 1926699 1926364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1927369 1927977 gene locus_tag LOCUS_17730 gene coaE 1927369 1927977 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257771.1 protein_id gnl|my_center|LOCUS_17730 1930126 1928009 gene locus_tag LOCUS_17740 gene pnp 1930126 1928009 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_17740 1930576 1930289 gene locus_tag LOCUS_17750 gene rpsO 1930576 1930289 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_17750 1931653 1930613 gene locus_tag LOCUS_17760 1931653 1930613 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_17760 1932400 1931675 gene locus_tag LOCUS_17770 1932400 1931675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1933024 1932455 gene locus_tag LOCUS_17780 1933024 1932455 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_17780 1933078 1933162 gene locus_tag LOCUS_t00460 1933078 1933162 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1933258 1934286 gene locus_tag LOCUS_17790 1933258 1934286 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583737.1 protein_id gnl|my_center|LOCUS_17790 1935234 1934365 gene locus_tag LOCUS_17800 1935234 1934365 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257519.1 protein_id gnl|my_center|LOCUS_17800 1936092 1935235 gene locus_tag LOCUS_17810 gene accD 1936092 1935235 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257520.1 protein_id gnl|my_center|LOCUS_17810 1936864 1936316 gene locus_tag LOCUS_17820 1936864 1936316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1939793 1936932 gene locus_tag LOCUS_17830 1939793 1936932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1940682 1939786 gene locus_tag LOCUS_17840 1940682 1939786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1940811 1941140 gene locus_tag LOCUS_17850 1940811 1941140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1942309 1941191 gene locus_tag LOCUS_17860 1942309 1941191 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_17860 1943464 1942352 gene locus_tag LOCUS_17870 1943464 1942352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080423.1 protein_id gnl|my_center|LOCUS_17870 1944651 1943488 gene locus_tag LOCUS_17880 1944651 1943488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 protein_id gnl|my_center|LOCUS_17880 1945664 1944681 gene locus_tag LOCUS_17890 1945664 1944681 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584054.1 protein_id gnl|my_center|LOCUS_17890 1947708 1945744 gene locus_tag LOCUS_17900 1947708 1945744 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_17900 1947824 1948201 gene locus_tag LOCUS_17910 1947824 1948201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1948403 1949236 gene locus_tag LOCUS_17920 1948403 1949236 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_17920 1949292 1950326 gene locus_tag LOCUS_17930 1949292 1950326 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833582.1 protein_id gnl|my_center|LOCUS_17930 1950323 1951906 gene locus_tag LOCUS_17940 1950323 1951906 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_17940 1952505 1951912 gene locus_tag LOCUS_17950 gene rdgB 1952505 1951912 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 protein_id gnl|my_center|LOCUS_17950 1953370 1952507 gene locus_tag LOCUS_17960 1953370 1952507 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_17960 1953515 1953913 gene locus_tag LOCUS_17970 1953515 1953913 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393351.1 protein_id gnl|my_center|LOCUS_17970 1954139 1955143 gene locus_tag LOCUS_17980 1954139 1955143 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_17980 1955233 1955682 gene locus_tag LOCUS_17990 gene rplI 1955233 1955682 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256838.1 protein_id gnl|my_center|LOCUS_17990 1955684 1957024 gene locus_tag LOCUS_18000 gene dnaB 1955684 1957024 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256839.1 protein_id gnl|my_center|LOCUS_18000 1957041 1957883 gene locus_tag LOCUS_18010 1957041 1957883 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257453.1 protein_id gnl|my_center|LOCUS_18010 1957962 1958762 gene locus_tag LOCUS_18020 gene cdaA 1957962 1958762 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257450.1 protein_id gnl|my_center|LOCUS_18020 1958765 1959667 gene locus_tag LOCUS_18030 1958765 1959667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1959895 1960383 gene locus_tag LOCUS_18040 1959895 1960383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1960524 1960449 gene locus_tag LOCUS_t00470 1960524 1960449 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1961004 1960603 gene locus_tag LOCUS_18050 gene rplL 1961004 1960603 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870240.1 protein_id gnl|my_center|LOCUS_18050 1961583 1961044 gene locus_tag LOCUS_18060 gene rplJ 1961583 1961044 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_18060 1962495 1961767 gene locus_tag LOCUS_18070 gene rplA 1962495 1961767 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258051.1 protein_id gnl|my_center|LOCUS_18070 1962973 1962551 gene locus_tag LOCUS_18080 gene rplK 1962973 1962551 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393949.1 protein_id gnl|my_center|LOCUS_18080 1963603 1962998 gene locus_tag LOCUS_18090 gene nusG 1963603 1962998 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_18090 1963865 1963635 gene locus_tag LOCUS_18100 1963865 1963635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1965324 1964122 gene locus_tag LOCUS_18110 gene tuf 1965324 1964122 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258047.1 protein_id gnl|my_center|LOCUS_18110 1965483 1965408 gene locus_tag LOCUS_t00480 1965483 1965408 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1965588 1965504 gene locus_tag LOCUS_t00490 1965588 1965504 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1965672 1965599 gene locus_tag LOCUS_t00500 1965672 1965599 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1966512 1965718 gene locus_tag LOCUS_18120 gene rlmB 1966512 1965718 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_18120 1967855 1966494 gene locus_tag LOCUS_18130 gene cysS 1967855 1966494 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257711.1 protein_id gnl|my_center|LOCUS_18130 1968187 1967936 gene locus_tag LOCUS_18140 1968187 1967936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1968327 1970666 gene locus_tag LOCUS_18150 1968327 1970666 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_18150 1970683 1971153 gene locus_tag LOCUS_18160 1970683 1971153 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867998.1 protein_id gnl|my_center|LOCUS_18160 1971208 1971507 gene locus_tag LOCUS_18170 1971208 1971507 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258652.1 protein_id gnl|my_center|LOCUS_18170 1971659 1972717 gene locus_tag LOCUS_18180 1971659 1972717 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258767.1 protein_id gnl|my_center|LOCUS_18180 1972749 1974620 gene locus_tag LOCUS_18190 gene dnaG 1972749 1974620 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258766.1 protein_id gnl|my_center|LOCUS_18190 1974765 1976555 gene locus_tag LOCUS_18200 1974765 1976555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1976696 1977868 gene locus_tag LOCUS_18210 gene obgE 1976696 1977868 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257169.1 protein_id gnl|my_center|LOCUS_18210 1977884 1978744 gene locus_tag LOCUS_18220 gene rsmI 1977884 1978744 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_18220 1978829 1979761 gene locus_tag LOCUS_18230 1978829 1979761 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258346.1 protein_id gnl|my_center|LOCUS_18230 1979758 1979958 gene locus_tag LOCUS_18240 1979758 1979958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1980033 1981406 gene locus_tag LOCUS_18250 1980033 1981406 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_18250 1982639 1981485 gene locus_tag LOCUS_18260 1982639 1981485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1983430 1982636 gene locus_tag LOCUS_18270 1983430 1982636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1985961 1984996 gene locus_tag LOCUS_18280 1985961 1984996 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974174.1 protein_id gnl|my_center|LOCUS_18280 1987375 1986074 gene locus_tag LOCUS_18290 1987375 1986074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1988526 1987369 gene locus_tag LOCUS_18300 1988526 1987369 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_18300 1989446 1988529 gene locus_tag LOCUS_18310 1989446 1988529 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_18310 1990758 1989580 gene locus_tag LOCUS_18320 1990758 1989580 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_18320 1990923 1991975 gene locus_tag LOCUS_18330 gene ychF 1990923 1991975 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_18330 1992731 1991976 gene locus_tag LOCUS_18340 gene rsmG 1992731 1991976 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_18340 1994637 1992715 gene locus_tag LOCUS_18350 gene dxs 1994637 1992715 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_18350 1994796 1995956 gene locus_tag LOCUS_18360 1994796 1995956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475594.1 protein_id gnl|my_center|LOCUS_18360 1996266 1995970 gene locus_tag LOCUS_18370 1996266 1995970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1997180 1996281 gene locus_tag LOCUS_18380 1997180 1996281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1997715 1997638 gene locus_tag LOCUS_t00510 1997715 1997638 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1998814 1997762 gene locus_tag LOCUS_18390 1998814 1997762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1999670 1998807 gene locus_tag LOCUS_18400 1999670 1998807 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224730.1 protein_id gnl|my_center|LOCUS_18400 1999934 1999683 gene locus_tag LOCUS_18410 1999934 1999683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2003706 2001862 gene locus_tag LOCUS_18420 2003706 2001862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2004244 2003900 gene locus_tag LOCUS_18430 2004244 2003900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2007035 2006028 gene locus_tag LOCUS_18440 2007035 2006028 CDS product TIGR03557 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258687.1 protein_id gnl|my_center|LOCUS_18440 2007815 2007054 gene locus_tag LOCUS_18450 gene cofE 2007815 2007054 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_18450 2008513 2007821 gene locus_tag LOCUS_18460 2008513 2007821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2009463 2008510 gene locus_tag LOCUS_18470 gene cofD 2009463 2008510 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_18470 2010071 2009487 gene locus_tag LOCUS_18480 2010071 2009487 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_18480 2011254 2010064 gene locus_tag LOCUS_18490 gene pimA 2011254 2010064 CDS product phosphatidyl-myo-inositol alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413478.1 protein_id gnl|my_center|LOCUS_18490 2011595 2012254 gene locus_tag LOCUS_18500 2011595 2012254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2014438 2013059 gene locus_tag LOCUS_18510 2014438 2013059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2014723 2015211 gene locus_tag LOCUS_18520 2014723 2015211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2017243 2015201 gene locus_tag LOCUS_18530 2017243 2015201 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_18530 2018672 2017278 gene locus_tag LOCUS_18540 2018672 2017278 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_18540 2019019 2020326 gene locus_tag LOCUS_18550 2019019 2020326 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055915.1 protein_id gnl|my_center|LOCUS_18550 2020331 2023396 gene locus_tag LOCUS_18560 2020331 2023396 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016450.1 protein_id gnl|my_center|LOCUS_18560 2023418 2024608 gene locus_tag LOCUS_18570 2023418 2024608 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404146.1 protein_id gnl|my_center|LOCUS_18570 2024612 2025217 gene locus_tag LOCUS_18580 2024612 2025217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2025219 2026901 gene locus_tag LOCUS_18590 2025219 2026901 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056105.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence2 85 294 gene locus_tag LOCUS_18600 85 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 281 535 gene locus_tag LOCUS_18610 281 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 532 2517 gene locus_tag LOCUS_18620 532 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3882 2764 gene locus_tag LOCUS_18630 3882 2764 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_18630 4965 3919 gene locus_tag LOCUS_18640 4965 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 6486 5098 gene locus_tag LOCUS_18650 6486 5098 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728048.1 protein_id gnl|my_center|LOCUS_18650 6929 7411 gene locus_tag LOCUS_18660 6929 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 7430 7813 gene locus_tag LOCUS_18670 7430 7813 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256893.1 protein_id gnl|my_center|LOCUS_18670 7890 8186 gene locus_tag LOCUS_18680 7890 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 8396 8827 gene locus_tag LOCUS_18690 8396 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 9268 8846 gene locus_tag LOCUS_18700 9268 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 10271 9150 gene locus_tag LOCUS_18710 10271 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 11960 10356 gene locus_tag LOCUS_18720 11960 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 12988 13152 gene locus_tag LOCUS_18730 12988 13152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 13121 13384 gene locus_tag LOCUS_18740 13121 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 14443 17277 gene locus_tag LOCUS_18750 14443 17277 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227616.1 protein_id gnl|my_center|LOCUS_18750 17279 18910 gene locus_tag LOCUS_18760 gene casA 17279 18910 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227614.1 protein_id gnl|my_center|LOCUS_18760 18941 19501 gene locus_tag LOCUS_18770 18941 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 19532 20680 gene locus_tag LOCUS_18780 gene cas7e 19532 20680 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_18780 20680 21372 gene locus_tag LOCUS_18790 gene cas5e 20680 21372 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_18790 21378 22100 gene locus_tag LOCUS_18800 gene cas6e 21378 22100 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_18800 22097 23071 gene locus_tag LOCUS_18810 gene cas1e 22097 23071 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_18810 23068 23358 gene locus_tag LOCUS_18820 23068 23358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 23514 24703 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atcgtccccacacgcgtgggggtgaaccg 26242 24947 gene locus_tag LOCUS_18830 26242 24947 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_18830 26656 26267 gene locus_tag LOCUS_18840 26656 26267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 27719 26676 gene locus_tag LOCUS_18850 27719 26676 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969402.1 protein_id gnl|my_center|LOCUS_18850 28431 27730 gene locus_tag LOCUS_18860 28431 27730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 29732 28470 gene locus_tag LOCUS_18870 29732 28470 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_18870 30778 29735 gene locus_tag LOCUS_18880 30778 29735 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_18880 31636 30794 gene locus_tag LOCUS_18890 31636 30794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 32529 31681 gene locus_tag LOCUS_18900 32529 31681 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967714.1 protein_id gnl|my_center|LOCUS_18900 32641 33135 gene locus_tag LOCUS_18910 32641 33135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 33132 33719 gene locus_tag LOCUS_18920 33132 33719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 33755 34669 gene locus_tag LOCUS_18930 33755 34669 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_18930 34830 35588 gene locus_tag LOCUS_18940 34830 35588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 36755 35598 gene locus_tag LOCUS_18950 36755 35598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 36874 37881 gene locus_tag LOCUS_18960 36874 37881 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_18960 38146 37976 gene locus_tag LOCUS_18970 38146 37976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 39029 38199 gene locus_tag LOCUS_18980 39029 38199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 39299 40057 gene locus_tag LOCUS_18990 39299 40057 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_18990 41704 40013 gene locus_tag LOCUS_19000 41704 40013 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_19000 41886 41590 gene locus_tag LOCUS_19010 41886 41590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 42162 41962 gene locus_tag LOCUS_19020 42162 41962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 42100 42597 gene locus_tag LOCUS_19030 42100 42597 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729205.1 protein_id gnl|my_center|LOCUS_19030 42760 42584 gene locus_tag LOCUS_19040 42760 42584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 43743 42853 gene locus_tag LOCUS_19050 43743 42853 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969937.1 protein_id gnl|my_center|LOCUS_19050 44585 43743 gene locus_tag LOCUS_19060 44585 43743 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259477.1 protein_id gnl|my_center|LOCUS_19060 44716 45771 gene locus_tag LOCUS_19070 44716 45771 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 protein_id gnl|my_center|LOCUS_19070 45841 46725 gene locus_tag LOCUS_19080 45841 46725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 46848 49055 gene locus_tag LOCUS_19090 46848 49055 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083038.1 protein_id gnl|my_center|LOCUS_19090 49982 49101 gene locus_tag LOCUS_19100 49982 49101 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226278.1 protein_id gnl|my_center|LOCUS_19100 51133 49985 gene locus_tag LOCUS_19110 51133 49985 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226899.1 protein_id gnl|my_center|LOCUS_19110 52197 51130 gene locus_tag LOCUS_19120 52197 51130 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027544.1 protein_id gnl|my_center|LOCUS_19120 52969 52436 gene locus_tag LOCUS_19130 52969 52436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 53145 54236 gene locus_tag LOCUS_19140 53145 54236 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767549.1 protein_id gnl|my_center|LOCUS_19140 54482 55624 gene locus_tag LOCUS_19150 54482 55624 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966748.1 protein_id gnl|my_center|LOCUS_19150 55981 56358 gene locus_tag LOCUS_19160 55981 56358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 56381 57007 gene locus_tag LOCUS_19170 56381 57007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 58583 57012 gene locus_tag LOCUS_19180 58583 57012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 58748 59842 gene locus_tag LOCUS_19190 58748 59842 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_19190 59892 60662 gene locus_tag LOCUS_19200 59892 60662 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_19200 60675 62051 gene locus_tag LOCUS_19210 60675 62051 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_19210 62288 62917 gene locus_tag LOCUS_19220 62288 62917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 62985 63440 gene locus_tag LOCUS_19230 62985 63440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 63455 64159 gene locus_tag LOCUS_19240 63455 64159 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528224.1 protein_id gnl|my_center|LOCUS_19240 65376 64126 gene locus_tag LOCUS_19250 65376 64126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 65495 65956 gene locus_tag LOCUS_19260 65495 65956 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 protein_id gnl|my_center|LOCUS_19260 65967 66803 gene locus_tag LOCUS_19270 65967 66803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 66904 68022 gene locus_tag LOCUS_19280 66904 68022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 69312 68050 gene locus_tag LOCUS_19290 69312 68050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 69872 69474 gene locus_tag LOCUS_19300 gene cmr5 69872 69474 CDS product type III-B CRISPR module-associated protein Cmr5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879355.1 protein_id gnl|my_center|LOCUS_19300 70765 69869 gene locus_tag LOCUS_19310 gene cmr4 70765 69869 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221897993.1 protein_id gnl|my_center|LOCUS_19310 72031 70769 gene locus_tag LOCUS_19320 gene cmr3 72031 70769 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879359.1 protein_id gnl|my_center|LOCUS_19320 73898 72024 gene locus_tag LOCUS_19330 gene cas10 73898 72024 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880206.1 protein_id gnl|my_center|LOCUS_19330 75055 73895 gene locus_tag LOCUS_19340 gene cmr1 75055 73895 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229142.1 protein_id gnl|my_center|LOCUS_19340 76395 75067 gene locus_tag LOCUS_19350 76395 75067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 77704 76400 gene locus_tag LOCUS_19360 77704 76400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 78623 77826 gene locus_tag LOCUS_19370 78623 77826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 80350 78746 gene locus_tag LOCUS_19380 80350 78746 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_19380 80541 80960 gene locus_tag LOCUS_19390 80541 80960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 81188 82912 gene locus_tag LOCUS_19400 gene araD 81188 82912 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228759.1 protein_id gnl|my_center|LOCUS_19400 82941 84287 gene locus_tag LOCUS_19410 82941 84287 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582573.1 protein_id gnl|my_center|LOCUS_19410 85583 84297 gene locus_tag LOCUS_19420 85583 84297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 86440 85592 gene locus_tag LOCUS_19430 86440 85592 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115716.1 protein_id gnl|my_center|LOCUS_19430 87404 86445 gene locus_tag LOCUS_19440 87404 86445 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027842956.1 protein_id gnl|my_center|LOCUS_19440 88763 87414 gene locus_tag LOCUS_19450 88763 87414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 89016 89705 gene locus_tag LOCUS_19460 89016 89705 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_19460 89708 91006 gene locus_tag LOCUS_19470 gene hemL 89708 91006 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_19470 91017 91781 gene locus_tag LOCUS_19480 91017 91781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536404.1 protein_id gnl|my_center|LOCUS_19480 92008 92250 gene locus_tag LOCUS_19490 92008 92250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 93240 92275 gene locus_tag LOCUS_19500 93240 92275 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259671.1 protein_id gnl|my_center|LOCUS_19500 93395 94804 gene locus_tag LOCUS_19510 93395 94804 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028622.1 protein_id gnl|my_center|LOCUS_19510 95060 96085 gene locus_tag LOCUS_19520 95060 96085 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909511.1 protein_id gnl|my_center|LOCUS_19520 96138 96521 gene locus_tag LOCUS_19530 96138 96521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 96521 97417 gene locus_tag LOCUS_19540 96521 97417 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777086.1 protein_id gnl|my_center|LOCUS_19540 97488 97865 gene locus_tag LOCUS_19550 97488 97865 CDS product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909510.1 protein_id gnl|my_center|LOCUS_19550 97893 98078 gene locus_tag LOCUS_19560 97893 98078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 98079 98597 gene locus_tag LOCUS_19570 98079 98597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19570 98622 99620 gene locus_tag LOCUS_19580 98622 99620 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_19580 99659 100630 gene locus_tag LOCUS_19590 99659 100630 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_19590 100747 101595 gene locus_tag LOCUS_19600 100747 101595 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897866.1 protein_id gnl|my_center|LOCUS_19600 101643 102440 gene locus_tag LOCUS_19610 101643 102440 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384819.1 protein_id gnl|my_center|LOCUS_19610 102559 103392 gene locus_tag LOCUS_19620 102559 103392 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_19620 103426 103818 gene locus_tag LOCUS_19630 103426 103818 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690482.1 protein_id gnl|my_center|LOCUS_19630 105084 104491 gene locus_tag LOCUS_19640 105084 104491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 105839 105195 gene locus_tag LOCUS_19650 105839 105195 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063881.1 protein_id gnl|my_center|LOCUS_19650 106689 105886 gene locus_tag LOCUS_19660 106689 105886 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528739.1 protein_id gnl|my_center|LOCUS_19660 107004 106702 gene locus_tag LOCUS_19670 107004 106702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 107654 107031 gene locus_tag LOCUS_19680 107654 107031 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148701912.1 protein_id gnl|my_center|LOCUS_19680 107881 108798 gene locus_tag LOCUS_19690 107881 108798 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19690 110548 109193 gene locus_tag LOCUS_19700 110548 109193 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_19700 112739 110562 gene locus_tag LOCUS_19710 112739 110562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 113157 112747 gene locus_tag LOCUS_19720 113157 112747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 114299 113199 gene locus_tag LOCUS_19730 114299 113199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 115173 114313 gene locus_tag LOCUS_19740 115173 114313 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_19740 116179 115196 gene locus_tag LOCUS_19750 116179 115196 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_19750 117823 116297 gene locus_tag LOCUS_19760 117823 116297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 118455 117862 gene locus_tag LOCUS_19770 118455 117862 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887249.1 protein_id gnl|my_center|LOCUS_19770 118760 118939 gene locus_tag LOCUS_19780 118760 118939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 118987 119373 gene locus_tag LOCUS_19790 118987 119373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19790 119507 120259 gene locus_tag LOCUS_19800 119507 120259 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460218.1 protein_id gnl|my_center|LOCUS_19800 120243 121277 gene locus_tag LOCUS_19810 120243 121277 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398939.1 protein_id gnl|my_center|LOCUS_19810 121274 122860 gene locus_tag LOCUS_19820 121274 122860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 122943 124349 gene locus_tag LOCUS_19830 122943 124349 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_19830 124410 125369 gene locus_tag LOCUS_19840 124410 125369 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_19840 125374 126228 gene locus_tag LOCUS_19850 125374 126228 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_19850 126237 127307 gene locus_tag LOCUS_19860 126237 127307 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_19860 127288 127956 gene locus_tag LOCUS_19870 127288 127956 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_19870 127940 128629 gene locus_tag LOCUS_19880 gene rpe 127940 128629 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_19880 128619 129578 gene locus_tag LOCUS_19890 128619 129578 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_19890 129589 130386 gene locus_tag LOCUS_19900 129589 130386 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_19900 130383 132314 gene locus_tag LOCUS_19910 130383 132314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827609.1 protein_id gnl|my_center|LOCUS_19910 132333 133346 gene locus_tag LOCUS_19920 132333 133346 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245542.1 protein_id gnl|my_center|LOCUS_19920 134051 133350 gene locus_tag LOCUS_19930 134051 133350 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_19930 135751 134210 gene locus_tag LOCUS_19940 135751 134210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 136368 136024 gene locus_tag LOCUS_19950 136368 136024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 136256 138043 gene locus_tag LOCUS_19960 136256 138043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 138047 138883 gene locus_tag LOCUS_19970 138047 138883 CDS product IucA/IucC family C-terminal-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259662.1 protein_id gnl|my_center|LOCUS_19970 138880 139911 gene locus_tag LOCUS_19980 138880 139911 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259661.1 protein_id gnl|my_center|LOCUS_19980 139908 140963 gene locus_tag LOCUS_19990 139908 140963 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259663.1 protein_id gnl|my_center|LOCUS_19990 140960 141796 gene locus_tag LOCUS_20000 140960 141796 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259664.1 protein_id gnl|my_center|LOCUS_20000 141966 143150 gene locus_tag LOCUS_20010 141966 143150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 143169 144410 gene locus_tag LOCUS_20020 143169 144410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 144431 146554 gene locus_tag LOCUS_20030 144431 146554 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_20030 146558 147004 gene locus_tag LOCUS_20040 146558 147004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 147027 147746 gene locus_tag LOCUS_20050 147027 147746 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970955.1 protein_id gnl|my_center|LOCUS_20050 148715 147762 gene locus_tag LOCUS_20060 148715 147762 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083105.1 protein_id gnl|my_center|LOCUS_20060 148846 149067 gene locus_tag LOCUS_20070 148846 149067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 150032 149145 gene locus_tag LOCUS_20080 150032 149145 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258534.1 protein_id gnl|my_center|LOCUS_20080 150956 150045 gene locus_tag LOCUS_20090 150956 150045 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083605764.1 protein_id gnl|my_center|LOCUS_20090 152281 150977 gene locus_tag LOCUS_20100 152281 150977 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_20100 152426 153361 gene locus_tag LOCUS_20110 152426 153361 CDS product UV damage repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256156.1 protein_id gnl|my_center|LOCUS_20110 153608 153390 gene locus_tag LOCUS_20120 153608 153390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 154550 153717 gene locus_tag LOCUS_20130 154550 153717 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_20130 155165 154719 gene locus_tag LOCUS_20140 155165 154719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 156628 155162 gene locus_tag LOCUS_20150 156628 155162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 157039 156644 gene locus_tag LOCUS_20160 157039 156644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 157354 157572 gene locus_tag LOCUS_20170 157354 157572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20170 157583 158365 gene locus_tag LOCUS_20180 157583 158365 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173736.1 protein_id gnl|my_center|LOCUS_20180 158368 159006 gene locus_tag LOCUS_20190 158368 159006 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 protein_id gnl|my_center|LOCUS_20190 159010 160797 gene locus_tag LOCUS_20200 159010 160797 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031326.1 protein_id gnl|my_center|LOCUS_20200 160901 161089 gene locus_tag LOCUS_20210 160901 161089 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532401.1 protein_id gnl|my_center|LOCUS_20210 165100 161141 gene locus_tag LOCUS_20220 165100 161141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 166531 165119 gene locus_tag LOCUS_20230 166531 165119 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_20230 169416 166549 gene locus_tag LOCUS_20240 169416 166549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 170337 169420 gene locus_tag LOCUS_20250 170337 169420 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_20250 171256 170339 gene locus_tag LOCUS_20260 171256 170339 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_20260 172687 171311 gene locus_tag LOCUS_20270 172687 171311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 173078 173881 gene locus_tag LOCUS_20280 173078 173881 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_20280 174079 175128 gene locus_tag LOCUS_20290 gene fni 174079 175128 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_20290 175140 176612 gene locus_tag LOCUS_20300 gene crtI 175140 176612 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903230.1 protein_id gnl|my_center|LOCUS_20300 176602 177441 gene locus_tag LOCUS_20310 176602 177441 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485796.1 protein_id gnl|my_center|LOCUS_20310 177422 178285 gene locus_tag LOCUS_20320 177422 178285 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903229.1 protein_id gnl|my_center|LOCUS_20320 179533 178256 gene locus_tag LOCUS_20330 179533 178256 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186962.1 protein_id gnl|my_center|LOCUS_20330 179602 180294 gene locus_tag LOCUS_20340 179602 180294 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_20340 181275 180304 gene locus_tag LOCUS_20350 181275 180304 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257220.1 protein_id gnl|my_center|LOCUS_20350 181473 183083 gene locus_tag LOCUS_20360 181473 183083 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066912.1 protein_id gnl|my_center|LOCUS_20360 183094 183969 gene locus_tag LOCUS_20370 183094 183969 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531801.1 protein_id gnl|my_center|LOCUS_20370 183966 184823 gene locus_tag LOCUS_20380 183966 184823 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_20380 184828 185046 gene locus_tag LOCUS_20390 184828 185046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 185065 186156 gene locus_tag LOCUS_20400 gene eltD 185065 186156 CDS product erythritol/L-threitol dehyrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728938.1 protein_id gnl|my_center|LOCUS_20400 186196 187224 gene locus_tag LOCUS_20410 186196 187224 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776787.1 protein_id gnl|my_center|LOCUS_20410 187228 188172 gene locus_tag LOCUS_20420 187228 188172 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_20420 188612 188175 gene locus_tag LOCUS_20430 188612 188175 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419428.1 protein_id gnl|my_center|LOCUS_20430 188836 189984 gene locus_tag LOCUS_20440 188836 189984 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082979.1 protein_id gnl|my_center|LOCUS_20440 191456 190149 gene locus_tag LOCUS_20450 191456 190149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20450 192017 191598 gene locus_tag LOCUS_20460 192017 191598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20460 192627 192965 gene locus_tag LOCUS_20470 192627 192965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 192931 194763 gene locus_tag LOCUS_20480 192931 194763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 196097 194790 gene locus_tag LOCUS_20490 196097 194790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 196609 197664 gene locus_tag LOCUS_20500 gene aroF 196609 197664 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_20500 197709 199199 gene locus_tag LOCUS_20510 197709 199199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 199203 199904 gene locus_tag LOCUS_20520 199203 199904 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_20520 199989 200345 gene locus_tag LOCUS_20530 199989 200345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 200374 202392 gene locus_tag LOCUS_20540 200374 202392 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_20540 203011 202364 gene locus_tag LOCUS_20550 203011 202364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 203903 203103 gene locus_tag LOCUS_20560 203903 203103 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392177.1 protein_id gnl|my_center|LOCUS_20560 204079 205125 gene locus_tag LOCUS_20570 204079 205125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706886.1 protein_id gnl|my_center|LOCUS_20570 205546 205391 gene locus_tag LOCUS_20580 205546 205391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 205717 207138 gene locus_tag LOCUS_20590 205717 207138 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706882.1 protein_id gnl|my_center|LOCUS_20590 207242 208186 gene locus_tag LOCUS_20600 207242 208186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776034.1 protein_id gnl|my_center|LOCUS_20600 208203 209237 gene locus_tag LOCUS_20610 208203 209237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706884.1 protein_id gnl|my_center|LOCUS_20610 209272 210246 gene locus_tag LOCUS_20620 209272 210246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461267.1 protein_id gnl|my_center|LOCUS_20620 210632 210264 gene locus_tag LOCUS_20630 210632 210264 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846473.1 protein_id gnl|my_center|LOCUS_20630 211902 210838 gene locus_tag LOCUS_20640 211902 210838 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526892.1 protein_id gnl|my_center|LOCUS_20640 212663 211974 gene locus_tag LOCUS_20650 212663 211974 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904947.1 protein_id gnl|my_center|LOCUS_20650 213259 212660 gene locus_tag LOCUS_20660 213259 212660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 213563 213243 gene locus_tag LOCUS_20670 213563 213243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 214205 213588 gene locus_tag LOCUS_20680 214205 213588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 214365 214571 gene locus_tag LOCUS_20690 214365 214571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 214568 215041 gene locus_tag LOCUS_20700 214568 215041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 215122 215349 gene locus_tag LOCUS_20710 215122 215349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 215336 216988 gene locus_tag LOCUS_20720 gene merA 215336 216988 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193219.1 protein_id gnl|my_center|LOCUS_20720 217155 217556 gene locus_tag LOCUS_20730 217155 217556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 218973 217819 gene locus_tag LOCUS_20740 218973 217819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 219563 218976 gene locus_tag LOCUS_20750 gene kdpC 219563 218976 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919467.1 protein_id gnl|my_center|LOCUS_20750 221623 219575 gene locus_tag LOCUS_20760 gene kdpB 221623 219575 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968197.1 protein_id gnl|my_center|LOCUS_20760 223338 221620 gene locus_tag LOCUS_20770 gene kdpA 223338 221620 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388910.1 protein_id gnl|my_center|LOCUS_20770 223577 223335 gene locus_tag LOCUS_20780 223577 223335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 224169 223780 gene locus_tag LOCUS_20790 224169 223780 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332309.1 protein_id gnl|my_center|LOCUS_20790 224953 224258 gene locus_tag LOCUS_20800 224953 224258 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_20800 226566 224947 gene locus_tag LOCUS_20810 226566 224947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 227235 227822 gene locus_tag LOCUS_20820 227235 227822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 228010 229482 gene locus_tag LOCUS_20830 228010 229482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 229422 230177 gene locus_tag LOCUS_20840 229422 230177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 230743 230198 gene locus_tag LOCUS_20850 230743 230198 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_20850 231191 230778 gene locus_tag LOCUS_20860 231191 230778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256057.1 protein_id gnl|my_center|LOCUS_20860 231296 233212 gene locus_tag LOCUS_20870 231296 233212 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222670.1 protein_id gnl|my_center|LOCUS_20870 233349 233822 gene locus_tag LOCUS_20880 233349 233822 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225120.1 protein_id gnl|my_center|LOCUS_20880 234489 233827 gene locus_tag LOCUS_20890 234489 233827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 235283 234546 gene locus_tag LOCUS_20900 235283 234546 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970686.1 protein_id gnl|my_center|LOCUS_20900 235398 236744 gene locus_tag LOCUS_20910 235398 236744 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225363.1 protein_id gnl|my_center|LOCUS_20910 237979 236741 gene locus_tag LOCUS_20920 237979 236741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 239391 238207 gene locus_tag LOCUS_20930 239391 238207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 239488 239688 gene locus_tag LOCUS_20940 239488 239688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 239825 240298 gene locus_tag LOCUS_20950 239825 240298 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574859.1 protein_id gnl|my_center|LOCUS_20950 240386 244216 gene locus_tag LOCUS_20960 240386 244216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 245960 244245 gene locus_tag LOCUS_20970 245960 244245 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_20970 246718 245957 gene locus_tag LOCUS_20980 246718 245957 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804391.1 protein_id gnl|my_center|LOCUS_20980 247354 246728 gene locus_tag LOCUS_20990 247354 246728 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124312.1 protein_id gnl|my_center|LOCUS_20990 247592 249781 gene locus_tag LOCUS_21000 247592 249781 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_21000 251290 250325 gene locus_tag LOCUS_21010 251290 250325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 251939 251298 gene locus_tag LOCUS_21020 251939 251298 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_21020 252893 252030 gene locus_tag LOCUS_21030 252893 252030 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_21030 254457 253171 gene locus_tag LOCUS_21040 254457 253171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 256892 254460 gene locus_tag LOCUS_21050 256892 254460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 257677 256904 gene locus_tag LOCUS_21060 gene gdh 257677 256904 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246720.1 protein_id gnl|my_center|LOCUS_21060 258456 257740 gene locus_tag LOCUS_21070 258456 257740 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_21070 259693 258431 gene locus_tag LOCUS_21080 259693 258431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21080 259863 261617 gene locus_tag LOCUS_21090 259863 261617 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533218.1 protein_id gnl|my_center|LOCUS_21090 261629 262906 gene locus_tag LOCUS_21100 261629 262906 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_21100 262917 264128 gene locus_tag LOCUS_21110 262917 264128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 264155 267202 gene locus_tag LOCUS_21120 264155 267202 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228347.1 protein_id gnl|my_center|LOCUS_21120 267769 267323 gene locus_tag LOCUS_21130 267769 267323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21130 268852 267839 gene locus_tag LOCUS_21140 268852 267839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21140 269505 268852 gene locus_tag LOCUS_21150 269505 268852 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259358.1 protein_id gnl|my_center|LOCUS_21150 270412 269498 gene locus_tag LOCUS_21160 270412 269498 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259359.1 protein_id gnl|my_center|LOCUS_21160 270682 270443 gene locus_tag LOCUS_21170 270682 270443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 271889 270903 gene locus_tag LOCUS_21180 271889 270903 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922076.1 protein_id gnl|my_center|LOCUS_21180 272615 271893 gene locus_tag LOCUS_21190 gene nagB 272615 271893 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_21190 273918 272620 gene locus_tag LOCUS_21200 gene celF 273918 272620 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145749.1 protein_id gnl|my_center|LOCUS_21200 274919 273960 gene locus_tag LOCUS_21210 274919 273960 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582497.1 protein_id gnl|my_center|LOCUS_21210 276089 274932 gene locus_tag LOCUS_21220 276089 274932 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_21220 277001 276111 gene locus_tag LOCUS_21230 277001 276111 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_21230 277925 277002 gene locus_tag LOCUS_21240 277925 277002 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229175.1 protein_id gnl|my_center|LOCUS_21240 279349 277946 gene locus_tag LOCUS_21250 279349 277946 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_21250 280467 279409 gene locus_tag LOCUS_21260 280467 279409 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_21260 281417 280467 gene locus_tag LOCUS_21270 281417 280467 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_21270 282280 281414 gene locus_tag LOCUS_21280 282280 281414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 283386 282277 gene locus_tag LOCUS_21290 283386 282277 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972959.1 protein_id gnl|my_center|LOCUS_21290 284220 283411 gene locus_tag LOCUS_21300 284220 283411 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_21300 284380 284793 gene locus_tag LOCUS_21310 284380 284793 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112247.1 protein_id gnl|my_center|LOCUS_21310 284908 288390 gene locus_tag LOCUS_21320 284908 288390 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_21320 288491 291304 gene locus_tag LOCUS_21330 288491 291304 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_21330 291668 294967 gene locus_tag LOCUS_21340 291668 294967 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_21340 296196 294997 gene locus_tag LOCUS_21350 gene anmK 296196 294997 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_21350 296402 296196 gene locus_tag LOCUS_21360 296402 296196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 298062 296458 gene locus_tag LOCUS_21370 298062 296458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 298319 298570 gene locus_tag LOCUS_21380 298319 298570 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_21380 298575 298898 gene locus_tag LOCUS_21390 298575 298898 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_21390 298889 299719 gene locus_tag LOCUS_21400 298889 299719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 299773 301020 gene locus_tag LOCUS_21410 299773 301020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_21410 301020 301277 gene locus_tag LOCUS_21420 301020 301277 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963400.1 protein_id gnl|my_center|LOCUS_21420 301288 301782 gene locus_tag LOCUS_21430 301288 301782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 301805 302128 gene locus_tag LOCUS_21440 301805 302128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 302207 302677 gene locus_tag LOCUS_21450 302207 302677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 303191 303997 gene locus_tag LOCUS_21460 303191 303997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 303880 304473 gene locus_tag LOCUS_21470 303880 304473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 305315 304470 gene locus_tag LOCUS_21480 305315 304470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 305857 305381 gene locus_tag LOCUS_21490 305857 305381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 306116 305880 gene locus_tag LOCUS_21500 306116 305880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 306453 306217 gene locus_tag LOCUS_21510 306453 306217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 306605 307645 gene locus_tag LOCUS_21520 306605 307645 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140309.1 protein_id gnl|my_center|LOCUS_21520 308152 307646 gene locus_tag LOCUS_21530 308152 307646 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256497.1 protein_id gnl|my_center|LOCUS_21530 308269 309231 gene locus_tag LOCUS_21540 308269 309231 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_21540 309452 309228 gene locus_tag LOCUS_21550 309452 309228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 310873 309512 gene locus_tag LOCUS_21560 gene mgtE 310873 309512 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062407.1 protein_id gnl|my_center|LOCUS_21560 310790 311002 gene locus_tag LOCUS_21570 310790 311002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 312273 311122 gene locus_tag LOCUS_21580 312273 311122 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522282.1 protein_id gnl|my_center|LOCUS_21580 312974 312360 gene locus_tag LOCUS_21590 312974 312360 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767695.1 protein_id gnl|my_center|LOCUS_21590 314078 313059 gene locus_tag LOCUS_21600 314078 313059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937478.1 protein_id gnl|my_center|LOCUS_21600 315035 314082 gene locus_tag LOCUS_21610 315035 314082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329701.1 protein_id gnl|my_center|LOCUS_21610 316008 315250 gene locus_tag LOCUS_21620 316008 315250 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_21620 317982 316075 gene locus_tag LOCUS_21630 gene psdB 317982 316075 CDS product lantibiotic ABC transporter permease PsdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243432.1 protein_id gnl|my_center|LOCUS_21630 318778 317954 gene locus_tag LOCUS_21640 318778 317954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948067.1 protein_id gnl|my_center|LOCUS_21640 319960 318893 gene locus_tag LOCUS_21650 gene psdS 319960 318893 CDS product two-component sensor histidine kinase PsdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242699.1 protein_id gnl|my_center|LOCUS_21650 320693 319986 gene locus_tag LOCUS_21660 320693 319986 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276720.1 protein_id gnl|my_center|LOCUS_21660 321493 320753 gene locus_tag LOCUS_21670 321493 320753 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_21670 321576 322871 gene locus_tag LOCUS_21680 321576 322871 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_21680 322974 323639 gene locus_tag LOCUS_21690 322974 323639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 323720 324538 gene locus_tag LOCUS_21700 323720 324538 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 protein_id gnl|my_center|LOCUS_21700 325114 324830 gene locus_tag LOCUS_21710 325114 324830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 326021 325023 gene locus_tag LOCUS_21720 326021 325023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21720 327894 326179 gene locus_tag LOCUS_21730 327894 326179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_21730 328922 328041 gene locus_tag LOCUS_21740 328922 328041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 330301 329990 gene locus_tag LOCUS_21750 330301 329990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 330680 330871 gene locus_tag LOCUS_21760 330680 330871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 331026 331928 gene locus_tag LOCUS_21770 331026 331928 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777001.1 protein_id gnl|my_center|LOCUS_21770 333389 331977 gene locus_tag LOCUS_21780 333389 331977 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_21780 334621 333386 gene locus_tag LOCUS_21790 334621 333386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 334693 335112 gene locus_tag LOCUS_21800 334693 335112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 336042 335131 gene locus_tag LOCUS_21810 336042 335131 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_21810 336401 336039 gene locus_tag LOCUS_21820 336401 336039 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268438.1 protein_id gnl|my_center|LOCUS_21820 340489 336398 gene locus_tag LOCUS_21830 340489 336398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 340668 341681 gene locus_tag LOCUS_21840 340668 341681 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_21840 341691 343223 gene locus_tag LOCUS_21850 341691 343223 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 protein_id gnl|my_center|LOCUS_21850 343258 344349 gene locus_tag LOCUS_21860 343258 344349 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111830427.1 protein_id gnl|my_center|LOCUS_21860 344420 346126 gene locus_tag LOCUS_21870 344420 346126 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_21870 346939 346130 gene locus_tag LOCUS_21880 346939 346130 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_21880 347476 347012 gene locus_tag LOCUS_21890 347476 347012 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228444.1 protein_id gnl|my_center|LOCUS_21890 348563 347532 gene locus_tag LOCUS_21900 348563 347532 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225533.1 protein_id gnl|my_center|LOCUS_21900 350013 348586 gene locus_tag LOCUS_21910 350013 348586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 351027 350035 gene locus_tag LOCUS_21920 351027 350035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 352067 351024 gene locus_tag LOCUS_21930 gene galT 352067 351024 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 protein_id gnl|my_center|LOCUS_21930 353054 352071 gene locus_tag LOCUS_21940 gene galE 353054 352071 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_21940 354599 353067 gene locus_tag LOCUS_21950 gene abfA 354599 353067 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_21950 355572 354673 gene locus_tag LOCUS_21960 355572 354673 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776904.1 protein_id gnl|my_center|LOCUS_21960 356505 355585 gene locus_tag LOCUS_21970 356505 355585 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_21970 357990 356527 gene locus_tag LOCUS_21980 357990 356527 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972759.1 protein_id gnl|my_center|LOCUS_21980 358213 359241 gene locus_tag LOCUS_21990 358213 359241 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_21990 359735 360349 gene locus_tag LOCUS_22000 359735 360349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22000 360381 361667 gene locus_tag LOCUS_22010 360381 361667 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932823.1 protein_id gnl|my_center|LOCUS_22010 361679 362536 gene locus_tag LOCUS_22020 361679 362536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 362693 363829 gene locus_tag LOCUS_22030 362693 363829 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_22030 365860 363944 gene locus_tag LOCUS_22040 365860 363944 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582880.1 protein_id gnl|my_center|LOCUS_22040 366795 365890 gene locus_tag LOCUS_22050 366795 365890 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_22050 367727 366810 gene locus_tag LOCUS_22060 367727 366810 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_22060 369182 367743 gene locus_tag LOCUS_22070 369182 367743 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_22070 369382 370413 gene locus_tag LOCUS_22080 369382 370413 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583033.1 protein_id gnl|my_center|LOCUS_22080 370834 370415 gene locus_tag LOCUS_22090 370834 370415 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172694.1 protein_id gnl|my_center|LOCUS_22090 370980 371696 gene locus_tag LOCUS_22100 370980 371696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 372141 371680 gene locus_tag LOCUS_22110 372141 371680 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920478.1 protein_id gnl|my_center|LOCUS_22110 372299 372868 gene locus_tag LOCUS_22120 gene ssuE 372299 372868 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 protein_id gnl|my_center|LOCUS_22120 372879 373862 gene locus_tag LOCUS_22130 372879 373862 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199695.1 protein_id gnl|my_center|LOCUS_22130 373890 375044 gene locus_tag LOCUS_22140 gene ssuD 373890 375044 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268305.1 protein_id gnl|my_center|LOCUS_22140 375041 375820 gene locus_tag LOCUS_22150 gene ssuC 375041 375820 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102309.1 protein_id gnl|my_center|LOCUS_22150 375833 376636 gene locus_tag LOCUS_22160 gene ssuB 375833 376636 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105420.1 protein_id gnl|my_center|LOCUS_22160 377759 376695 gene locus_tag LOCUS_22170 377759 376695 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_22170 378195 377890 gene locus_tag LOCUS_22180 378195 377890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 378946 378209 gene locus_tag LOCUS_22190 378946 378209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 379472 379041 gene locus_tag LOCUS_22200 379472 379041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 380391 379525 gene locus_tag LOCUS_22210 380391 379525 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_22210 382764 380401 gene locus_tag LOCUS_22220 382764 380401 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_22220 383334 382777 gene locus_tag LOCUS_22230 383334 382777 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_22230 383844 383386 gene locus_tag LOCUS_22240 383844 383386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 383974 385044 gene locus_tag LOCUS_22250 383974 385044 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_22250 386397 385036 gene locus_tag LOCUS_22260 386397 385036 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_22260 388060 386582 gene locus_tag LOCUS_22270 388060 386582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 388734 388291 gene locus_tag LOCUS_22280 388734 388291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256549.1 protein_id gnl|my_center|LOCUS_22280 388815 389735 gene locus_tag LOCUS_22290 388815 389735 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228232.1 protein_id gnl|my_center|LOCUS_22290 389728 390294 gene locus_tag LOCUS_22300 389728 390294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 390364 390696 gene locus_tag LOCUS_22310 390364 390696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 391235 390837 gene locus_tag LOCUS_22320 391235 390837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 391744 391349 gene locus_tag LOCUS_22330 391744 391349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 392846 391929 gene locus_tag LOCUS_22340 392846 391929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 392966 393463 gene locus_tag LOCUS_22350 392966 393463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 394492 393464 gene locus_tag LOCUS_22360 394492 393464 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975777.1 protein_id gnl|my_center|LOCUS_22360 395160 394528 gene locus_tag LOCUS_22370 395160 394528 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891568.1 protein_id gnl|my_center|LOCUS_22370 396011 395193 gene locus_tag LOCUS_22380 396011 395193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 396952 396101 gene locus_tag LOCUS_22390 396952 396101 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931877.1 protein_id gnl|my_center|LOCUS_22390 397709 396909 gene locus_tag LOCUS_22400 397709 396909 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931878.1 protein_id gnl|my_center|LOCUS_22400 398026 399486 gene locus_tag LOCUS_22410 398026 399486 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_22410 399488 400714 gene locus_tag LOCUS_22420 gene rhaI 399488 400714 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_22420 400734 402809 gene locus_tag LOCUS_22430 400734 402809 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_22430 402814 403407 gene locus_tag LOCUS_22440 402814 403407 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942266.1 protein_id gnl|my_center|LOCUS_22440 403394 405697 gene locus_tag LOCUS_22450 403394 405697 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393788.1 protein_id gnl|my_center|LOCUS_22450 405812 406129 gene locus_tag LOCUS_22460 405812 406129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 406126 406266 gene locus_tag LOCUS_22470 406126 406266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 406268 406516 gene locus_tag LOCUS_22480 406268 406516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 406861 407853 gene locus_tag LOCUS_22490 406861 407853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 407979 408584 gene locus_tag LOCUS_22500 gene rpsD 407979 408584 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 protein_id gnl|my_center|LOCUS_22500 410094 409018 gene locus_tag LOCUS_22510 410094 409018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22510 410479 410303 gene locus_tag LOCUS_22520 410479 410303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 411769 410774 gene locus_tag LOCUS_22530 411769 410774 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888815.1 protein_id gnl|my_center|LOCUS_22530 412884 411814 gene locus_tag LOCUS_22540 412884 411814 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067163.1 protein_id gnl|my_center|LOCUS_22540 413713 412913 gene locus_tag LOCUS_22550 413713 412913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 413877 415115 gene locus_tag LOCUS_22560 413877 415115 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728677.1 protein_id gnl|my_center|LOCUS_22560 415131 415547 gene locus_tag LOCUS_22570 415131 415547 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_22570 415590 416597 gene locus_tag LOCUS_22580 415590 416597 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222782.1 protein_id gnl|my_center|LOCUS_22580 417148 416594 gene locus_tag LOCUS_22590 417148 416594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 417943 417170 gene locus_tag LOCUS_22600 417943 417170 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969509.1 protein_id gnl|my_center|LOCUS_22600 418993 417944 gene locus_tag LOCUS_22610 418993 417944 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921854.1 protein_id gnl|my_center|LOCUS_22610 419712 418990 gene locus_tag LOCUS_22620 419712 418990 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_22620 420693 419713 gene locus_tag LOCUS_22630 420693 419713 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_22630 421068 422036 gene locus_tag LOCUS_22640 421068 422036 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_22640 422038 423234 gene locus_tag LOCUS_22650 422038 423234 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257901.1 protein_id gnl|my_center|LOCUS_22650 424233 423235 gene locus_tag LOCUS_22660 gene kdgK1 424233 423235 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_22660 424380 428303 gene locus_tag LOCUS_22670 424380 428303 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256600.1 protein_id gnl|my_center|LOCUS_22670 429541 428363 gene locus_tag LOCUS_22680 429541 428363 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893677.1 protein_id gnl|my_center|LOCUS_22680 429667 431943 gene locus_tag LOCUS_22690 429667 431943 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_22690 431986 432570 gene locus_tag LOCUS_22700 431986 432570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 432649 433188 gene locus_tag LOCUS_22710 432649 433188 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166090.1 protein_id gnl|my_center|LOCUS_22710 433655 433308 gene locus_tag LOCUS_22720 433655 433308 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_22720 433766 434494 gene locus_tag LOCUS_22730 433766 434494 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530802.1 protein_id gnl|my_center|LOCUS_22730 434491 435492 gene locus_tag LOCUS_22740 434491 435492 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530803.1 protein_id gnl|my_center|LOCUS_22740 435497 436951 gene locus_tag LOCUS_22750 435497 436951 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400819.1 protein_id gnl|my_center|LOCUS_22750 436953 437894 gene locus_tag LOCUS_22760 436953 437894 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268087.1 protein_id gnl|my_center|LOCUS_22760 438236 438658 gene locus_tag LOCUS_22770 438236 438658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 438852 439595 gene locus_tag LOCUS_22780 438852 439595 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043775763.1 protein_id gnl|my_center|LOCUS_22780 439813 440733 gene locus_tag LOCUS_22790 439813 440733 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_22790 440744 441637 gene locus_tag LOCUS_22800 440744 441637 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257156.1 protein_id gnl|my_center|LOCUS_22800 441682 443028 gene locus_tag LOCUS_22810 441682 443028 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257157.1 protein_id gnl|my_center|LOCUS_22810 443438 443160 gene locus_tag LOCUS_22820 443438 443160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 444452 443457 gene locus_tag LOCUS_22830 444452 443457 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_22830 445345 444485 gene locus_tag LOCUS_22840 445345 444485 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258850.1 protein_id gnl|my_center|LOCUS_22840 446048 445356 gene locus_tag LOCUS_22850 446048 445356 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_22850 447154 446126 gene locus_tag LOCUS_22860 447154 446126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 447248 447712 gene locus_tag LOCUS_22870 447248 447712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 448577 447720 gene locus_tag LOCUS_22880 448577 447720 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_22880 449549 448587 gene locus_tag LOCUS_22890 449549 448587 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_22890 451006 449564 gene locus_tag LOCUS_22900 451006 449564 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972818.1 protein_id gnl|my_center|LOCUS_22900 451169 452212 gene locus_tag LOCUS_22910 451169 452212 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_22910 452260 453735 gene locus_tag LOCUS_22920 452260 453735 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055010987.1 protein_id gnl|my_center|LOCUS_22920 455132 453780 gene locus_tag LOCUS_22930 455132 453780 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082772.1 protein_id gnl|my_center|LOCUS_22930 456822 455455 gene locus_tag LOCUS_22940 gene nhaA 456822 455455 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_22940 456968 457345 gene locus_tag LOCUS_22950 456968 457345 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969671.1 protein_id gnl|my_center|LOCUS_22950 457375 458178 gene locus_tag LOCUS_22960 457375 458178 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729199.1 protein_id gnl|my_center|LOCUS_22960 460847 458181 gene locus_tag LOCUS_22970 460847 458181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 460948 461859 gene locus_tag LOCUS_22980 460948 461859 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_22980 463428 461872 gene locus_tag LOCUS_22990 463428 461872 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_22990 465266 463416 gene locus_tag LOCUS_23000 465266 463416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 465389 466147 gene locus_tag LOCUS_23010 465389 466147 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_23010 466217 467728 gene locus_tag LOCUS_23020 466217 467728 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_23020 467752 468693 gene locus_tag LOCUS_23030 467752 468693 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_23030 468700 469599 gene locus_tag LOCUS_23040 468700 469599 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_23040 469629 471620 gene locus_tag LOCUS_23050 469629 471620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 472664 471690 gene locus_tag LOCUS_23060 472664 471690 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220209699.1 protein_id gnl|my_center|LOCUS_23060 472830 473771 gene locus_tag LOCUS_23070 472830 473771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 475486 473768 gene locus_tag LOCUS_23080 475486 473768 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226836.1 protein_id gnl|my_center|LOCUS_23080 476030 475491 gene locus_tag LOCUS_23090 476030 475491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 476172 476915 gene locus_tag LOCUS_23100 476172 476915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 476950 478923 gene locus_tag LOCUS_23110 476950 478923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 478946 479608 gene locus_tag LOCUS_23120 478946 479608 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030017.1 protein_id gnl|my_center|LOCUS_23120 480066 481070 gene locus_tag LOCUS_23130 480066 481070 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 protein_id gnl|my_center|LOCUS_23130 481084 481899 gene locus_tag LOCUS_23140 gene cysT 481084 481899 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895898.1 protein_id gnl|my_center|LOCUS_23140 481889 482683 gene locus_tag LOCUS_23150 gene cysW 481889 482683 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_23150 482680 483660 gene locus_tag LOCUS_23160 482680 483660 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060315.1 protein_id gnl|my_center|LOCUS_23160 483870 484847 gene locus_tag LOCUS_23170 483870 484847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 485020 485406 gene locus_tag LOCUS_23180 485020 485406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 485533 486051 gene locus_tag LOCUS_23190 485533 486051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 486162 486425 gene locus_tag LOCUS_23200 486162 486425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 486441 486725 gene locus_tag LOCUS_23210 486441 486725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 486943 487503 gene locus_tag LOCUS_23220 486943 487503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 489890 487500 gene locus_tag LOCUS_23230 489890 487500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 489963 490265 gene locus_tag LOCUS_23240 489963 490265 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_23240 490311 491576 gene locus_tag LOCUS_23250 490311 491576 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_23250 491573 492871 gene locus_tag LOCUS_23260 491573 492871 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_23260 493263 493126 gene locus_tag LOCUS_23270 493263 493126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 493434 493273 gene locus_tag LOCUS_23280 493434 493273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 494352 493840 gene locus_tag LOCUS_23290 494352 493840 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877221.1 protein_id gnl|my_center|LOCUS_23290 496307 494481 gene locus_tag LOCUS_23300 496307 494481 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_23300 497145 496321 gene locus_tag LOCUS_23310 497145 496321 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_23310 498383 497157 gene locus_tag LOCUS_23320 498383 497157 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_23320 499715 498393 gene locus_tag LOCUS_23330 499715 498393 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804157.1 protein_id gnl|my_center|LOCUS_23330 500699 499872 gene locus_tag LOCUS_23340 500699 499872 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064688.1 protein_id gnl|my_center|LOCUS_23340 501297 500737 gene locus_tag LOCUS_23350 501297 500737 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_23350 503161 501335 gene locus_tag LOCUS_23360 503161 501335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243525.1 protein_id gnl|my_center|LOCUS_23360 504929 503184 gene locus_tag LOCUS_23370 504929 503184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_23370 505472 504951 gene locus_tag LOCUS_23380 505472 504951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 507630 505576 gene locus_tag LOCUS_23390 507630 505576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 508106 507630 gene locus_tag LOCUS_23400 508106 507630 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_23400 509035 508253 gene locus_tag LOCUS_23410 509035 508253 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807737.1 protein_id gnl|my_center|LOCUS_23410 509151 510041 gene locus_tag LOCUS_23420 509151 510041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 510805 510038 gene locus_tag LOCUS_23430 510805 510038 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_23430 512369 511137 gene locus_tag LOCUS_23440 512369 511137 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187352.1 protein_id gnl|my_center|LOCUS_23440 512461 512643 gene locus_tag LOCUS_23450 512461 512643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 512702 513469 gene locus_tag LOCUS_23460 512702 513469 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_23460 514334 513471 gene locus_tag LOCUS_23470 514334 513471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 514789 514337 gene locus_tag LOCUS_23480 514789 514337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 515690 514794 gene locus_tag LOCUS_23490 515690 514794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 515859 517088 gene locus_tag LOCUS_23500 gene lhgO 515859 517088 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_23500 518663 517134 gene locus_tag LOCUS_23510 518663 517134 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155019.1 protein_id gnl|my_center|LOCUS_23510 519307 518660 gene locus_tag LOCUS_23520 519307 518660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 519330 519560 gene locus_tag LOCUS_23530 519330 519560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 519704 519853 gene locus_tag LOCUS_23540 519704 519853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 520095 523610 gene locus_tag LOCUS_23550 520095 523610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 524507 523611 gene locus_tag LOCUS_23560 524507 523611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 525411 524512 gene locus_tag LOCUS_23570 525411 524512 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_23570 527536 525455 gene locus_tag LOCUS_23580 527536 525455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 527759 527932 gene locus_tag LOCUS_23590 527759 527932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 528455 527919 gene locus_tag LOCUS_23600 528455 527919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 528536 528736 gene locus_tag LOCUS_23610 528536 528736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 528779 530026 gene locus_tag LOCUS_23620 528779 530026 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_23620 530155 530006 gene locus_tag LOCUS_23630 530155 530006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 531069 530212 gene locus_tag LOCUS_23640 531069 530212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 531144 531944 gene locus_tag LOCUS_23650 531144 531944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 532039 533223 gene locus_tag LOCUS_23660 532039 533223 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494988.1 protein_id gnl|my_center|LOCUS_23660 533569 533288 gene locus_tag LOCUS_23670 533569 533288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 533940 533566 gene locus_tag LOCUS_23680 533940 533566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 535139 534099 gene locus_tag LOCUS_23690 535139 534099 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311173.1 protein_id gnl|my_center|LOCUS_23690 535728 535183 gene locus_tag LOCUS_23700 535728 535183 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 protein_id gnl|my_center|LOCUS_23700 536083 536706 gene locus_tag LOCUS_23710 536083 536706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 536828 537301 gene locus_tag LOCUS_23720 536828 537301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 537184 537921 gene locus_tag LOCUS_23730 537184 537921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 538552 538217 gene locus_tag LOCUS_23740 538552 538217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 538843 539199 gene locus_tag LOCUS_23750 538843 539199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 540116 539196 gene locus_tag LOCUS_23760 540116 539196 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103129516.1 protein_id gnl|my_center|LOCUS_23760 541275 540802 gene locus_tag LOCUS_23770 541275 540802 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_23770 541487 542113 gene locus_tag LOCUS_23780 541487 542113 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111484.1 protein_id gnl|my_center|LOCUS_23780 542971 542144 gene locus_tag LOCUS_23790 542971 542144 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084962.1 protein_id gnl|my_center|LOCUS_23790 543063 543407 gene locus_tag LOCUS_23800 543063 543407 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_23800 543413 544315 gene locus_tag LOCUS_23810 543413 544315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_23810 544312 545037 gene locus_tag LOCUS_23820 544312 545037 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_23820 545084 545275 gene locus_tag LOCUS_23830 545084 545275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 545672 545505 gene locus_tag LOCUS_23840 545672 545505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 546907 545744 gene locus_tag LOCUS_23850 546907 545744 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026824.1 protein_id gnl|my_center|LOCUS_23850 547544 547188 gene locus_tag LOCUS_23860 547544 547188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 550526 547749 gene locus_tag LOCUS_23870 550526 547749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 551894 550764 gene locus_tag LOCUS_23880 551894 550764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 553262 552432 gene locus_tag LOCUS_23890 553262 552432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 557659 553373 gene locus_tag LOCUS_23900 557659 553373 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257092.1 protein_id gnl|my_center|LOCUS_23900 557828 558058 gene locus_tag LOCUS_23910 557828 558058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 558533 558060 gene locus_tag LOCUS_23920 558533 558060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 558689 558859 gene locus_tag LOCUS_23930 558689 558859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 559169 560521 gene locus_tag LOCUS_23940 559169 560521 CDS product DUF4157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251156.1 protein_id gnl|my_center|LOCUS_23940 560619 560831 gene locus_tag LOCUS_23950 560619 560831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 562645 560849 gene locus_tag LOCUS_23960 562645 560849 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_23960 563048 562845 gene locus_tag LOCUS_23970 563048 562845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 563311 563808 gene locus_tag LOCUS_23980 563311 563808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 563985 564926 gene locus_tag LOCUS_23990 563985 564926 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_23990 565031 565336 gene locus_tag LOCUS_24000 565031 565336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 566349 565333 gene locus_tag LOCUS_24010 566349 565333 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_24010 566988 566359 gene locus_tag LOCUS_24020 566988 566359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 567747 567571 gene locus_tag LOCUS_24030 567747 567571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 568233 567853 gene locus_tag LOCUS_24040 568233 567853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 568469 569614 gene locus_tag LOCUS_24050 568469 569614 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392247.1 protein_id gnl|my_center|LOCUS_24050 569601 570632 gene locus_tag LOCUS_24060 gene pdxA 569601 570632 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063965.1 protein_id gnl|my_center|LOCUS_24060 570921 572600 gene locus_tag LOCUS_24070 570921 572600 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 protein_id gnl|my_center|LOCUS_24070 572754 574739 gene locus_tag LOCUS_24080 gene cas8b 572754 574739 CDS product type I-B CRISPR-associated protein Cas8b/Csh1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181363066.1 protein_id gnl|my_center|LOCUS_24080 574746 575705 gene locus_tag LOCUS_24090 gene cas7b 574746 575705 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_24090 575717 576511 gene locus_tag LOCUS_24100 gene cas5b 575717 576511 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 protein_id gnl|my_center|LOCUS_24100 576508 579084 gene locus_tag LOCUS_24110 576508 579084 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_24110 579081 579578 gene locus_tag LOCUS_24120 gene cas4 579081 579578 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546197.1 protein_id gnl|my_center|LOCUS_24120 579575 580567 gene locus_tag LOCUS_24130 gene cas1b 579575 580567 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545370.1 protein_id gnl|my_center|LOCUS_24130 580569 580832 gene locus_tag LOCUS_24140 gene cas2 580569 580832 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082343.1 protein_id gnl|my_center|LOCUS_24140 581539 580919 gene locus_tag LOCUS_24150 581539 580919 CDS product DUF2726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229271.1 protein_id gnl|my_center|LOCUS_24150 581695 582732 gene locus_tag LOCUS_24160 581695 582732 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_24160 584101 582737 gene locus_tag LOCUS_24170 584101 582737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24170 584388 585200 gene locus_tag LOCUS_24180 584388 585200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 587764 585197 gene locus_tag LOCUS_24190 587764 585197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 587873 589759 gene locus_tag LOCUS_24200 587873 589759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 589854 590549 gene locus_tag LOCUS_24210 gene tenA 589854 590549 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666833.1 protein_id gnl|my_center|LOCUS_24210 590566 592665 gene locus_tag LOCUS_24220 590566 592665 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226869.1 protein_id gnl|my_center|LOCUS_24220 594238 592652 gene locus_tag LOCUS_24230 594238 592652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 594994 594242 gene locus_tag LOCUS_24240 594994 594242 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_24240 595091 596020 gene locus_tag LOCUS_24250 595091 596020 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_24250 596084 596536 gene locus_tag LOCUS_24260 596084 596536 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_24260 596637 597542 gene locus_tag LOCUS_24270 596637 597542 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143730.1 protein_id gnl|my_center|LOCUS_24270 597546 598394 gene locus_tag LOCUS_24280 597546 598394 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877415.1 protein_id gnl|my_center|LOCUS_24280 598404 598970 gene locus_tag LOCUS_24290 598404 598970 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530046.1 protein_id gnl|my_center|LOCUS_24290 601163 599130 gene locus_tag LOCUS_24300 601163 599130 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_24300 602701 601286 gene locus_tag LOCUS_24310 602701 601286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 603175 602978 gene locus_tag LOCUS_24320 603175 602978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 603312 603148 gene locus_tag LOCUS_24330 603312 603148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 604673 603324 gene locus_tag LOCUS_24340 604673 603324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 605591 604692 gene locus_tag LOCUS_24350 605591 604692 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582765.1 protein_id gnl|my_center|LOCUS_24350 606540 605596 gene locus_tag LOCUS_24360 606540 605596 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_24360 606722 608125 gene locus_tag LOCUS_24370 606722 608125 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_24370 608118 609200 gene locus_tag LOCUS_24380 608118 609200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 609205 610044 gene locus_tag LOCUS_24390 609205 610044 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980434.1 protein_id gnl|my_center|LOCUS_24390 610054 610845 gene locus_tag LOCUS_24400 610054 610845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 610842 611813 gene locus_tag LOCUS_24410 gene pfkB 610842 611813 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_24410 611810 612751 gene locus_tag LOCUS_24420 611810 612751 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_24420 612744 613538 gene locus_tag LOCUS_24430 612744 613538 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_24430 613535 616324 gene locus_tag LOCUS_24440 613535 616324 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_24440 617529 617942 gene locus_tag LOCUS_24450 617529 617942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 618136 620766 gene locus_tag LOCUS_24460 618136 620766 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_24460 620932 620741 gene locus_tag LOCUS_24470 620932 620741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 621512 621300 gene locus_tag LOCUS_24480 621512 621300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 624467 622038 gene locus_tag LOCUS_24490 624467 622038 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_24490 625356 624484 gene locus_tag LOCUS_24500 625356 624484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 626977 625370 gene locus_tag LOCUS_24510 gene groL 626977 625370 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_24510 628098 626983 gene locus_tag LOCUS_24520 628098 626983 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272563.1 protein_id gnl|my_center|LOCUS_24520 628709 628095 gene locus_tag LOCUS_24530 628709 628095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 629869 628772 gene locus_tag LOCUS_24540 629869 628772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 631354 629900 gene locus_tag LOCUS_24550 631354 629900 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_24550 631557 632579 gene locus_tag LOCUS_24560 631557 632579 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_24560 632597 632734 gene locus_tag LOCUS_24570 632597 632734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 632738 634027 gene locus_tag LOCUS_24580 632738 634027 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083033.1 protein_id gnl|my_center|LOCUS_24580 634828 634637 gene locus_tag LOCUS_24590 634828 634637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 635142 634828 gene locus_tag LOCUS_24600 635142 634828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 637095 635626 gene locus_tag LOCUS_24610 637095 635626 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243667.1 protein_id gnl|my_center|LOCUS_24610 638140 637079 gene locus_tag LOCUS_24620 638140 637079 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969792.1 protein_id gnl|my_center|LOCUS_24620 638631 638140 gene locus_tag LOCUS_24630 gene derI1 638631 638140 CDS product D-erythrulose 4-phosphate isomerase DerI1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728942.1 protein_id gnl|my_center|LOCUS_24630 639274 638651 gene locus_tag LOCUS_24640 639274 638651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 640278 639271 gene locus_tag LOCUS_24650 640278 639271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24650 640991 640275 gene locus_tag LOCUS_24660 640991 640275 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230987.1 protein_id gnl|my_center|LOCUS_24660 641847 640984 gene locus_tag LOCUS_24670 641847 640984 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393168.1 protein_id gnl|my_center|LOCUS_24670 642154 643644 gene locus_tag LOCUS_24680 642154 643644 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254855.1 protein_id gnl|my_center|LOCUS_24680 643666 644619 gene locus_tag LOCUS_24690 643666 644619 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976293.1 protein_id gnl|my_center|LOCUS_24690 644654 645493 gene locus_tag LOCUS_24700 644654 645493 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969796.1 protein_id gnl|my_center|LOCUS_24700 645503 646642 gene locus_tag LOCUS_24710 gene ugpC 645503 646642 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_24710 646623 647735 gene locus_tag LOCUS_24720 gene ugpC 646623 647735 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_24720 647747 649171 gene locus_tag LOCUS_24730 647747 649171 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928604.1 protein_id gnl|my_center|LOCUS_24730 649180 649812 gene locus_tag LOCUS_24740 649180 649812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 650022 650444 gene locus_tag LOCUS_24750 650022 650444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24750 650502 651383 gene locus_tag LOCUS_24760 650502 651383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24760 651479 652321 gene locus_tag LOCUS_24770 651479 652321 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976275.1 protein_id gnl|my_center|LOCUS_24770 652332 653189 gene locus_tag LOCUS_24780 652332 653189 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530524.1 protein_id gnl|my_center|LOCUS_24780 653950 654261 gene locus_tag LOCUS_24790 653950 654261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 656882 654771 gene locus_tag LOCUS_24800 656882 654771 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_24800 657731 656898 gene locus_tag LOCUS_24810 657731 656898 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383329.1 protein_id gnl|my_center|LOCUS_24810 658696 657758 gene locus_tag LOCUS_24820 658696 657758 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383328.1 protein_id gnl|my_center|LOCUS_24820 660125 658734 gene locus_tag LOCUS_24830 660125 658734 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383327.1 protein_id gnl|my_center|LOCUS_24830 660010 660237 gene locus_tag LOCUS_24840 660010 660237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 661321 660308 gene locus_tag LOCUS_24850 661321 660308 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383326.1 protein_id gnl|my_center|LOCUS_24850 661527 662855 gene locus_tag LOCUS_24860 661527 662855 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258532.1 protein_id gnl|my_center|LOCUS_24860 662873 664504 gene locus_tag LOCUS_24870 662873 664504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 664536 665456 gene locus_tag LOCUS_24880 664536 665456 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114399.1 protein_id gnl|my_center|LOCUS_24880 665453 666343 gene locus_tag LOCUS_24890 665453 666343 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_24890 667485 666340 gene locus_tag LOCUS_24900 667485 666340 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767191.1 protein_id gnl|my_center|LOCUS_24900 669239 667506 gene locus_tag LOCUS_24910 669239 667506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 669359 670186 gene locus_tag LOCUS_24920 669359 670186 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976366.1 protein_id gnl|my_center|LOCUS_24920 670200 671153 gene locus_tag LOCUS_24930 670200 671153 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_24930 671153 672031 gene locus_tag LOCUS_24940 671153 672031 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_24940 672134 673459 gene locus_tag LOCUS_24950 672134 673459 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_24950 673482 675653 gene locus_tag LOCUS_24960 673482 675653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 675653 677692 gene locus_tag LOCUS_24970 675653 677692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 677689 679701 gene locus_tag LOCUS_24980 677689 679701 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_24980 679691 680464 gene locus_tag LOCUS_24990 679691 680464 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_24990 680489 681607 gene locus_tag LOCUS_25000 680489 681607 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_25000 681619 682620 gene locus_tag LOCUS_25010 681619 682620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 682702 684354 gene locus_tag LOCUS_25020 682702 684354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 684377 685522 gene locus_tag LOCUS_25030 684377 685522 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767191.1 protein_id gnl|my_center|LOCUS_25030 686412 685519 gene locus_tag LOCUS_25040 686412 685519 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_25040 687260 686412 gene locus_tag LOCUS_25050 687260 686412 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582825.1 protein_id gnl|my_center|LOCUS_25050 688815 687364 gene locus_tag LOCUS_25060 688815 687364 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_25060 691072 688937 gene locus_tag LOCUS_25070 691072 688937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 691516 691253 gene locus_tag LOCUS_25080 691516 691253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 691503 692837 gene locus_tag LOCUS_25090 691503 692837 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_25090 692851 693780 gene locus_tag LOCUS_25100 692851 693780 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_25100 693794 694732 gene locus_tag LOCUS_25110 693794 694732 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228684.1 protein_id gnl|my_center|LOCUS_25110 694787 698212 gene locus_tag LOCUS_25120 694787 698212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 698236 700830 gene locus_tag LOCUS_25130 698236 700830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 700863 701714 gene locus_tag LOCUS_25140 700863 701714 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973395.1 protein_id gnl|my_center|LOCUS_25140 701701 702858 gene locus_tag LOCUS_25150 701701 702858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 702865 704004 gene locus_tag LOCUS_25160 702865 704004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 704029 704574 gene locus_tag LOCUS_25170 704029 704574 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 protein_id gnl|my_center|LOCUS_25170 706021 704834 gene locus_tag LOCUS_25180 706021 704834 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026930.1 protein_id gnl|my_center|LOCUS_25180 706321 706025 gene locus_tag LOCUS_25190 706321 706025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 706845 706318 gene locus_tag LOCUS_25200 706845 706318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 707450 706833 gene locus_tag LOCUS_25210 707450 706833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 709762 707462 gene locus_tag LOCUS_25220 709762 707462 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_25220 710820 709762 gene locus_tag LOCUS_25230 710820 709762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 710985 711476 gene locus_tag LOCUS_25240 710985 711476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 711514 713460 gene locus_tag LOCUS_25250 711514 713460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 713444 716191 gene locus_tag LOCUS_25260 713444 716191 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530065.1 protein_id gnl|my_center|LOCUS_25260 716418 717539 gene locus_tag LOCUS_25270 716418 717539 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402097.1 protein_id gnl|my_center|LOCUS_25270 717540 719987 gene locus_tag LOCUS_25280 717540 719987 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_25280 720052 721179 gene locus_tag LOCUS_25290 720052 721179 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_25290 721215 722135 gene locus_tag LOCUS_25300 721215 722135 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_25300 722807 722151 gene locus_tag LOCUS_25310 722807 722151 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_25310 724181 722811 gene locus_tag LOCUS_25320 724181 722811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 724458 724162 gene locus_tag LOCUS_25330 724458 724162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 725697 724582 gene locus_tag LOCUS_25340 725697 724582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 726030 725743 gene locus_tag LOCUS_25350 726030 725743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 726092 726295 gene locus_tag LOCUS_25360 726092 726295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 726714 726271 gene locus_tag LOCUS_25370 726714 726271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 727350 726841 gene locus_tag LOCUS_25380 727350 726841 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226004.1 protein_id gnl|my_center|LOCUS_25380 727584 727381 gene locus_tag LOCUS_25390 727584 727381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 728465 727611 gene locus_tag LOCUS_25400 728465 727611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 729000 729761 gene locus_tag LOCUS_25410 729000 729761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 730449 729904 gene locus_tag LOCUS_25420 730449 729904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 731406 730519 gene locus_tag LOCUS_25430 731406 730519 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402928.1 protein_id gnl|my_center|LOCUS_25430 732473 731436 gene locus_tag LOCUS_25440 732473 731436 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_25440 732826 732497 gene locus_tag LOCUS_25450 732826 732497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 733358 732819 gene locus_tag LOCUS_25460 733358 732819 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_25460 733535 735166 gene locus_tag LOCUS_25470 733535 735166 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141493.1 protein_id gnl|my_center|LOCUS_25470 737620 735125 gene locus_tag LOCUS_25480 gene mgtA 737620 735125 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948085.1 protein_id gnl|my_center|LOCUS_25480 738014 737613 gene locus_tag LOCUS_25490 738014 737613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 738869 738264 gene locus_tag LOCUS_25500 738869 738264 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236362.1 protein_id gnl|my_center|LOCUS_25500 739919 738987 gene locus_tag LOCUS_25510 739919 738987 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_25510 740647 740039 gene locus_tag LOCUS_25520 gene wrbA 740647 740039 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970175.1 protein_id gnl|my_center|LOCUS_25520 741557 740682 gene locus_tag LOCUS_25530 741557 740682 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_25530 742804 742094 gene locus_tag LOCUS_25540 742804 742094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 743765 742815 gene locus_tag LOCUS_25550 743765 742815 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776036.1 protein_id gnl|my_center|LOCUS_25550 744617 743772 gene locus_tag LOCUS_25560 744617 743772 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258534.1 protein_id gnl|my_center|LOCUS_25560 745543 744614 gene locus_tag LOCUS_25570 745543 744614 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_25570 746911 745550 gene locus_tag LOCUS_25580 746911 745550 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975930.1 protein_id gnl|my_center|LOCUS_25580 747703 746972 gene locus_tag LOCUS_25590 747703 746972 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_25590 748053 748379 gene locus_tag LOCUS_25600 748053 748379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 748928 749557 gene locus_tag LOCUS_25610 748928 749557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 749544 750392 gene locus_tag LOCUS_25620 749544 750392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 750389 751126 gene locus_tag LOCUS_25630 750389 751126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 751870 751196 gene locus_tag LOCUS_25640 751870 751196 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258297.1 protein_id gnl|my_center|LOCUS_25640 752292 751930 gene locus_tag LOCUS_25650 752292 751930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 752490 752296 gene locus_tag LOCUS_25660 752490 752296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25660 752666 752914 gene locus_tag LOCUS_25670 752666 752914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 752895 754979 gene locus_tag LOCUS_25680 752895 754979 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256866.1 protein_id gnl|my_center|LOCUS_25680 755773 755108 gene locus_tag LOCUS_25690 755773 755108 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_25690 755851 756846 gene locus_tag LOCUS_25700 755851 756846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 756864 757751 gene locus_tag LOCUS_25710 756864 757751 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038568432.1 protein_id gnl|my_center|LOCUS_25710 757839 760298 gene locus_tag LOCUS_25720 757839 760298 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_25720 760660 761658 gene locus_tag LOCUS_25730 760660 761658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 761770 762822 gene locus_tag LOCUS_25740 gene hemE 761770 762822 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_25740 762819 763781 gene locus_tag LOCUS_25750 gene hemH 762819 763781 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887774.1 protein_id gnl|my_center|LOCUS_25750 766191 763834 gene locus_tag LOCUS_25760 766191 763834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 766320 767213 gene locus_tag LOCUS_25770 766320 767213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25770 767235 767834 gene locus_tag LOCUS_25780 767235 767834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25780 768700 767912 gene locus_tag LOCUS_25790 768700 767912 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258317.1 protein_id gnl|my_center|LOCUS_25790 768773 769870 gene locus_tag LOCUS_25800 768773 769870 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_25800 769871 770281 gene locus_tag LOCUS_25810 769871 770281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 771432 770278 gene locus_tag LOCUS_25820 771432 770278 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_25820 771910 771401 gene locus_tag LOCUS_25830 771910 771401 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_25830 772000 772974 gene locus_tag LOCUS_25840 772000 772974 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929014.1 protein_id gnl|my_center|LOCUS_25840 773042 776368 gene locus_tag LOCUS_25850 773042 776368 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015902.1 protein_id gnl|my_center|LOCUS_25850 776511 776374 gene locus_tag LOCUS_25860 776511 776374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 777590 776586 gene locus_tag LOCUS_25870 777590 776586 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_25870 778583 777603 gene locus_tag LOCUS_25880 778583 777603 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_25880 779709 778645 gene locus_tag LOCUS_25890 779709 778645 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942690.1 protein_id gnl|my_center|LOCUS_25890 781349 779718 gene locus_tag LOCUS_25900 781349 779718 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_25900 782390 781365 gene locus_tag LOCUS_25910 782390 781365 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530990.1 protein_id gnl|my_center|LOCUS_25910 783742 782891 gene locus_tag LOCUS_25920 783742 782891 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878779.1 protein_id gnl|my_center|LOCUS_25920 784486 783752 gene locus_tag LOCUS_25930 784486 783752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202429.1 protein_id gnl|my_center|LOCUS_25930 785394 784483 gene locus_tag LOCUS_25940 785394 784483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889267.1 protein_id gnl|my_center|LOCUS_25940 786908 785475 gene locus_tag LOCUS_25950 786908 785475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 787037 787519 gene locus_tag LOCUS_25960 787037 787519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 787537 789234 gene locus_tag LOCUS_25970 787537 789234 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437634.1 protein_id gnl|my_center|LOCUS_25970 789420 790193 gene locus_tag LOCUS_25980 789420 790193 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_25980 790270 791655 gene locus_tag LOCUS_25990 790270 791655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 791669 792592 gene locus_tag LOCUS_26000 791669 792592 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032532.1 protein_id gnl|my_center|LOCUS_26000 792594 793478 gene locus_tag LOCUS_26010 792594 793478 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729785.1 protein_id gnl|my_center|LOCUS_26010 793492 794835 gene locus_tag LOCUS_26020 793492 794835 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_26020 795623 794820 gene locus_tag LOCUS_26030 gene cas6 795623 794820 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_26030 795878 795699 gene locus_tag LOCUS_26040 795878 795699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 795972 797066 gene locus_tag LOCUS_26050 gene ribD 795972 797066 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_26050 797459 799918 gene locus_tag LOCUS_26060 797459 799918 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873439.1 protein_id gnl|my_center|LOCUS_26060 799958 801019 gene locus_tag LOCUS_26070 799958 801019 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_26070 803439 801037 gene locus_tag LOCUS_26080 803439 801037 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_26080 803900 803718 gene locus_tag LOCUS_26090 803900 803718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 804474 803911 gene locus_tag LOCUS_26100 804474 803911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 805052 804471 gene locus_tag LOCUS_26110 805052 804471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 805341 805036 gene locus_tag LOCUS_26120 805341 805036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 805791 805354 gene locus_tag LOCUS_26130 805791 805354 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 protein_id gnl|my_center|LOCUS_26130 806092 805832 gene locus_tag LOCUS_26140 806092 805832 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367020.1 protein_id gnl|my_center|LOCUS_26140 806276 806836 gene locus_tag LOCUS_26150 806276 806836 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_26150 806821 807123 gene locus_tag LOCUS_26160 806821 807123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 807120 807941 gene locus_tag LOCUS_26170 807120 807941 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315687.1 protein_id gnl|my_center|LOCUS_26170 808032 809630 gene locus_tag LOCUS_26180 808032 809630 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140493.1 protein_id gnl|my_center|LOCUS_26180 810589 809684 gene locus_tag LOCUS_26190 810589 809684 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246070.1 protein_id gnl|my_center|LOCUS_26190 810747 811136 gene locus_tag LOCUS_26200 810747 811136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 811625 811140 gene locus_tag LOCUS_26210 811625 811140 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366672.1 protein_id gnl|my_center|LOCUS_26210 812141 811638 gene locus_tag LOCUS_26220 812141 811638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 812272 812652 gene locus_tag LOCUS_26230 812272 812652 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056419.1 protein_id gnl|my_center|LOCUS_26230 812711 813199 gene locus_tag LOCUS_26240 812711 813199 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227042.1 protein_id gnl|my_center|LOCUS_26240 813447 814550 gene locus_tag LOCUS_26250 gene purM 813447 814550 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869698.1 protein_id gnl|my_center|LOCUS_26250 815272 814547 gene locus_tag LOCUS_26260 815272 814547 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_26260 817292 815283 gene locus_tag LOCUS_26270 817292 815283 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_26270 818821 817295 gene locus_tag LOCUS_26280 818821 817295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 818967 820262 gene locus_tag LOCUS_26290 818967 820262 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775953.1 protein_id gnl|my_center|LOCUS_26290 820259 821194 gene locus_tag LOCUS_26300 820259 821194 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_26300 821204 822031 gene locus_tag LOCUS_26310 821204 822031 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775955.1 protein_id gnl|my_center|LOCUS_26310 822111 823055 gene locus_tag LOCUS_26320 822111 823055 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_26320 823135 825987 gene locus_tag LOCUS_26330 823135 825987 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_26330 825987 831125 gene locus_tag LOCUS_26340 825987 831125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 831950 831501 gene locus_tag LOCUS_26350 831950 831501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 832566 833582 gene locus_tag LOCUS_26360 832566 833582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 833579 835099 gene locus_tag LOCUS_26370 833579 835099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 835117 838638 gene locus_tag LOCUS_26380 835117 838638 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861850.1 protein_id gnl|my_center|LOCUS_26380 838674 840599 gene locus_tag LOCUS_26390 838674 840599 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861851.1 protein_id gnl|my_center|LOCUS_26390 840977 840669 gene locus_tag LOCUS_26400 840977 840669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 842357 841101 gene locus_tag LOCUS_26410 842357 841101 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_26410 843292 842441 gene locus_tag LOCUS_26420 843292 842441 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004438848.1 protein_id gnl|my_center|LOCUS_26420 844233 843304 gene locus_tag LOCUS_26430 844233 843304 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_26430 845477 844287 gene locus_tag LOCUS_26440 845477 844287 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965989.1 protein_id gnl|my_center|LOCUS_26440 845527 845871 gene locus_tag LOCUS_26450 845527 845871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 846979 846434 gene locus_tag LOCUS_26460 846979 846434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 847741 846992 gene locus_tag LOCUS_26470 847741 846992 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888547.1 protein_id gnl|my_center|LOCUS_26470 847826 848797 gene locus_tag LOCUS_26480 847826 848797 CDS product proline-specific peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566310.1 protein_id gnl|my_center|LOCUS_26480 849994 848828 gene locus_tag LOCUS_26490 gene chrA 849994 848828 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_26490 850318 853068 gene locus_tag LOCUS_26500 850318 853068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 853150 858246 gene locus_tag LOCUS_26510 853150 858246 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_26510 858268 859593 gene locus_tag LOCUS_26520 858268 859593 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_26520 860083 859652 gene locus_tag LOCUS_26530 860083 859652 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_26530 861090 860095 gene locus_tag LOCUS_26540 861090 860095 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887570.1 protein_id gnl|my_center|LOCUS_26540 861321 861106 gene locus_tag LOCUS_26550 861321 861106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 861964 861602 gene locus_tag LOCUS_26560 861964 861602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 863172 862054 gene locus_tag LOCUS_26570 863172 862054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107326.1 protein_id gnl|my_center|LOCUS_26570 864049 863192 gene locus_tag LOCUS_26580 864049 863192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170849.1 protein_id gnl|my_center|LOCUS_26580 864220 865212 gene locus_tag LOCUS_26590 864220 865212 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185912.1 protein_id gnl|my_center|LOCUS_26590 865298 866071 gene locus_tag LOCUS_26600 865298 866071 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227652.1 protein_id gnl|my_center|LOCUS_26600 866076 867728 gene locus_tag LOCUS_26610 866076 867728 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 protein_id gnl|my_center|LOCUS_26610 868830 868174 gene locus_tag LOCUS_26620 868830 868174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 869569 868823 gene locus_tag LOCUS_26630 869569 868823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 869795 870190 gene locus_tag LOCUS_26640 869795 870190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 871535 870174 gene locus_tag LOCUS_26650 871535 870174 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_26650 871744 872997 gene locus_tag LOCUS_26660 871744 872997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 873366 873004 gene locus_tag LOCUS_26670 873366 873004 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_26670 875098 873428 gene locus_tag LOCUS_26680 875098 873428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_26680 875260 876093 gene locus_tag LOCUS_26690 875260 876093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 877157 876090 gene locus_tag LOCUS_26700 877157 876090 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228108.1 protein_id gnl|my_center|LOCUS_26700 877271 877474 gene locus_tag LOCUS_26710 877271 877474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 878515 877475 gene locus_tag LOCUS_26720 878515 877475 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_26720 878582 879169 gene locus_tag LOCUS_26730 878582 879169 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895255.1 protein_id gnl|my_center|LOCUS_26730 879177 880181 gene locus_tag LOCUS_26740 879177 880181 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930957.1 protein_id gnl|my_center|LOCUS_26740 880747 880190 gene locus_tag LOCUS_26750 880747 880190 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 protein_id gnl|my_center|LOCUS_26750 880971 881996 gene locus_tag LOCUS_26760 880971 881996 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_26760 882001 883035 gene locus_tag LOCUS_26770 882001 883035 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 protein_id gnl|my_center|LOCUS_26770 883113 883829 gene locus_tag LOCUS_26780 883113 883829 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_26780 883940 885289 gene locus_tag LOCUS_26790 883940 885289 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943456.1 protein_id gnl|my_center|LOCUS_26790 885317 886249 gene locus_tag LOCUS_26800 885317 886249 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328866.1 protein_id gnl|my_center|LOCUS_26800 887223 886246 gene locus_tag LOCUS_26810 887223 886246 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943378.1 protein_id gnl|my_center|LOCUS_26810 887294 888073 gene locus_tag LOCUS_26820 887294 888073 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_26820 888078 889253 gene locus_tag LOCUS_26830 gene nagA 888078 889253 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338857.1 protein_id gnl|my_center|LOCUS_26830 889321 890493 gene locus_tag LOCUS_26840 889321 890493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 891500 890490 gene locus_tag LOCUS_26850 gene degA 891500 890490 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_26850 892632 891550 gene locus_tag LOCUS_26860 892632 891550 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530504.1 protein_id gnl|my_center|LOCUS_26860 893497 892667 gene locus_tag LOCUS_26870 893497 892667 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107573728.1 protein_id gnl|my_center|LOCUS_26870 894345 893497 gene locus_tag LOCUS_26880 894345 893497 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029022.1 protein_id gnl|my_center|LOCUS_26880 895827 894475 gene locus_tag LOCUS_26890 895827 894475 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029023.1 protein_id gnl|my_center|LOCUS_26890 895962 897155 gene locus_tag LOCUS_26900 gene rlmD 895962 897155 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_26900 897204 897764 gene locus_tag LOCUS_26910 897204 897764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 898038 897769 gene locus_tag LOCUS_26920 898038 897769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 898258 899529 gene locus_tag LOCUS_26930 898258 899529 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393137.1 protein_id gnl|my_center|LOCUS_26930 902337 899539 gene locus_tag LOCUS_26940 902337 899539 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_26940 902829 902440 gene locus_tag LOCUS_26950 902829 902440 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603272.1 protein_id gnl|my_center|LOCUS_26950 903991 902888 gene locus_tag LOCUS_26960 903991 902888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 904597 904001 gene locus_tag LOCUS_26970 904597 904001 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_26970 904659 905141 gene locus_tag LOCUS_26980 904659 905141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 905761 905138 gene locus_tag LOCUS_26990 905761 905138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 907083 905830 gene locus_tag LOCUS_27000 gene tetA(P) 907083 905830 CDS product tetracycline efflux MFS transporter TetA(P) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964756.1 protein_id gnl|my_center|LOCUS_27000 907272 908132 gene locus_tag LOCUS_27010 907272 908132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 908232 908882 gene locus_tag LOCUS_27020 908232 908882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 908893 909549 gene locus_tag LOCUS_27030 908893 909549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 909980 909621 gene locus_tag LOCUS_27040 909980 909621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 910618 910091 gene locus_tag LOCUS_27050 910618 910091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 910780 911121 gene locus_tag LOCUS_27060 910780 911121 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084133.1 protein_id gnl|my_center|LOCUS_27060 911125 911889 gene locus_tag LOCUS_27070 911125 911889 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228232.1 protein_id gnl|my_center|LOCUS_27070 911909 912334 gene locus_tag LOCUS_27080 911909 912334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 912331 913761 gene locus_tag LOCUS_27090 912331 913761 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_27090 913775 914170 gene locus_tag LOCUS_27100 913775 914170 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_27100 914231 914614 gene locus_tag LOCUS_27110 914231 914614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 914631 915035 gene locus_tag LOCUS_27120 914631 915035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 915045 915497 gene locus_tag LOCUS_27130 915045 915497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27130 915522 915731 gene locus_tag LOCUS_27140 915522 915731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 915784 916887 gene locus_tag LOCUS_27150 915784 916887 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 protein_id gnl|my_center|LOCUS_27150 916942 917775 gene locus_tag LOCUS_27160 916942 917775 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246382.1 protein_id gnl|my_center|LOCUS_27160 917772 918389 gene locus_tag LOCUS_27170 gene eda 917772 918389 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_27170 918555 919370 gene locus_tag LOCUS_27180 918555 919370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 919383 920009 gene locus_tag LOCUS_27190 919383 920009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 920021 920500 gene locus_tag LOCUS_27200 920021 920500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 920741 921151 gene locus_tag LOCUS_27210 920741 921151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 922052 921144 gene locus_tag LOCUS_27220 922052 921144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 922406 923182 gene locus_tag LOCUS_27230 922406 923182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 924527 923352 gene locus_tag LOCUS_27240 gene megL 924527 923352 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_27240 924973 924605 gene locus_tag LOCUS_27250 924973 924605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 925776 925201 gene locus_tag LOCUS_27260 925776 925201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 926762 925917 gene locus_tag LOCUS_27270 gene pstB 926762 925917 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404312.1 protein_id gnl|my_center|LOCUS_27270 927618 926773 gene locus_tag LOCUS_27280 gene pstA 927618 926773 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889419.1 protein_id gnl|my_center|LOCUS_27280 928579 927620 gene locus_tag LOCUS_27290 gene pstC 928579 927620 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_27290 929657 928656 gene locus_tag LOCUS_27300 gene pstS 929657 928656 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_27300 929599 929925 gene locus_tag LOCUS_27310 929599 929925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 932218 930164 gene locus_tag LOCUS_27320 932218 930164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 933170 932274 gene locus_tag LOCUS_27330 933170 932274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582574.1 protein_id gnl|my_center|LOCUS_27330 934221 933154 gene locus_tag LOCUS_27340 934221 933154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776185.1 protein_id gnl|my_center|LOCUS_27340 935105 934239 gene locus_tag LOCUS_27350 935105 934239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868060.1 protein_id gnl|my_center|LOCUS_27350 936186 935110 gene locus_tag LOCUS_27360 936186 935110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584069.1 protein_id gnl|my_center|LOCUS_27360 938184 936247 gene locus_tag LOCUS_27370 938184 936247 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080066.1 protein_id gnl|my_center|LOCUS_27370 938425 939564 gene locus_tag LOCUS_27380 938425 939564 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_27380 939652 940572 gene locus_tag LOCUS_27390 939652 940572 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966735.1 protein_id gnl|my_center|LOCUS_27390 940597 941505 gene locus_tag LOCUS_27400 gene ala 940597 941505 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_27400 942266 942439 gene locus_tag LOCUS_27410 942266 942439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 942366 943025 gene locus_tag LOCUS_27420 942366 943025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 943036 943692 gene locus_tag LOCUS_27430 943036 943692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 943689 944168 gene locus_tag LOCUS_27440 943689 944168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 945086 944295 gene locus_tag LOCUS_27450 945086 944295 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_27450 945295 945098 gene locus_tag LOCUS_27460 945295 945098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 945537 945301 gene locus_tag LOCUS_27470 945537 945301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 946058 947233 gene locus_tag LOCUS_27480 gene lysS 946058 947233 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256235.1 protein_id gnl|my_center|LOCUS_27480 947221 948462 gene locus_tag LOCUS_27490 gene hacA 947221 948462 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_27490 948462 948941 gene locus_tag LOCUS_27500 948462 948941 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867561.1 protein_id gnl|my_center|LOCUS_27500 949297 949488 gene locus_tag LOCUS_27510 949297 949488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 949504 949959 gene locus_tag LOCUS_27520 949504 949959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 949851 950126 gene locus_tag LOCUS_27530 949851 950126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 950446 951051 gene locus_tag LOCUS_27540 gene ribE 950446 951051 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258063.1 protein_id gnl|my_center|LOCUS_27540 951048 952271 gene locus_tag LOCUS_27550 951048 952271 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_27550 952268 952735 gene locus_tag LOCUS_27560 gene ribE 952268 952735 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392435.1 protein_id gnl|my_center|LOCUS_27560 953180 953722 gene locus_tag LOCUS_27570 953180 953722 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258315.1 protein_id gnl|my_center|LOCUS_27570 953810 954193 gene locus_tag LOCUS_27580 953810 954193 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600363.1 protein_id gnl|my_center|LOCUS_27580 954503 954880 gene locus_tag LOCUS_27590 954503 954880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27590 955103 955633 gene locus_tag LOCUS_27600 955103 955633 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921635.1 protein_id gnl|my_center|LOCUS_27600 955848 956609 gene locus_tag LOCUS_27610 955848 956609 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_27610 957219 956632 gene locus_tag LOCUS_27620 957219 956632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 961033 957428 gene locus_tag LOCUS_27630 961033 957428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 963757 961286 gene locus_tag LOCUS_27640 963757 961286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 964178 969271 gene locus_tag LOCUS_27650 964178 969271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 969286 972222 gene locus_tag LOCUS_27660 969286 972222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 972789 972565 gene locus_tag LOCUS_27670 972789 972565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 973179 973048 gene locus_tag LOCUS_27680 973179 973048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 973314 973769 gene locus_tag LOCUS_27690 973314 973769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 974130 974432 gene locus_tag LOCUS_27700 974130 974432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 975220 974672 gene locus_tag LOCUS_27710 975220 974672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 977116 976385 gene locus_tag LOCUS_27720 977116 976385 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222789.1 protein_id gnl|my_center|LOCUS_27720 977253 977627 gene locus_tag LOCUS_27730 977253 977627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 977624 978514 gene locus_tag LOCUS_27740 977624 978514 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_27740 978965 978555 gene locus_tag LOCUS_27750 gene bleO 978965 978555 CDS product bleomycin binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242578.1 protein_id gnl|my_center|LOCUS_27750 979108 979371 gene locus_tag LOCUS_27760 979108 979371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888728.1 protein_id gnl|my_center|LOCUS_27760 980142 979474 gene locus_tag LOCUS_27770 980142 979474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 983097 980281 gene locus_tag LOCUS_27780 983097 980281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 984413 983232 gene locus_tag LOCUS_27790 984413 983232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 985617 984403 gene locus_tag LOCUS_27800 985617 984403 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 protein_id gnl|my_center|LOCUS_27800 986584 985607 gene locus_tag LOCUS_27810 986584 985607 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485734.1 protein_id gnl|my_center|LOCUS_27810 988392 986581 gene locus_tag LOCUS_27820 988392 986581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 989442 988393 gene locus_tag LOCUS_27830 989442 988393 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252964.1 protein_id gnl|my_center|LOCUS_27830 990560 989439 gene locus_tag LOCUS_27840 990560 989439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 990846 991763 gene locus_tag LOCUS_27850 990846 991763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 991760 992689 gene locus_tag LOCUS_27860 991760 992689 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158657585.1 protein_id gnl|my_center|LOCUS_27860 992825 993787 gene locus_tag LOCUS_27870 992825 993787 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158657585.1 protein_id gnl|my_center|LOCUS_27870 995119 993800 gene locus_tag LOCUS_27880 995119 993800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_27880 996012 995125 gene locus_tag LOCUS_27890 996012 995125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_27890 996415 996191 gene locus_tag LOCUS_27900 996415 996191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 996305 996781 gene locus_tag LOCUS_27910 996305 996781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 996855 997883 gene locus_tag LOCUS_27920 996855 997883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 998779 997892 gene locus_tag LOCUS_27930 998779 997892 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024365.1 protein_id gnl|my_center|LOCUS_27930 999953 998772 gene locus_tag LOCUS_27940 999953 998772 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_27940 1001440 999956 gene locus_tag LOCUS_27950 1001440 999956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1002654 1001437 gene locus_tag LOCUS_27960 1002654 1001437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1003786 1002644 gene locus_tag LOCUS_27970 1003786 1002644 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_27970 1004786 1003806 gene locus_tag LOCUS_27980 1004786 1003806 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_27980 1005787 1004780 gene locus_tag LOCUS_27990 1005787 1004780 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_27990 1006884 1005787 gene locus_tag LOCUS_28000 1006884 1005787 CDS product NeuD/PglB/VioB family sugar acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943647.1 protein_id gnl|my_center|LOCUS_28000 1007965 1006874 gene locus_tag LOCUS_28010 1007965 1006874 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_28010 1008672 1007995 gene locus_tag LOCUS_28020 1008672 1007995 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_28020 1009661 1008783 gene locus_tag LOCUS_28030 1009661 1008783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1009978 1009658 gene locus_tag LOCUS_28040 1009978 1009658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 1010235 1009957 gene locus_tag LOCUS_28050 1010235 1009957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1010120 1010662 gene locus_tag LOCUS_28060 1010120 1010662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 1011005 1011676 gene locus_tag LOCUS_28070 1011005 1011676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1011986 1012666 gene locus_tag LOCUS_28080 1011986 1012666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 1014450 1012861 gene locus_tag LOCUS_28090 1014450 1012861 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_28090 1016221 1014464 gene locus_tag LOCUS_28100 1016221 1014464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_28100 1016512 1016315 gene locus_tag LOCUS_28110 1016512 1016315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 1018098 1016788 gene locus_tag LOCUS_28120 1018098 1016788 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929319.1 protein_id gnl|my_center|LOCUS_28120 1020106 1018118 gene locus_tag LOCUS_28130 1020106 1018118 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_28130 1021128 1020103 gene locus_tag LOCUS_28140 1021128 1020103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_28140 1021563 1021390 gene locus_tag LOCUS_28150 1021563 1021390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1023652 1021688 gene locus_tag LOCUS_28160 1023652 1021688 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528116.1 protein_id gnl|my_center|LOCUS_28160 1024626 1023649 gene locus_tag LOCUS_28170 1024626 1023649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 1025056 1024616 gene locus_tag LOCUS_28180 1025056 1024616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 1025312 1025046 gene locus_tag LOCUS_28190 1025312 1025046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 1026393 1025482 gene locus_tag LOCUS_28200 gene lipA 1026393 1025482 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166373.1 protein_id gnl|my_center|LOCUS_28200 1027351 1026395 gene locus_tag LOCUS_28210 1027351 1026395 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_28210 1027495 1028190 gene locus_tag LOCUS_28220 1027495 1028190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1029461 1028358 gene locus_tag LOCUS_28230 1029461 1028358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1030321 1029770 gene locus_tag LOCUS_28240 1030321 1029770 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_28240 1030557 1030886 gene locus_tag LOCUS_28250 1030557 1030886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28250 1031186 1030995 gene locus_tag LOCUS_28260 1031186 1030995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 1031586 1031269 gene locus_tag LOCUS_28270 1031586 1031269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1033129 1031549 gene locus_tag LOCUS_28280 1033129 1031549 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084106.1 protein_id gnl|my_center|LOCUS_28280 1033276 1033914 gene locus_tag LOCUS_28290 1033276 1033914 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_28290 1034035 1034841 gene locus_tag LOCUS_28300 1034035 1034841 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110864.1 protein_id gnl|my_center|LOCUS_28300 1034834 1035967 gene locus_tag LOCUS_28310 1034834 1035967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 1036085 1037416 gene locus_tag LOCUS_28320 1036085 1037416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1038697 1037507 gene locus_tag LOCUS_28330 1038697 1037507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1039161 1039607 gene locus_tag LOCUS_28340 1039161 1039607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1039604 1039921 gene locus_tag LOCUS_28350 1039604 1039921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1040543 1041196 gene locus_tag LOCUS_28360 1040543 1041196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1041381 1043375 gene locus_tag LOCUS_28370 1041381 1043375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1043703 1053544 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatcccttataggtaggctacgaac 1054151 1054300 gene locus_tag LOCUS_28380 1054151 1054300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1055840 1055160 gene locus_tag LOCUS_28390 1055840 1055160 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393576.1 protein_id gnl|my_center|LOCUS_28390 1056126 1055824 gene locus_tag LOCUS_28400 1056126 1055824 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393575.1 protein_id gnl|my_center|LOCUS_28400 1056683 1056216 gene locus_tag LOCUS_28410 1056683 1056216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1058134 1056680 gene locus_tag LOCUS_28420 1058134 1056680 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_28420 1061507 1058508 gene locus_tag LOCUS_28430 1061507 1058508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 1061594 1061839 gene locus_tag LOCUS_28440 1061594 1061839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1062030 1062470 gene locus_tag LOCUS_28450 1062030 1062470 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223989.1 protein_id gnl|my_center|LOCUS_28450 1062529 1063128 gene locus_tag LOCUS_28460 1062529 1063128 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222876.1 protein_id gnl|my_center|LOCUS_28460 1063781 1064122 gene locus_tag LOCUS_28470 1063781 1064122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 1064692 1064525 gene locus_tag LOCUS_28480 1064692 1064525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1065025 1065315 gene locus_tag LOCUS_28490 1065025 1065315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1066460 1065312 gene locus_tag LOCUS_28500 1066460 1065312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1066621 1067322 gene locus_tag LOCUS_28510 1066621 1067322 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_28510 1067338 1069119 gene locus_tag LOCUS_28520 gene phoR 1067338 1069119 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_28520 1069223 1069468 gene locus_tag LOCUS_28530 1069223 1069468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 1069357 1070856 gene locus_tag LOCUS_28540 1069357 1070856 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_28540 1070947 1071609 gene locus_tag LOCUS_28550 gene phoU 1070947 1071609 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_28550 1071762 1072289 gene locus_tag LOCUS_28560 1071762 1072289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 1073661 1072777 gene locus_tag LOCUS_28570 1073661 1072777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 1074563 1073718 gene locus_tag LOCUS_28580 1074563 1073718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580