COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..62327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1641..3095 product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 3076..4041 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(4082..5356) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(5356..6528) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151960.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(6691..7140) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001856267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(7142..7900) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392880.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(7987..9873) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene pknB CDS complement(9870..10607) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(10623..11939) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049552196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene rsmB CDS complement(11929..12864) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene fmt CDS complement(12876..15266) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(15351..15665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(15690..16316) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene gmk CDS complement(16453..18066) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404940.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(18283..19380) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(19395..19793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(19797..20537) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(20544..20978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(21074..21427) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene rsfS CDS complement(21428..22021) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene yqeK CDS complement(22021..22650) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963718.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(22700..23011) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060169.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene yhbY CDS complement(23221..24327) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391188.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene yqeH CDS complement(24330..24857) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(24874..25779) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(25831..26397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 26628..27596 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(27651..27905) product DUF3165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262800.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(27925..29766) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061563670.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene typA CDS 29928..30653 product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(30707..30919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(31005..31385) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(31391..31615) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(31674..32135) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(32113..32886) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(32876..33625) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199179.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene truA CDS complement(33711..34196) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770492.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(34868..35650) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127036.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene trpA CDS complement(35643..36866) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331302.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene trpB CDS complement(36844..37443) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169895.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(37430..38197) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene trpC CDS complement(38194..39198) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene trpD CDS complement(39209..39775) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601934.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(39772..41133) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene trpE CDS complement(41749..42927) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene trpB CDS complement(43380..44606) product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134519.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(44646..45338) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922203.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(45445..47187) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(47177..48922) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 49185..50012 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767454.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 50023..50409 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(50472..50876) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651198.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(50946..52427) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176978.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(52446..53624) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 53793..54794 product DNA-binding transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene galR CDS complement(55007..56050) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833731.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(56124..57026) product cation diffusion facilitator family transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645093.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene czcD CDS 57159..57710 product TetR/AcrR family transcriptional regulator SczA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene sczA CDS complement(57856..59376) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836843.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(59369..60109) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(60269..61417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 tRNA complement(61530..61617) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(61623..61698) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(61731..61801) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(61820..61894) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(61899..61972) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(61987..62076) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(62086..62161) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(62173..62248) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(62252..62327) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 sequence02 source 1..22726 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1002..1307) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590549.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(1349..1825) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521980.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(2009..2620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(2711..4534) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047207.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene lepA CDS complement(4616..5344) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133353.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(5345..7012) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923570.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene recN CDS complement(7019..7450) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034404.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(7443..8258) product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041048.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(8251..9126) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743809.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(9123..9335) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043230.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(9313..10653) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene xseA CDS complement(10831..12135) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene eno CDS 12299..12742 product DUF1694 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(12745..13854) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706392.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(13873..14514) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084504.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene serB CDS complement(14577..16010) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697284.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene glgA CDS complement(16007..17146) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687025.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene glgD CDS complement(17136..18278) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(18268..20196) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene glgB CDS complement(20604..22721) product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene pulA sequence03 source 1..4030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(366..2294) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene ligA CDS complement(2418..3677) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 sequence04 source 1..4461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002382226.1:SpaA isopeptide-forming pilin-related protein locus_tag LOCUS_00840 CDS 832..1539 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864623.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 sequence05 source 1..15710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(403..798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(785..1483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(1486..1785) product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014540.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(1791..2192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727547.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(2457..3080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(3190..3576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 4559..5569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 5971..7326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 7466..7726 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 7794..9011 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205010568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(9122..9514) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene rpsI CDS complement(9533..9979) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044624.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene rplM CDS complement(10138..10845) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055251.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(10968..11579) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857991.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(11566..12939) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778743.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(12993..14036) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(14203..14799) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene recR misc_feature complement(14810..>15710) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012972469.1:penicillin-binding protein 2B locus_tag LOCUS_01030 sequence06 source 1..13156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..986 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000382718.1:DNA/RNA non-specific endonuclease locus_tag LOCUS_01040 CDS 996..1460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 1450..1893 product DUF600 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657445.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 2453..2755 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918605.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 2813..6082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 6165..6545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 6676..6918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 6933..8081 product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136613.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene essB CDS 8091..12467 product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549287.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene essC CDS 12479..12808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 sequence07 source 1..7008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1195..3642) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331160.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(3626..3856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(4107..4604) product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342539.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(4721..4942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 5122..6369 product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 sequence08 source 1..3178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 385..1068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 1068..1385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 1394..2077 product enhanced serine sensitivity protein SseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595838.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 2104..2253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 sequence09 source 1..40760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(329..2116) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196523.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 2439..3155 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 3426..7295 product LPXTG-anchored beta-N-acetylhexosaminidase StrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene strH CDS complement(7448..8746) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972422.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene purB CDS complement(8760..9626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(9772..10011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(10054..10221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(10391..11068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(11078..12169) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099011.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene purK CDS complement(12156..12647) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene purE CDS complement(12838..14100) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene purD CDS complement(14221..15768) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166538.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene purH CDS complement(15784..16329) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene purN CDS complement(16326..17348) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182582.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene purM CDS complement(17385..18827) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene purF CDS complement(18987..22712) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361183.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(22768..23475) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(23637..24554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(24567..26720) product peptide cleavage/export ABC transporter ComA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene comA CDS complement(26962..27198) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136448.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(27209..28201) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene plsX CDS complement(28198..28968) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616166.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene recO CDS complement(28965..30134) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366378.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 30289..31299 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009146.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(31328..31765) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076491.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(31883..32851) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010168.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(33067..33561) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119799.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(33723..34418) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(34490..35752) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075213698.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene radA CDS complement(35894..36385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(36402..36968) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691249.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(36943..37386) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(37571..38038) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene tadA CDS complement(38238..39524) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 tRNA complement(40202..40275) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 rRNA complement(40284..40393) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence10 source 1..32869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(519..1250) product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene cps4B CDS complement(1252..2700) product capsular polysaccharide biosynthesis protein Cps4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091050.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene cps4A CDS complement(2896..4854) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(5016..6983) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837407.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(7152..8762) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 8912..10396 product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743581.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 10554..12029 product M protein trans-acting positive regulator PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(12108..12635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(12740..14548) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334246.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene glmS CDS complement(14822..15622) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(15723..16016) product DUF5960 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196993.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(16009..16371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(16368..17783) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540278.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(17787..18473) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(18631..19221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(19501..20076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(20608..20778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(21008..21391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898159.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(21970..22557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(22601..24523) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(24505..26538) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(26774..27349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(28101..28718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(28723..29337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(29348..30985) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(30975..31334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(31331..31609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(32107..32766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 sequence11 source 1..2688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 737..1357 product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 1495..2115 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 sequence12 source 1..184265 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 678..1007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 1251..2810 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(2852..3751) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene htpX CDS complement(3753..4313) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 4408..5121 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene rsmG CDS 5587..6870 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208912133.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(6913..7671) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023916573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(7785..8696) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071680.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(8706..9638) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(9635..10360) product CppA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102228.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(10509..11327) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(11381..13567) product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974074.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 13759..14706 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 14690..15247 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045606009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 15240..15494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 15506..17560 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 17600..18463 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233700.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(18691..19632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184231.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(19646..20896) product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392212.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 21611..23296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(23333..23647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734653.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 23692..23895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(23858..24727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 tRNA complement(25023..25095) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(25191..25976) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(25978..26796) product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(26798..27790) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240801.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(28106..28651) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066185.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(28702..29649) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698052.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(29788..29994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(30009..30353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(30377..30616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 30896..31357 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(31491..32372) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(32520..33839) product sensor histidine kinase VncS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene vncS CDS complement(33836..34492) product response regulator transcription factor VncR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697960.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene vncR CDS complement(34563..35942) product ABC transporter permease subunit Vex3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene vex3 CDS complement(35990..36637) product ABC transporter ATP-binding subunit Vex2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene vex2 CDS complement(36651..37928) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 tRNA complement(38063..38148) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(38226..38801) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158722.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(38801..39589) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene codY CDS complement(39863..41437) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 41777..43093 product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 43181..44524 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770026.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 44524..45306 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263194.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 45421..46503 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040927.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(46549..47034) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(47394..48218) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058036.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene nadE CDS complement(48215..49675) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283131.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(49783..50271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797184.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(50261..50470) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(50620..51030) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(51129..52502) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070842508.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(52585..53067) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818760.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene greA CDS complement(53142..54809) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene mltG CDS complement(54892..55386) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702238.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(55383..55898) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(55907..57241) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene murC CDS complement(57253..57846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808215.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(57893..60991) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(61083..62249) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(62254..63348) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(63495..65453) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748895.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(65653..67275) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064185.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 67381..68826 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(68868..69515) product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(69499..70011) product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(70084..71019) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036043.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(71104..71388) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349600.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(71378..72127) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390783.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(72177..72539) product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689605.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(72541..73941) product bifunctional Cof-type HAD-IIB family hydrolase/peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339039.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(74022..74540) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365476.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(74658..74897) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068664.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene rpsR CDS complement(74929..75399) product single-stranded DNA-binding protein SsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene ssbA CDS complement(75411..75701) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene rpsF CDS complement(75831..76487) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(76802..77512) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062202.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(77512..78276) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(78276..79232) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(79236..80105) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941421.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(80221..81381) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(81469..81738) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462119.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(81814..82404) product ATP-dependent Clp protease proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene clpP CDS complement(82565..83215) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene upp CDS complement(83284..83751) product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(83770..84327) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004134.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 84452..85297 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 85354..86532 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 86547..87092 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400054.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 87103..87558 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001861299.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(87679..88419) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 88668..90008 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120718877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(90052..90996) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene manA CDS complement(91147..91725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(91873..92220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(92280..94055) product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene spxB CDS complement(94387..96609) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134998.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(96619..96990) product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935061.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(97001..97396) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167198.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(97814..98245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(98273..99178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 99212..99502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(99711..100343) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170919.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene pyrE CDS complement(100374..101075) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206713.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene pyrF CDS complement(101283..102548) product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene divIB CDS complement(102558..103616) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724838.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(103618..104970) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863054.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene murD CDS complement(105231..112154) product LPXTG-anchored adhesin/beta-galactosidase BgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515226.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene bgaA repeat_region 105415..105797 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tattctggaacttcgttcaccgctgc CDS complement(112452..114200) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(114446..114640) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(114647..114976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(115231..115818) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681651.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(115863..116930) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681626.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(117120..117875) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142136.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(117896..118825) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354338.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rnz CDS complement(118840..119463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(119456..120694) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567353.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene hflX CDS complement(120687..121571) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene miaA CDS 121694..121864 product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051780.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(121909..122748) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(122802..123236) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(123334..124293) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224290.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(124342..124959) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766564.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(124960..126681) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554830.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene pabB CDS complement(126754..127869) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene msrB CDS complement(127879..128439) product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(128598..133166) product ZmpA/ZmpB/ZmpC family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 note possible pseudo, internal stop codon, frameshifted CDS complement(133249..134109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 note possible pseudo, internal stop codon, frameshifted CDS complement(134111..134674) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(134826..135503) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene mecA CDS complement(135829..138198) product phosphorylcholine esterase CbpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727870.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene cbpE CDS complement(138299..139105) product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(139120..140601) product type IV teichoic acid flippase TacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene tacF CDS complement(141191..142225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(142225..143682) product O-antigen polysaccharide polymerase Wzy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(143712..144731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(144744..145847) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225909.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(145855..146820) product (galactosaminyl)2-N,N'-diacetylbacillosaminyl-alpha1-diphospho-di-trans,octa-cis-undecaprenol synthase PglE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene pglE CDS complement(146820..148031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(148128..148493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(148636..149964) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032335.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(149961..150809) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686443.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene pheA CDS complement(150806..151282) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151377.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(151275..152558) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene aroA CDS complement(152648..152986) product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(153038..153643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(153655..154758) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(154768..155934) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene aroC CDS complement(155944..157011) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702164.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene aroB CDS complement(157030..157884) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(157874..158551) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767783.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene aroD CDS complement(158548..159711) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 159972..161423 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(161470..162144) product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(162153..163097) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122725.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene metA CDS complement(163289..163801) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897341.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(164491..166404) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(166401..167600) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(167597..168364) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene dapB CDS complement(168627..169475) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762183.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(169480..169854) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(169921..171270) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene glmM CDS complement(171303..172082) product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(172069..172851) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011063.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene cdaA CDS 173059..174027 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(174059..174970) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011281.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene whiA CDS complement(174967..175944) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(175941..176831) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene rapZ CDS complement(176883..177263) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(177273..177860) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422605.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene yihA CDS complement(177869..179077) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972566.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene clpX CDS complement(179133..179303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442260.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(179303..179809) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162455.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(179937..180455) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014017309.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(180605..182386) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836926.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(182397..184133) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836925.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 sequence13 source 1..8628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(299..937) product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 1467..2063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749552.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 2066..2290 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041098.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 2664..3470 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 3504..3743 product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897142.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(3805..5346) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(5823..6908) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene rlmN CDS complement(6925..7458) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(7622..8527) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348097.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 sequence14 source 1..8937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(319..1110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(1103..1288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 1631..2170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 2229..2759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(3268..3750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(3898..5475) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(5476..5940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(5940..6116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(6130..7854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 sequence15 source 1..6950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..1279) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(1292..2032) product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(2054..2878) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(3014..4228) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200061.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene thiI CDS complement(4237..5379) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 5516..5917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045611899.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 misc_feature complement(6062..>6950) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002875186.1:sialidase domain-containing protein locus_tag LOCUS_03870 sequence16 source 1..32849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(493..1476) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931141.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(1659..2954) product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174705273.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(2941..4848) product McrB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(5000..5779) product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160516.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(5813..6400) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene leuD CDS complement(6410..7792) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene leuC CDS complement(7796..8065) product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762428.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(8062..9099) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162527.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene leuB CDS complement(9111..10673) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(10984..11640) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461591.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(11684..12316) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(12409..12768) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237219.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(12877..14964) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179617.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene topA CDS complement(15084..15947) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene dprA CDS complement(16051..16986) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121621.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene dapA CDS complement(17239..18315) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(18471..19217) product sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078846.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene srtA CDS complement(19217..21685) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene gyrA CDS 21880..22866 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895436.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(22930..23493) product thiol-disulfide oxidoreductase-associated lipoprotein SdbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757386.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene sdbB CDS complement(23506..24213) product thiol-disulfide oxidoreductase-associated membrane protein CcdA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447993.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene ccdA2 CDS complement(24341..25201) product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(25217..26494) product CBS-HotDog domain-containing transcription factor SpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene spxR CDS complement(26487..27038) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(27056..28315) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(28529..28822) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene rpmA CDS complement(28839..29183) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613699.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(29199..29513) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene rplU CDS complement(29783..30478) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 30625..31602 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915911.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 31599..32681 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850585.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 sequence17 source 1..46801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1442..1855) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(1848..2285) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737446.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(2334..2663) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069051.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene yajC CDS complement(2780..4756) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067891.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene tkt CDS complement(4875..5495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932649.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(5547..6503) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(6518..7315) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538333.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(7308..7742) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene rnpA CDS complement(7991..9328) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354889.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(9338..9604) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644124.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(9868..10254) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene rplQ CDS complement(10266..11201) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568988.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(11245..11628) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene rpsK CDS complement(11646..12011) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090781.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene rpsM CDS complement(12170..12388) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029883.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene infA CDS complement(12506..13144) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(13300..14610) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465403.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene secY CDS complement(14623..15063) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766087.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene rplO CDS complement(15209..15391) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057241.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene rpmD CDS complement(15405..15899) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene rpsE CDS complement(15917..16273) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene rplR CDS complement(16357..16893) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene rplF CDS complement(17081..17479) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene rpsH CDS complement(17653..17838) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085697.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(17856..18398) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013542.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene rplE CDS complement(18422..18727) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene rplX CDS complement(18800..19168) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616545.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene rplN CDS complement(19194..19454) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440801.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rpsQ CDS complement(19479..19685) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene rpmC CDS complement(19695..20108) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960948.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene rplP CDS complement(20112..20765) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene rpsC CDS complement(20778..21122) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene rplV CDS complement(21134..21415) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533766.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene rpsS CDS complement(21518..22351) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512911.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene rplB CDS complement(22369..22665) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(22665..23288) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene rplD CDS complement(23313..23939) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rplC CDS complement(24022..24330) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene rpsJ CDS complement(24596..25219) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(25216..25812) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064217.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene nrdG CDS complement(25818..26324) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(26334..26834) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423414.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(26872..27012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(27024..29237) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560899.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene nrdD CDS complement(29357..30910) product damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118112.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(30955..31089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(31177..33093) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene mnmG CDS complement(33102..33557) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(33699..34820) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene mnmA CDS 35110..35928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 36287..36559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(36581..37207) product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 37448..38119 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838912.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene sdaAB CDS 38128..39000 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500038.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene sdaAA CDS 39024..39653 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200879.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(39730..40089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(40163..40627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(40779..41138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(41296..43146) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035701.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(43225..44055) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890771.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 44274..45440 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744880.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 45580..45906 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273864.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 45893..46486 product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 sequence18 source 1..3526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..799 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001233696.1:DUF4097 domain-containing protein locus_tag LOCUS_04820 CDS 848..1861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(1966..2826) product DUF4299 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 misc_feature complement(2950..>3526) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001030024.1:rhodanese-related sulfurtransferase locus_tag LOCUS_04850 sequence19 source 1..89387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1085 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000804748.1:membrane protein locus_tag LOCUS_04860 CDS 1082..2083 product bifunctional lysozyme/C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769868.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 2080..3012 product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224318.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 3389..5308 product tetracycline resistance ribosomal protection protein Tet(M) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene tet(M) CDS complement(5654..6007) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 6512..6934 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804885.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 6931..7161 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 7622..7825 product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 7907..9124 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(9308..9940) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(10113..10412) product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(10476..10925) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013084.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(11015..13264) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000882502.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(13505..13735) product DUF1797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 14052..14624 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 14624..15358 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140955.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 15491..16348 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192079.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 16585..23844 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140834635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 23974..24822 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864675.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(24845..25030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 25176..27602 product bifunctional DnaQ family exonuclease/ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848689.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 27636..28859 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830650.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 28870..29418 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 29520..30092 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001809365.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 30107..32053 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134035.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene gyrB CDS 32134..33861 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064821.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene ezrA CDS 34064..35371 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361602.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 35579..36136 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene infC CDS 36170..36370 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene rpmI CDS 36420..36779 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124836.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene rplT CDS 36836..37216 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 37426..37860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 38018..41119 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561518.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 41200..42207 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820847.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene pfkA CDS 42273..43778 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene pyk tRNA complement(44090..44162) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(44269..45018) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500205.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 45138..47486 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 47642..48265 product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 48252..49049 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881151.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 49066..50160 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049552700.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 50267..51286 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156530.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene galE CDS complement(51536..51739) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 51785..52276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 52285..52956 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene cmk CDS 53095..53433 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 53436..54068 product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 54080..55081 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene pdxS CDS 55082..55654 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689943.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene pdxT CDS complement(55689..56336) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(56326..56781) product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 56913..57416 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405836.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 57430..57921 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170334.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 57934..58290 product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 58447..59247 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103449.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 59247..59990 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590982.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 60070..60294 product DUF4059 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 60360..61271 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene trxB CDS complement(61451..62212) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene rlmB CDS complement(62224..62835) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene def CDS 62983..64299 product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140834638.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 64293..65150 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152854.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 65152..65787 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 tmRNA 65848..66192 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 66501..67835 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100445.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 tRNA complement(67914..68003) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 68164..68904 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 68901..69812 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene pfkB CDS 69809..71764 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 71855..74188 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020902321.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 74515..80745 product SpGH101 family endo-alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032521.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 80787..81188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 sequence20 source 1..11831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..608 product Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711078.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene cadX CDS 979..1590 product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261995.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 2261..2464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 2457..3443 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 3440..4234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 4236..5021 product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 5871..6143 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268760.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene rpsP CDS 6163..6402 product RNA-binding protein KphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene kphA CDS 6546..7064 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rimM CDS 7054..7773 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686918.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene trmD CDS 7786..8124 product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196039.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(8154..8474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269557.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 8567..8782 product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075567822.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(8834..9373) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709036.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(9514..10860) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209604.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene gor sequence21 source 1..20131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 114..647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 666..1025 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 1028..1228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 1321..1524 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837579.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 2059..2418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(2995..3144) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265622.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene rpmG CDS complement(3160..3342) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290417.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene rpmF CDS 3560..5263 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene ilvD CDS complement(5373..7739) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(7991..10618) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(10608..11558) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264558.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(11738..12079) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(12196..14013) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(14148..15290) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285239.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene tgt CDS 15407..16264 product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108864.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(16475..17629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(17807..18421) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172835.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(18425..19660) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 sequence22 source 1..1922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 927..1349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 sequence23 source 1..22455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..1058) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288288.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene pflA CDS complement(1191..2444) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(2517..3317) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001809310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene purR CDS complement(3444..4385) product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703195.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(4375..5631) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020901986.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(5633..6295) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(6258..6914) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085022.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene rpe CDS complement(6925..7803) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene rsgA CDS complement(7805..8677) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216869.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene rsmA CDS complement(8708..10135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(10269..10832) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene rnmV CDS complement(10829..11605) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575607.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 11761..13605 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494369.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(13788..13922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(14067..15281) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(15753..17213) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031057.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene gltX CDS complement(17343..18692) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018268.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(18871..19560) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138350.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(19698..21464) product multidrug efflux ABC transporter subunit PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859877.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene patB CDS complement(21466..22455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 sequence24 source 1..18941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(973..2250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 2571..3560 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 3590..4402 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 4417..5328 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136858.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(5394..6728) product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene pepC CDS complement(6836..7558) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234916.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(7713..8297) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098896.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(8278..9276) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502087.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene ruvB CDS complement(9443..10297) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880500.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(10297..11160) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602886.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(11438..11860) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628392.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(11873..12565) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144931.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(12677..15178) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011806.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene leuS CDS 15416..16432 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415108.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 16454..17353 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene galU sequence25 source 1..77114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 903..1079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 1144..2106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 2242..3177 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115140.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene hprK CDS 3170..3958 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene lgt CDS 3960..4343 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 4358..4753 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 4839..5969 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170096.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene hemW CDS 5974..6711 product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 6722..7495 product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875444.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 8255..8656 product Spx/MgsR family RNA polymerase-binding regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631262.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 8657..8935 product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041974.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 8925..9692 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444045.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 9699..11012 product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 11122..11997 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020903179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 12000..12917 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070903.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene pstC CDS 12907..13791 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene pstA CDS 13802..14605 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene pstB CDS 14618..15376 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene pstB CDS 15387..16040 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene phoU CDS 16133..16600 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806807.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 16719..17534 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(17653..18981) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744842.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 19310..20038 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene budA CDS 20051..20800 product YhfC family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 20920..21825 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111588.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene murB CDS 21960..22274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 note possible pseudo, internal stop codon CDS 22275..23117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 note possible pseudo, internal stop codon CDS 23098..23904 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753801.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 23901..24674 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 24671..25741 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737955.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 repeat_region 25988..26968 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatagatacctatctacctcg repeat_region 27065..28979 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatagatacctatctacctcgagagggg repeat_region 27066..27603 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tatagctacctatctacctcg CDS 29070..29801 product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene cas6 CDS 29782..32025 product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917163.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene cas10 CDS 32026..32406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 32406..33068 product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917166.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene csm3 CDS 33070..33975 product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene csm4 CDS 33972..35048 product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene csm5 CDS 35048..36208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 36225..37514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837015.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 37812..38297 product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847054.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 38318..40936 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811741.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene alaS CDS complement(41019..42365) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135782805.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene gdhA CDS 42594..43529 product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255183.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 43562..44599 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879657.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene holA CDS 44669..45274 product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene sodA CDS 45432..46340 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025693.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 46337..46798 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene lspA CDS 46788..47681 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(47705..49270) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene ffh CDS complement(49289..49504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(49507..49839) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402071.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 49993..50691 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene rnc CDS 50682..54221 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene smc CDS 54311..54970 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 55151..55732 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(55863..56330) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 56662..57453 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 57453..58271 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 58275..59633 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene ftsY CDS complement(59957..60289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(60345..60668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(60828..61283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(61394..61537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(61810..62019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(62087..62602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(62711..63061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(63331..64002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(63995..64381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(64384..64662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(64728..65201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(65370..65600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(65646..66146) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(66208..66612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(66636..67220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(67290..67742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(68048..68416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(68440..68667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(69044..69424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(69707..70030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(70225..70614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(70929..71093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(71313..71714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(72153..72620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(72654..72878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(73020..73328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(73447..73878) product DUF4265 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206140.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(74491..75258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(75316..75702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(75948..76124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(76220..76891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 sequence26 source 1..81767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..790 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811475.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 792..2051 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 2044..4182 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene metG CDS 4267..5517 product DUF6287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 5563..6489 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269437.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 6582..6818 product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002874474.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 6811..7509 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 7546..7881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 7900..8319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 8338..8676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 8719..9108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 9152..9559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 9556..10116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 10148..10663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 10665..11291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 11366..11755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 11920..12633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 12647..13087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 13186..13470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 13525..14088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 14116..14811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 14973..15713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 15797..16195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 16284..17213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 17297..17683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 17756..18076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 18086..18673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 18860..19168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 19440..19799 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 19864..20460 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 20475..21026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 21086..21271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 21343..21843 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 21821..22723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 22665..23105 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045611364.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 23228..25774 product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149118.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 25890..26561 product two-component system response regulator CiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590640.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene ciaR CDS 26554..27888 product two-component system sensor histidine kinase CiaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene ciaH CDS complement(27915..28190) product DUF3270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894977.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 28560..29615 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900595.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 29629..30309 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 30420..31349 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 31454..32137 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429264.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene rpiA CDS 32160..33371 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 33373..33915 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199111.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 33931..34740 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 34812..36023 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972498.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 36439..37149 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene deoD CDS complement(37241..37753) product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684205.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(37819..38052) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene rpsT CDS complement(38120..39040) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene coaA CDS 39164..39442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 39509..40090 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061759014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 40087..41370 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202961.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 41388..42050 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene deoC CDS 42037..42426 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 42517..43572 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 43713..45248 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929819.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 45241..46299 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770055.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 46302..47258 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029122.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(47288..48043) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene plsY CDS 48146..48787 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 48798..49427 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 49437..50279 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 50426..52375 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037256.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene parE CDS 52372..52995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 53128..53535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 53585..54127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 54117..54944 product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 54995..56164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 56732..59173 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene parC CDS 59303..60325 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 60347..62314 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837407.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 62349..63038 product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454809.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 63035..63958 product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 63972..64616 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene pcp CDS 64741..64971 product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 tRNA 65021..65101 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 65111..65182 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 65197..65282 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(65356..66489) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(66493..66687) product DUF3173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562210.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(66747..67133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(67136..68305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(68373..68846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 69167..69613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 69972..70235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 70283..70948 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355232.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 72551..72748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 73359..74510 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134457.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene nagA CDS 74651..75709 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 75845..76222 product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286392.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 76275..77216 product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249564.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene comGA CDS 77332..78180 product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene comGB CDS 78181..78501 product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738641.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene comGC CDS 78512..78898 product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044012294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene comGD CDS 78861..79163 product competence type IV pilus minor pilin ComGE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene comGE CDS 79126..79587 product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene comGF CDS 79565..80002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 80061..80762 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 sequence27 source 1..46743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(211..969) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene tpiA CDS complement(1087..2454) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042750245.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene rlmD CDS 2540..3286 product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837397.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 3297..4073 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene recX CDS 4161..4694 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(4773..5540) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567572.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(5608..6807) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837095.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(7032..8375) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene asnS CDS complement(8525..9703) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(9700..10074) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747248.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 10457..11005 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(11048..12238) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 12450..13385 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene birA CDS complement(13445..14635) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167757.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(14686..15639) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345096.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(15736..17343) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(17613..18188) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene rpoE CDS complement(18762..19139) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001813593.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 19212..20516 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 20529..21335 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023518.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene yidA CDS complement(21410..21883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(21930..22838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(22896..23567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836771.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(23638..24312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836770.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(24394..24912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836771.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(25160..25819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836771.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 tRNA complement(25934..26005) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(26049..26396) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene rplS CDS complement(26515..26844) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene crcB CDS complement(26838..27212) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712093.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene crcB CDS complement(27209..27475) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362491.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(27590..28033) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 28137..29075 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401775.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 29168..29410 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710764.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(29610..29885) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(29993..30829) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161407.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(31000..32232) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(32222..33385) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 33573..34586 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665633.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(34629..35048) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068046.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(35059..36465) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene atpD CDS complement(36657..37535) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301214.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(37551..39056) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996630.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene atpA CDS complement(39071..39607) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359036.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(39607..40101) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene atpF CDS complement(40120..40836) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896002.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene atpB CDS complement(40869..41069) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054559.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(41299..41610) product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983189.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(41624..42910) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169063.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(43033..44619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(45227..45868) product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(45934..46503) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443760.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 sequence28 source 1..2055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 497..907 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 1136..1477 product type II toxin-antitoxin system antitoxin YxxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244256.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene yxxD sequence29 source 1..2290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(254..886) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001841142.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(873..1670) product tyrosine-type DNA invertase PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651183.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene psrA misc_feature complement(1727..>2290) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764674.1:restriction endonuclease subunit S locus_tag LOCUS_08650 sequence30 source 1..1735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(406..>1735) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000950133.1:glycogen/starch/alpha-glucan family phosphorylase locus_tag LOCUS_08660 sequence31 source 1..2164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1251..1727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 sequence32 source 1..23863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(285..356) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(466..1002) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene nusG CDS complement(1052..1228) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene secE CDS complement(1238..1390) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001809375.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene rpmG CDS complement(1511..2203) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900876.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(2335..2703) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101080.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(2805..5597) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene ileS CDS complement(5853..6659) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123190.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(6676..6930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(6939..7724) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(7721..7981) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(7981..8529) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053356.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(8539..9210) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049394.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(9216..10469) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144280.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene ftsZ CDS complement(10486..11853) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090383.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene ftsA CDS complement(12248..13303) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(13319..14416) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene glf CDS complement(14428..15840) product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(16029..16499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(17201..18166) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(18166..19260) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene wecB CDS complement(19257..20342) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(20317..21057) product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene vpsK CDS complement(21059..21844) product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455037.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(21849..23219) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936357.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 misc_feature complement(23243..>23863) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775429.1:tyrosine-protein kinase locus_tag LOCUS_08920 sequence33 source 1..10806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 545..1066 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850021.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene pyrR CDS 1084..2007 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 2057..3136 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166701.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 3584..6760 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene carB sequence34 source 1..3367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(131..406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(655..1344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 1384..1527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(1611..1910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 2026..2319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(2323..3105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(3146..3367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 sequence35 source 1..134816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..1274) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493179.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(1278..1958) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615312.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(1955..2530) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(2752..2880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(2985..4184) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245373.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(4181..5074) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(5271..7676) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961516.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene pheT CDS complement(7753..8262) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619957.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(8262..9308) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007519670.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene pheS CDS complement(9587..10303) product LD-carboxypeptidase LdcB/DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747772.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene ldcB CDS complement(10307..10777) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(10779..11816) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077252.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 11949..12485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(12524..13849) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene brnQ CDS complement(14014..14295) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(14292..14882) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078128.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(14936..16336) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene pepV CDS complement(16346..16951) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 17184..17993 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714633.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(18057..18890) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(18993..19889) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(20087..22423) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035051.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(22533..23081) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(23078..23380) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002023.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene zapA CDS 23467..24348 product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146887.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene rnhC CDS 24353..24967 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048155.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene lepB CDS 25057..27423 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(27469..28752) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene tig CDS complement(28865..29497) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698434.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(29516..30505) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(30502..31140) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene liaF CDS complement(31299..32300) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene fni CDS complement(32278..33291) product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(33278..34231) product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene mvaD CDS complement(34213..35091) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163321.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene mvk CDS complement(35214..36215) product N-acetylmuramoyl-L-alanine amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691497.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(36310..36999) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000518031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(37011..38435) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158778.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene gndA CDS complement(38512..39963) product mid-cell-anchored protein MapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039255.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene mapZ CDS complement(39956..41134) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711367.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(41617..41952) product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene gpsB CDS complement(42022..42549) product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205317.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 42617..43213 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248753.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene recU CDS 43210..45360 product penicillin-binding protein PBP1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene pbp1a CDS complement(45438..46253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 note possible pseudo, frameshifted CDS complement(46247..47419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 note possible pseudo, frameshifted CDS 47625..48107 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032547.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(48166..50268) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063353.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(50673..52988) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene pflB CDS 53192..54289 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene dinB CDS complement(54324..55169) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(55231..57123) product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(57157..57342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 57254..58819 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227315.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 58819..59559 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(59644..59859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893653.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(59965..60861) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(60944..62194) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene ilvA CDS complement(62275..63297) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene ilvC CDS complement(63465..63941) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253803.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene ilvN CDS complement(63934..65634) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(65838..66527) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894855.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene rplA CDS complement(66624..67049) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085809.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene rplK CDS complement(67281..67769) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(67741..68160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(68187..68837) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(68827..69390) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(69811..70314) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140833033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 70739..72088 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691695.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene trkA CDS 72092..73531 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 74382..75086 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(75362..76906) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025411.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(77116..77808) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836665.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(77843..78517) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836664.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 78730..79032 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705421.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene gatC CDS 79032..80498 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143702.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene gatA CDS 80498..81943 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008652.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene gatB CDS 81994..82386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 82506..82673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 82727..83422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 83432..84637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 84718..85278 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene efp CDS 85300..85689 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510575.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 85682..86104 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene nusB CDS complement(87037..87804) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(87804..88667) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173353.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene accD CDS complement(88700..90067) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488679.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene accC CDS complement(90079..90501) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene fabZ CDS complement(90498..90980) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene accB CDS complement(90983..92224) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene fabF CDS complement(92241..92975) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene fabG CDS complement(93008..93928) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene fabD CDS complement(93921..94895) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene fabK CDS complement(95012..95236) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257838.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(95295..96269) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852942.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(96269..96703) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386347.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(96796..97581) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(97691..98251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 98353..99717 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869662.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 99720..100091 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 100305..101579 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene serS CDS complement(101666..103285) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031573.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene groL CDS complement(103301..103585) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene groES CDS complement(103893..104288) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282467.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(104362..105123) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107784.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(105346..105507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(105782..106453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(106588..107238) product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(107248..107565) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(107562..107852) product DUF4651 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013971.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(108088..108342) product DUF1912 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119707.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(108352..109686) product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(109686..109919) product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(110021..110800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612809.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(110919..111269) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene rbfA CDS complement(111520..114261) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene infB CDS complement(114278..114577) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(114570..114863) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(114885..116021) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene nusA CDS complement(116063..116542) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001810863.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene rimP CDS complement(116708..117859) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(118030..118665) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene trmB CDS complement(118662..119456) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(119504..120553) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653770.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(120550..121281) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 121349..121759 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 121769..122056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 122140..122781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(122851..123987) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene dnaJ CDS complement(124268..124711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(124722..126545) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene dnaK CDS complement(126805..127320) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene grpE CDS complement(127347..128381) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene hrcA CDS complement(128544..129056) product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088694.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 129650..131983 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 131996..133459 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 133459..134526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 sequence36 source 1..17565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1437..2288 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(2402..9193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(9506..10390) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222983.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(10406..11323) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(11487..12137) product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(12157..12609) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575438.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(12866..13705) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192007.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(13722..14609) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001821805.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(14823..16142) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672121.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(16259..16957) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 sequence37 source 1..26174 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(423..1841) product MobT family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398284.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene mobT CDS complement(2019..3404) product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813488.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(3433..3819) product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(3835..4149) product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420682.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(4478..5668) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene metK CDS complement(5905..6603) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936187.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 6744..8306 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065723.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene guaA CDS 8553..9326 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 9442..11370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 11403..12086 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837285.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 12076..13059 product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436739.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 13316..13525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(13662..15041) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836899.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(15284..16627) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010998.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(16780..17475) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837223.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(17456..18466) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(18490..19245) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(19247..20293) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(20917..21186) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene rpsO CDS 21611..21766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 22024..22347 product MazG-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 22398..24341 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608336.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene thrS CDS complement(24553..25602) product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147505.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 sequence38 source 1..52527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(692..1012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(1215..1754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1879..2718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(2797..3003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(3243..3470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(3484..3654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(3597..3908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(4001..4453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(4642..4992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(5275..5715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(5782..6006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(6071..6496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(6638..6955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(7026..7193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(7335..7598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(7784..8308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 8606..8866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(8799..9002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(9227..9862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(10274..10576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(10598..11236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(11499..11981) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(12001..12408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(12590..12943) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221464.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(12933..13217) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213592.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(13693..13965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 note possible pseudo, internal stop codon, frameshifted CDS complement(14140..14388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(14570..15004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(15164..15727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(15862..16224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(16268..16957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(16954..17091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(17794..18015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(18244..18825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(18851..19012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(19068..19532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(19768..20304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(20636..20980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(21473..21865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(21988..22221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(22295..22627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(22825..23676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(23909..24340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(24355..24624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(24729..25061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(25110..25670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(25633..25986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(26151..26726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(26808..27026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(27053..27547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(27549..27887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(27884..28168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 note possible pseudo, frameshifted CDS complement(28206..28889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(29368..29772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(29803..30030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(30070..30393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(30564..31403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(31418..31906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(32091..32414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(32591..33067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(33266..33475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(33657..33929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(34032..34607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(34634..34807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(34912..35106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(35492..36025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(36336..36587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(36587..37039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(37199..37357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(37468..38043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(38269..38712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963657.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(38734..38976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(39119..39412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(39303..40781) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096129.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene zwf CDS complement(40931..41671) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096316.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(41671..43116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 43294..43920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 43910..45898 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607031.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene uvrB CDS 45913..46539 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 47801..47968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 47988..48455 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091534.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(48452..48967) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159176.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(48986..49513) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097388.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 50329..50829 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836923.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene rplJ CDS 50905..51273 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196960.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene rplL CDS 51680..52051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 sequence39 source 1..19441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2112..2522) product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390747.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(2525..2749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(2759..3754) product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010708082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(3766..4323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(4325..4558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(4573..5805) product replication initiation factor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006738730.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(6013..7701) product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(7715..8176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062569.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(8198..8494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(8529..8711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 9367..9708 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 9716..11164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 11263..12123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 12177..12818 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284674.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(13176..13538) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 13822..14577 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(14857..15369) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(15362..15550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(15728..16105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(16136..17131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(17128..18033) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 18145..18297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 18541..18873 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263453.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 sequence40 source 1..46988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 271..1176 product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617011.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1163..1984 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1988..2392 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 2507..3670 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 3684..4721 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(4764..6443) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331991.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(6445..6678) product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639589.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 7268..7951 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene tsaB CDS 7948..8385 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene rimI CDS 8375..9385 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene tsaD CDS 9547..10053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 10124..10819 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208222.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 10809..11132 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253939.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 11235..12077 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 12217..14559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 14745..15599 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694521.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 15721..17094 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231807.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 17087..18148 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085672.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 18150..18842 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(18866..19438) product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748394.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 19635..20912 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene hisS CDS 21188..27709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 27857..28984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 29609..32572 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 32736..32939 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176227.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 32939..33142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046144.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 33139..33489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 33504..34205 product DUF3169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023947597.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 34215..34856 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771241.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 34875..35090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832180.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 35228..36991 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830900.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene aspS CDS 36969..37910 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(37974..38960) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(38970..39770) product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938246.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(39976..40818) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(40820..42109) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414968.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(42233..43501) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095472.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 43919..45436 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene malQ sequence41 source 1..67011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..862 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001180963.1:penicillin-binding protein PBP1B locus_tag LOCUS_12220 CDS 872..1804 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001812545.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1868..2566 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127466.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene dapD CDS 2629..3759 product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885102.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 3763..4302 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834333.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 4286..4960 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(5034..6413) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene bglA CDS complement(6524..8377) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814057.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(8394..9650) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene rseP CDS complement(9672..10475) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189869.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(10483..11235) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 11449..11844 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038635.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 12139..12726 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813807.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 12704..13264 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124550.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 13311..16328 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080564.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 16342..18993 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032177.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 19069..21933 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126795678.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(21946..22338) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(22371..22970) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772075.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(22971..24068) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893535.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(24068..24805) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972436.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(24807..25691) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(25678..25872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708869.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(25869..26060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(26057..26248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(26389..28053) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(28056..28421) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216437.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(28574..28762) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene rpmB CDS complement(28869..29543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725708.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(29548..29994) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(30113..30616) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800927.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(30729..30872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(30856..31080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 31239..31922 product CD20-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001539.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(31967..32683) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532885.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(32781..34151) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036258.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 34260..34814 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918892.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(34859..36007) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene recA CDS complement(36062..37318) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642685.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(37395..38444) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(38449..38970) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455529.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(38960..39403) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene tsaE CDS complement(39493..40914) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359256.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 41111..41923 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(42060..42485) product SP_0198 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694264.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(42572..43822) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(44036..44341) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017620.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(44357..44767) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001808830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene ruvX CDS complement(44780..45046) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(45144..45716) product SP0191 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725123.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(45777..46175) product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene spx CDS complement(46311..48971) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858856.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene mgtA CDS complement(49476..50537) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042889.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(50530..53361) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152883.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene uvrA CDS 53504..54448 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 54460..55134 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 55335..55598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(55662..56339) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987422.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(56336..56899) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(56909..57502) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273417.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene ruvA CDS complement(57624..59573) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene mutL CDS 59863..61119 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene tyrS CDS complement(61116..61292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 61257..62021 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095514.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(62138..62527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(62537..62941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(62934..64157) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653707.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(64144..64848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(64959..65684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(65684..66391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(66445..67011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 sequence42 source 1..38639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(961..1170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1284..2630) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene glnA CDS complement(2666..3028) product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659547.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene glnR CDS complement(3105..3626) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(3746..4726) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene mraY CDS complement(4728..6983) product penicillin-binding protein PBP2X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene pbp2X CDS complement(6987..7304) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227821.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene ftsL CDS complement(7314..8264) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene rsmH CDS complement(8333..10159) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972569.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene uvrC CDS complement(10229..10930) product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267194.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(11037..11816) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290025.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(11885..13546) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065637.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(13870..14526) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188880.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(14740..16959) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612591.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene recJ CDS 17179..17757 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140224612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 17976..21713 product pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(22035..22466) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166793.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(22537..23376) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 23521..23973 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(24007..25398) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000452107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 25464..26426 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124777.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(26465..27472) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene ccpA CDS 27677..27994 product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(28023..28835) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene folK CDS complement(28874..29428) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene folE CDS complement(29432..30655) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(30732..31676) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene folP CDS complement(32081..33280) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(33435..33950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156802397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(33953..34489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156802397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 misc_feature complement(34730..>38639) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000792779.1:bacterial Ig-like domain-containing protein locus_tag LOCUS_13230 sequence43 source 1..69683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(581..2065) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(2172..3092) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818352.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(3106..4035) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032152.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(4239..6119) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(6113..6982) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927925.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(7067..9712) product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140223810.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(9899..11179) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 11352..13436 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 13864..15312 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837251.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(15430..18063) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene polA CDS complement(18128..19249) product choline binding-anchored murein hydrolase CbpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866454.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene cbpD CDS complement(19344..19610) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278167.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(19607..20965) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852486.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene dnaB CDS complement(21008..21460) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864219.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene rplI CDS complement(21457..23430) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(23583..24131) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene raiA CDS complement(24211..24873) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649974.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(24870..26078) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 26224..26859 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 27015..27941 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029885.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene cysK CDS complement(28043..29083) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808070.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene tsf CDS complement(29162..29944) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene rpsB CDS complement(30169..31377) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727024.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(31471..31716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(31962..32783) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene mreC CDS complement(32814..33608) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377893.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(33601..34440) product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510406.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(34425..35252) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835729.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(35255..35794) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712121.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene pgsA CDS complement(35806..36633) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227960.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene rodZ CDS complement(36676..37956) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170200.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(37953..39203) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424263.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 39363..39731 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455905.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene yaaA CDS 39734..40825 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266662.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene recF CDS complement(40880..42358) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene guaB CDS complement(42521..43546) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene trpS CDS 43754..45376 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(45544..48198) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 48327..48869 product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158276.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 tRNA complement(48909..48982) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(48987..49060) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(49111..49863) product competence system response regulator transcription factor ComE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866062.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene comE CDS complement(49860..51179) product competence system sensor histidine kinase ComD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362880.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene comD CDS complement(51201..51326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 tRNA complement(51491..51564) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(51606..52085) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene rlmH CDS 52271..53452 product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681606.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 53512..54273 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 54483..55844 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972409.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene dnaA CDS 56003..57139 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene dnaN CDS 57206..57400 product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285186.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 57485..58600 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218707.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene ychF CDS 58674..59243 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163929.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene pth CDS 59236..62739 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258129.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene mfd CDS 62805..63071 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234978.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 63064..63432 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 63439..63561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 63554..64822 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 64819..66096 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208977.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene tilS CDS 66101..66643 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892185.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene hpt CDS 66660..68618 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744562.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene ftsH tRNA 68783..68854 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 sequence44 source 1..206953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 455..2491 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene glyS CDS 2521..2778 product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(2859..4106) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673679.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(4124..4729) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915944.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(4764..5684) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 6003..7382 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036771.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(7441..8301) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592064.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(8364..10016) product Rqc2 family fibronectin-binding protein PavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene pavA CDS 10121..10618 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene ybeY CDS 10599..10994 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378171.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 11012..11911 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene era CDS 11960..12784 product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene mutM CDS 12784..13377 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516169.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene coaE CDS 13650..13883 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282517.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene secG CDS 14099..16441 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rnr CDS 16404..16871 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene smpB CDS 16886..17746 product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene tehB CDS 17936..19084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 19322..20278 product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495918.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 20297..22099 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene pepF CDS 22101..22814 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972506.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 22889..23878 product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727935.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene prsA CDS 24226..25302 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 25326..28151 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837193.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene ppc CDS 28596..29594 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792147.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene trpX CDS 29656..30522 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004234420.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 30519..31277 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 31545..32267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 32393..32815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 32841..33158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 33254..33391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 33382..33699 product Imm40 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234414.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene imm40 CDS 33927..34235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 34462..34893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 35074..36834 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227864.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene dnaG CDS 36837..37946 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene rpoD CDS 37963..38292 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331925.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 38393..39445 product alpha-galactosylglucosyldiacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146631.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene cpoA CDS 39454..40770 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 40797..40988 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 41018..41152 product DUF4044 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863857.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 41229..42539 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061648.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene obgE CDS 42549..42710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001808548.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(42760..45039) product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212040.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 45210..46364 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene mutY CDS 46435..47139 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene yycF CDS 47132..48481 product cell wall metabolism sensor histidine kinase VicK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593410.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene vicK CDS 48483..49292 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004959.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 49387..50160 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385631.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(50198..50545) product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(50657..52375) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 52528..54429 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584880.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 tRNA complement(54473..54546) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(54652..55032) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910203.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene mscL CDS complement(55111..55545) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742997.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 55669..56178 product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 56295..56714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 56802..57599 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254797.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 57680..58954 product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002635.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 58957..60201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 60428..60997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 61111..61290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 61271..62110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 62110..62265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 62269..62535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 62572..63030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 63232..64074 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene truB CDS 64269..64760 product chromosome segregation protein RocS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021242.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene rocS CDS 64830..65420 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 65429..67192 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(67239..67538) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 67893..68600 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 68603..69625 product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 69638..70507 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 70497..71375 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791851.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 71388..72077 product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643970.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 72326..73126 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054489.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 73137..74072 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 74122..75039 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 75231..76157 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 76165..79257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(79284..80507) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222027.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene pepT CDS 80662..81756 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709260.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene hemH CDS complement(82151..83524) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632720.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene mnmE CDS complement(83652..83834) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117401.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 83957..84541 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068144.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 84544..85623 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene prfA CDS 85623..86459 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene prmC CDS 86443..87045 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969297.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 87047..87493 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942936.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 87490..88746 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 88753..89727 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356089.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 89727..90329 product cell wall hydrolase Pmp23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476383.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene pmp23 CDS 90565..91539 product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 91614..92972 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914611.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene rlmD CDS 93087..93266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 93363..93962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 94124..94312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179769.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 94375..95139 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262039.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 95272..95955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114933.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 96256..96423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 96506..98224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 98377..98721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127478.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 98797..100080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 100134..100904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 100933..101550 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062173042.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 101964..102716 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836451.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 102805..103296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937118.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 103446..103856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 103968..104522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234983.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 104545..104844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 105400..105819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 105816..106196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 106327..106713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 106759..107640 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710115.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 107682..108203 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 108380..109264 product DUF4300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 109278..109460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 109465..109800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420551.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 109810..110616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(110649..111668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 111916..112932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 113530..114984 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 114985..115845 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene speE CDS 115842..117101 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 117101..118228 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene nspC CDS 118225..119310 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene aguA CDS 119320..120195 product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene aguB CDS 120543..120779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 120776..121189 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(121326..122141) product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(122138..123043) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(123044..123175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 123331..125460 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972513.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 125447..125896 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 125956..126228 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(126284..126979) product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 127168..128451 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 128515..129195 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286923.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene radC CDS complement(129219..129908) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743346.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(129924..130565) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653421.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(130648..130863) product DUF4649 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061759713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(130873..131220) product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863538.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(131225..132340) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(132356..133306) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283813.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(133430..133999) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 134133..134804 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 134788..135606 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799053.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 135603..136502 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209981.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 136518..137492 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene pta CDS 137641..138492 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene ylqF CDS 138479..139258 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 139274..140824 product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 142053..143123 product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene xerS CDS complement(143390..143851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 note possible pseudo, internal stop codon CDS complement(143961..144950) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873993.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(145009..146712) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162912.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene lpdA CDS complement(146752..147795) product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752705.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(148011..149003) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(149020..149988) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105362.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(150170..151510) product sodium-coupled multidrug efflux MATE transporter PdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene pdrM CDS complement(151554..152822) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924530.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(152835..153299) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135770.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(153309..153962) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(153976..154734) product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(155071..156162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(156452..157144) product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 157556..159157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 159752..161083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(161409..162821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(162835..163308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(163524..163949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934707.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(163924..164835) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(164832..165875) product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(166085..166582) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(166672..170322) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802630.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene addA CDS complement(170319..173570) product ATP-dependent nuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972512.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene rexB CDS 173687..174496 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593576.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(174545..174805) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291476.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(174935..177223) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992872.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene pcrA CDS complement(177344..178039) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(178050..178361) product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene macP CDS complement(178373..178918) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393827.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(178928..180307) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073746.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene glmU CDS 180465..181265 product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 181372..182214 product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954122.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 182214..182699 product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 182696..183319 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780836.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 183289..183486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 183455..184945 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene lysS CDS complement(185029..186699) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 186933..187619 product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699493.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene coaB CDS 187634..188185 product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene coaC CDS 188169..188732 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747408.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(188767..189405) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181374.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene udk CDS complement(189526..191259) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene ptsP CDS complement(191264..191527) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 191888..192106 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene nrdH CDS 192176..194335 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523239.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene nrdE CDS 194335..195129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 195176..196138 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451369.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene nrdF CDS 196269..197033 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917572.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(197127..197381) product DUF3884 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471579.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(197424..198902) product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene lacG CDS complement(199044..200735) product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(200735..201052) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(201087..201923) product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285709.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(202154..203134) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229114.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene lacD CDS complement(203136..204065) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604263.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(204076..204591) product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene lacB CDS complement(204620..205045) product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018897.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene lacA CDS complement(205309..206202) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234196.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 misc_feature complement(206298..>206953) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000338723.1:PTS galactitol transporter subunit IIC locus_tag LOCUS_15930 sequence45 source 1..7299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..715 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001064570.1:sucrose-specific PTS transporter subunit IIBC locus_tag LOCUS_15940 CDS 855..1742 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1785..2975) product CDF family manganese efflux transporter MntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813913.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene mntE CDS 3246..5930 product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910746.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 6034..6444 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412237.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 sequence46 source 1..4972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1340..1597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1611..2723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(2740..2964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(2966..4831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357668.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 sequence47 source 1..12708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..2125) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489378.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(2127..2885) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(3212..4186) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887976.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(4179..4856) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 4952..6028 product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273825.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 6134..6763 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070479771.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(6802..8694) product endopeptidase PepO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140223944.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene pepO CDS 8875..9597 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 9594..10442 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559786.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 10474..11403 product metal ABC transporter substrate-binding lipoprotein/adhesin PsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene psaA CDS 11525..12019 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene tpx sequence48 source 1..34495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1258..2889 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026641.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(2919..3215) product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(3240..4304) product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene pepA CDS complement(4655..5380) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222228.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(5367..5936) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105299.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene scpB CDS complement(5955..6683) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351907.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(6683..7417) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene xerD CDS complement(7414..7875) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(7872..8345) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(8369..9340) product nucleoside-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182421.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(9337..10131) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370376.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene racE CDS complement(10339..10584) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364990.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 10898..16171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(16417..16617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(16773..17699) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291304.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(17710..18777) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159554.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(18786..19712) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103704.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(19712..21208) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759913.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(21274..23253) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749702.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 tRNA 23433..23504 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(23588..24919) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390035.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(25038..25865) product DNA-entry nuclease EndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036774.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene endA CDS complement(25912..26100) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075566207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(26093..27385) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358027.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene murA CDS complement(27410..28441) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964711.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(28802..29839) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972442.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(29823..30311) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene coaD CDS complement(30301..30708) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706956.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene rsmD CDS complement(30900..31892) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747996.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene asnA CDS complement(31988..32671) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016917.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(32725..33363) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 33499..33777 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 sequence49 source 1..64163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 25..97 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 100..172 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 190..264 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 268..351 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 363..435 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 463..534 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 542..627 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 639..712 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 725..800 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 1041..2255 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837051.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 2252..3232 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837707.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 3207..4022 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899565.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 4000..5262 product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 5259..6221 product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899386.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 6393..7925 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877345.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene cls CDS 8367..8657 product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 8641..9378 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001813866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 9415..10422 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754546.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 10422..11150 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 11237..11620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 11845..12009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 12037..12330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 12667..13125 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 13132..15564 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109716.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 15814..16872 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730572.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 16882..17658 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736873.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene pnuC CDS 17660..18433 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140989.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(18631..18861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949600.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 19145..19840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730890.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(19916..20896) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183312.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene dusB CDS complement(20883..21755) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357854.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene hslO CDS 22145..23299 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426712.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene dltB CDS 23337..24509 product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene dltD CDS 25113..26663 product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene dltA CDS 26660..27904 product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969755.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene dltB CDS 27936..28175 product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene dltC CDS 28168..29436 product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene dltD CDS 29579..31651 product cell surface ecto-5'-nucleotidase Nt5e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837008.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene nt5e CDS 31790..32230 product zinc-dependent transcriptional regulator AdcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249308.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene adcR CDS 32230..32934 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269498.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 32927..33733 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 33743..35245 product zinc ABC transporter substrate-binding lipoprotein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene adcA CDS 35449..35706 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(35798..36094) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904590.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(36084..36905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(36962..37267) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294651.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 37836..41438 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907176.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene rpoB CDS 41471..45124 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene rpoC CDS 45389..49648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 note possible pseudo, internal stop codon, frameshifted CDS 49793..50680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 note possible pseudo, internal stop codon, frameshifted CDS 50827..51390 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(51419..52102) product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(52095..52871) product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 53057..54295 product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(54358..54561) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(54678..55310) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(55307..55759) product DUF3290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 55952..56716 product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614984.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 56713..58125 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897705.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 58139..58804 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 58961..61048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 61129..61533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 note possible pseudo, frameshifted CDS 61533..61826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 note possible pseudo, frameshifted CDS 61823..62857 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836930.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 63061..63672 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092756.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene rpsD tRNA 63810..63881 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 sequence50 source 1..71828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3405..4388) product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(4699..6714) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048745.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene recG CDS complement(6739..7842) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648090.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene alr CDS complement(7832..8230) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080566626.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene acpS CDS complement(8240..9271) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864040.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(9273..10304) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(10385..12898) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274071.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene secA CDS complement(13078..13671) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028367.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(13710..14552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(14745..16055) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207696.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene der CDS complement(16069..16782) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(16779..17675) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446509.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene dnaI CDS complement(17676..18845) product replication initiation and membrane attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802376.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(18846..19319) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203672.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene nrdR CDS 19462..19827 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 19831..20526 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054202.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 20542..21273 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498759.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(21343..22038) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(22035..22409) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781329.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 22590..22970 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042750621.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 23066..23287 product DUF4649 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570244.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 23302..23616 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029579.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene trxA CDS 23819..24472 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene queC CDS 24472..24915 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464576.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene queD CDS 24908..25624 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196451.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene queE CDS 25643..26134 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082587.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene queF CDS complement(26351..27019) product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714865.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(27165..27512) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028039.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 27664..28053 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002941856.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(28095..28217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 28447..29211 product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(29525..30268) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188179.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(30270..31223) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164555427.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene prmA CDS complement(31358..31831) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903456.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(31828..32256) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418176.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(32266..32736) product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 32852..34123 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 tRNA 34385..34460 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 34675..35106 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379854.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 35192..36196 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861516.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 36210..37046 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921898.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 37048..37926 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921899.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(37915..38118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 38357..38890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(39073..39636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(39823..40860) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090135.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene queA CDS complement(40889..41797) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222592.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(41939..42169) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(42179..43420) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243934.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(43548..45428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(45422..46732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(46740..47690) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804276.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(47800..48318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(48405..52799) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071439.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(52913..54994) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090357.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene fusA CDS complement(55272..55742) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene rpsG CDS complement(55762..56175) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142332.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene rpsL CDS 56518..56958 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861965.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 56955..57413 product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745054.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(57453..59987) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene mutS CDS complement(60034..60480) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231476.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene argR CDS 60634..62325 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092709.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene argS CDS 62582..62830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(62865..63074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(63144..63611) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849614.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene nrdI CDS complement(63688..64218) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140832896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(64280..65566) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278886.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(65569..67254) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171011731.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(67220..67834) product DUF624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(68468..68674) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837579.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(68712..69341) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064116.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(69353..69523) product DUF2273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905455.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(69535..69897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(70184..70423) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(70850..71188) product Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711078.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene cadX CDS complement(71200..71814) product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911684.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 sequence51 source 1..23082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..891 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002905011.1:alanine dehydrogenase locus_tag LOCUS_17760 CDS complement(942..1928) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(2012..2227) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232084.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(2236..3090) product RNA-binding virulence regulatory protein CvfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095453.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene cvfB CDS complement(3151..3708) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene frr CDS complement(3718..4455) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene pyrH CDS complement(4539..5873) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083709.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene trmFO CDS complement(6006..6884) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene rsmI CDS complement(6887..7204) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358228.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene yabA CDS complement(7240..8124) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806711.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(8121..8759) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene tmk CDS complement(9030..10226) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040724.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene tuf CDS complement(10426..11526) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488875.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 11632..12873 product D-alanyl-D-alanine carboxypeptidase PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719173.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene pbp3 CDS complement(12908..13477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(13497..14909) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797050.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene sufB CDS complement(14945..15385) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218481.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(15372..16598) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887749.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(16609..17871) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159648.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene sufD CDS complement(17899..18669) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene sufC CDS complement(18824..19018) product DUF3272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(19041..20705) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283776.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene dnaX CDS complement(20705..21202) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(21287..22489) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001631.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene rpsA tRNA complement(22648..22721) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(22733..22807) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(22818..22890) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(22896..22976) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(22991..23065) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 sequence52 source 1..6343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(358..2583) product penicillin-binding protein PBP2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762624.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene pbp2a CDS 2771..3547 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044012468.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(3614..4624) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260685.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene gap misc_feature complement(4933..>6343) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836312.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase locus_tag LOCUS_18030 sequence53 source 1..35103 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(263..2479) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123772.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(2625..3755) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229951.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene ugpC CDS complement(3868..4737) product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987098.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(4740..5126) product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(5119..6462) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972571.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene cysS CDS complement(6506..7267) product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837515.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(7302..7919) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539978.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene cysE CDS complement(7934..10156) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972572.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene pnp CDS complement(10491..11357) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089967.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene metF CDS complement(11420..13669) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108255.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene metE CDS complement(13913..14275) product TIGR02328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(14259..14663) product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429941.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(14745..16346) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922657.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(16390..17145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(17228..18136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(18153..19397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(19394..20185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(20221..21219) product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993737.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(21267..21665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(21786..24776) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922655.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 24932..25552 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076168.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(25594..26748) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(26928..27854) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene ftsX CDS complement(27847..28539) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022265.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene ftsE CDS complement(28555..29544) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015511312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene prfB CDS complement(29830..31089) product TRZ/ATZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049551703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(31267..32205) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818207.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene msrB CDS complement(32330..33199) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692438.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene thrB CDS complement(33201..34487) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216350.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320