COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..1943635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 145..1323 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 1499..2641 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641629.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS complement(2833..3405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 note possible pseudo, internal stop codon, frameshifted CDS complement(3368..3502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 note possible pseudo, frameshifted CDS 3771..3992 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene yaaA CDS 4001..5125 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene recF CDS 5122..7071 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene gyrB CDS 7114..9618 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene gyrA CDS 9819..10115 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene rpsF CDS 10153..10716 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662304.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene ssb CDS 10750..10986 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene rpsR CDS 11202..13220 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643610.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 13226..13678 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641637.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene rplI CDS 13712..15103 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702157.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene dnaB CDS 15225..16427 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 16440..16766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 16871..17749 product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(18483..19220) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene istB CDS complement(19222..20406) product IS21-like element ISMac9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene istA CDS complement(20815..21471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 note possible pseudo, internal stop codon CDS complement(21535..21783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 note possible pseudo, internal stop codon tRNA complement(21919..21993) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 22142..22576 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 22664..24313 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546396.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 tRNA complement(24408..24483) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 24658..25365 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene yycF CDS 25481..27244 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641656.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene walK CDS 27222..28517 product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene yycH CDS 28530..29372 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475474.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 29390..30196 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 30300..31580 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641660.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 31684..32181 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642953.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 32490..33476 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700783.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene trpX CDS 33945..34424 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643636.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene rlmH CDS 34568..34786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 34860..35396 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 35615..36787 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644879.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(36855..37631) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943339.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(37633..38445) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene proC CDS 38746..40119 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476263.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 40295..41377 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 41379..42077 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 42064..43299 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(43574..44704) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 44744..45412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 45669..46994 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064095.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 47117..47272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 47284..47799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(47796..48200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 note possible pseudo, internal stop codon CDS complement(48210..48770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 note possible pseudo, internal stop codon CDS complement(48915..49343) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(49411..49740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(49905..50399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 note possible pseudo, frameshifted CDS complement(50401..51588) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 52093..52314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 52432..54669 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475490.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 55583..58477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(58562..59146) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703867.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 59286..60749 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015381020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene cls CDS 60864..64646 product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101883.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 64646..68824 product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene addA CDS 68825..69760 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 69824..71002 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 71339..72721 product ISLre2-like element ISLca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 72892..74241 product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 74330..76582 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 76601..77263 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene pgmB CDS 77523..78143 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548123.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 78145..78810 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548121.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 78822..80069 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 80072..81253 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 81405..82745 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(82888..83616) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 83734..84600 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 84597..84908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 85003..86790 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548622.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(86843..87340) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642092.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 87609..88958 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(89010..89984) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 90180..91478 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 91591..92658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 92831..93367 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639428.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene pyrR CDS complement(93462..93848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 94563..94760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 94748..95203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(95268..95672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 95811..97352 product accessory Sec system glycosyltransferase Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene asp1 CDS 97354..98856 product accessory Sec system glycosyltransferase Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene asp1 CDS 98971..100728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 100912..102594 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 102612..103703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 note possible pseudo, frameshifted CDS 103654..103998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 note possible pseudo, frameshifted CDS complement(104076..107246) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene carB CDS complement(107239..108327) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene carA CDS complement(108707..110074) product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(110135..110317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(110235..111245) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102207.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(111387..112790) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642454.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene rlmD CDS 113046..113618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 113618..114868 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360528.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 114871..115797 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549691.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 115963..117753 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(117781..118749) product IS30-like element IS6770 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 119032..119283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 119380..120060 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550031.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 120057..120959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 note possible pseudo, frameshifted CDS 120961..121389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 note possible pseudo, frameshifted CDS 121494..122144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 122411..123487 product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(124299..124619) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296337.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(124745..125338) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 125488..126168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 126170..127144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 127378..128250 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 128353..128838 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(128897..129766) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254160.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 129883..130413 product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 130422..130625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 130626..131486 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025080575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 131593..132132 product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641609.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 132175..132705 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775286.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 132681..133307 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101945.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 133407..134408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(134467..135456) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(135533..135898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 note possible pseudo, internal stop codon CDS complement(136136..136405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 note possible pseudo, internal stop codon CDS 136528..137406 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642522.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(137507..138085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 138177..138797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 note possible pseudo, frameshifted CDS 138806..139318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 139318..139962 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 140077..140439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 140541..141212 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641684.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(141285..141836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(142006..142929) product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(143131..144462) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254457.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(144452..144949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 145588..146301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 146317..146997 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(147066..148364) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640473.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene asnS CDS complement(148384..149394) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene asnA CDS complement(149772..150332) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(150555..153086) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(153233..153874) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700625.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 154091..155413 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 155563..156738 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 156750..158063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(158056..158508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(158573..159175) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 159273..159584 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 159712..160368 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 160549..160986 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 161115..161291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 161473..161691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 161704..161949 product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(162007..163143) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 163904..164860 product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(165044..166420) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 166859..167959 product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101973.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 note possible pseudo, frameshifted CDS 167969..169213 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(169375..169509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 169811..170524 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035148028.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 170521..171372 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156093518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(171446..173251) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene thrS CDS complement(173580..174263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(174529..176121) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 176312..176437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 176694..177704 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 177966..178478 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 178489..179547 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 179565..180251 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 180350..181942 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(182015..183301) product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102866030.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 183509..183853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 184078..184314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(184417..184734) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(184898..186595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 187023..187967 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549144.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(188099..188284) product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643006.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 188510..189130 product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 189324..190328 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 190650..191927 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640691.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene hisS CDS complement(192049..192543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(192647..193285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(193483..194868) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 195202..196155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(196167..197090) product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 197290..197538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 198023..198679 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(198878..199459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 199530..200741 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 200809..201663 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262269.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(201827..202948) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(203105..205234) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(205360..205623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475499.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 205755..206408 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 206580..208130 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114296.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(208173..209582) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene nhaC CDS complement(209894..211222) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 211589..213022 product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 213173..214915 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(215006..215923) product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 216070..216990 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476348.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 217009..217764 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642722.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 217766..218083 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476363.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene trxA CDS complement(218152..219474) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 219829..223329 product YSIRK-type signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(223388..223720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(223765..224328) product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643355.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(224394..225158) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101822.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(225151..226050) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(226047..227042) product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene trpX CDS complement(227417..228442) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102154.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(228651..229616) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311774.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 229891..231432 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642739.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 231473..232252 product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549297.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 232329..232922 product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703028.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(232995..234380) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene brnQ CDS complement(234736..235971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 236107..237186 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 237226..237405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(237593..237877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 238104..238289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 238282..239055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 note possible pseudo, frameshifted CDS 239160..240110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 240141..240461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 240467..241150 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674243.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 241153..241326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(241622..241999) product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 242062..242694 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101615.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 242698..243843 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 243840..245132 product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102172.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 245136..245429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 245503..247407 product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 247551..248189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 248189..248692 product RNase III inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645538.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 248793..249953 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989601.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 250029..251522 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547770.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene cls CDS 252053..253183 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(253198..254118) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263236.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(254111..254791) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605134.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 254910..255752 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924976.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(255946..256698) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene pnuC CDS complement(256949..257446) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475533.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene greA CDS 257553..258674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 258697..259023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475559.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(259080..259304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641910.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(259318..259824) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(259860..260642) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015380740.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(260672..261640) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102164.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 261835..263013 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 263040..264491 product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003715509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 264529..265521 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(265591..266202) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 266452..267765 product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(267820..268290) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 268495..268959 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 269038..269412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 note possible pseudo, internal stop codon CDS 269521..270048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 270129..270536 product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene tnpA CDS 270536..271711 product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene tnpB CDS complement(272182..274134) product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(274357..275280) product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(275350..275583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(275737..277023) product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016252543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(277214..278650) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645183.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene gndA CDS complement(278794..280275) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644713.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene zwf CDS complement(280558..281727) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 281903..282328 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722084.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(282378..282845) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene nrdI CDS complement(282958..284286) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101876.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 284459..285322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 285340..285864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 285881..286408 product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 286476..286928 product transcriptional regulator SylA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene sylA CDS 286952..287677 product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296773.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(287710..288819) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(288831..289661) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660564.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 290846..291553 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 291626..292459 product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989696.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene eutJ CDS complement(292540..293634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 293889..294167 product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene pduA CDS 294265..294981 product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene pduB CDS 295006..296682 product propanediol/glycerol family dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008947521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 296700..297410 product propanediol/glycerol family dehydratase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 297424..297939 product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836574.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 297967..299814 product diol dehydratase reactivase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931948.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 299804..300160 product glycerol dehydratase reactivase beta/small subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 300168..300737 product propanediol utilization microcompartment protein PduK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene pduK CDS 300750..301037 product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895463.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene eutM CDS 301060..301704 product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 301735..302238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 302292..302498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 302519..303106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 note possible pseudo, frameshifted CDS 303109..303582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 303585..305012 product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 305030..306151 product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 306175..307362 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 307378..307725 product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene eutS CDS 307795..308589 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 308737..309369 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646364.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 309366..309926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(309919..310347) product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 310455..310904 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 310928..311767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(311826..312392) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382343.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 312750..313838 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene cobD CDS 313835..315199 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 315196..316155 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989705.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene cbiB CDS 316161..316847 product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721591.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 316825..317976 product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836528.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene cbiD CDS 317973..318572 product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 318565..319119 product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 319134..319895 product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 319898..320953 product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene cbiG CDS 320965..321690 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene cobJ CDS 321687..322445 product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene cobK CDS 322435..323829 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836532.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene cobA CDS 323822..324598 product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 324604..325302 product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 325305..326048 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 326045..326368 product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721603.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 326394..327071 product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721604.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 327081..327890 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 327986..329497 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 329506..329964 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659744.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 329967..331232 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723241.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene hemA CDS 331222..332139 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723240.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene hemC CDS 332145..333116 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836541.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene hemB CDS 333136..334431 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene hemL CDS 334493..335083 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene cobU CDS 335092..335853 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene cobS CDS 335850..336440 product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933053.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene cobC CDS 336454..337164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 337166..338218 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437772.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene cobT CDS 338479..338823 product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene tnpA CDS 338823..339998 product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene tnpB CDS 340156..340362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 340505..340882 product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 340888..341427 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549293.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 341603..341788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 341815..341961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(342046..343134) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 343354..343812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 343809..345551 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 345544..347364 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564926.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(347437..349641) product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene nrdJ CDS complement(349780..351216) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(351304..351810) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101872.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene ybaK CDS 351942..352673 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 352942..355353 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 355626..357008 product ISLre2-like element ISLca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 357109..358464 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 358499..359245 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 359379..360731 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476479.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene brnQ CDS 360757..361659 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(361814..363100) product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016252543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(363240..365168) product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100870.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(365180..365647) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645906.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 365848..366861 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642650.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 367146..367553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 367550..368008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(368376..369545) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704462.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 369700..371112 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475887.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 371158..372144 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(372199..373056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(373067..373480) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642665.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 373617..374582 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 374596..374952 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(375000..376961) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101852.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(377205..377546) product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(377588..378241) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(378231..379613) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100922.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(379618..380178) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643692.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 380444..381229 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644715.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(381291..382046) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(382347..383309) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475972.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 383475..384473 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642692.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 384470..384649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(384743..385540) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156093518.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(385570..386136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 note possible pseudo, frameshifted CDS 386437..386793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(386893..387540) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563745.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 387681..389033 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(389161..389628) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587210.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(389771..392434) product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476462.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(392670..393581) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(393671..396073) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101183.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 396213..397304 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 397304..398110 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 398110..398928 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 398925..399998 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 400111..401403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 401583..402506 product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(402543..403847) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211863.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(404022..405413) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 405542..405952 product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 405959..406531 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 406572..407009 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 407069..407545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 407564..408403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641118.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(408581..408832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 409140..409676 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 409713..412580 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087118395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 412835..413827 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048233.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 414007..414186 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 414189..414440 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356092.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(414487..415764) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene hflX CDS complement(415794..416447) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(416521..417171) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162685289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 417391..419697 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene helD CDS 419746..419982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(420019..420888) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439388.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 421099..423195 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 423388..424311 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene coaA CDS complement(424308..425498) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 425569..425742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 426012..427565 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene guaA CDS 427716..429092 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241738.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 429353..430591 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476517.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 430662..431534 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 431970..432638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 432628..432939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(432936..433814) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311774.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 434304..434918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 434942..435637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 436025..436501 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 436620..437480 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(437788..438480) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156093518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 note possible pseudo, frameshifted CDS complement(438477..438692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(438780..438977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 439454..440560 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 440817..441374 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700953.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene efp CDS 441723..442073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 note possible pseudo, frameshifted CDS 442084..442494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 note possible pseudo, internal stop codon, frameshifted CDS complement(442701..443411) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 443537..444409 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 444414..445313 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene pstC CDS 445313..446194 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene pstA CDS 446205..446960 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene pstB CDS 446971..447675 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene phoU CDS 448846..449709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 449852..451165 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 451180..452319 product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548666.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(452316..453077) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(453155..454927) product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254216.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 455082..456425 product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 456418..457086 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 457104..457649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(457917..459221) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(459224..460156) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene hemH CDS complement(460341..460514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 460543..461457 product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056996568.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 461796..462191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 note possible pseudo, internal stop codon CDS complement(462252..463382) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 463722..464645 product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 464850..467051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(467121..468149) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547468.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 468328..469044 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(469139..470236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 note possible pseudo, internal stop codon CDS complement(470276..470608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 note possible pseudo, internal stop codon CDS complement(470925..472202) product ISLre2-like element ISLca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(472432..473394) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 473528..474013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 note possible pseudo, frameshifted CDS 473943..475046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 note possible pseudo, frameshifted CDS 475059..476393 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294399.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 476690..477907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 477928..479385 product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262875.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene gtfA CDS complement(479538..480335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(480446..480844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 note possible pseudo, internal stop codon CDS complement(480854..481414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 note possible pseudo, internal stop codon CDS 481612..482856 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476403.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 483212..483652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(483729..484766) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 484911..485111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(485135..486532) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(486713..487873) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene tnpB CDS 488110..489648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 489697..490743 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323130.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 490816..491409 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(491609..492490) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476274.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 492627..494255 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 494549..495937 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 496059..497453 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 497526..498947 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 499114..500001 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 500057..501424 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 501437..502090 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355481.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 502218..503726 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640572.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 503775..504758 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485371.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 504771..505343 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(505405..507990) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene mprF tRNA 508144..508220 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 508296..509162 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(509379..510107) product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(510107..511615) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641223.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 511748..512194 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 512273..512620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 512813..514669 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700012.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(514743..515711) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 515895..517079 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546414.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(517127..517780) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(517793..518431) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(518431..519261) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(519274..520014) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 520292..520768 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642165.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 520972..521655 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642969.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 521670..522362 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642968.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(522426..523346) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 523529..524203 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 524350..524550 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 524659..525414 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641228.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 525426..525899 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 525955..526629 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 526699..527154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 527494..528969 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 529068..529709 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641239.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 tRNA 529774..529848 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 529854..529938 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 530028..530099 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 530105..530179 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 530225..530300 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(530436..531149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 note possible pseudo, frameshifted CDS complement(531251..531394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 531687..532715 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837444.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene adhP CDS 532881..533348 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 533363..535855 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101242.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 536143..536745 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101243.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 536982..540590 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 540634..544269 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641247.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene rpoC CDS 544339..545514 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674763.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 546495..546914 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene rpsL CDS 546935..547405 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene rpsG CDS 547544..549631 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475578.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene fusA CDS 549830..551116 product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016252543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 551428..551562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 551579..551887 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638059.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene rpsJ CDS 551936..552595 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene rplC CDS 552617..553240 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene rplD CDS 553240..553536 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene rplW CDS 553562..554407 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene rplB CDS 554448..554726 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene rpsS CDS 554744..555091 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene rplV CDS 555104..555769 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene rpsC CDS 555773..556207 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene rplP CDS 556197..556403 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene rpmC CDS 556428..556694 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene rpsQ CDS 556764..557132 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene rplN CDS 557168..557476 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701316.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene rplX CDS 557505..558047 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638072.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene rplE CDS 558063..558248 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288673.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 558281..558679 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701322.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene rpsH CDS 558709..559245 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene rplF CDS 559308..559664 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene rplR CDS 559686..560195 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638077.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene rpsE CDS 560211..560393 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567529.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene rpmD CDS 560425..560859 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638079.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene rplO CDS 560861..562177 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644092.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene secY CDS 562177..562836 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 562970..563188 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene infA CDS 563225..563344 product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567518.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene rpmJ CDS 563376..563741 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641265.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene rpsM CDS 563777..564166 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene rpsK CDS 564252..565196 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 565231..565614 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene rplQ CDS 565834..566661 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 566637..567503 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476334.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 567496..568299 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 568319..569089 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene truA CDS 569195..569638 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene rplM CDS 569652..570047 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rpsI CDS complement(570209..571399) product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016252543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 571506..572474 product IS30-like element IS6770 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 572748..573521 product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905614.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 573671..574297 product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703028.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 574316..574891 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476270.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 574908..576041 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 576199..578472 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene pcrA CDS 578491..580533 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene ligA CDS 580537..581652 product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701508.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 581804..582121 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene gatC CDS 582121..583593 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene gatA CDS 583595..585019 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641343.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene gatB CDS 585036..586043 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 586140..587510 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene rlmD CDS 587677..588093 product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700413.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 588093..591041 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 591195..591572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(591643..592236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 note possible pseudo, frameshifted CDS complement(592247..592597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 note possible pseudo, frameshifted CDS 592826..594727 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 594754..594984 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546307.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 594984..595529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 595549..596184 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 596322..596669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 note possible pseudo, internal stop codon, frameshifted CDS 596662..597012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 note possible pseudo, internal stop codon, frameshifted CDS 597283..597552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 note possible pseudo, internal stop codon, frameshifted CDS complement(598065..598658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 note possible pseudo, frameshifted CDS complement(598646..598894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(598916..599464) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(599466..600908) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(601026..601733) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 601981..602949 product IS30-like element IS6770 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389992.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 603038..604003 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(604005..604610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 604714..605037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 605365..605916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(605962..606402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(606568..607515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 note possible pseudo, frameshifted CDS 607889..609214 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547445.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 609368..610081 product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 610173..610712 product hydrophobic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 610796..611449 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 611464..611922 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(611973..613055) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158181852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 613300..614223 product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(614231..614677) product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(614674..615108) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700966.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 615255..615764 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 615825..616379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013245460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(616431..617138) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 617275..617730 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 617720..618751 product DUF3114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387420.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 618888..620417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 620524..621447 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 621452..622027 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004564056.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(622064..622426) product DUF4828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 622587..623606 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 623618..624919 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 tRNA 624978..625052 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 625131..626252 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254207.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene wecB CDS complement(626305..626757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(626852..627289) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(627282..627740) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 627854..628711 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705135.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene map CDS complement(628774..629895) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475604.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(629910..631331) product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene arcD CDS 631663..633168 product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene yjeM CDS 633286..634176 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(634228..634455) product DUF2922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476074.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(634477..634692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 634793..635587 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene recX CDS 635663..636430 product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101283.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 636448..637377 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 637389..638036 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966340.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 638060..639178 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057797519.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene glf CDS 639316..640737 product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 640755..641804 product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476396.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene waaB CDS 641816..642847 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 643009..644538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 644838..645893 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 646047..647243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476397.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 647240..647869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(648768..650279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 650477..651982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 652238..653563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 653643..654215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 654445..655560 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 655578..656549 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476439.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 656688..657656 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 657713..657883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 658124..658276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 658291..659436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 659535..661412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 661472..662590 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(662633..664102) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 664312..665031 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905206.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 665044..666501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 666634..668211 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(668277..669407) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 669626..670594 product IS30-like element IS6770 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389992.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(670714..671160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 671371..671571 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643615.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 671756..673042 product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102866030.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 673256..673639 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 673620..674483 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 674483..675169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(675228..675953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 676103..676711 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(676763..678820) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 679243..679428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 679550..679816 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 679816..681546 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646541.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene ptsP CDS 681780..682997 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643292.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 683000..684028 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 684028..685041 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 685098..685346 product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 rRNA 685757..687329 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 687422..687498 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 687500..687574 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 rRNA 687735..690653 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 690737..690848 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 690900..690993 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 691000..691072 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 691076..691150 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 691185..691259 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 691263..691347 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 691353..691424 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 691441..691516 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 691552..691622 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 691636..691722 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 692025..693311 product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102866030.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 693672..694226 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(694265..695662) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548236.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 696056..698290 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644788.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene nrdD CDS 698356..698934 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene nrdG CDS 698946..699836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 700220..701008 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262447.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 701164..702864 product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 703194..703901 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(704030..704878) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549471.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 705011..705442 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 705569..707071 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 707071..707514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(707538..708062) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(708375..708542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(708554..709120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 709256..710602 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(710814..711269) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 711393..712832 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 712918..713457 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643720.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 713618..714805 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene metK CDS 715127..717547 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene leuS CDS 717609..717872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 717987..719636 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101352.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(719701..720561) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 720650..722053 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645262.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene pepV CDS 722093..722590 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 722697..723725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(723760..724392) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 724608..725216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 725298..726314 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002414145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 726371..727294 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene rbsK CDS 727426..727656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 727640..728317 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645251.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 728661..728939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 tRNA 729021..729107 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 729182..729577 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 729665..730000 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene folB CDS 730003..730515 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642516.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene folK CDS 730497..731075 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642515.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene folE CDS 731062..732321 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 732311..732898 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643483.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 732900..734063 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene folP CDS complement(734029..734364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 734506..734778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 tRNA 734842..734913 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(734964..735902) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(735915..736730) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene thiD CDS 737091..738779 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene argS CDS 738947..741112 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 741161..741532 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 741612..742796 product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645226.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 742800..745292 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 745407..746342 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699757.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(746515..746745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(746748..747182) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640251.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 747319..748056 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644277.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 748049..749251 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101412.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 749264..749905 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644279.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene trmB CDS 750145..750438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 note possible pseudo, frameshifted CDS 750675..751181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 751368..753803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(753849..755351) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(755390..756370) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289101.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(756539..757459) product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene glsA CDS complement(757511..757849) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289862.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 758014..758334 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 758463..759110 product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101413.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(759249..759479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 note possible pseudo, frameshifted CDS complement(759590..759883) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 760087..761391 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699774.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene murC CDS 761483..762196 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(762301..762978) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 763101..765767 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101451.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene polA CDS 765782..766612 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene mutM CDS 766616..767215 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene coaE CDS 767261..767725 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene nrdR CDS 767743..769098 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 769119..770060 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644286.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene dnaI CDS 770286..770798 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355797.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene infC CDS 770821..771018 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638526.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene rpmI CDS 771063..771416 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640279.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene rplT CDS 771570..772100 product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 772093..773220 product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703227.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene yqeH CDS 773244..773555 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640289.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene yhbY CDS 773577..774221 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640290.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 774214..774828 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene yqeK CDS 774828..775184 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene rsfS CDS 775184..775924 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645186.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 775936..777069 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 777199..777756 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 777811..777990 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene rpmF CDS 778213..778899 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638551.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 778912..780387 product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 780800..780934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(780974..781138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 781080..782069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(782258..783577) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(783716..784126) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(784190..785140) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene yidC CDS complement(785239..785514) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475805.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 785613..786389 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 786454..786960 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 786981..787319 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 787613..788659 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 788666..791083 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101464.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene pheT CDS 791269..791907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 792020..792676 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene udk CDS 792740..793216 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene greA CDS 793458..793868 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014124664.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene tnpA CDS 794125..794514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(794582..797197) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101465.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 797428..799506 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 799645..799794 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene rpmG CDS 799931..800485 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 800646..800882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 note possible pseudo, frameshifted CDS 801035..801274 product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 801299..802270 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644304.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 802290..802703 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640328.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(802864..803040) product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288457.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 803155..804078 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene miaA CDS 804248..805591 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475817.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene glnA CDS 805833..807338 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene gltX CDS 807451..808632 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(808702..808827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 809318..810169 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390147.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 810186..810713 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706147.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene msrA CDS 810716..811030 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 811339..812226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699835.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 812216..813244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640335.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 813274..813780 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644309.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(813843..813977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 tRNA complement(814192..814267) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 814452..815084 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 815301..815609 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640343.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene rplU CDS 815625..815948 product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640344.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 815974..816255 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564659.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene rpmA CDS 816381..817088 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 817101..818177 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 818179..818853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 818943..819380 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640347.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 819382..819798 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101470.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene nusB CDS 819929..820789 product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645162.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 820782..822119 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene xseA CDS 822121..822402 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699848.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 822421..823293 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101471.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 823305..824126 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640353.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 824145..824597 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 824613..826292 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene recN CDS complement(826430..826762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 826922..827542 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640361.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene gmk CDS 827539..827757 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene rpoZ CDS 827868..829073 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene coaBC CDS 829074..831503 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene priA CDS 831521..832474 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101475.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene fmt CDS 832464..833813 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene rsmB CDS 833821..834561 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 834565..836469 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene pknB CDS 836482..837372 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene rsgA CDS 837383..838036 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene rpe CDS 838122..838772 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 838922..839107 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene rpmB CDS 839302..839664 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 839690..841399 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 841502..843538 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene recG CDS 843556..844587 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644323.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene plsX CDS 844624..844878 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene acpP CDS 845056..845757 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene rnc CDS 845774..849337 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101482.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene smc CDS 849360..850886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 850901..851242 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046870843.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 851244..852689 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene ffh CDS 852788..853063 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene rpsP CDS 853076..853336 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 853391..853897 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170268.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene rimM CDS 853897..854655 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene trmD CDS 854666..856096 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475849.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 856219..856578 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640385.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene rplS CDS complement(857186..857410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 857560..857892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 857895..858722 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701698.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(858774..859253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(859554..860930) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(860999..861979) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476124.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 862060..862959 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(862995..863696) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102162.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(863717..864940) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044005378.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 865098..865949 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 866095..866364 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene rpsN CDS 866595..867059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 867059..867286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 867357..868019 product serine dehydratase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 868029..868910 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene sdaAA CDS 869011..869574 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene ahpC CDS 869588..871255 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706831.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 871935..873005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 873093..874997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 874997..875893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 note possible pseudo, internal stop codon, frameshifted CDS 876160..876741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 876994..880371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 880977..881984 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 882004..883194 product accessory Sec system protein translocase subunit SecY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene secY2 CDS 883197..884708 product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836743.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene asp1 CDS 884720..886207 product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032114.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene asp2 CDS 886210..887097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 887101..889449 product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene secA2 CDS 889464..891002 product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene gtfA CDS 890995..892320 product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene gtfB CDS 892313..892510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 892768..893316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(893324..893479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(894324..894668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 894655..895155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(895274..895900) product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020063.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene istB CDS complement(895902..896669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(896688..897611) product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(897681..898145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(898300..899703) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101518.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 899842..901671 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254067.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 901754..901939 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 902074..903576 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357138.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene glpK CDS 903630..904133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 904200..905576 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(905664..905900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(905910..906485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 906702..906920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 907090..907434 product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene tnpA CDS 907434..908609 product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene tnpB CDS 908744..909268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 909497..909772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 910348..911349 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 911370..912245 product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 912258..913010 product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 913045..913701 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 913694..914851 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 914864..915667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 915669..916811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 916863..917798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 917803..918840 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 918842..919960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 919983..920933 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107915.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 920937..922349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(922666..922998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 923148..923780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 923841..925052 product IS21-like element ISMac9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023062.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene istA CDS 925057..925815 product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene istB CDS 925959..926465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 926467..927204 product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene istB CDS 927441..928481 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene rfbB CDS 928831..929799 product IS30-like element IS6770 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389992.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(929887..931005) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 931801..932733 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene mmuM CDS 932726..934129 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(934585..934959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(934959..935201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 935383..937230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 937295..940780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 940876..941652 product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 941700..941885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 942001..943119 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 943121..946222 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476308.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(946680..947648) product IS30-like element IS6770 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389992.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 947802..948257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 948286..948777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 rRNA 949210..950782 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA 950988..953906 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 953991..954101 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS 954407..954568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(954623..955264) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596406.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 955407..957713 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 957871..959130 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(959315..959962) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100887.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene thiE CDS complement(959959..960777) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene thiD CDS complement(960789..961580) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100886.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene thiM CDS 961860..962165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 962166..964067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 964216..965346 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(965981..966418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021731738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(966434..967393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101447.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(967524..968492) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 968606..969625 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(969685..970461) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(970458..971234) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101422.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(971446..971895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 972023..972427 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101424.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 972427..972672 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101425.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 972719..973912 product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(973973..974878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(974883..975851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101431.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(975857..976129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(976225..976878) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101433.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(976871..977926) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(978077..978361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(978351..978923) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(978923..979411) product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101439.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene mobB CDS complement(979390..980607) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(980597..981094) product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(981091..982110) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 982256..985921 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 985911..987470 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene narH CDS 987463..988041 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene narJ CDS 988034..988723 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene narI CDS complement(988839..990086) product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577841.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(990238..991128) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673979.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(991237..991884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(991901..992755) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 993201..995597 product glycoside hydrolase family 68 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(995691..995849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(995922..997001) product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547513.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene xerS tRNA complement(997069..997142) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 997325..997771 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563897.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene fabZ CDS 997858..998304 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699732.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 998324..999298 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 999318..999560 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 999560..1000510 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475764.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1000494..1001228 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699736.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene fabG CDS 1001239..1002471 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene fabF CDS 1002478..1002933 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475766.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene accB CDS 1002926..1003360 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699740.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene fabZ CDS 1003369..1004739 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475767.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene accC CDS 1004736..1005584 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025022359.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene accD CDS 1005577..1006353 product carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057868922.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene accA CDS 1006364..1007128 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475769.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene fabI tRNA 1007330..1007402 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 1007407..1007478 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 1007495..1007581 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 1007587..1007663 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 1007847..1007917 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 1007934..1008006 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 1008010..1008084 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 1008122..1008195 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 1008679..1008897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1009001..1010011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 note possible pseudo, frameshifted CDS complement(1010168..1010521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1010655..1011302) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549576.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1011637..1012113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 note possible pseudo, internal stop codon CDS complement(1012238..1012510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(1012510..1012875) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006307660.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1012926..1013111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 tRNA complement(1013188..1013259) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 1013428..1013790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1013811..1014647 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101579.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1014692..1015174) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1015250..1015405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(1015407..1016270) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1016346..1016984) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550051.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1016994..1017437) product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1017952..1019238 product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102866030.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1019385..1021709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(1021888..1022742) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1022852..1024240) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1024528..1025433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1025473..1027248) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1027416..1028666 product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100975.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1028669..1029361 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254217.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1029425..1031938) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1031954..1032292) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene crcB CDS complement(1032285..1032662) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476362.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1032770..1033162 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1033214..1033882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1034030..1035763) product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1035903..1037264 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1037324..1037752) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705203.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 1037907..1039295 product multidrug efflux MFS transporter MdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene mdrM CDS complement(1039344..1039799) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547019.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1039871..1040287) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1040470..1041600 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(1041677..1042153) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605799.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1042196..1043080 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1043126..1044016 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361212.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1044154..1044420 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1044445..1045788 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(1045961..1046485) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1046645..1047490 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1047464..1048312) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1048411..1049067 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101874.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1049131..1049808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1049772..1050650) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1050867..1052549 product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640521.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1052597..1055074) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(1055071..1056156) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101548.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1056233..1057144) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1057148..1057594) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene lspA CDS complement(1057595..1057987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1058027..1058422 product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(1058597..1059751) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644375.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1059966..1060442) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene nrdI CDS complement(1061160..1061522) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene gpsB CDS complement(1061594..1062166) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640485.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1062285..1062899 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene recU CDS 1062911..1065175 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476055.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1065253..1066170) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700189.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(1066193..1066897) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644365.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(1066981..1067499) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1067593..1070457) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1070676..1071623 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475864.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene mvk CDS 1071623..1072594 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene mvaD CDS 1072622..1073749 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1073768..1074811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 note possible pseudo, internal stop codon CDS 1074884..1075360 product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642103.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1075405..1077594) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1077758..1078777 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 1078899..1079777 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907200.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1079958..1080932) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703196.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1080960..1081700) product antiholin-like protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421724.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene lrgB CDS complement(1081693..1082112) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1082314..1083045) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921843.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1083026..1084789) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354827.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1084790..1085656) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1085675..1087042) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 1087181..1087999 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476106.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1088057..1088293) product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1088398..1088592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1088779..1089432 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1089626..1090516) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1090533..1090865) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101428.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1090898..1092307) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640267.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene sufB CDS complement(1092300..1092761) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640266.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1092748..1093986) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1093967..1095256) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene sufD CDS complement(1095268..1096065) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640263.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene sufC CDS 1096292..1096495 product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1096497..1098488 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101417.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene feoB CDS 1098495..1098653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(1098719..1100140) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(1100155..1100976) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene menB CDS 1101009..1101383 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1101731..1102306 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1102511..1103695) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1103902..1104870 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1104943..1107831 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 1107905..1108630 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1108676..1109134) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902111.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene ribE CDS complement(1109137..1110318) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1110318..1110920) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1110913..1111971) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131986.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene ribD CDS complement(1112317..1113261) product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097582.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene rihA CDS complement(1113500..1114675) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene tnpB CDS complement(1114675..1115019) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene tnpA CDS complement(1115267..1115392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(1115562..1117829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1118483..1121608) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1121662..1122774) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851154.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(1122764..1124296) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1124314..1126077) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 1126275..1126766 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721792.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1126827..1127102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1127320..1127529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1127620..1128588) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1128748..1129059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1129106..1129639) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 1129868..1131397 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563002.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene gntK CDS 1131410..1132750 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231203.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1132848..1133852 product pectin utilization transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230725.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene kdgR CDS 1133904..1135433 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563002.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene gntK CDS 1135613..1136158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 1136173..1136364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1136382..1136765 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1136927..1137118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 note possible pseudo, internal stop codon CDS complement(1137224..1137421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 note possible pseudo, internal stop codon CDS complement(1137449..1137589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1137708..1138865) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1139036..1139359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1139424..1139813) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1139978..1141354) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241738.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1141427..1142362) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1142471..1142938) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1142955..1145420) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640556.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene parC CDS complement(1145439..1147448) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640557.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene parE CDS 1147674..1148303 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene plsY CDS complement(1148345..1149223) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101568.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1149357..1151477) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645027.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene topA CDS complement(1151599..1152474) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene dprA CDS complement(1152525..1153295) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(1153288..1154160) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700107.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene ylqF CDS complement(1154181..1154402) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1154421..1155023) product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1155026..1155952) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1156126..1156968) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640577.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1157147..1157791 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357443.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1157780..1158268) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1158284..1159246) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(1159265..1161175) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1161177..1162388) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475877.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(1162514..1163779) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644434.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1163915..1164190) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1164400..1165713) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700239.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene der CDS complement(1165943..1167193) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640589.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene rpsA CDS complement(1167266..1167952) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene cmk CDS complement(1168026..1168598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1168683..1170122) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1170112..1171137) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645009.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1171238..1171816) product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1172187..1172900) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640595.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1172900..1173505) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640596.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene scpB CDS complement(1173468..1174259) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640597.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(1174252..1174608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644440.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(1174622..1175515) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294386.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene xerD CDS complement(1175515..1176396) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640600.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1176538..1177959) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640603.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene pyk CDS complement(1178145..1181492) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene dnaE CDS 1181614..1181817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1181859..1183109) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene pepT CDS complement(1183134..1183958) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(1183945..1184586) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475993.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1184750..1185934) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1186130..1187272) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640674.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene rpoD CDS complement(1187274..1189139) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476034.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene dnaG CDS complement(1189274..1191349) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene glyS CDS complement(1191351..1192337) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700278.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene glyQ CDS complement(1192598..1193383) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene recO CDS complement(1193399..1194304) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047769999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene era CDS complement(1194316..1194711) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002330764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(1194695..1195174) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene ybeY CDS complement(1195174..1196181) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644473.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1196281..1197252) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255227.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1197258..1197830) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643749.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1197958..1199343) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475672.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene argH CDS complement(1199333..1200154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 note possible pseudo, frameshifted CDS complement(1200301..1200564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 note possible pseudo, frameshifted CDS complement(1200724..1201701) product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene bsh CDS complement(1201769..1202197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 note possible pseudo, frameshifted CDS complement(1202274..1202741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 note possible pseudo, frameshifted CDS complement(1202906..1203352) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475872.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1203412..1203603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 1203903..1205414 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1205404..1206144 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(1206205..1208007) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101612.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene aspS CDS 1208389..1209237 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644479.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1209438..1209875) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene dtd CDS complement(1209886..1212123) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640696.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1212142..1212477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1212556..1213296) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640698.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1213297..1214256) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101614.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene prmA CDS complement(1214334..1214594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1214836..1215015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1215122..1216081 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1216218..1217186) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1217292..1218479 product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102866030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1218618..1218794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1218870..1219946) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1220019..1221434) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674806.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1221928..1223763) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699919.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene lepA CDS complement(1223894..1225045) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene dnaJ CDS complement(1225174..1227039) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101636.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene dnaK CDS complement(1227064..1227636) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene grpE CDS complement(1227649..1228701) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640713.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene hrcA CDS 1228822..1229193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704291.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1229287..1230573) product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016252543.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1230775..1231722) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594636.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene ribF CDS complement(1231735..1232640) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640716.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene truB CDS complement(1232834..1233193) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene rbfA CDS complement(1233213..1235471) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101641.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene infB CDS complement(1235485..1235796) product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1235783..1236064) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1236114..1237301) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene nusA CDS complement(1237322..1237795) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699900.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene rimP CDS complement(1237929..1242260) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640729.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(1242336..1244069) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1244099..1245373) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475820.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene rseP CDS complement(1245396..1246181) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1246201..1246965) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(1247188..1247751) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640736.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene frr CDS complement(1247756..1248478) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene pyrH CDS complement(1248560..1249435) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699817.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene tsf CDS complement(1249534..1250322) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene rpsB CDS complement(1250485..1251477) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1251479..1251769) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1251759..1252514) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644499.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1252609..1253247 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1253291..1253518) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640745.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1253592..1253843) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644501.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 1253972..1254598 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene lexA CDS complement(1254641..1255798) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475806.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1255824..1256492) product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 tRNA 1256645..1256732 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(1256859..1257473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1257585..1258103) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1258120..1260447) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101649.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene recJ CDS complement(1260581..1261414) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700506.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1261431..1262360) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene rnz CDS complement(1262393..1263709) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476163.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene obgE CDS complement(1263775..1265586) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640789.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene uvrC CDS 1265730..1265948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1266070..1266369) product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699862.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1266371..1266961) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene yihA CDS complement(1266979..1268229) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene clpX CDS complement(1268407..1269717) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene tig CDS complement(1269913..1271103) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565275.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene tuf CDS complement(1271282..1272187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1272304..1274085) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640800.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1274266..1274535) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene rpsO CDS 1274797..1275051 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene rpsT CDS complement(1275147..1276178) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene holA CDS complement(1276148..1277557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 note possible pseudo, frameshifted CDS complement(1278425..1278910) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640806.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1278974..1279606) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700061.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1279700..1280752) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1280736..1281257) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295492.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene coaD CDS complement(1281257..1281820) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene rsmD CDS complement(1281817..1282101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1282094..1283317) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1283411..1285255) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644590.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene typA CDS complement(1285362..1286135) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640819.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1286128..1286421) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1286578..1288005) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene lpdA CDS complement(1288009..1289343) product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101671.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1289375..1290352) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674460.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1290355..1291461) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101672.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene pdhA CDS 1291718..1292278 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645922.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene def CDS complement(1292331..1292807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475852.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1292943..1293155 product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640827.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1293299..1294246 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1294319..1294522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1294674..1296107) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101674.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1296278..1296574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1296567..1296917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(1297184..1298335) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(1298354..1299649) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379729.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1299839..1300627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 1300704..1301672 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 1301749..1301976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1302033..1303091) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254270.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(1303111..1304295) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1304308..1305087) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546885.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene dapB CDS complement(1305091..1306014) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546883.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene dapA CDS complement(1306042..1307187) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1307198..1307908) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546878.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene dapD CDS complement(1307945..1309255) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene lysA CDS 1309734..1311092 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1311105..1312091 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene dapF CDS complement(1312173..1312562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1312589..1313515) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156093518.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1313496..1314149) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035148028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1314236..1315210) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644596.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1315280..1317757) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101675.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1317779..1318462) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(1318475..1319131) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1319268..1320401) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene mnmA CDS complement(1320509..1320847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1320849..1322003) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1322023..1322718) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1322734..1323003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1322996..1323547) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704380.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1323560..1323763) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082199.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1323877..1326672) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101679.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene ileS CDS complement(1326970..1327710) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640850.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1327732..1328517) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640851.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1328540..1328800) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1328819..1329235) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene sepF CDS complement(1329306..1330553) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640854.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene ftsZ CDS complement(1330571..1331944) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640855.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene ftsA CDS complement(1332065..1332913) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101680.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(1332941..1334053) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene murG CDS complement(1334055..1335425) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476140.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene murD CDS complement(1335438..1336409) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene mraY CDS complement(1336434..1338593) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101681.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1338593..1338964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1338972..1339928) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476142.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene rsmH CDS complement(1339944..1340372) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene mraZ CDS complement(1340517..1340870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1340999..1341118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 1341217..1342593 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1342669..1344999) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1345021..1345530) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644616.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1345702..1346559) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640871.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1346674..1347702 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101686.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(1348006..1348128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 rRNA complement(1348313..1348424) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(1348508..1351426) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA complement(1351587..1351661) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(1351663..1351739) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 rRNA complement(1351832..1353404) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS complement(1353919..1354710) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640877.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1354824..1355636) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289847.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1355640..1356293) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640879.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1356458..1357096 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101687.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(1357163..1358539) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674698.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1358541..1359575) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1359658..1360329) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640883.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(1360455..1360856) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720569.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene spxA CDS 1361104..1361595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1361689..1363038) product ISLre2-like element ISLca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674077.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1363378..1364568) product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016252543.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 tRNA complement(1364877..1364953) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(1364956..1365031) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(1365039..1365113) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(1365116..1365205) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(1365206..1365282) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(1365291..1365361) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(1365376..1365450) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(1365458..1365534) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(1365537..1365612) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(1365620..1365707) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(1365752..1365828) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(1365842..1365917) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(1365946..1366021) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(1366025..1366100) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(1366107..1366193) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(1366210..1366281) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(1366290..1366363) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(1366406..1366480) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(1366497..1366571) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 rRNA complement(1366578..1366689) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(1366773..1369691) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(1369852..1369926) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(1369928..1370004) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 rRNA complement(1370097..1371669) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS 1372317..1372964 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475755.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1372938..1373585) product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287161.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1373569..1374339) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1374348..1374884) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1374904..1375512) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641558.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1375627..1376823) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1376837..1377670) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101695.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1377925..1378116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1378085..1378516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1378513..1378803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(1378790..1379224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1379221..1379532) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475747.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1379532..1380602) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475746.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene comGB CDS complement(1380526..1381497) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene comGA CDS complement(1381618..1382364) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641545.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1382439..1383284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1383298..1384308) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene ccpA CDS 1384469..1385569 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709752.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1385610..1386068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(1386061..1386501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1386644..1387519 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1387509..1388345 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1388453..1388896) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705862.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1388917..1389435) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1389441..1390028) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(1390030..1390833) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene racE CDS 1390988..1391542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1391597..1391911) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641528.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene trxA CDS complement(1392002..1394377) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1394379..1394915) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1395014..1395310) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674279.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(1395320..1395763) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641524.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene ruvX CDS complement(1395760..1396026) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703962.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(1396297..1398951) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476171.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene alaS CDS complement(1399210..1400583) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476172.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1400597..1401556) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101704.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1401683..1402147) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700554.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene yajC CDS complement(1402219..1403307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1403320..1404336) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene ruvB CDS complement(1404351..1404950) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene ruvA CDS complement(1404963..1406969) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101707.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene mutL CDS complement(1406981..1409626) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101708.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene mutS CDS complement(1409787..1411340) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644638.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene rny CDS complement(1411515..1412897) product ISLre2-like element ISLca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674077.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1413143..1414231) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene recA CDS complement(1414321..1415568) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1415693..1416280) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene pgsA CDS complement(1416308..1417345) product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1417444..1418742) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1418747..1419994) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1420197..1421048) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1421066..1421716) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641493.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1421731..1422378) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1422847..1423383) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene mreD CDS complement(1423390..1424247) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene mreC CDS complement(1424381..1425382) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644642.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(1425518..1426150) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene radC CDS complement(1426217..1427530) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1427632..1428846) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700423.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1428900..1430645) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene cydC CDS complement(1430638..1432323) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476126.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene cydD CDS complement(1432375..1433391) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476127.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene cydB CDS complement(1433392..1434810) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706422.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1435193..1437847) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1438173..1439393) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641480.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene thiI CDS complement(1439415..1440563) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1440787..1442490) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641477.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene ezrA CDS 1442881..1443486 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641475.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene rpsD CDS complement(1443560..1445263) product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254026.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1445415..1446749) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1446978..1448309) product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene frc CDS complement(1448302..1450032) product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044304031.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene oxc CDS complement(1450142..1450720) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene yaaA note possible pseudo, internal stop codon CDS 1451143..1451886 product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102236.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1451911..1452318 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1452376..1452648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 1452777..1453265 product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1453269..1454573 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1454884..1455180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 1455264..1455752 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644650.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 1455863..1456960 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 1456953..1457795 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1457884..1458453) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1458540..1459961) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene araA CDS complement(1460015..1460743) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1460747..1462369) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102218.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1462382..1463797) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102219.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 1464249..1464848 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010012236.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1464845..1465690 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156093518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1465796..1466641) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1466844..1467812) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1468155..1469291) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476153.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1469424..1469717) product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569969.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1469730..1470923) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1470972..1471196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(1471220..1471456) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene yidD CDS complement(1471462..1472454) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1472561..1473877) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644659.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene murA CDS complement(1473896..1474126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1474361..1474792) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641444.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1474804..1476231) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene atpD CDS complement(1476258..1477202) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1477238..1478767) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene atpA CDS complement(1478821..1479744) product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(1479858..1480400) product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641440.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene atpH CDS complement(1480390..1480908) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699938.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene atpF CDS complement(1480951..1481169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(1481194..1481901) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699936.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene atpB CDS complement(1481921..1482085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1482215..1483486) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(1483646..1484419) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101234.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1484416..1485531) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101233.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1485633..1487360) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene ptsP CDS complement(1487492..1488127) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene upp CDS complement(1488220..1489455) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1489569..1490597) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(1490603..1491469) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641434.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene prmC CDS complement(1491462..1492550) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene prfA CDS complement(1492566..1493141) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289675.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1493371..1494708 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 1494708..1495415 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699925.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1495431..1495733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(1495798..1497195) product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949127.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1497253..1498674) product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene arcD CDS complement(1498695..1499156) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1499267..1500499) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene arcA CDS complement(1500707..1501726) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475830.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1501919..1502518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(1502597..1503622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1503674..1504597 product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1504604..1505218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1505627..1506505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 tRNA complement(1506650..1506724) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS complement(1506786..1507712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 note possible pseudo, frameshifted CDS complement(1507702..1508172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 note possible pseudo, frameshifted CDS complement(1508163..1508339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1508400..1508729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644663.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 tRNA complement(1508820..1508893) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS complement(1508958..1509434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1509551..1511488) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1511488..1511775) product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1511775..1512143) product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549440.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 1512419..1513000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 1513084..1513986 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(1514168..1515100) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074342.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene arcC CDS complement(1515117..1516124) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene argF CDS 1516378..1517217 product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675241.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(1517330..1518838) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene xylB CDS complement(1518973..1520322) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene xylA CDS complement(1520532..1520747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1520761..1520979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 note possible pseudo, frameshifted CDS complement(1521035..1521772) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene istB CDS complement(1521774..1522961) product IS21-like element ISMac9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene istA CDS complement(1523304..1525343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1525363..1526862) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1527012..1527947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1528213..1529610 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012898121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1529710..1530009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1530074..1531255) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1531355..1531564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(1531641..1532999) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642759.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1533180..1533794 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254380.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1533868..1534728) product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475462.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1534897..1536384) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1536384..1537103) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646617.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 tmRNA complement(1537250..1537621) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1537714..1538325) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286836.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1538648..1539454) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645847.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1539447..1539914) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1539925..1541790) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101182.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1541852..1542163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1542424..1544244) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641075.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene glmS CDS complement(1544453..1545808) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700589.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene glmM CDS complement(1545836..1546729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1546713..1547564) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene cdaA CDS complement(1547723..1549078) product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene fucP CDS complement(1549098..1549493) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254480.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene rbsD CDS complement(1549505..1550428) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548221.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene rbsK CDS complement(1550761..1551657) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641067.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene murB CDS 1551785..1552321 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101164.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1552333..1552755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1552788..1553297) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1553297..1553755) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene tsaE CDS complement(1553875..1554849) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene pta CDS complement(1554910..1555599) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1555750..1556334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101162.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1556391..1556864) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene smpB CDS complement(1556882..1559287) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101159.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene rnr CDS complement(1559274..1560050) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1560129..1560368) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700607.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene secG CDS complement(1560435..1561985) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641049.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1562103..1563485) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1563681..1565003) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700615.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene eno CDS complement(1565094..1565843) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene tpiA CDS complement(1565959..1567164) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641045.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(1567255..1568262) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene gap tRNA 1568531..1568602 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS complement(1568765..1569358) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641041.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene clpP CDS complement(1569573..1569704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 1569966..1570136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(1570296..1571237) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641038.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene whiA CDS complement(1571256..1572242) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1572258..1573130) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene rapZ CDS complement(1573238..1574569) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547412.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1574838..1577702) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643969.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene uvrA CDS complement(1577718..1579733) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene uvrB CDS complement(1579955..1580227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1580333..1580971) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641028.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1581136..1582860) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(1582950..1583456) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034982991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1583502..1584383) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1584642..1585811) product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(1585905..1586837) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene trxB CDS 1587085..1587900 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 1587901..1589388 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004564379.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 1589381..1590115 product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1590186..1591100) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641010.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene galU CDS complement(1591165..1592181) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(1592207..1593034) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene lgt CDS complement(1593035..1593997) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene hprK CDS complement(1594012..1594368) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1594368..1594703) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101151.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1594733..1595731) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096641376.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene prfB CDS complement(1595931..1598294) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643952.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene secA CDS complement(1598505..1599053) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637821.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene raiA CDS complement(1599185..1599853) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(1599843..1601177) product DNA/RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 1601239..1601913 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 1601956..1602924 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1602993..1604378) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1604378..1604788) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1605051..1605311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1605338..1607176) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(1607261..1608871) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254096.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1608953..1609441) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1609534..1611162) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene groL CDS complement(1611254..1611538) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706535.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene groES CDS complement(1611573..1611752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(1611773..1612417) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 1612689..1613657 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1613737..1615674 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(1615705..1616670) product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709717.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1616684..1617865) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703454.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 1617893..1618816 product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1618938..1619723) product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 1620316..1621104 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596013.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene proB CDS 1621116..1622360 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674871.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1622378..1623151 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103661284.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene proC CDS complement(1623258..1624289) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706529.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene tsaD CDS complement(1624308..1624862) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101142.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene rimI CDS complement(1624846..1625571) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567077.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene tsaB CDS complement(1625747..1626358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 note possible pseudo, frameshifted CDS complement(1626430..1627122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 note possible pseudo, frameshifted CDS complement(1627198..1628193) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643943.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene galE CDS complement(1628305..1629276) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene ppx CDS complement(1629280..1631523) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641095.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1631525..1633039) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(1633204..1633965) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700658.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(1633975..1634841) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643942.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene rsmI CDS complement(1634850..1635200) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1635211..1636224) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene holB CDS complement(1636239..1636562) product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640965.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1636579..1637220) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101140.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene tmk CDS complement(1637230..1637478) product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476227.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1637483..1638085) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene recR CDS complement(1638089..1638397) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1638418..1640250) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene dnaX CDS complement(1640523..1641035) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene tadA CDS 1641293..1641514 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259249.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene nrdH CDS 1641614..1643785 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene nrdE CDS 1643900..1644919 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene nrdF CDS 1645274..1647910 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene adhE CDS complement(1648002..1648757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1648758..1649369) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1649362..1649694) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475524.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 1649885..1650256 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene mscL CDS 1650390..1650620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1650868..1651125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 1651270..1652994 product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 1652964..1653899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 1654072..1654662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 note possible pseudo, internal stop codon CDS 1654763..1654987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1655051..1656181) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(1656465..1656830) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637775.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene rplL CDS complement(1656893..1657393) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643933.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene rplJ CDS complement(1657591..1658523) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene wecB note possible pseudo, frameshifted CDS complement(1658529..1658711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 note possible pseudo, frameshifted CDS complement(1658728..1660029) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356675.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1660036..1660170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(1660427..1661620) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(1661797..1662489) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene rplA CDS complement(1662582..1663007) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene rplK CDS complement(1663147..1663689) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384070.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene nusG CDS complement(1663807..1663983) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene secE CDS complement(1663995..1664144) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene rpmG CDS complement(1664210..1664959) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702630.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene rlmB CDS complement(1664949..1665362) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700685.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1665374..1666786) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene cysS CDS complement(1667160..1668302) product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640931.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1668330..1669703) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643928.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene radA CDS complement(1669729..1670265) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476235.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1670404..1670700 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356545.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 1670712..1671395 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640926.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene rpiA CDS 1671424..1672764 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101072.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1672872..1673663) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1673679..1674428) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1674434..1675135) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476474.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1675162..1676304) product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182586238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1676581..1677447) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389847.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1677422..1678132) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640923.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 1678302..1680071 product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254405.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1680169..1681128) product beta-galactosidase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254473.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1681112..1682998) product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548184.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 tRNA complement(1683159..1683245) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 CDS complement(1683748..1685925) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674441.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1685997..1686824) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene nadE CDS complement(1686837..1688303) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101056.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1688365..1689066) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1689221..1689940) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702044.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1689974..1691599) product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549953.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene aspT CDS complement(1691714..1693114) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673958.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(1693232..1693579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1693585..1694715) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1694815..1695168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 tRNA complement(1695261..1695333) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(1695342..1695427) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS complement(1695527..1696357) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1696417..1697916) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1698129..1698680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 tRNA complement(1699031..1699106) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 CDS complement(1699277..1699822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 note possible pseudo, internal stop codon, frameshifted CDS complement(1699844..1700029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 note possible pseudo, internal stop codon, frameshifted CDS complement(1699987..1700307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 note possible pseudo, internal stop codon, frameshifted CDS complement(1700509..1700847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101365.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1700951..1701319 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1701607..1702107) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547331.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene tpx tRNA complement(1702369..1702443) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS complement(1702541..1703509) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 1703597..1704778 product IS66-like element short variant transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921814.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 tRNA complement(1704926..1705000) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 rRNA complement(1705008..1705118) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 rRNA complement(1705203..1708121) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 rRNA complement(1708327..1709899) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 CDS 1710816..1712228 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1712430..1713956) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701392.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene lysS CDS complement(1713977..1714978) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene dusB CDS complement(1715086..1716006) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene hslO CDS complement(1716097..1718205) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643854.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene ftsH CDS complement(1718439..1718981) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene hpt CDS complement(1718974..1720368) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642085.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene tilS CDS complement(1720370..1720864) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1721053..1721409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1721510..1721782) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567635.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1721779..1725315) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101049.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene mfd CDS complement(1725337..1725897) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene pth CDS 1726103..1726741 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476307.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene cbpA CDS complement(1727048..1727788) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102282.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1728172..1729410) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1729401..1730777) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1730968..1731342) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637688.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1731361..1732488) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene alr CDS complement(1732488..1732850) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567669.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene acpS CDS 1733182..1733322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 1733344..1734870 product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640707.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene dltA CDS 1734870..1736087 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640706.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene dltB CDS 1736107..1736346 product D-alanine--poly(phosphoribitol) ligase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene dltC CDS 1736339..1737628 product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919740.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene dltD CDS complement(1737672..1738586) product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene glsA CDS 1738998..1740128 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1740185..1742836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 1743087..1743917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1743999..1745492) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(1745564..1746943) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1747101..1747997) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699683.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene htpX CDS complement(1748000..1748569) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642054.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1748700..1749164 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387365.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1749201..1749857) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476528.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1749877..1750743) product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene fba CDS complement(1750755..1751534) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene tpiA CDS complement(1751547..1751765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1751656..1753392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1753805..1754509) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1754559..1755449) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(1755433..1756749) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549552.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1756909..1757154) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567687.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1757247..1758524) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642050.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1758795..1760399) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(1760575..1761132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1761178..1761498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1761736..1762560 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643833.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1762562..1763929 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1763929..1764750 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377829.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene yidA CDS complement(1764828..1765565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1765735..1766724) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643830.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(1766799..1768166) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475681.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene glmU CDS complement(1768170..1769015) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene purR CDS complement(1769282..1770079) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646500.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1770079..1770750) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1770758..1771669) product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476452.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1772103..1772954) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643828.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene ispE CDS complement(1773139..1773381) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642020.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1773472..1774365) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475602.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene rsmA CDS complement(1774358..1774924) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene rnmV CDS complement(1774921..1775730) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004468999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1775732..1777759) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene metG CDS complement(1777837..1778685) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475713.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 1778955..1779080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1779135..1779833) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646490.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1779839..1780798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(1780791..1782053) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(1782046..1782984) product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1783132..1784154) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567794.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene trpS CDS 1784432..1785391 product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene yhdJ CDS complement(1785443..1785886) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene ndk CDS complement(1785974..1788292) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101002.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene helD CDS complement(1788305..1789474) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100995.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 tRNA complement(1789644..1789717) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 CDS complement(1789757..1790560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 note possible pseudo, frameshifted CDS complement(1790557..1791117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 note possible pseudo, frameshifted CDS complement(1791080..1792552) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 1792850..1793491 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706145.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene nth CDS 1793503..1793793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1793875..1795071) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641027.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1795186..1796472) product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102866030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1796739..1797671) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644197.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 1798195..1799046 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 1799059..1800123 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1800116..1800805 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475541.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 1800824..1801969 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475542.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 1802316..1803653 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254446.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1803805..1804233) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene msrB CDS complement(1804305..1804943) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964785.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1804936..1805706) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1805681..1806331) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1806413..1807312) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964783.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 1807462..1807917 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641849.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 1807920..1808774 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102090.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 1808809..1808940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(1808990..1810180) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene deoB CDS 1810284..1812092 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1812550..1813284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(1813342..1814472) product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(1814652..1815356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1815466..1815786) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129544.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 1816073..1817428 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(1817722..1817841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(1817903..1820752) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254017.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(1820773..1821273) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(1821273..1822226) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 tRNA complement(1822371..1822446) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 CDS complement(1822502..1823272) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene tpiA CDS 1823404..1823805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 1823817..1824359 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707037.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(1824711..1824899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 1824978..1825382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 note possible pseudo, frameshifted CDS 1825364..1826002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 note possible pseudo, frameshifted CDS 1826333..1827751 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476054.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene nhaC CDS 1827897..1828130 product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(1828196..1828846) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547411.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(1828925..1829152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 1829260..1830000 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1830164..1831489) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389418.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(1832214..1832783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 1832925..1833890 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311774.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 1834010..1834201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 1834322..1834810 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101438.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene moaC CDS complement(1834861..1835199) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101428.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1835202..1836200) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101426.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene moaA CDS 1836578..1837708 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1837723..1838184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(1838252..1838608) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585300.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene tnpB CDS complement(1838598..1838786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1838926..1839114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 1839104..1839460 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748777.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene tnpB CDS 1839532..1841076 product IS66-like element short variant transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921814.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(1841249..1851058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1851183..1851341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 1851534..1851902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1852352..1852648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1852648..1853280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1853282..1854481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(1854450..1855040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 tRNA complement(1855779..1855853) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 rRNA complement(1855938..1856049) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 rRNA complement(1856134..1859052) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 rRNA complement(1859258..1860830) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 CDS complement(1861372..1862622) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701368.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene tyrS CDS complement(1863146..1864195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(1864363..1865049) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642405.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(1865145..1866404) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548355.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene purD CDS complement(1866420..1867958) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548356.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene purH CDS complement(1867962..1868534) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548358.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene purN CDS complement(1868544..1869581) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700044.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene purM CDS complement(1869586..1871040) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene purF CDS complement(1871016..1873244) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene purL CDS complement(1873248..1873928) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475857.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene purQ CDS complement(1873929..1874177) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700038.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene purS CDS complement(1874178..1874897) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1875120..1876415) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475797.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene purB CDS complement(1876487..1877611) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254497.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene purK CDS complement(1877604..1878089) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548377.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene purE CDS complement(1878271..1878987) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101638.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene budA CDS complement(1879004..1880683) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene alsS CDS complement(1880877..1882538) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548380.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(1882707..1883750) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549287.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 1883922..1885097 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 1885355..1886017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 1886094..1886735 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene pgmB CDS complement(1886807..1887448) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475979.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene pyrE CDS complement(1887445..1888176) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288882.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene pyrF CDS complement(1888173..1889099) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1889099..1890391) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288875.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1890405..1891334) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101888.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1891679..1892551) product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene gltC CDS complement(1892715..1893173) product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475483.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene tnpA CDS complement(1893416..1893760) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701691.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1893763..1894671) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563843.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1894807..1895946) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475582.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(1895978..1896667) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642424.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(1896847..1897989) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(1898073..1899005) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227124.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene deoR CDS complement(1899114..1899824) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene deoD CDS complement(1899845..1901143) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485262.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(1901172..1902365) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(1902418..1903092) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563099.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene deoC CDS complement(1903307..1904077) product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642428.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(1904110..1905207) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642429.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene ychF CDS complement(1905291..1905488) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(1905502..1906386) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642430.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(1906373..1907143) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(1907156..1908124) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642432.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene noc CDS complement(1908142..1908867) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene rsmG CDS complement(1909044..1909928) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702512.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1910031..1910939) product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene rihC CDS complement(1911020..1912231) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1913183..1914532) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(1914492..1914641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1914836..1915579) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699922.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(1915581..1917044) product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(1917311..1918618) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene serS CDS complement(1919101..1919952) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156093518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(1919949..1920662) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035148028.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(1920762..1921781) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254513.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 1921995..1922531 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene hpt CDS 1922662..1923339 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 1923359..1923637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 note possible pseudo, frameshifted CDS 1923585..1923992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 note possible pseudo, frameshifted CDS complement(1924092..1924238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(1924285..1924938) product glucose-6-phosphate 1-dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289292.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(1925035..1925358) product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene azlD CDS complement(1925345..1926037) product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene azlC CDS 1926143..1927543 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774250.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(1927585..1929156) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(1929655..1929795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(1929799..1930662) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(1930813..1931307) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040531169.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(1931345..1931950) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641616.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene lepB CDS complement(1932243..1933487) product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475459.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(1933505..1935055) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475458.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(1935196..1937115) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene asnB CDS complement(1937314..1939257) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102289.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene mnmG CDS complement(1939269..1940657) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641622.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene mnmE CDS complement(1940814..1941581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(1941677..1942510) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641627.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene yidC CDS complement(1942514..1942867) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640224.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene rnpA CDS complement(1943006..1943140) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene rpmH sequence2 source 1..138515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 1437..2177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 2355..3077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 3225..3491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 3729..3899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 3912..4688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 4678..4884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 5252..6682 product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399591.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 6698..8272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 8287..10002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 10033..10473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 10498..11481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 11551..12114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 12140..12598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 12595..13653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 13657..14220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 14233..15036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 15060..16166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 16319..23452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 23464..23778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 23771..23983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 24005..24283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 24400..24666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 24680..24949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 25040..25642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 25749..26273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 26286..27314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 27414..36485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 36591..37112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 37197..38828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 38847..39887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 39900..41996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 42044..42778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 42789..43178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 43193..44548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 44562..45245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 45386..46657 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774154.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 47308..48438 product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 48525..48656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 48668..49171 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241750.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 49361..50410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 50407..51591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 51602..54880 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 55015..55452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 55456..56820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 56973..57464 product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 57472..57753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 57722..58045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 58175..58645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 58666..58935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 58957..59100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 59090..59374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 59367..59645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 59638..59844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 59855..60226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 60242..60409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 60425..60829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 60844..61995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 61988..62350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 62387..62977 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994966.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 63030..63623 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843471.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 64479..65072 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 65083..65337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 65711..66148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 66163..66552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 66723..69608 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 70865..71788 product IS30-like element ISLpl1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003561810.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 71927..73303 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379815.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 73415..73708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 74043..74393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 note possible pseudo, frameshifted CDS 74390..75238 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156093518.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(75371..75733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 75831..76004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(76923..78860) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 78995..79567 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963525.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 79834..80196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(80348..81286) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804173.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(81630..82001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(81991..82131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(82121..82489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(82538..84430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(84411..85703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(85705..88695) product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(88699..90789) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910350.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(90824..91033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(91166..91381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(91523..91771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(91768..91944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(91956..92096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(92098..92373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(92385..92603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(92636..93112) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(93153..93305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(93380..93577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(93567..93905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(93935..94120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(94135..94920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(94913..95272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(95275..95799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(95816..96052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(96052..96393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(96393..97064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(97168..97362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(97365..97682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(97689..98105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(98105..98635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(98635..99420) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701006.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(99444..100394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 tmRNA complement(100819..101193) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00020 tRNA complement(101255..101328) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(101682..101758) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(102030..102101) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(102296..102371) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 CDS complement(102753..102938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 tRNA complement(103701..103785) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA complement(104392..104468) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 CDS complement(104641..104883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(104864..105127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(105127..105384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(105430..106233) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287078.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene pnuC CDS complement(106238..106393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(106393..107202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(107186..107386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(107395..107730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(107714..109978) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966138.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(109978..110292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(110270..110842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(110951..112438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(112452..112733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(112733..113341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(113341..114630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(114670..115638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(115678..116826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(116813..117421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(117411..117989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(118144..119427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(119551..120594) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene xerD CDS complement(120845..121192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(121402..121767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(122036..122449) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289716.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(122451..122696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(122976..123263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(123305..123541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(123682..123903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(123933..124415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(124435..124608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(124624..124890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(124922..125131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(125137..125319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(125345..126202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(126265..126537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(126560..126826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(126884..127177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(127253..127507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(127584..127865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(127892..128431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(128488..128760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(128799..129134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(129163..129318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(129345..129500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(129521..130045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(130119..130322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(131248..131475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 131649..131813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(132734..133054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(134677..135018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(135031..136239) product ParM/StbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(136504..136848) product DUF5388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476548.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(136848..137663) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 sequence3 source 1..9093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 25..2730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 2918..3172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 3563..3925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 3912..5282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 5312..5794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 5807..8272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 repeat_region 8581..8758 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtaggtctgtgttcagccctacggccacaag