COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..16602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..2327) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene fusA CDS complement(2358..2831) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene rpsG CDS complement(2955..3326) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene rpsL CDS complement(3544..7743) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rpoC CDS complement(7808..11881) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene rpoB CDS complement(12102..12467) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555497.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene rplL CDS complement(12547..13047) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555498.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene rplJ CDS complement(13246..13941) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene rplA CDS complement(13941..14372) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555500.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene rplK CDS complement(14490..15023) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene nusG CDS complement(15033..15401) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555502.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene secE tRNA complement(15447..15522) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 misc_feature complement(15577..>16602) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007245455.1:elongation factor Tu locus_tag LOCUS_00120 sequence02 source 1..3120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(33..2921) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence03 source 1..1311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence04 source 1..577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 63..272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 sequence05 source 1..5380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..1855 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 1849..3183 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 3505..4827 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395916.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(4734..4958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 sequence06 source 1..19501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(68..1312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(1323..3194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(3357..6815) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 assembly_gap 7496..7563 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8051..8557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 8532..8915 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 8902..9399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 9509..11086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 11358..11798 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene gspG CDS 11816..12310 product type III secretion system invasion protein IagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097340.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene iagB CDS 12307..13485 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 13490..15124 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 15105..15851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 15851..16393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 16408..16965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 16962..17480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 17511..19436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 sequence07 source 1..575134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 187..1146 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene birA CDS 1136..1885 product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 1893..2339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768916.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 tRNA 2481..2565 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 2592..2665 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 2692..2767 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 2854..4047 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene tuf CDS 4205..4516 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene rpsJ CDS 4564..5232 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene rplC CDS 5245..5847 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene rplD CDS 5844..6143 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555488.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene rplW CDS 6158..6982 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317104.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene rplB CDS 6999..7274 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene rpsS CDS 7286..7618 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene rplV CDS 7632..8318 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003176422.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene rpsC CDS 8331..8744 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555482.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene rplP CDS 8744..8935 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene rpmC CDS 8932..9204 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene rpsQ CDS 9228..9596 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene rplN CDS 9608..9922 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene rplX CDS 9943..10482 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene rplE CDS 10496..10801 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555476.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene rpsN CDS 11014..11406 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene rpsH CDS 11419..11952 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene rplF CDS 11963..12313 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene rplR CDS 12317..12817 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene rpsE CDS 12814..12996 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene rpmD CDS 13000..13434 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene rplO CDS 13435..14763 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene secY CDS 15038..15394 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555467.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene rpsM CDS 15425..15814 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene rpsK CDS 15833..16453 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rpsD CDS 16476..17477 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene rpoA CDS 17520..17906 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene rplQ assembly_gap 17959..18030 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18171..19625 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269092.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 19782..20246 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614296.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene bfr CDS complement(20427..23261) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085990813.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene uvrA CDS 23452..24849 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768949.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 24859..25383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(25500..25790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939692.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 25878..26855 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(26935..27807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(27882..29771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 30057..33383 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(33392..34312) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095765.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 34419..34631 product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388926.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(34723..35934) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 36182..37084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 assembly_gap 36945..37030 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 37072..38370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(38382..42683) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 42880..43749 product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 43742..44671 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(44734..45432) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(45528..46061) product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769001.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(46073..47338) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(47340..48050) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(48180..48773) product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103233.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 48870..49265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(49404..50276) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379146.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene trxA CDS complement(50351..51007) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(51004..51459) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 assembly_gap 52036..52121 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52257..53285 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene ribD CDS 53331..53993 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 54010..55101 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103237.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene ribBA CDS 55193..55669 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene ribE CDS 55666..56166 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269045.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene nusB CDS 56185..57150 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269044.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene thiL CDS 57147..57650 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 57661..58431 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102821.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 58531..59148 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379129.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene ribA CDS 59145..59564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(59758..61656) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene dxs CDS complement(61786..62673) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(62670..62912) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 63315..64727 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(64703..65698) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 65925..66518 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 66870..67658 product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 67695..69434 product DUF2138 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112864.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 69620..70261 product DUF1175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 70273..74826 product alpha-2-macroglobulin MagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene magD CDS 74828..76474 product DUF2300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003455629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 76478..77293 product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 77647..77913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 77910..78221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 note possible pseudo, frameshifted CDS 78230..79246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 note possible pseudo, frameshifted CDS complement(79297..79983) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(79958..83335) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393613.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 83658..84902 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767480.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene urtA CDS 85299..86216 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393615.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene urtB CDS 86227..87414 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene urtC CDS 87411..88169 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene urtD CDS 88180..88869 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene urtE CDS 89095..90582 product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 assembly_gap 89120..89225 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 90613..90957 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 90973..92016 product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113129.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 92020..93036 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113130.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(93059..93649) product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 93722..94117 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817007.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(94205..94873) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083104.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(95119..95733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 95856..96899 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 96957..97868 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 98240..98986 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(99024..100553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(100867..101499) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(101854..102381) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene ppa CDS complement(102494..103306) product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(103311..103964) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(104278..104736) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(104840..105670) product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene eutC CDS complement(105667..107061) product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 assembly_gap 107116..107254 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(107291..108661) product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene eat CDS complement(108954..109919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 assembly_gap 109929..110043 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 110095..110724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 110956..112872 product sigma-54-dependent transcriptional regulator EatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114083.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene eatR CDS 112968..114317 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770120.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene mpl CDS 114314..114943 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379089.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene ubiX CDS 114936..115223 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(115397..116038) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770116.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(116066..117784) product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770114.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(117897..118352) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770111.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 118531..118893 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770109.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 118890..119606 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 119617..120207 product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103257.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(120227..121543) product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268990.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(121610..122305) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268989.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 122484..123755 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105195.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 123757..124446 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene nadD CDS 124517..125011 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555337.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene rsfS CDS 125021..125488 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313894.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene rlmH assembly_gap 126388..126523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 126570..127460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 127457..128602 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244673.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene rodA CDS 128662..129630 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene mltB CDS 129630..130643 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 130963..132126 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376558.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 132216..132527 product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 132527..133177 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244676.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene lipB CDS 133200..134204 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene lipA CDS 134207..135163 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930225.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(135297..136613) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268984.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(136686..136973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(136940..137977) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene holA CDS complement(138018..138623) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268981.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene lptE CDS complement(138710..141316) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105190.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene leuS CDS 141539..141859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105188.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 141984..142745 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(142891..144414) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene lnt CDS complement(144423..145262) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(145297..145755) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105185.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene ybeY CDS complement(145748..146755) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268976.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(146829..148157) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene miaB CDS 148290..148616 product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(148745..149293) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(149531..150814) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene hemL CDS complement(150832..151455) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene thiE assembly_gap 151766..151854 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 151865..152629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 152706..155087 product hybrid sensor histidine kinase/response regulator LadS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene ladS CDS 155166..156815 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 156910..158382 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene amn assembly_gap 158445..158573 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(158995..159089) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(159272..159481) product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(159582..160064) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419292.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 160544..160762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 160802..161704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 note possible pseudo, frameshifted assembly_gap 160839..160924 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(161705..162595) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763294.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(162656..163075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340868.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 163185..165716 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057417846.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene hrpB CDS complement(165870..166952) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(167041..167703) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268949.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 167884..168636 product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463346.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 168790..169269 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105112.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 169398..170009 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 170415..170981 product Bro-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402397.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 assembly_gap 171283..171292 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(171330..171803) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 171962..172852 product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene yedA CDS 172910..174250 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105110.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 assembly_gap 174408..174470 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(174483..175754) product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(175995..176915) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 177009..177578 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 177734..178603 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene tesB CDS 178600..179193 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463348.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(179329..180318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399936.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(180319..181212) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 181405..182334 product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765677.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene pcaQ CDS 182464..183183 product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene pcaH CDS 183195..183800 product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene pcaG CDS complement(183974..185308) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 assembly_gap 185599..185608 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 185676..187586 product bifunctional sugar phosphate isomerase/epimerase/4-hydroxyphenylpyruvate dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267451.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 187692..188375 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(188411..189616) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763811.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(189616..189960) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(190086..190940) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(190946..191386) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106162.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene aroQ CDS 191658..192389 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235372.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 192431..193714 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 193861..194700 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268243.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(194808..195887) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene trmA CDS complement(195884..197179) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396212.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 197407..197862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(197870..199117) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 199470..200909 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399952.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 200913..201920 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105098.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene cydB CDS 201921..202154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(202180..203373) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268935.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(203472..204185) product LuxR family transcriptional regulator AbaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208103.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene abaR CDS 204579..205355 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268934.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(205502..205915) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene mscL CDS 206201..207742 product catalase KatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094881.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene katB assembly_gap 208200..208286 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 208360..208575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 208622..209989 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555235.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene radA CDS 210012..210740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(210785..211153) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268933.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 assembly_gap 211864..212050 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 212332..212341 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 212803..213141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 note possible pseudo, frameshifted assembly_gap 212819..212828 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 213056..213820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 note possible pseudo, frameshifted assembly_gap 213060..213069 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 213836..214033 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105096.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 214167..215138 product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770183.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene yjiA CDS complement(215236..215898) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(215922..216635) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083762.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(216735..217997) product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 assembly_gap 218247..218446 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(218573..219826) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(220074..223925) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105092.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 224215..225879 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene ettA CDS 226124..227461 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene gdhA CDS complement(227458..227952) product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 assembly_gap 228246..228328 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 228723..229091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 assembly_gap 229272..229367 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(229368..231221) product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(231296..231784) product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379721.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 232063..234501 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268923.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 234786..235118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094775.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(235122..236948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 237120..237608 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379718.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 237744..238049 product DUF6482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268921.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 238167..238784 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736691.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(238938..239195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555214.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 assembly_gap 239417..239426 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(239441..239782) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(239984..240952) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 241050..241508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 241544..241801 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene rpmA CDS 242002..243225 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene cgtA CDS 243347..244465 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381304.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene proB CDS 244486..244947 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403541.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(245130..245408) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene rpsT CDS 245703..247199 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene murJ assembly_gap 247240..247324 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 247446..248396 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene ribF CDS 248393..251224 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene ileS CDS 251217..251732 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266581.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene lspA CDS 251725..252177 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 252254..253201 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene ispH CDS complement(253178..253723) product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 253862..254326 product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246769.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 254323..254799 product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene pilV CDS 254796..255500 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 255508..256032 product PilX N-terminal domain-containing pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 256046..259156 product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266586.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 259169..259582 product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266587.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 259630..260730 product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene thiO assembly_gap 260915..261019 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(261042..262385) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(262388..263977) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(263967..264200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 note possible pseudo, internal stop codon, frameshifted CDS complement(264394..265410) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769279.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 265591..266523 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene rluD assembly_gap 266780..266876 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 267469..270033 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614629.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene clpB tRNA 270419..270494 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 270504..270580 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 270586..270661 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 assembly_gap 270794..271023 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 271427..272740 product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene wbpA CDS 272758..273708 product UDP-N-acetyl-2-amino-2-deoxy-D-glucuronate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene wbpB CDS 273716..274300 product UDP-2-acetamido-3-amino-2,3-dideoxy-D-glucuronate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113426.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene wbpD CDS 274297..275388 product UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene wbpE CDS 275608..276684 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538757.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 276674..277177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 277181..278137 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 278140..279111 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 279244..280095 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rfbD CDS 280092..280607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 280621..281949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 281942..283390 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085030.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 283487..285412 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene asnB assembly_gap 285314..285399 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 285686..285782 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 288378..288490 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 288745..289818 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene wecB CDS 290409..291188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 291752..292729 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 293011..293868 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 293887..294897 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 294890..296017 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817161.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene wecB CDS 296025..296987 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(297050..298351) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614782.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(298415..298588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(298656..299285) product DUF1780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 299421..300119 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 300198..300413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094660.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(300419..300622) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552020.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene yacG CDS complement(300619..301242) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene coaE CDS complement(301239..302111) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(302112..303329) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(303333..305033) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene pilB CDS 305264..305695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 assembly_gap 305983..306137 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(306321..306563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 306496..307242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 tRNA 307282..307357 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(307405..307626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(307626..308099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 308291..309769 product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(309798..310646) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene nadC CDS 311021..313243 product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266649.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 313327..313890 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266650.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene ampD CDS 313887..314726 product regulatory signaling modulator protein AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412346.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene ampE CDS 314939..316969 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 317143..317526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(317501..318292) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(318295..319290) product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene cra CDS 319725..322586 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103365.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene ptsP assembly_gap 323058..323136 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 323182..323610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 323622..325367 product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266653.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(325496..326659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(326626..328113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 assembly_gap 326843..326917 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 328324..329109 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112848.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(329283..330494) product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 assembly_gap 329344..329437 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(331047..332204) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(332201..332854) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400010.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(332864..333757) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(333772..334488) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400006.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 334828..336411 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396266.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 assembly_gap 336482..336542 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 336729..336992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(337108..338076) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(338076..339044) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436785.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(339055..339966) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555194.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(339977..340987) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(341063..342658) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(342736..344136) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(344309..345907) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(346206..347831) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(348090..349754) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 assembly_gap 349127..349223 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 349824..349900 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(349931..350641) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 350848..352107 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268907.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 352104..352664 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 352762..354495 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105053.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 354566..355315 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(355372..355563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(355578..357317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 assembly_gap 355592..355685 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 357542..358453 product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620479.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene kdgD CDS 358512..359957 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 360056..361426 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769363.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 361438..362991 product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268905.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene garD assembly_gap 363023..363126 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(363192..364100) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene glsB CDS 364248..364742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 364805..365092 product PA4642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(365277..365954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 assembly_gap 366104..366213 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(367613..367846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 368039..368623 product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406899.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(368693..368899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 369105..369392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114705.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(369408..370574) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421706.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 370717..370899 product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 370913..371173 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103440.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 371206..371826 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(371956..372360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(372291..374165) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099358.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 assembly_gap 372379..372516 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 374198..374410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 374441..375259 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346150.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(375414..375998) product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768799.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(376248..377246) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768797.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(377280..378245) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 378338..378967 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(378951..379724) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004351567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 379829..381103 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 assembly_gap 380494..380565 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 381251..382933 product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768794.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 383261..385126 product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 385156..386520 product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004402712.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 386729..389476 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 389690..391384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(391440..391871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 391885..395871 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 assembly_gap 392046..392141 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 395991..396635 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 396733..397524 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379278.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 assembly_gap 397578..397647 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(397671..398108) product DUF1043 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 398252..398887 product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 398913..400265 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268853.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 400431..401450 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene zapE CDS complement(401550..402545) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162840014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 402709..403845 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(403990..405030) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 405276..405704 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene rplM CDS 405719..406111 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene rpsI assembly_gap 406165..406229 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 406428..407024 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene petA CDS 407021..408232 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 408232..409014 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 409199..409816 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766548.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 409828..410241 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(410365..410943) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(410940..411533) product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(411748..412119) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(412119..413930) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 414180..415022 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243679.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene rsmI CDS 415831..416286 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene mraZ CDS 416283..417311 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268849.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene rsmH assembly_gap 416888..416970 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 417308..417601 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739040.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene ftsL CDS 417598..419337 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427469.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 assembly_gap 419415..419512 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 419536..420891 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268848.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 420884..422266 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105004.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 422266..423348 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene mraY CDS 423354..424700 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene murD CDS 424697..425911 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene ftsW assembly_gap 426293..426391 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 426394..427056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 427049..428509 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268845.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene murC CDS 428506..429486 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105003.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 429490..430359 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340706.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 430374..431639 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene ftsA CDS 431695..432882 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene ftsZ CDS 432995..433906 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene lpxC CDS complement(433957..435408) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(435558..436922) product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(436912..437592) product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(437602..440697) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(440694..441944) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406632.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 assembly_gap 440711..440812 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 442070..442163 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 442413..442745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 443156..443713 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244885.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 443764..444510 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 444662..447199 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042912373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 447196..447975 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266846.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 447972..448952 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266847.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 449040..449282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 449446..450411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 assembly_gap 450308..450400 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 450408..451121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(451126..451773) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764030.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 451708..451944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(451977..452111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 assembly_gap 452125..452220 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(452432..452923) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266849.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(452925..453827) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408993.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(454040..455590) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene norR CDS 455747..456928 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113387.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene hmpA CDS 457360..457869 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406623.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 458736..459587 product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene cyoA CDS 459591..461612 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244877.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene cyoB CDS 461697..462242 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 462243..462572 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409003.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene cyoD CDS 462583..463470 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375846.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene cyoE CDS complement(463529..464923) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223575817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 464828..465019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 465067..466167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706007.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 466207..467505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 467502..468065 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 468120..468605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 469010..469663 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene yfcF CDS 469920..471266 product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 471296..472360 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 472357..473238 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 473260..474018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 474094..475062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 475076..475897 product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(475951..477501) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(477602..477805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 478123..479748 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(479713..480324) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267085.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(480445..481266) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 assembly_gap 481891..481983 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 482076..482336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(482383..483288) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405623.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 483391..484593 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(484803..485819) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(486015..486740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(486733..487350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 487785..488651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(488662..489480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(489644..490348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766113.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 490699..491844 product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene bcsQ CDS 491841..494066 product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770918.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene bcsA CDS 494063..496420 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene bcsB CDS 496417..497622 product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene bcsZ CDS 497604..501494 product cellulose biosynthesis protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463740.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 501513..502199 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 502196..502873 product alginate O-acetyltransferase AlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 502893..504308 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770932.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 504308..505456 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770934.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 505475..506797 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266685.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(506864..507961) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113982.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 assembly_gap 508020..508130 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(508556..509401) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115566.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 509487..510110 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112753.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 510208..510993 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 511083..512048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(512081..512533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 assembly_gap 512688..512805 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 513245..513742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 514691..515518 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 515553..516068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(516204..516425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(516422..519310) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene fdhF CDS complement(519307..520941) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 assembly_gap 519769..519850 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(520941..521417) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528011.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(522055..522423) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(522449..522778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 tRNA complement(522873..522957) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 523066..524130 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771042.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene queA CDS 524127..525260 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene tgt CDS 525305..525643 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene yajC CDS 525706..527574 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771039.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene secD CDS 527584..528498 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380592.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene secF CDS 528619..529167 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(529243..530058) product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene suhB assembly_gap 530268..530355 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 531061..531840 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene cysE CDS 532151..532603 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene iscR CDS 532654..533868 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365095.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 533971..534357 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552476.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene iscU CDS 534394..534717 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100617.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene iscA CDS 534726..535247 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771027.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene hscB CDS 535299..537161 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266907.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene hscA CDS 537164..537505 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406488.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene fdx CDS 537520..537720 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene iscX CDS 537821..538246 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene ndk CDS 538275..539417 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene rlmN CDS 539436..540194 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene pilW CDS 540194..541195 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(541184..541699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 assembly_gap 541764..541874 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 542423..543712 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266910.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene hisS CDS 543754..544395 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552488.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 544388..545539 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428301.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene bamB CDS 545821..547293 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene der CDS 547409..548557 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 548545..549339 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266913.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 assembly_gap 549447..549607 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(549663..551345) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380623.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene leuA CDS complement(551891..552712) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 assembly_gap 553238..553336 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 553578..553671 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 554382..554517 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(554531..555430) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113814.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 555516..556298 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113815.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 556353..556901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 556984..558453 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314194.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene guaB CDS 558559..560136 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266918.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene guaA CDS 560404..560691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 560696..561214 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(561234..561938) product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987240.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene treR CDS 562167..563609 product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene treP CDS 563669..565318 product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656142.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene treC CDS 565445..566644 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 566708..569242 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ptsP CDS 569245..569538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 assembly_gap 569568..569577 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 569772..571148 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406430.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 571148..571639 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266922.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene tadA CDS complement(571693..572649) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene cmoB CDS complement(572646..573389) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene cmoA CDS complement(573543..573833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(573988..574644) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(574646..575038) product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 sequence08 source 1..41917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1128..1508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(2600..3508) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530002.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(3542..4750) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268247.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(4890..5489) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168558.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(5567..6562) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023619.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 6790..7182 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(7215..8255) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(8329..9423) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene ddlA CDS 9567..10289 product laccase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087130.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(10326..10784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(11036..11923) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 12080..12436 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 12433..12747 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071008.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 12824..13306 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(13401..14717) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697807.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 14895..15119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316018.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(15130..15807) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810854.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(15893..17095) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 17303..18706 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 18715..19716 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 19737..20765 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(20772..21116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(21234..22547) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767577.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 22878..24296 product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 24474..26174 product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405857.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene acpA CDS 26454..28151 product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104950.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 28164..29126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 note possible pseudo, internal stop codon CDS 29160..29546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 29642..30817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(31079..31723) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene can CDS complement(31816..32268) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095025.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene rimI CDS complement(32261..33040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 33209..34489 product Mks condensin complex protein MksB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404706.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene mksB CDS 34479..35192 product Mks condensin complex protein MksE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380289.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene mksE CDS 35189..38029 product Mks condensin complex protein MksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266671.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene mksF CDS complement(37977..40529) product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107435.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 assembly_gap 38138..38233 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(40522..41145) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(41132..41791) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023187661.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 sequence09 source 1..240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence10 source 1..2121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence11 source 1..1110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence12 source 1..46425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 68..1009 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 assembly_gap 1073..1142 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1214..1810 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 1982..2566 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103428.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene pth CDS 2590..3690 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene ychF CDS complement(3767..4354) product type IV secretion system toxin Tse4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099160.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene tse4 CDS complement(4359..4793) product type VI secretion system immunity protein Tsi4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene tsi4 CDS complement(4946..6886) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(7137..8354) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769084.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 8724..10748 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103405.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 tRNA 10864..10940 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 11324..12409 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 note possible pseudo, frameshifted assembly_gap 11407..11484 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12704..12895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 13172..13708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 13692..14051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 14023..15009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 15006..15302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(15707..16510) product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene istB CDS complement(16503..18011) product IS21-like element IS1326 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324342.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene istA CDS complement(18106..18654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 note possible pseudo, internal stop codon, frameshifted CDS complement(18749..19198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 note possible pseudo, internal stop codon, frameshifted CDS complement(19269..21038) product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114720.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(21158..21514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(21524..21982) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(21979..22347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(22467..22916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 22824..23204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(23275..24330) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998299.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene dmpG CDS complement(24330..25244) product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(25241..25453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(25477..26280) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(26277..27074) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(27082..28542) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(28748..29809) product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(29821..30177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(30243..31763) product aromatic/alkene/methane monooxygenase hydroxylase/oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(31779..32048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(32058..33050) product aromatic/alkene monooxygenase hydroxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206218.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(33098..33388) product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(33399..34328) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene hpaD CDS complement(34774..36459) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(36581..38074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(38149..40551) product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(40548..41666) product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(41800..43110) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(43188..44846) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 45199..46095 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 sequence13 source 1..585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 125..526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 sequence14 source 1..97292 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..436) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene queD CDS complement(522..1601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 1785..2093 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090497.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 2093..2401 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 2401..3069 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246025.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 3066..4382 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(4402..6558) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 assembly_gap 5343..5352 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6853..8535 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104517.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(8618..9955) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene yegQ CDS 10110..11174 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268279.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(11180..13318) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(13457..14920) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268278.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene nuoN CDS complement(14928..16460) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene nuoM CDS complement(16501..18354) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene nuoL CDS complement(18351..18659) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene nuoK CDS complement(18664..19164) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380113.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene nuoJ CDS complement(19174..19722) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene nuoI CDS complement(19734..20741) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411662.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene nuoH CDS complement(20738..23452) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268277.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene nuoG CDS complement(23581..24936) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405108.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene nuoF CDS complement(24933..25430) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371730.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene nuoE CDS complement(25433..27214) product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268276.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene nuoC CDS complement(27288..27962) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 assembly_gap 28003..28088 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 28821..28902 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29048..30373) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene aceA CDS complement(30882..31643) product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405102.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(31782..32207) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(32200..33366) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(33451..34821) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene purB CDS complement(34937..35560) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405097.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene hflD CDS complement(35557..36687) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene mnmA CDS complement(36748..37194) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(37351..39576) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 40080..41336 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene icd CDS complement(41386..41685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 41913..42275 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405085.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene clpS CDS 42304..44574 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene clpA assembly_gap 44680..44784 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(44861..45079) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene infA CDS complement(45260..45967) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(46023..46712) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene aat CDS complement(46713..47663) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene trxB CDS 47999..50449 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010200894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene ftsK assembly_gap 50155..50244 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 50508..51131 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767395.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene lolA CDS 51151..52476 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405078.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 52473..52847 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268268.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene crcB CDS 52864..54144 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene serS CDS 54144..55538 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405073.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene cysG CDS complement(55698..56696) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(56785..57786) product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(57783..58118) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268265.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(58115..58414) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268264.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene tusB CDS complement(58414..58776) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene tusC CDS complement(58778..59170) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene tusD CDS complement(59282..59953) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 tRNA 60076..60163 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 60806..61096 product type II toxin-antitoxin system antitoxin YacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene yacA CDS 61093..61389 product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(61532..61792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(62006..63331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(63679..65283) product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 65482..66513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 assembly_gap 65824..65922 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 66742..68058 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063785.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 68055..68972 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 assembly_gap 69025..69102 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 69106..69861 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532863.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 69874..70959 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532862.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 71036..72148 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 72175..73698 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 73802..74644 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 74789..75607 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 assembly_gap 77050..77142 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(77212..77514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 note possible pseudo, frameshifted CDS complement(77541..78116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 note possible pseudo, frameshifted CDS 78212..79174 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205699.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(79185..79394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(79394..80701) product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316782.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 80955..82826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(82842..83663) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(83753..84736) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089436.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 84841..85401 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089433.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 85451..86521 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 86518..87360 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115101.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 87326..88525 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 88525..89289 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(89326..89559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(89673..90947) product sensor histidine kinase ParS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene parS CDS complement(90961..91680) product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene bfmR CDS 91879..93627 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 93642..94964 product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(95108..95686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 95895..96179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 96248..96787 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 sequence15 source 1..429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 104..427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 sequence16 source 1..7237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(67..489) product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(489..1355) product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(1361..2308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 2334..3806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 assembly_gap 2364..2473 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3787..4476) product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268752.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 4773..7205 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620091.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene lon sequence17 source 1..1246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence18 source 1..23166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..663) product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162888971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(707..961) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(1111..1629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(1768..3210) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(3509..4324) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(4321..4677) product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409835.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(4687..5508) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267373.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 assembly_gap 5562..5637 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5708..6637) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267475.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(6640..7389) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267476.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 7931..9595 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(9732..10661) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 10812..11864 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244776.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(11997..12806) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103889.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(12915..13913) product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene araH CDS complement(14009..15529) product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene araG CDS complement(15675..16676) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(16760..17149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 assembly_gap 17189..17287 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17425..17658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(17720..19114) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 assembly_gap 18661..18749 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19292..20440) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene dgoD CDS complement(20496..21116) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(21148..22119) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267365.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 assembly_gap 22270..22359 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22479..23120 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 sequence19 source 1..206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence20 source 1..207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(52..161) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence21 source 1..61838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 564..902 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 1193..2602 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 2614..3564 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378609.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 3561..4364 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(4410..5234) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268042.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(5244..5720) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 6287..7492 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 7512..9653 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 9796..10524 product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267292.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(10645..11199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 assembly_gap 11598..11700 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11886..12608) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(12825..13046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 assembly_gap 13091..13198 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13694..13930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 tRNA 13939..14028 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 assembly_gap 14029..14105 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14495..15382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 15747..16031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 16083..16328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 16325..16576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463578.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(16560..17744) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 assembly_gap 17880..17889 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17921..19330) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 19547..20014 product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 20311..22200 product methyl-accepting chemotaxis protein PctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene pctA CDS complement(22190..23170) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(23269..23763) product DUF1543 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139542.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 assembly_gap 23869..23955 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23997..24908 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 25051..26250 product NAD-dependent formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 26247..26759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(26781..27209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 27359..27700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(27723..27947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 assembly_gap 28364..28453 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28483..28971 product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(28956..29243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 29459..29719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 assembly_gap 29953..30037 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(30276..30614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(30711..31010) product DUF6388 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 31270..31920 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(31917..32117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 assembly_gap 31968..31977 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(32110..32376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(32443..32736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(32752..35547) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074056806.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(35551..35784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(35860..36222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(36219..36728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(36728..36928) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 37003..37368 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246451.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 37470..37646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(38048..38926) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040233361.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(38838..40892) product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097400.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 41056..41973 product GPO family capsid scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 41975..42994 product phage major capsid protein, P2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 assembly_gap 43082..43160 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 43175..43792 product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815667.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene gpM CDS 43891..44352 product head completion/stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 44349..44792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 44782..45459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 45471..46583 product DUF2586 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 46591..47040 product DUF2597 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097392.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 47040..47252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 47249..47641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 47641..47856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 47846..48208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 48210..48464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 48457..48744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 48915..50900 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 50897..51214 product DUF2590 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 51211..52392 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 52379..52903 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767209.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 52912..54507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 54518..55063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 55060..55986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 55983..56507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 56504..57208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 note possible pseudo, frameshifted CDS 57181..58158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055010900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 58255..59334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 assembly_gap 59239..59323 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(60887..61102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 assembly_gap 61395..61490 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence22 source 1..41885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 277..906 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406312.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(922..1206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406313.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(1346..1711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 2100..2987 product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene cmrA CDS complement(2984..4048) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(4067..4804) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 assembly_gap 4837..4916 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4998..5804) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246654.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(6136..7239) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104054.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(7448..8896) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(8896..10533) product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 10676..11566 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(11618..12289) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314590.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(12300..13124) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268597.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene ttcA CDS 13427..14029 product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 14160..14654 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(14753..15934) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(16098..17429) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 17763..18908 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 assembly_gap 18755..18825 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18833..20182) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(20179..20856) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381559.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 21080..21805 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202907615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(21816..23423) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463925.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(23420..24142) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 assembly_gap 24724..24811 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 24963..28085 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 assembly_gap 27812..27918 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 28185..28278 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28372..29709) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene flgE CDS complement(29742..30470) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene flgD CDS complement(30486..30929) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene flgC CDS complement(30933..31340) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370068.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene flgB CDS complement(31589..32416) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene cheR CDS complement(32469..33383) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316772.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 33616..34236 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032608868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene flgA CDS 34408..34728 product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404324.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene flgM CDS 34777..35244 product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 35341..36084 product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771573.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(36157..37497) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103773.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(37655..38998) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797788.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(39098..39790) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268467.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(39787..41391) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103766.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 sequence23 source 1..121670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..1165 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 1167..2114 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251335.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 2104..2928 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 3015..4439 product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene patD CDS 4541..6022 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731469.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 6089..7951 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 assembly_gap 8418..8498 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9378..9470 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9817..11526) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266941.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene recJ CDS complement(11581..12123) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 12263..13462 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 13537..14421 product TIGR02285 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765892.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(14585..14887) product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 15202..15864 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765888.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(15871..17109) product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797770.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(17197..20718) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420270.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(20914..22323) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314231.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene thrC CDS complement(22356..23660) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222944447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(23799..24530) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene dsbC CDS complement(24700..26550) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(26836..27732) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266933.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene xerD CDS complement(27959..28309) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene rplS CDS complement(28355..29107) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552523.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene trmD CDS complement(29111..29647) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406396.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene rimM CDS complement(29653..29904) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene rpsP CDS complement(30156..31532) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene ffh CDS 31754..32545 product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene ccsA CDS 32558..33802 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 34182..35498 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032615959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(35660..36841) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene purT CDS complement(36942..37409) product preQ0 transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(37485..37694) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(37691..38215) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(38262..38861) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266927.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 39008..39565 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 39601..40104 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266926.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 40285..41016 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 41036..42142 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113826.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene nagA assembly_gap 42235..42321 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 42332..43228 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148055.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 43242..45758 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895663.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene ptsP CDS 45782..47461 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene nagE CDS complement(47476..47787) product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266925.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(47794..51735) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266924.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene purL CDS 52044..53438 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080546580.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene mltF assembly_gap 53486..53495 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(53594..54340) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764769.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene pdxJ CDS complement(54392..55081) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405347.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene recO CDS complement(55106..56008) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363707.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene era CDS complement(56001..56690) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554906.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene rnc CDS complement(56687..57064) product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(57131..57985) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene lepB CDS complement(57991..59790) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene lepA CDS complement(59962..61023) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene lptG CDS complement(61016..62134) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene lptF CDS 62420..63910 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266820.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 63969..64397 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 64406..64831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 65069..67915 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 68208..69326 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032621684.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene rlmF assembly_gap 69029..69123 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(69389..69670) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552279.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 70067..71074 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266815.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene yejK CDS 71078..71428 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406715.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 assembly_gap 71472..71607 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(72654..72983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(73030..73500) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(73603..74916) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(74906..75565) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(75634..75828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(75947..76711) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(76740..77834) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(77845..79026) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(79093..80124) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 80597..81253 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266805.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 81329..82804 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199726912.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene rhlB CDS 82939..83889 product NAD(P)H-dependent anabolic L-arginine dehydrogenase DauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113781.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene dauB CDS 84028..85155 product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene dauA CDS 85219..85854 product transcriptional regulator DauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113779.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene dauR CDS complement(85982..86758) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113778.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 assembly_gap 86990..87172 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(87217..87666) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736458.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene moaE CDS complement(87668..87913) product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene moaD CDS complement(87913..88383) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene moaC CDS complement(88614..90008) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(90346..91470) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 91770..92549 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764136.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene yaaA CDS 93508..94824 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 assembly_gap 94936..95018 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 95086..96567 product mannuronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552255.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene alg8 CDS 96604..97776 product alginate biosynthesis protein Alg44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 97786..99195 product alginate biosynthesis TPR repeat lipoprotein AlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene algK CDS 99192..100676 product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266797.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 100676..102379 product mannuronan 5-epimerase AlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene algG assembly_gap 100944..101033 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 102391..103824 product alginate biosynthesis protein AlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 103836..104960 product mannuronate-specific alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 105269..106819 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 106831..108009 product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 108024..108680 product alginate O-acetyltransferase AlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 108832..110283 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 110458..110922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266792.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 111031..111432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 111442..112266 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266791.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(112415..113275) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(113286..113486) product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365425.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(113476..115662) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(115673..117184) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 117453..117869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 117885..118235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 118242..120530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 120627..121583 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017277809.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 sequence24 source 1..27041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 128..1111 product purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268702.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1113..1379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1378..2223 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370754.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 2289..3011 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 assembly_gap 3050..3197 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3322..4806 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084906.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 4939..5190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(5187..6146) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 6289..6723 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096712.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 6726..7175 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 7414..7935 product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103513.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 8161..8742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 note possible pseudo, internal stop codon CDS 8743..9543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 note possible pseudo, internal stop codon assembly_gap 8762..8834 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9733..11904 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470621.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 11916..13148 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530090.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 13196..18532 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 18547..19287 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 assembly_gap 19403..19488 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19522..19734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 19731..21167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 assembly_gap 20728..20856 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21272..22897 product pyochelin biosynthesis salicyl-AMP ligase PchD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114688.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene pchD CDS complement(22904..23530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 assembly_gap 23664..23752 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24216..24842) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(24874..26238) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 assembly_gap 26721..26831 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence25 source 1..39338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(800..1471) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269401.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1490..1936) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1946..2569) product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 2686..4236 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105535.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 4323..7676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 assembly_gap 7721..7857 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7903..9003) product putrescine-binding protein SpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene spuD CDS complement(9016..10047) product acetylpolyamine amidohydrolase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112424.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene aphA CDS complement(10207..11199) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(11290..11742) product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617103.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(12262..13266) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(13402..14850) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(15285..16709) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269395.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene aspA CDS 16894..17811 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 assembly_gap 17869..18045 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18342..18466 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18693..19184 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene purE CDS 19196..20278 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 20388..20633 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096795.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 20714..21250 product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621857.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(21284..22216) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(22241..22642) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 23069..24286 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 24331..25620 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 25783..26784 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene pstS CDS 26978..29269 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 29285..30955 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174518729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene pstA assembly_gap 30998..31104 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31185..32018 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene pstB CDS 32138..32899 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene phoU CDS 33061..33981 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768363.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 34135..35031 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 assembly_gap 35143..35229 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(35236..36579) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(36703..38025) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245011.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene phoR CDS complement(38069..38758) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene phoB CDS 38912..39289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 sequence26 source 1..145982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 880..1740 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895559.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1742..2485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267080.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 2486..3187 product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267079.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 3184..3918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 3902..4120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 4117..5466 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267078.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene dnaB CDS 5463..5654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 5644..6189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 6182..6415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 6415..7416 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene yejK CDS 7447..7680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 7677..9425 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267075.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 9452..10159 product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 repeat_region 10823..10987 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgagttcggcatccgaactcag assembly_gap 11949..12072 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12663..12691 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12969..13694 product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 13694..14239 product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 14255..14743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 assembly_gap 14801..14874 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14907..15341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 assembly_gap 15622..15694 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15901..17805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 17942..18250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 18247..20202 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(20254..21054) product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 21260..22435 product TcpQ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267070.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 22435..24240 product PilN family type IVB pilus formation outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 24244..25572 product type 4b pilus protein PilO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267068.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene pilO2 CDS 25562..26149 product type IV pilus biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317569.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene pilP CDS 26162..27802 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 27792..28883 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267066.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 28904..29422 product type 4 pilus major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 29432..30367 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 30358..31620 product shufflon system plasmid conjugative transfer pilus tip adhesin PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425014.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene pilV CDS 31667..32107 product type IV pilus biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425016.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene pilM CDS 33021..33359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 33671..33922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 34021..34575 product STY4534 family ICE replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 34687..35001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 35125..35463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054991125.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 35568..36164 product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 36175..36459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 37048..37566 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709765.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 38009..38686 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103380.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 assembly_gap 39281..39353 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(42151..42753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 assembly_gap 42859..42973 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(43617..43772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(43834..45099) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816055.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(45113..45409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 45782..45970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 45967..47145 product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene aspB CDS 47166..48017 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 48375..49850 product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212059.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene ansP CDS 50584..50994 product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970109.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(50995..51243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 51648..51857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 52238..53464 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(53524..53976) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 54338..54820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 assembly_gap 54838..54905 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 55159..55869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 55879..56655 product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267030.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 56667..57197 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267029.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 57194..57703 product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 57713..58162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 58174..58413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 58426..60648 product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895408.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene traD CDS 60676..60870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 60890..61645 product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 61655..63121 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 63197..63508 product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 63622..63981 product RAQPRD family integrative conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317499.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 63978..64217 product TIGR03758 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 64235..64573 product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267026.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 64586..64969 product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 64966..65619 product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319098.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 65616..66521 product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 66511..67998 product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 67976..68419 product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740043.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 68420..71422 product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267020.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 71419..71715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103318.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 71712..72410 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267018.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(73240..73491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(73488..73754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(73751..73996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(73983..74309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(74479..74691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(74756..75010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(75025..75231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 75687..76058 product TIGR03757 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267009.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 76055..76990 product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 77011..78372 product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029572036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 78383..78754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 78751..80286 product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(80337..80684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 80821..81111 product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391284.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 81114..81470 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(81594..82064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 assembly_gap 82382..82461 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 82596..84218 product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004409737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene mobH CDS 84215..85573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 tRNA complement(85963..86038) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(86102..86791) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene queC CDS complement(86793..87365) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267001.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene queE CDS complement(87606..88430) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104810.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene ybgF CDS complement(88437..88934) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554651.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene pal CDS complement(88987..90258) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene tolB CDS complement(90285..91364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(91364..91816) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene tolR assembly_gap 91965..92048 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(92599..93066) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406122.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene ybgC CDS complement(93195..94253) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene ruvB CDS complement(94254..94868) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245442.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene ruvA CDS complement(94983..95507) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene ruvC CDS complement(95656..96402) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339485.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(96536..98311) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene aspS CDS complement(98406..98621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(98839..99111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(99400..99927) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 100332..100934 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106665.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(101010..101216) product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(101213..101602) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 102630..103994 product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(104228..105070) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395337.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(105192..105677) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 105796..106749 product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106524.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 106749..107666 product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(107693..109018) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407399.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 assembly_gap 107965..108066 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 109234..110994 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 note possible pseudo, frameshifted assembly_gap 110891..110972 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 110985..111350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 note possible pseudo, frameshifted CDS 111353..111937 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104998.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 assembly_gap 111965..112052 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(112122..113063) product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(113123..114340) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268841.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene argJ CDS complement(114469..117204) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene secA CDS 117513..117968 product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(117973..119397) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114975.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(119495..119692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768677.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(119723..120571) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363851.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene purU CDS 120921..121298 product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(121389..122825) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene sbcB CDS 122988..123713 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268792.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 123710..124690 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 124677..126206 product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 126203..127366 product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104956.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 127521..128669 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 128669..130348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124433836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 130345..132240 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124433837.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 132237..132665 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463671.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 132730..134931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(135054..135257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 135174..136097 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268796.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 136111..137442 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(137449..137808) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093898.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(138036..138410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 138583..140034 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene pyk CDS complement(140126..140875) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(140921..141859) product iron-sulfur-binding ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246206.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(141852..142988) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101151.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 143294..144817 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268799.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 assembly_gap 144932..144941 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(145128..145604) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 sequence27 source 1..45355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..1626) product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607108.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(2346..3167) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619515.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 3404..3619 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 3616..4695 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(4759..4938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 assembly_gap 5024..5116 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5980..6996) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226848.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(7225..8220) product putative FMN-dependent luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(8217..9236) product putative FMN-dependent luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384360.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(9233..10561) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269247.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(10627..13062) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(13519..13884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 assembly_gap 13900..13997 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14022..14600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(14664..15662) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207523.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 15852..16745 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(16785..18149) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213222.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 18362..20128 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064865.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 20125..21114 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064134.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 21114..21962 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 21959..23602 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813166.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 23645..24484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 24729..24935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 25318..25755 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 25999..26775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 26814..27212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 27281..27934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 28052..29884 product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(29988..31136) product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(31244..32824) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 33007..33225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(33250..34875) product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087273407.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 35053..35682 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 35843..36946 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 37098..37349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(37371..37940) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(37937..38962) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267523.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene folD assembly_gap 39061..39132 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 39179..41506 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478814.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 41510..42529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(42549..43199) product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(43266..44210) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 44322..45305 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 sequence28 source 1..884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 264..352 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence29 source 1..242453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 351..1175 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1212..2099 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 2181..3152 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 assembly_gap 3450..3542 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3550..3846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 3847..5127 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 assembly_gap 5160..5220 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5264..6193 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266700.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(6201..7115) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706409.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 7259..7867 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376205.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(7890..8330) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 8595..10370 product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene gcl CDS 10501..11283 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene hyi CDS 11324..12304 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 assembly_gap 12112..12206 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12526..13821 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 13811..15226 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114299.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene pyk CDS 15344..16216 product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114298.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 16264..17088 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 17180..18178 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408188.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(18263..18901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095513.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(19101..19493) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(19504..20703) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene ccmI CDS complement(20700..21170) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104639.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(21167..21703) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268401.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(21700..23688) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(23692..24147) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene ccmE CDS complement(24144..24320) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083136.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene ccmD CDS complement(24317..25072) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(25121..25789) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene ccmB CDS complement(25786..26367) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene ccmA CDS 26617..28188 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268407.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 28185..28514 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(28650..29042) product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412376.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(29043..29525) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370201.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(29602..30480) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244357.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(30553..31341) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(31394..32281) product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene motD CDS complement(32293..33033) product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378725.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(33033..34172) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(34225..35343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(35396..36592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 note possible pseudo, frameshifted assembly_gap 35547..35649 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(36607..37395) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268434.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(37418..37801) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083073.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(37964..38704) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378731.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene fliA CDS complement(38701..39534) product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene fleN CDS complement(39656..40984) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene flhF CDS complement(40996..43125) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412395.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene flhA CDS complement(43257..43880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 assembly_gap 43914..44005 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(44482..45264) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244363.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene fliR CDS complement(45266..45535) product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554277.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(45557..46309) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene fliP CDS complement(46309..46743) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene fliO CDS complement(46744..47205) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378749.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene fliN CDS complement(47263..48231) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422170.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene fliM CDS complement(48241..48747) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244365.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene fliL CDS complement(49009..50418) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(50507..50866) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268438.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(50896..52602) product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(52608..52913) product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene hsbA CDS complement(52999..53448) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene fliJ CDS complement(53455..54813) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268440.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene fliI CDS complement(54803..55585) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268441.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene fliH CDS complement(55596..56615) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene fliG CDS complement(56608..58392) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268443.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene fliF CDS complement(58408..58737) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene fliE CDS complement(58872..60272) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(60272..60562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 assembly_gap 60636..60754 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(61691..63166) product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316803.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene fleQ CDS complement(63338..63634) product flagellar protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554297.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene fliT CDS complement(63648..64043) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268446.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene fliS CDS complement(64174..65646) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268447.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene fliD CDS complement(65729..66097) product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767009.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(66171..67022) product flagellin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(67254..67526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(67523..68815) product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707838.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(68896..69822) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(70053..71189) product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene pseI assembly_gap 70237..70320 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(71182..72681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(72684..73394) product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene pseF CDS complement(73391..74011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(74045..75214) product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene pseC CDS complement(75331..78273) product TIGR00180 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(78328..79062) product cephalosporin hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(79083..80153) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987004.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(80143..80994) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970960.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene galE CDS complement(81006..82232) product methyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707820.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(82229..82696) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 82595..82804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(82786..83868) product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene rfbG CDS complement(83850..84623) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707823.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene rfbF CDS complement(84823..88419) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(88540..90117) product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(90131..92191) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene flgK CDS complement(92202..93479) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene flgJ CDS complement(93490..94605) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(94612..95307) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene flgH CDS complement(95361..96146) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554310.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene flgG CDS complement(96193..96933) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767027.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 97261..98127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 98124..98846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(98937..100493) product sigma-54-dependent phenylalanine hydroxylase transcriptional regulator PhhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114242.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 100794..101585 product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767729.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene phhA CDS 101688..102044 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 102044..103240 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114240.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 assembly_gap 103301..103403 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(103450..104217) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085797.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(104210..104722) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 104871..105842 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 105856..106170 product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085799.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 106341..106472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 106558..106740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 106844..108049 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(108180..108593) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene arfB CDS complement(108680..110101) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(110295..112070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 assembly_gap 110798..110867 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(112226..113248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(113260..114078) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(114079..114708) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268524.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(114722..115588) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 115634..116269 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210436297.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 116271..116570 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 116681..117088 product translation initiation factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 117123..117800 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 assembly_gap 118115..118216 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 118253..118504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 118575..119909 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(119974..120534) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404145.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 120653..121846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 assembly_gap 121711..121780 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 121843..122187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(122144..123172) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 123365..123676 product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767692.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 123787..124374 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(124382..125203) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103709.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 125350..126108 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 126187..127077 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 127224..127517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809192.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(127586..127870) product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 127943..130132 product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene plpD CDS complement(130216..130782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(130791..132503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 assembly_gap 130813..130888 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(132634..133068) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(133221..135350) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245677.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene recQ CDS 135635..136222 product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767637.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 136233..136634 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268622.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(136631..137230) product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(137245..138138) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 assembly_gap 138929..139024 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 139050..139379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 139389..139799 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 139854..141365 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 141517..142896 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 143165..143407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(143748..144650) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082949.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 144756..145937 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115602.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(145885..146814) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 146907..147098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(147008..147397) product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767545.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(147436..148272) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 148621..148809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 148976..149836 product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(149882..150274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(150453..151808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(151805..153049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(153051..154178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(154398..155783) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 155939..157384 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103605.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 assembly_gap 157203..157343 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(157489..158358) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764980.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 158284..158493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(158692..159291) product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene azoR3 CDS complement(159439..159753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764975.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 159803..160726 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 160741..161544 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 161548..162114 product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 162200..164032 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 164225..164923 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene aqpZ CDS complement(164941..165495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 assembly_gap 165633..165715 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 165716..166129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(166459..167787) product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 assembly_gap 168030..168113 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(168125..168364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(168358..168969) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(169138..170259) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(170451..174362) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104871.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene hrpA CDS complement(174469..176190) product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112397.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene aceK CDS 176427..177338 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 assembly_gap 177442..177536 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(177582..178391) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090576.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(178803..179741) product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(179950..180924) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene cysK CDS 181054..182142 product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 182285..183130 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 183309..184487 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(184646..185563) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(185560..186264) product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(186261..187013) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(187077..188363) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102111.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 188516..189433 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102114.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 assembly_gap 189462..189588 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(189619..190152) product DUF2937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104777.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(190164..190940) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619831.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(190973..191473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(191582..192649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 194410..196461 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104778.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 196550..197023 product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245797.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(197020..197295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 197455..198141 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 198192..198566 product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552611.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(198579..200504) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105342.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 200721..201623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(201649..202230) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 202336..203043 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 203122..203559 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245794.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 203642..204016 product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(204038..205276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(205302..205751) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 206029..206622 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(206761..207693) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(207820..208113) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379038.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(208110..208358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(208277..209329) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267099.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene rnd assembly_gap 208368..208460 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(209473..210150) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739535.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(210349..211731) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106001.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(212097..212978) product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112831.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene cynR CDS 213088..213747 product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107081.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene cynT CDS 213782..214252 product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194284.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene cynS CDS complement(214305..214664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(214751..215674) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738213.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 215938..217164 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 217618..218103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(218179..218712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(218705..219184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 tRNA complement(219512..219601) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(219686..220396) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379028.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(220425..221183) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(221189..222301) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406091.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene bamC CDS complement(222319..223197) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317384.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene dapA CDS 223525..224085 product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 224095..224568 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(224760..225830) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267087.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(225874..226113) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 226242..227675 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 assembly_gap 227725..227821 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(227828..228886) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene nadA CDS 229135..230061 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene coaA CDS complement(230120..230365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 230907..233903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 assembly_gap 232306..232382 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 233916..234338 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317918.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene gspG CDS 234341..234796 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411575.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 234793..235164 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104494.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 235161..235790 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104493.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 235787..236497 product general secretion pathway protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 236494..237555 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104492.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 237557..238180 product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343405.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene gspM CDS 238177..238677 product general secretion pathway protein GspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405008.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 238733..240337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 assembly_gap 240205..240291 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 240346..241098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 241220..241675 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528840.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 241669..242139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 sequence30 source 1..132794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(67..636) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene pgsA CDS complement(669..2492) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764425.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene uvrC CDS complement(2495..3076) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene uvrY CDS complement(3286..3603) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074594453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 3733..3954 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(4029..4481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(4475..5233) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 5876..6967 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 7160..7441 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 7574..9442 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268075.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 9442..10509 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104338.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 10509..11531 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 11546..13141 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104339.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 assembly_gap 13708..13792 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13973..14650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 14958..16349 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 16360..17130 product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene bdhA CDS 17301..19256 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(19267..20550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(20749..21783) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene astA CDS complement(21780..22718) product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(22923..23402) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(23802..25412) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(25489..26706) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(26708..28012) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868824.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(28100..29458) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066669.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene aldA assembly_gap 29486..29608 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29842..30741) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 30646..30846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 31169..32404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(32348..33256) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 33412..34293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 34470..35696 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 assembly_gap 35743..35912 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 36208..37842 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 37917..38870 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 38867..39703 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527129.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 39706..41346 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 41450..42631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206505.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 42967..43842 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211861.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 assembly_gap 43899..43997 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(44019..45452) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene gabD CDS complement(45449..46483) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211865.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(46494..47012) product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211864.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene fae CDS 47272..47490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(47562..48140) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 48247..48900 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228475.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 48986..50962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 assembly_gap 51591..51662 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(52179..52757) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(52824..53468) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704554.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 53630..54541 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(54569..55471) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930233.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(55587..55874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 55756..57702 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267536.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(57792..58685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(58733..59425) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(59422..60111) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(60117..60878) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(61081..61584) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(61594..62364) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(62407..62901) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 note possible pseudo, frameshifted assembly_gap 62980..63069 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 63689..64561 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070801.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(64853..65053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 assembly_gap 65233..65288 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 65620..65629 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 65808..67091 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(67223..67909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267670.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 68139..68306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(68368..69117) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267668.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(69146..69388) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104145.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 69514..70428 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene nhaR CDS complement(70518..71027) product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 71158..71805 product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267665.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(71859..72677) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369293.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 72935..73279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 73550..73744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 73885..74067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405489.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(74149..74709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246013.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(74828..75856) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895557.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 assembly_gap 75490..75580 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 76127..77581 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 assembly_gap 77394..77489 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 77903..78838 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267664.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene pbpG CDS complement(78874..79839) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 80036..82600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895704.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 assembly_gap 80578..80691 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 82724..83560 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(83565..84152) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010205556.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 84278..84838 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 84909..85124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(85134..86024) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968433.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 86163..87593 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968432.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(87744..88265) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(88274..89197) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(89333..90316) product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(90499..90771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 90841..91758 product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene metR CDS 91983..92852 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(92973..97352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(97396..98553) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 98922..99521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 99855..100475 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(100472..101215) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973973.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 101316..102278 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035566.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(102163..103506) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 assembly_gap 102628..102717 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(103549..104730) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 104826..105728 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099180.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 assembly_gap 105811..105891 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 105934..107610 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(107638..108591) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(108595..109554) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 assembly_gap 110613..110731 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 110793..111797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 note possible pseudo, frameshifted CDS complement(111962..113257) product sensor histidine kinase ParS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113589.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene parS CDS complement(113258..113965) product response regulator transcription factor ParR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098126.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene parR CDS complement(114210..114932) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(114934..117585) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528828.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene acnA CDS complement(117599..118795) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(118971..120089) product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(120256..121257) product porin OpdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene opdQ note possible pseudo, frameshifted assembly_gap 121258..121267 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(121629..123272) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(123275..124153) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(124150..125091) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(125094..126608) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 127234..128148 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 128182..129648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(129718..130710) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529113.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 assembly_gap 131280..131386 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 131407..131595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 132023..132766 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 sequence31 source 1..26582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..10653 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210043352.1:deaminase domain-containing protein locus_tag LOCUS_15920 CDS 10664..11290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(11704..12051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(12048..13496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 assembly_gap 13574..13660 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13865..14950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(15074..15238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(15850..16065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(16062..16397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 16855..17091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(17048..17347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 note possible pseudo, internal stop codon CDS complement(17402..17566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 note possible pseudo, internal stop codon CDS complement(17699..17830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 note possible pseudo, internal stop codon CDS complement(17827..18171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(18314..18517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(18528..19499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 assembly_gap 19233..19242 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19480..23220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 assembly_gap 20905..20914 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(23286..>26582) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104446.1:filamentous hemagglutinin N-terminal domain-containing protein locus_tag LOCUS_16080 assembly_gap 23302..23543 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence32 source 1..98427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..480) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(482..1207) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010203861.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1251..1532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 assembly_gap 1688..1858 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2316..2403 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2705..3028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(3238..5610) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 5764..6711 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105356.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 6922..8526 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114996.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(8587..9492) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 9661..10680 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 assembly_gap 10574..10657 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10716..11576) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 assembly_gap 11602..11698 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12230..12330 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 13236..13328 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13427..13945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 13942..14757 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112653.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 14771..16381 product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene atsA CDS complement(16531..17604) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 17701..18705 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247332.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 assembly_gap 18759..18768 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18873..19559) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 19646..20170 product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403937.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(20354..21343) product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(21347..22219) product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380253.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene cysW CDS complement(22232..23050) product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene cysT CDS complement(23133..24143) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(24302..24484) product sulfur starvation response protein OscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene oscA assembly_gap 24671..24783 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24955..26874) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103090.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 27042..28226 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 28376..29365 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032613485.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(29385..30596) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(30729..32009) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene gabT CDS complement(32193..33635) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103085.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene gabD CDS complement(33949..34263) product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 tRNA 34517..34593 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(34686..39623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 assembly_gap 39668..39750 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 39755..40009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(40128..40640) product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212041.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene pgaD CDS complement(40637..41989) product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164390.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene pgaC CDS complement(41993..43993) product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212043.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene pgaB CDS complement(44003..46486) product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082816276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene pgaA CDS complement(46656..48971) product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(49007..50020) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110517.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(50327..50596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 50793..51509 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093250.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(51681..52187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 assembly_gap 52197..52272 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(53525..54160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(54326..54976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(55045..56481) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268398.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(56478..57362) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(57374..57583) product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(57580..59664) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(59661..60119) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407381.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(60273..60518) product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705082.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(60700..61161) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 61378..61863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 61866..62627 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(62632..63564) product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(63552..64298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(64337..64936) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124345.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene cysC CDS complement(64920..66416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(66513..67058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(67181..72643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 note possible pseudo, frameshifted assembly_gap 67200..67209 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 67510..67519 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 68122..68131 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 69134..69229 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(72708..73580) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(73720..75195) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 75529..76119 product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 76251..76562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(76555..77049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(77079..80675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 assembly_gap 77914..78008 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 79308..79396 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(80672..81454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 81668..83845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114102.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 83852..84565 product DUF3142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(84652..85518) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737007.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(85538..86392) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105360.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(86398..87435) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104032.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(87461..88357) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105361.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 assembly_gap 88576..88658 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 88908..89591 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 90457..91134 product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 91131..92060 product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269373.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 92075..95509 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269374.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 95536..96003 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269375.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(96114..97994) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103402.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 rRNA complement(98226..98335) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence33 source 1..14057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..4275 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267345.1:non-ribosomal peptide synthetase locus_tag LOCUS_16850 CDS 4317..10763 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 assembly_gap 8543..8552 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10406..10581 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10681..10977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 10979..12643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 assembly_gap 12431..12533 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence34 source 1..121428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..1317 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763555.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 1256..2527 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene metK CDS 2715..3110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 3209..4888 product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269232.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene ligB assembly_gap 4770..4853 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5062..5457 product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(5498..5947) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110213.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 6094..7245 product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770915.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(7401..7787) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(7802..8638) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101583.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 8824..9993 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(9944..10849) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(10920..11327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 11652..13061 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene ahcY CDS 13209..14054 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346344.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene metF CDS 14176..14958 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707741.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 15265..17121 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(17203..17781) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551707.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(17813..18364) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266415.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 18705..19676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 assembly_gap 19580..19664 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19688..20191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 20422..21141 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(21259..21876) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 assembly_gap 22041..22123 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22711..23253 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089256.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 23318..24232 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105301.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(24237..25001) product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene madM CDS complement(25003..25419) product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene madL CDS complement(25485..26414) product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266411.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene mdcH CDS complement(26411..27046) product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(27047..27850) product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene mdcE CDS complement(27847..28698) product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(28691..28990) product malonate decarboxylase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378783.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(28990..29847) product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105305.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(29848..31524) product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765429.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene mdcA CDS complement(31700..32068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(32031..32660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(32925..33380) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(33373..39303) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266435.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(39311..41368) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266434.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 assembly_gap 41382..41467 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(42008..42373) product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene pilH CDS complement(42419..42826) product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551738.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene pilG CDS 43076..44029 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene gshB CDS 44107..45006 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004414710.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 45146..45715 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 assembly_gap 45975..46050 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 46311..46817 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736951.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene pyrR CDS 46841..47935 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 assembly_gap 47287..47378 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 47932..48945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 assembly_gap 48694..48780 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 48845..49285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 assembly_gap 49339..49430 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(49522..49941) product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769424.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 50193..50852 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080269995.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 assembly_gap 50970..50979 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(51005..52111) product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene pilU CDS complement(52223..53257) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene pilT CDS 53314..54000 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 assembly_gap 54255..54371 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 54964..55554 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404543.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 55759..56898 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266425.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 56906..57526 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377217.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene metW CDS 57553..57984 product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 57981..58577 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266424.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene rdgB CDS 58574..59863 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene hemW assembly_gap 59087..59168 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 59873..60196 product DUF3392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551720.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(60440..61222) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237838.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene trmB assembly_gap 60473..60550 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(61232..62026) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613959.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(62092..62310) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379876.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene thiS CDS complement(62383..62754) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269203.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 62825..63547 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene mtgA assembly_gap 63664..63673 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(63756..64610) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene rpoH CDS complement(64740..65762) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393643.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene ftsX CDS complement(65759..66430) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555631.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene ftsE CDS complement(66427..67869) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene ftsY CDS 68044..69396 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 69393..70883 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 70883..71497 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269210.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene rsmD CDS 71623..72972 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 72965..74428 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 74686..75651 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797805.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 assembly_gap 74701..74789 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(75691..76674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(76799..77461) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 assembly_gap 77476..77564 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(77783..78457) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022641646.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 78611..80041 product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102868.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 80088..80633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 80742..82427 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 assembly_gap 80871..80983 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 82543..83022 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348749.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene coaD CDS 83169..83420 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(83457..83801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(83868..84680) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372546.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene mutM CDS complement(84715..85581) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402256.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 assembly_gap 86022..86118 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 86163..87011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 87344..88423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 88466..89659 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene punC CDS 89942..91789 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105291.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene ilvD CDS complement(91932..92987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763647.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 93319..94806 product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097015.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene tcyP assembly_gap 94630..94741 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(94898..95452) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244533.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 95494..96873 product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269202.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 96866..98239 product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269201.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(98300..98839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(98964..99968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(99965..102142) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105688.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 assembly_gap 102168..102248 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 102808..102909 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 103019..103591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(103676..103840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(104029..104625) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(104622..105761) product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(105897..106934) product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(106978..108702) product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926325.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(108704..109768) product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930838.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(109873..110751) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(110768..112942) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269255.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 assembly_gap 113114..113228 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 113398..113844 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene cadR CDS complement(113960..114931) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105406.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(114980..115801) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382072.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene lgt CDS complement(115929..116711) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 116822..117568 product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(117824..120097) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382074.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene ptsP CDS complement(120119..120658) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555745.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 120742..121398 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 sequence35 source 1..200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence36 source 1..25276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 184..1071 product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086919.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene rhtA CDS 1242..1523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1534..2103) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938036.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 2194..2934 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 assembly_gap 3532..3611 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3650..4279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 assembly_gap 4337..4410 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4835..5722 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(5838..7646) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(7705..8874) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104556.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 assembly_gap 9158..9250 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9874..10437 product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089470.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene msuE CDS 10447..11685 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104574.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene ssuD assembly_gap 10578..10667 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11751..12995 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 assembly_gap 13367..13376 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13384..14109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 note possible pseudo, frameshifted CDS complement(14116..14529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 14575..15048 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396597.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene soxR CDS complement(15089..15859) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(15937..16602) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(16607..17299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 assembly_gap 17309..17406 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 18113..18235 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18248..19441) product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267559.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene sfnG assembly_gap 18840..18934 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19792..20028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 19909..21048 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115478.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 21156..21935 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737718.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(21903..22733) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene nudC CDS complement(22764..23576) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 23734..25233 product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene nhaB sequence37 source 1..5518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..3093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 assembly_gap 246..255 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(3471..>5518) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104446.1:filamentous hemagglutinin N-terminal domain-containing protein locus_tag LOCUS_18280 assembly_gap 3497..3577 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence38 source 1..285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence39 source 1..42682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(615..878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017699409.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(892..1143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(1165..1371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1385..1657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1650..1979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(2003..2425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(2480..3307) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107012.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(3502..4011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(4083..4532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 assembly_gap 4580..4689 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5239..5457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(5469..5819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(5824..6246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(6258..6476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(6560..8242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(8294..8536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(8679..8870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(8935..9180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(9186..9482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(9521..9673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(9677..9838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(9902..10057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 10319..10621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 note possible pseudo, frameshifted CDS 10618..10914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 note possible pseudo, frameshifted assembly_gap 11055..11064 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 11153..11581 product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 11571..12854 product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267948.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene umuC CDS complement(12851..13246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(13290..14558) product DUF1173 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529857.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(14569..15084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(15081..15347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(15491..16060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(16531..17160) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747119.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(17425..17841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(17876..18178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(18175..18525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(18522..19445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(19457..20230) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 20881..21153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 21170..21631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 21635..21928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 21915..24599 product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920277.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 24596..25282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 25310..25522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 25515..25919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 25907..26770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 26770..27435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 27462..28253 product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597362.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene virB9 CDS 28256..29539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 29549..30577 product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene virB11 CDS 30561..31463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 31493..31822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 31812..32417 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 32432..32914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 32959..33597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(33920..34675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(34748..37693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(37704..39260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(39253..39645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 40074..40529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 40526..41245 product StbB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264012.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene stbB CDS 41249..41635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 41773..42558 product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842205.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 sequence40 source 1..208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence41 source 1..256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence42 source 1..58411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1099..1818) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010203323.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(1815..2645) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104191.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(2679..3671) product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 4075..5202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(5260..6225) product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 6443..7573 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846352.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 7570..8001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 8064..9884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057917422.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 9877..12807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 12942..13691 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 assembly_gap 13752..13832 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13839..15503 product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113100.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 15662..15907 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089354.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 16055..17461 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113101.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 17472..18266 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113102.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 18266..19120 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113103.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 19117..20085 product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113104.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 20085..20357 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113105.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 20473..21219 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 21342..21923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(21927..23336) product GntR family transcriptional regulator MpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene mapR CDS complement(23422..24873) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895670.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene ccoG CDS complement(25057..25308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 25451..26347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 assembly_gap 25849..25937 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26463..28460 product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243982.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 28595..31933 product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267720.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene treS CDS 31930..34164 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104179.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene glgB CDS complement(34275..35321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(35633..36484) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268144.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 assembly_gap 36109..36192 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(36625..38784) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268142.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene glgX CDS complement(38925..39212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(39234..41117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 assembly_gap 41206..41309 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41778..44264) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene malQ assembly_gap 42203..42297 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(44261..44830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(44827..46104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 note possible pseudo, frameshifted assembly_gap 45023..45095 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(46161..47633) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411269.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene glgA CDS complement(48227..49180) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104476.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(49196..50215) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(50323..50769) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(50934..51398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(51537..53531) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 53869..54393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 54760..55287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 55483..57150 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104447.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 57184..57837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 assembly_gap 57735..57781 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 58091..58111 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence43 source 1..133634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..800) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763057.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(1794..2510) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407872.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(2507..3382) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431920.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(3379..4677) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763054.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene livM CDS complement(4681..5595) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266504.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(5769..6902) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736842.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(7265..8548) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112529.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(8724..10214) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895535.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 10378..11283 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 11628..12827 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene pncB CDS 12864..13691 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186707837.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene nadE CDS 13697..14029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 14061..15083 product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528763.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 15193..15888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(15925..16371) product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407854.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene azu CDS 16805..16978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(17197..18099) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(18099..20585) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(20673..23948) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105234.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(24125..24589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(24589..25509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 25791..31184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(31218..31421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(31429..33594) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 assembly_gap 31446..31570 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33797..37510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 37565..41542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(41564..42961) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317209.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene dnaB CDS complement(43077..43523) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene rplI CDS complement(43543..44433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(44470..44700) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene rpsR CDS complement(44729..45151) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene rpsF assembly_gap 45903..46003 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(46342..48948) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105236.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene rnr assembly_gap 49193..49202 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 49273..49359 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 assembly_gap 49477..49561 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(49653..51587) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266498.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(51728..53020) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366319.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(53075..54343) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763027.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 assembly_gap 53078..53158 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(54644..55513) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene hflC CDS complement(55513..56682) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene hflK CDS complement(56779..58080) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551820.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene hflX CDS complement(58093..58353) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene hfq CDS complement(58447..59388) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266496.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene miaA CDS complement(59442..61445) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266495.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene mutL assembly_gap 60681..60766 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(61442..62884) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198702760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(62885..63355) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317192.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene tsaE CDS complement(63343..64203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 64267..65340 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene queG CDS complement(65350..69354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(69554..70165) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(70253..70795) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene orn CDS 70906..71937 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene rsgA CDS complement(72014..73054) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763003.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene motB CDS complement(73058..73909) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763001.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene motA CDS 74120..75658 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 75702..76517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 assembly_gap 76913..77001 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 77008..77487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 77644..79470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(79573..80787) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene serB CDS 80920..82464 product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(82538..83113) product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244601.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(83425..85683) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762992.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene parC CDS complement(85801..86799) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463655.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(86799..87374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(87260..88783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 assembly_gap 87429..87510 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(88823..89446) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(89607..90425) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266482.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene cpdA CDS complement(90564..91019) product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551796.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(91010..91630) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366260.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 91841..92581 product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402864.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(92550..93842) product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266480.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene cytX CDS complement(93959..95848) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene thiC CDS 96289..97728 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762981.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 97757..99097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 assembly_gap 97765..97885 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(99180..100076) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114539.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 100173..100505 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762979.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 100576..101751 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266476.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 101748..102560 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 102602..103567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404692.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 assembly_gap 103607..103684 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(103730..105094) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene hldE CDS complement(105216..105866) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043054.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene cysC CDS complement(105859..106563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(106750..108555) product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010213170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene msbA CDS 108713..110572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(110621..111241) product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266854.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(111256..112140) product alpha-1,3-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene wapR CDS complement(112137..113291) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476096.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(113288..114172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(114230..115642) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266469.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(115639..116535) product antimicrobial resistance protein Mig-14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266468.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(116535..117671) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(117649..119406) product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377131.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(119575..121026) product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105266.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(121026..121778) product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266464.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(121775..122509) product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244579.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(122509..123315) product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266462.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene rfaP CDS complement(123312..124436) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266461.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(124436..125500) product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244577.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene waaC CDS complement(125502..126536) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene waaF CDS complement(126597..129536) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene glnE CDS 129921..132566 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422379.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene aceE assembly_gap 132770..133141 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence44 source 1..9007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..4121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090208471.1:non-ribosomal peptide synthetase locus_tag LOCUS_20320 assembly_gap 3422..3547 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 4624..4727 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6613..6824 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7540..7719 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence45 source 1..24710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 139..927 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266540.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(940..2886) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104011.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 3326..4225 product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770085.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(4360..4767) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene cueR CDS complement(4778..4990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 assembly_gap 5003..5084 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5611..7338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 assembly_gap 5623..5722 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7423..7809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770079.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 7956..8156 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092153.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 8329..9516 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266545.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(9527..9706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(9964..10977) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770073.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(11016..11309) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 11427..12356 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407991.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 12614..13330 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407992.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 13464..14843 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113893.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(14967..15920) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614495.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 16122..17210 product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414637.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(17223..17906) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463381.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(17896..18282) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226817.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 18367..18795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(19199..19780) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(19804..20454) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(20693..21613) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 21738..23087 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383172.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 23160..24653 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 sequence46 source 1..18415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2873 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090208471.1:non-ribosomal peptide synthetase note possible pseudo, frameshifted locus_tag LOCUS_20580 assembly_gap 1241..1375 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2462..2471 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2761..3420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 assembly_gap 3324..3333 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3869..4011 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4043..5968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 assembly_gap 5442..5554 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 6122..6396 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6419..7213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 assembly_gap 6814..6823 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7146..7823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 assembly_gap 7153..7162 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7820..10501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 assembly_gap 10294..10303 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10488..12167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 note possible pseudo, frameshifted assembly_gap 11714..11723 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 12021..12030 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12056..12901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 assembly_gap 12674..12683 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12793..16599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 note possible pseudo, frameshifted assembly_gap 15454..15543 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16177..16272 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 16999..17088 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence47 source 1..4582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(158..937) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161633151.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(934..2145) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770586.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2325..3839) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene purF CDS complement(3872..4366) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770588.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 note possible pseudo, internal stop codon sequence48 source 1..181578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..841) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142852.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 978..1901 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(1947..2222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 2473..3729 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103393.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(3743..4393) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529016.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(4561..5403) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112398.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 5538..6488 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368401.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 6620..7396 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083104.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(7414..7698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 7869..8072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 8261..8560 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113690.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(8600..9412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112339.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(9424..9771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(9759..11507) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112340.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(11532..11813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(11858..12385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(12352..14658) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112338.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene mgtA assembly_gap 12406..12516 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14947..15246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 15134..15367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 15702..16487 product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(16484..16891) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(16917..19550) product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(19590..20609) product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267946.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(20684..21772) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104308.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene modC CDS complement(21776..22456) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267944.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene modB CDS complement(22458..23225) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463409.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene modA assembly_gap 23411..23513 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23546..24610) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267942.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 24807..25271 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925670.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 25329..25964 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 26022..27005 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 assembly_gap 27199..27290 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27857..28027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380430.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(28063..28368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 28592..28948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400692.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(28982..29263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400694.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(29276..29458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 29740..30579 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088639.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene galU CDS 30766..32124 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463388.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene gorA CDS 32127..32894 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114237.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 32999..33172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 33207..34241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 assembly_gap 33878..33966 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34336..34794 product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204640.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(34915..35460) product DUF4946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463773.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 35680..36939 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 37007..38299 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526010.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 38316..39266 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063866.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 39421..40698 product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268556.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(40751..41665) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895683.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(41662..42690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 assembly_gap 42704..42775 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(43197..44306) product spermidine-binding protein SpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084301.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene spuE CDS complement(44483..45307) product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063168068.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 45618..46232 product ribonuclease T2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 46328..47026 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113515.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 47023..47337 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088669.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(47383..49737) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038165.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(49816..50637) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(50634..51158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(51278..51760) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027562923.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(51851..52810) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252799.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(52895..53971) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391989.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 54083..54952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 55020..55808 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 55809..56465 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704715.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 56462..57145 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723203.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 57150..58574 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807657.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 58574..59890 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930797.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 assembly_gap 59098..59191 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 59914..60279 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 60404..60988 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921379.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 61231..61548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 61749..62021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(62112..62510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 assembly_gap 62515..62600 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 62768..63601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(63493..64119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 assembly_gap 64125..64207 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(64702..66060) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 66233..67144 product HTH-type transcriptional regulator EutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753715.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene eutR CDS complement(67152..67553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093424.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(67589..68620) product class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975881.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene ampC CDS 69005..69952 product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101291.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene ampR CDS complement(70071..70763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(70892..72112) product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(72158..73420) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 73564..74031 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171812.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 74123..74689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 74775..75794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 75883..77238 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385416.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(77256..78470) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 78608..79558 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189405.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 assembly_gap 80102..80184 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 80399..81379 product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105579.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(81386..81784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(82034..82555) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003133652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 82469..82648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 82745..83374 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082512.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(83389..84834) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268386.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(84986..86491) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224508.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(86488..87357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 assembly_gap 87396..87481 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 88075..88968 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029651.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(88990..89373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 assembly_gap 89397..89490 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 90299..91225 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703477.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 91309..93036 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103282.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene ggt CDS complement(93101..94648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(94645..96336) product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267894.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene arnT assembly_gap 95736..95745 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(96654..97337) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268213.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(97582..98025) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762782.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(98221..98979) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266848.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(99100..100707) product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene rtcR CDS 100972..102198 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112811.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 102203..102856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 102868..103656 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105094.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 103666..104688 product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112809.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene rtcA CDS complement(104690..105595) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(105665..106360) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(106593..106904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617613.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 107601..108575 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130724.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene hemB CDS 108687..109589 product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(109580..110473) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807733.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 110756..111751 product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104033.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 assembly_gap 111942..112140 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(112502..113017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(113026..113742) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112292.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(113744..114289) product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895688.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 114457..115110 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 115114..116352 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene pncB assembly_gap 115961..115970 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 117011..117115 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(117277..118479) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531653.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(118537..119133) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(119288..120577) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268247.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 assembly_gap 119310..119394 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 120466..120475 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 121031..121822 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114532.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 121841..123001 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114530.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 123022..125109 product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114528.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 assembly_gap 125222..125356 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 125425..126063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 126063..127112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 assembly_gap 126068..126150 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 127129..128088 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 128092..128922 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182307726.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 128925..130574 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 130707..131408 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102071.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 131457..132089 product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114535.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 132200..132931 product two-component system response regulator AruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095718.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene aruR CDS complement(132946..138375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 assembly_gap 139292..139386 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 139390..140370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 140526..141944 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 142102..144105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 144148..144915 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528189.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 assembly_gap 144927..145018 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 145251..145955 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974385.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 145961..146659 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 146661..147665 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 147771..148331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 148401..149417 product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067707.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(149428..150564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 assembly_gap 150755..150947 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 151030..151650 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267741.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene lexA CDS 151650..152267 product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762447.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene imuA CDS 152275..153693 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463506.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 assembly_gap 154087..154178 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 154283..156862 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895514.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene dnaE2 CDS complement(156879..157103) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765645.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 157261..157959 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526980.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 158171..158758 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169172.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(158759..159598) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267623.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 159762..160247 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268902.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(160259..160603) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(160600..161085) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970751.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 161227..162132 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528172.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 162259..163278 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314085.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 163488..164081 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 164106..165398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 assembly_gap 165219..165347 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 165359..166111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 166108..166614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 166728..167633 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246046.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(167659..168429) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268261.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(168476..169807) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767375.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 assembly_gap 169850..169925 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(170013..170915) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068371288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 171022..171885 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226917.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 171882..172601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 172604..174073 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 174082..174864 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 174875..175675 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 175687..176916 product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene mhpF assembly_gap 175864..175951 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 176927..177964 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013499.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene dmpG CDS 178019..179455 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113292.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 assembly_gap 178527..178603 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 179636..181018 product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084265.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 assembly_gap 181214..181269 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence49 source 1..57457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..923) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407356.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(920..1840) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372160.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(1837..2979) product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene potA CDS complement(3060..4154) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(4194..4367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(4408..5514) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767078.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(5688..7052) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269274.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(7108..7347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(7332..8531) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382103.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 assembly_gap 7392..7490 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8573..9349) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 9724..11004 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 11291..11929 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024642508.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 assembly_gap 12096..12206 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12221..13054) product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene tauD CDS complement(13137..13967) product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105423.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene tauC CDS complement(13964..14203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 assembly_gap 14221..14317 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14889..15866) product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105422.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene tauA CDS 16549..17088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 note possible pseudo, frameshifted CDS 17331..17942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 18264..18902 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 19190..19783 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091915.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene ssuE CDS 19876..20841 product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 20867..22015 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene ssuD CDS 22025..22816 product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767089.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene ssuC CDS 22813..23619 product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427335.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene ssuB CDS 23661..23876 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555770.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(24126..24755) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817450.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 24885..26327 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298733.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(26545..27174) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(27394..28038) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765584.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(28028..29149) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266342.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(29151..29960) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105353.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(30070..31440) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266344.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(31440..32645) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105351.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 assembly_gap 32042..32051 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(32666..33907) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(34117..34872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403135.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(35362..36111) product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266347.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene yecC CDS complement(36115..36780) product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene tcyL CDS complement(36780..37574) product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765569.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene tcyJ assembly_gap 37627..37716 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37962..38957) product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266349.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 39148..40077 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010216200.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 assembly_gap 40201..40285 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 40502..42502 product choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405243.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene betT CDS complement(42679..42936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(43065..43961) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975353.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(44068..44808) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198766.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 44936..45826 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524197.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(46203..47066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 assembly_gap 47184..47556 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(47580..50633) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266339.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(50630..51712) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105357.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(51709..52809) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765592.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 52961..54121 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073564.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(54589..55371) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093057.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(55692..56588) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 assembly_gap 56694..56782 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence50 source 1..346010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..471) product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(524..1345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 assembly_gap 1352..1448 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2290..2961 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene rpiA CDS complement(3011..3940) product SdiA-regulated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105411.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(4210..4875) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(4916..6310) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 6513..7823 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene serA assembly_gap 7406..7501 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7887..8327) product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 8467..9240 product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(9298..9798) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112945.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(9798..10430) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666025.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 10539..11297 product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420191.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 11399..11902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(12036..13988) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236934.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 14269..15396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(15461..16636) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538730.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 16868..17605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105473.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 18403..18729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 18726..19139 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044768.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 19293..19661 product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266196.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(19709..21256) product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367573.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(21436..22338) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613652.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene hslO CDS complement(22488..22892) product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266240.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 23133..23588 product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186005924.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 23585..24490 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318100.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene rimK CDS complement(24536..25849) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763465.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(25964..26704) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318889.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene ompR CDS 27040..29364 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266280.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 29364..29747 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763459.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 29948..31531 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763456.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene gshA CDS complement(31693..32991) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763455.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene argA CDS complement(33131..34378) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763453.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene argE assembly_gap 33934..34032 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34698..36065 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763452.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 36295..38136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 assembly_gap 37554..37563 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(38126..39148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114782.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 39310..40230 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499312.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 40240..40689 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 40758..41075 product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551535.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(41146..41808) product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 41953..42831 product phloretin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112428.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene phlG CDS complement(42880..43209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 assembly_gap 43363..43441 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 44017..45105 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 45135..46331 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 46343..46783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 46999..48048 product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 48200..49477 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113027.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 49484..50410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(50401..53274) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114051.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene gcvP CDS 53704..54843 product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(54957..55340) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103095.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene gcvH CDS complement(55400..56482) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266272.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene gcvT CDS complement(56639..58255) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266271.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 assembly_gap 58379..58388 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(58423..59424) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247176.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(59531..60754) product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(60839..62026) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene ubiH CDS complement(62023..63357) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105380.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene pepP CDS complement(63384..63938) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621372.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 64103..64312 product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551573.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 64309..64626 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380079.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 64924..65529 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105381.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(65577..65735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317333.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 65921..66370 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765622.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 66519..67478 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966136.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 67475..70201 product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene rbbA CDS 70201..71319 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943323.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(71396..71809) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551568.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 71967..72944 product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 73174..74523 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403247.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene glpT CDS complement(74520..75146) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737044.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(75196..77598) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246690.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 77903..78385 product palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082771.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene pagP CDS complement(78426..79394) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768422.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(79394..80890) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317344.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene ubiD CDS complement(80948..82927) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895699.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(83148..84407) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551560.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene rho CDS complement(84653..84982) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380053.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene trxA CDS complement(85187..85888) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247319.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 86144..86929 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266305.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 86954..87619 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403260.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 87619..88266 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464032.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 assembly_gap 88693..88911 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 89378..90880 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene ppx CDS complement(90867..93089) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266303.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene ppk1 CDS complement(93108..94121) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403849.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene hemB CDS 94329..94940 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266302.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(94918..96156) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 96270..96932 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266301.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene elbB CDS complement(96948..97184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 assembly_gap 97186..97279 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(97506..99401) product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103008.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(99498..100400) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(100423..101136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 101284..102609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 102969..104363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 104380..104754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 104770..105387 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene lpoB CDS 105388..106137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(106366..106917) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266152.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(107087..108997) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266153.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 109048..109512 product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266154.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 assembly_gap 109780..109962 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 110919..111584 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769477.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(111649..112107) product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738602.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(112300..112812) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(113038..114276) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(114273..115400) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103003.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(115418..116185) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266160.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(116182..117123) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318426.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene hemC CDS complement(117262..118008) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(118005..119066) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 119271..120665 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103000.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene argH assembly_gap 120696..120859 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(121047..121706) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196420.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS 121832..122116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 122283..122531 product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 122715..125561 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266242.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(125596..126009) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246537.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene rnk CDS complement(126238..126459) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318094.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(126462..126794) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768497.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene cyaY CDS 127011..127172 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103040.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 127182..128429 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401767.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene lysA CDS 128434..129264 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401768.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene dapF CDS 129278..130003 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 130006..130902 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246535.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene xerC CDS 130902..131609 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(131673..132002) product transcriptional regulator SutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266246.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene sutA CDS complement(132105..132530) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318084.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 assembly_gap 132726..132802 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(132820..134160) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(134194..134532) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene glnK CDS 134908..135207 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768515.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 135490..135789 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095863.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(135768..136610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 assembly_gap 136731..136832 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(137624..139630) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769504.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(139627..140778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 assembly_gap 139933..140021 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 140990..141080 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 142305..142691 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(142709..144379) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266168.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 144647..146656 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401585.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene rep CDS 146809..147381 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(147414..148115) product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene uhpA CDS 148382..148945 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206555.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 149007..149777 product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465919.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 149797..150576 product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484311.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 150714..153317 product fimbrial biogenesis outer membrane usher protein CupB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895669.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene cupB3 CDS 153320..154336 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206552.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 154413..154940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 155000..155521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 155593..156615 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096966.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(156646..158568) product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266268.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(158705..159133) product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098270.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(159309..159950) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314015.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(159987..161060) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403944.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene alr CDS complement(161151..161504) product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769531.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(161476..162669) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403947.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene dadA assembly_gap 162699..162783 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 163022..163510 product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314011.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene dadR CDS complement(163532..163882) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769534.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 164032..165324 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266264.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(165321..165563) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403956.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 165745..167178 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769539.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 167251..168792 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403960.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(168789..169937) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 assembly_gap 170049..170213 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(170228..171721) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102988.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 171960..172322 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096551.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(172323..173705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(173868..174023) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551515.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene rpmG CDS complement(174036..174269) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551514.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene rpmB CDS 174720..176309 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266261.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(176438..177112) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769555.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene radC CDS 177246..178454 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463702.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene coaBC CDS 178460..178915 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266259.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene dut CDS 178998..181595 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114359.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 181649..182554 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene argB CDS complement(182625..183404) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551505.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 183487..184131 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246510.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene pyrE CDS 184138..184719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(184825..185190) product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769565.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(185227..185949) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313989.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene rph CDS 186197..187060 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403997.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 187073..187693 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377979.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene gmk CDS 187861..188124 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551500.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene rpoZ CDS 188185..190290 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769571.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene spoT CDS 190327..190707 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 190786..191523 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313983.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(191765..192622) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 192888..193796 product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246518.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene exbB CDS 193803..194231 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551495.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene exbD assembly_gap 194445..194534 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 195315..196235 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551493.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 196202..198316 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425918.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene recG CDS 198395..199795 product aminoacyl-tRNA deacylase and HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769583.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 assembly_gap 199900..200370 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(200396..200839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(200913..201863) product type VI secretion system-associated lipoprotein TagQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106614.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene tagQ CDS complement(201942..203669) product type VI secretion system-associated regulator TagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106615.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene tagR CDS complement(203662..204603) product type IV secretion associated ABC transporter permease TagS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083634.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 gene tagS assembly_gap 204659..204752 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(204956..205672) product type IV secretion associated ABC transporter ATP-binding protein TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114657.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene tagT CDS complement(205672..208806) product serine/threonine protein kinase PpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene ppkA CDS complement(208821..209549) product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene pppA CDS complement(209550..210203) product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene tagF CDS complement(210200..213703) product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene tssM CDS complement(213700..215025) product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(215032..216366) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115052.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene tssK CDS complement(216382..216762) product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083660.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene tssJ assembly_gap 216814..216898 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 217126..217135 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(217153..218547) product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene tagH CDS 218938..219969 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene tssA CDS 220051..220566 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene tssB CDS 220582..222075 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene tssC CDS 222217..222705 product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene hcp CDS 222868..223392 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104971.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene tssE CDS 223389..225248 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene tssF CDS 225263..226264 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene tssG CDS 226257..228938 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene tssH CDS 229046..230980 product type VI secretion system spike protein VgrG1a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895494.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene vgrG1a CDS 230996..231421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 assembly_gap 231861..231948 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 231981..235961 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025330854.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 235962..236366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 236449..236733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 236884..237180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(237188..237721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769947.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(237718..239013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(239041..239475) product type VI secretion system effector EagT6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083692.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene eagT6 CDS complement(239702..239977) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383132.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(240167..241396) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105519.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 assembly_gap 241039..241120 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(241440..241607) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401239.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 241825..242388 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 242388..243278 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245012.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene ubiA assembly_gap 243346..243520 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(243715..244992) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266536.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 245113..246465 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103262.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 246468..247322 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419249.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 247458..247763 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 247760..248509 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407968.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 248523..249131 product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103259.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 249162..249725 product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095282.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 249997..251976 product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(251973..254726) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463552.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(254723..255163) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268993.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 255239..255709 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763215.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 255835..256620 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032699777.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(256781..257047) product DUF3613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399719.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(257080..257796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269004.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(257808..258263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 assembly_gap 258292..258383 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(258785..259672) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269003.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(259685..260959) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313926.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(260959..262146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244656.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(262143..263381) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269002.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(263400..264338) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105205.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene cpaB CDS 264645..264836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 264903..265316 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763193.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(265352..267022) product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175308.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(267221..268669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 269181..269474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555356.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 269532..270881 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244661.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(270902..271699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(271696..273030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(273303..275216) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763203.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene speA CDS complement(275444..275815) product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(275991..276548) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399749.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(276552..277619) product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268997.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 277952..279613 product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105198.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 279669..281708 product methyl-accepting chemotaxis protein CtpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112328.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene ctpL assembly_gap 281167..281285 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 281740..283536 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269005.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 283669..284124 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555369.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene aroQ CDS 284149..284613 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555370.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene accB CDS 284631..285989 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244651.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene accC CDS 286128..287006 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244650.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene prmA CDS 287037..288341 product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269007.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 288518..289531 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399694.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene dusB CDS 289528..289848 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555375.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene fis CDS 289985..291676 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341009.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene purH CDS 291809..293104 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399692.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene purD CDS 293205..296075 product hybrid sensor histidine kinase/response regulator RetS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399691.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene retS assembly_gap 293321..293411 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 296137..296733 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269009.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(296764..298470) product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105215.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene cobJ CDS complement(298467..299201) product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763136.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(299198..299824) product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269015.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(299817..301214) product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193383855.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene cobG CDS 301332..302543 product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269017.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 302536..303633 product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244641.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 303630..304352 product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269019.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 304407..304559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 304565..304888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 305035..305439 product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105383.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 305487..305972 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763123.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 305994..306428 product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105217.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 306522..308651 product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 308796..310178 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 310332..313256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 assembly_gap 312376..312629 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 313223..313232 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 313340..313489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 note possible pseudo, frameshifted CDS 313486..314436 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269429.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 314433..315443 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114019.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 315866..317131 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269025.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene urtA assembly_gap 317208..317521 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 318920..319999 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269027.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene urtC CDS 319996..320871 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376420.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene urtD assembly_gap 320933..321036 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 321709..322548 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269030.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 322602..322904 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene ureA CDS 322913..323446 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269031.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 323454..323987 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269032.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 323984..324304 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391866.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 324301..326001 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene ureC CDS 326079..327224 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269036.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(327237..327545) product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024560.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene cbpM CDS complement(327548..328501) product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763092.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene cbpA CDS 328802..330067 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(330281..331291) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419507.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(331353..331883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(332190..332486) product PsiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105225.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(332573..333358) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103975.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 333457..334335 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105226.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(334351..335241) product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170261.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(335342..335653) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103070.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(335657..336295) product FMN-dependent NADH-azoreductase AzoR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114189.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene azoR1 CDS 336434..337366 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895522.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 337454..337984 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376387.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 assembly_gap 338088..338179 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(338385..340454) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105228.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 340816..341259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 341425..342057 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555418.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 342295..342795 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244624.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene ureE CDS 342792..343466 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269042.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 343476..344090 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368915.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene ureG assembly_gap 344449..344543 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 344615..344779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 344852..345985 product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266506.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 sequence51 source 1..10349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 486..1550 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266786.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 assembly_gap 1301..1391 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1568..7699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(7794..8696) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266785.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 8836..9711 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266784.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(9735..9959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 sequence52 source 1..240693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(828..6968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 assembly_gap 7435..7518 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7776..8456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(8498..9223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(9257..11083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268419.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(11226..13130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103801.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 13476..15728 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463456.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(15805..17643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268419.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(18002..19567) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268416.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(19783..20208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 assembly_gap 20231..20354 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20784..22805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(22735..25746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 assembly_gap 22818..22904 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25994..28735) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268414.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene acnA CDS 28983..30050 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268413.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene rlmM CDS 30077..30328 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene tusA CDS complement(30350..31753) product proton-coupled multidrug efflux MATE transporter PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112388.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene pmpM CDS 31929..33164 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766914.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene pdxB assembly_gap 32701..32801 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(33223..33399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 33677..35464 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766911.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(35518..35799) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378666.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(35886..36428) product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315164.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(36551..38458) product geranyl-CoA carboxylase subunit apha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene atuF assembly_gap 38491..38500 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(38603..39421) product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene atuE CDS complement(39418..40575) product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene atuD CDS complement(40712..42328) product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene atuC CDS complement(42332..43201) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(43214..45004) product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 45180..45803 product atu genes transcriptional repressor AtuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090989.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene atuR CDS 45969..46718 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443274.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(46781..47329) product pyoverdine signaling pathway sigma factor PvdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113068.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene pvdS CDS 47636..48394 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122219211.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 48472..52329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 note possible pseudo, internal stop codon, frameshifted CDS 52381..61509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 note possible pseudo, internal stop codon, frameshifted assembly_gap 61248..61390 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(61729..63837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(64029..64808) product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089790.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene dsbG CDS complement(64784..65653) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(65654..67402) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103572.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene dsbD CDS 67629..68303 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 68306..69562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 assembly_gap 69264..69363 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 69483..69731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 69922..71508 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267338.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 assembly_gap 71326..71402 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 71492..71716 product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304661.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(71759..74269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 assembly_gap 74323..74404 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(74696..78172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(78307..79251) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406946.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(79252..80151) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406943.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(80148..80918) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267339.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(80915..81844) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267340.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(81892..82455) product DUF6162 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(82452..82808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406932.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(82805..83344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(83341..84549) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267342.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 assembly_gap 84603..84973 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 85132..86112 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103869.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 86192..89527 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464036.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 assembly_gap 89498..89507 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 89509..89700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 note possible pseudo, frameshifted CDS 89697..97847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 assembly_gap 93239..93248 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 93476..93591 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 97863..101120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 note possible pseudo, frameshifted assembly_gap 101082..101091 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 101107..101967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 note possible pseudo, frameshifted assembly_gap 101662..101671 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 101964..103706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 assembly_gap 103193..103301 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 103681..108396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 assembly_gap 108280..108391 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 108420..108620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 assembly_gap 108637..108700 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(108842..111301) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463309.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(111564..113228) product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103875.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(113319..114218) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267351.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(114275..115549) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103877.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(115630..116961) product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene pvdM CDS 117141..118760 product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103878.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(118903..120282) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267355.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(120290..122263) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769685.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(122264..123436) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769683.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 123746..124228 product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene fpvI CDS 124477..127245 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808882.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene mgtA assembly_gap 125958..125967 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 127273..127989 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706774.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 128258..128884 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554843.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(128898..129701) product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815699.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene dkgB CDS complement(129799..130041) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108924.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(130051..130602) product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114785.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(131109..131582) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226992699.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 assembly_gap 131583..131592 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(131605..134679) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267494.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(134681..135673) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103299.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 assembly_gap 135685..135821 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(136037..136576) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095346.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 136832..137698 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211685.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 137783..139243 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973731.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(139340..141772) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104570.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(142001..143215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 assembly_gap 143512..143724 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(143837..144802) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114934.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(144802..145299) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089775.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(145432..146859) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205562.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 147047..147487 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 147602..148507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(148502..149323) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266172.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(149320..150408) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 assembly_gap 150458..150540 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(150687..151571) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266170.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 151828..152427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 note possible pseudo, frameshifted CDS 152403..153146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 note possible pseudo, frameshifted CDS 153155..154096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 154093..155031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 155481..156086 product transcriptional regulator RhlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119559.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene rhlR CDS 156400..157014 product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113896.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene rhlI CDS 157216..158508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 158505..159353 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730206.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene prmC CDS 159350..160612 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 160640..160969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 160973..163018 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene pabB CDS 163011..163895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 163895..165394 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803919.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(165455..166927) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267581.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 assembly_gap 167681..167765 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 167886..170132 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268475.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 170319..170819 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175137776.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 170860..171843 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267457.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 171941..174391 product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115567.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(174582..175763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 assembly_gap 174826..174931 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(175969..176424) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183828876.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 176583..177503 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967190.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS complement(177510..178661) product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268162.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(179208..179576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 179727..180362 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768035.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(180582..182021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 tRNA complement(180959..181052) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 assembly_gap 182057..182338 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(182654..183469) product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104164.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(183597..185204) product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267706.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS complement(185216..186379) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(186614..188101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(187989..191693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 assembly_gap 188494..188584 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(191893..197097) product NEL-type E3 ubiquitin ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104869.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 assembly_gap 195503..195611 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(197189..199120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 assembly_gap 197499..197607 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 199840..200048 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(200130..201029) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267708.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(201070..201474) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762545.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(201566..202495) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 202647..203876 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104167.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(204103..205437) product phosphate ABC transporter substrate-binding/OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267709.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(205662..206165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 assembly_gap 206207..206302 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 206759..207409 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345438.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 207525..209201 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104170.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 209198..212872 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463502.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(213025..214017) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 214126..215037 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267711.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 assembly_gap 215540..215641 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(215686..216063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 216405..218711 product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(218854..219852) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103965.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(219993..220406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 assembly_gap 220447..220558 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 221095..222021 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064421.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(222035..222580) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418807.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(222655..223122) product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766304.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(223317..223556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 assembly_gap 223606..223708 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 224613..225332 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398720.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 225387..225734 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974572.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 225784..226896 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111446.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene zapE CDS 226995..227486 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766220.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 227640..229436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 assembly_gap 229314..229398 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 229453..232533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 assembly_gap 233111..233189 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 233230..237207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 237322..238302 product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766216.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene gnd CDS 238299..239822 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268136.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene zwf CDS 239819..240643 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 sequence53 source 1..13838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 210..219 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(460..1884) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(1891..4035) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(4205..5494) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032606785.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 assembly_gap 5450..5459 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6062..6454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 assembly_gap 6525..6687 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 7184..7193 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7343..7654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(7905..13379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 assembly_gap 8581..8656 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 10206..10282 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13360..13578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 sequence54 source 1..84377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(46..1245) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208741.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 1351..2241 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(2340..3098) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315093.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 3229..4164 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112652.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(4231..4965) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971646.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(5039..6628) product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084774.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 7060..8112 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267458.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(8109..9020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 note possible pseudo, frameshifted CDS complement(9017..13270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267226.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 note possible pseudo, frameshifted CDS complement(13373..18460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267226.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 assembly_gap 18521..18686 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18810..19130) product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245870.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 19297..19551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380539.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(19562..20062) product elongation factor GreAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766772.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(20059..20466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268555.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 20592..21725 product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene earP CDS 21774..22343 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404205.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 assembly_gap 22448..22604 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(22634..23653) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103700.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(23680..24099) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766782.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(24385..24837) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268553.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(24911..25867) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119870.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 25971..26720 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268552.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(26710..27591) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434445.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 27660..27890 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110987.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 27949..29160 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(29289..30635) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766790.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 30791..31546 product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766792.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(31550..32341) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 32751..34424 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245115.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 assembly_gap 34557..34693 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34708..35475) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268548.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(35574..36131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 assembly_gap 36231..36431 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(36501..37388) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397849.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene htpX CDS complement(37707..38918) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004657364.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 38823..39155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 39142..39537 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268546.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene msrB CDS 39672..40157 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397843.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 40154..40612 product hydroperoxide stress response transcriptional regulator OspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114767.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene ospR CDS complement(40599..42917) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766801.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 43093..43983 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268543.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 43980..44462 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(44470..47418) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196173418.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(47563..51246) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267442.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(51255..51884) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423744.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(52194..52610) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373331.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(52876..54207) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408510.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(54277..55440) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579450.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(55573..55914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103249.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(55911..56288) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373338.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(56291..56605) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373339.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 56947..58155 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(58157..60112) product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 60290..61408 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408504.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 61401..62372 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337402.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 62439..62675 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 62823..63023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 63174..63506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086015.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 63587..64477 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235933.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(64499..64945) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene aroQ CDS complement(65109..65330) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315600.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(65395..65994) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113968.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene mobA CDS 65972..66652 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617455.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene moaB CDS 66636..67862 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 68011..69159 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(69174..69722) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412368.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(69781..70515) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408100.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene fnr CDS 70670..71209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(71213..71467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(71464..72663) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103794.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene hemN assembly_gap 71496..71582 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(72745..73428) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(73421..73639) product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene ccoS CDS complement(73662..76205) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268428.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 assembly_gap 74981..75102 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(76327..76866) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103795.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(76878..78293) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene ccoG CDS complement(78598..79581) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087292.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene ccoP assembly_gap 79434..79443 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(79578..79763) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087298.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(79769..79972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 assembly_gap 80090..80169 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(80454..81896) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087306.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene ccoN CDS complement(82231..83169) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087292.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene ccoP CDS complement(83166..83360) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766941.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(83347..83769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 note possible pseudo, frameshifted assembly_gap 83436..83445 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 83776..83785 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence55 source 1..503646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(223..417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(1238..1999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(2189..2833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(3038..3364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(3647..4036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(4167..5192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(5271..5627) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532154.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(5648..6337) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177082959.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 6541..7974 product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970759.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(8206..9132) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101343.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 9249..9644 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101334.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 9932..10360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 10616..10897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(10781..11173) product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532540.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 11281..12144 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930765.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(12234..12452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(12431..13327) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072054.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 13758..14162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(14315..14926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 15484..16659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(16715..17584) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967171.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 17906..18670 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 18834..19148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(19158..19763) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120055.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 19873..20985 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400929.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 21027..21335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 assembly_gap 21571..21671 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 21742..22020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 22133..24331 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971066.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 24354..24776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 24876..26411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(26465..26845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317528.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(26955..27695) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665641.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 27801..29156 product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene pcaB CDS 29225..30526 product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082442.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene dctA CDS 30595..31986 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919970.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene fumC CDS complement(32084..33016) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 33213..33647 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268889.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(33663..34559) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104938.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(34613..35488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 35660..36622 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104060.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 36791..37624 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene rarD CDS 37822..41307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 assembly_gap 37998..38114 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41386..43656) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103898.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(43932..45950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(46317..48281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(48547..49239) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378513.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene ung CDS 49374..50486 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(50765..51127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 assembly_gap 51300..51438 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(51480..52319) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104981.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(52435..53433) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268818.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(53486..54379) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268819.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 54476..54877 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 54883..55485 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768608.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 55677..56273 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380941.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene sodB CDS 56607..58658 product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104985.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 assembly_gap 58982..59063 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 59162..60328 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 note possible pseudo, frameshifted CDS 60544..61971 product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268823.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 61999..63063 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104987.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 63063..64163 product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268825.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 64428..65576 product multidrug efflux RND transporter periplasmic adaptor subunit MexV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115243.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 gene mexV CDS 65591..68614 product multidrug efflux RND transporter permease subunit MexW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112762.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene mexW assembly_gap 68632..68892 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 68913..73013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 assembly_gap 73060..73122 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(73301..76072) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104119.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene metC CDS complement(76069..76725) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141701.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(76722..77318) product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104118.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(77348..78169) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104117.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(78156..78845) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762766.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(78835..79557) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104116.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(79557..80771) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388890.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(80768..82276) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039043.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 assembly_gap 81571..81669 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(82273..83094) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104115.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(83233..84201) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104115.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 84309..85166 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762770.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 assembly_gap 85341..85407 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(85429..86727) product two-component system sensor histidine kinase BprS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527959.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene bprS CDS complement(86732..87433) product two-component system response regulator BprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523775.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene bprR CDS 87589..88746 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810338.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 88749..91841 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067600.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(91822..93366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 assembly_gap 92130..92225 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(93366..94772) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112722.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene gspE assembly_gap 94830..94922 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(94923..97328) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213605796.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene gspD CDS complement(97325..97867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(97860..99020) product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895515.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene gspL CDS complement(99017..100003) product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112726.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene gspK CDS complement(100012..100461) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085349.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene gspG assembly_gap 100610..100619 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 100828..101253 product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085347.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene gspI CDS complement(101213..101644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 101773..102228 product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112728.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene gspH CDS 102225..102833 product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112729.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 assembly_gap 102884..102988 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(103115..104071) product anti-sigma factor VreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106396.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene vreR assembly_gap 104142..104261 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(104723..105439) product TonB-dependent outer membrane receptor VreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120815.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene vreA CDS complement(105607..106071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 106390..106716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(106731..107366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 assembly_gap 107457..107546 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 108171..108446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 108528..108947 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112927.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 109085..110011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(110074..111231) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(111228..111479) product psl/pyoverdine operon transcriptional regulator PpyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090502.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene ppyR CDS complement(111672..112766) product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086907.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 assembly_gap 113505..113608 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 113817..114254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(114393..115676) product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene dctM CDS complement(115676..116314) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114245.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(116505..117491) product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene dctP CDS complement(117582..118394) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085920.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(118567..119781) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083368598.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(119781..121130) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(121141..122304) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(122326..123153) product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085910.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 123283..124176 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085908.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 124308..125228 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771350.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene tal assembly_gap 125340..125445 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 125576..126508 product TIGR03571 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(126525..127379) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119197.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 127477..128124 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105458.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 128285..129745 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527615.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(129742..131826) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104176.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(131975..132436) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402606.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene rpiB CDS 132775..133785 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267783.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 133936..135051 product erythritol/L-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402615.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(135116..136447) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369244.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(136564..137505) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(137502..137897) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346527.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(137894..138868) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(138888..140078) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(140199..141098) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(141091..141864) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200681.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 141748..142047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 142248..143786 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066493188.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(143823..144263) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705325.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 144342..145574 product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114387.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 assembly_gap 145609..145891 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(145938..147584) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198536.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 tRNA 146546..146622 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(147730..148893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(149247..149900) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266675.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 150031..150729 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087036.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 150927..152684 product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399325.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 152671..154431 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116848363.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 assembly_gap 153254..153321 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 154585..156600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 assembly_gap 156681..156776 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(157072..157833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(157836..159374) product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971068.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(159514..159924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083612.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(159956..160360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083612.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 160581..162197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 assembly_gap 161783..161924 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 162091..163896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 163977..165137 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 assembly_gap 164009..164104 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 165642..165732 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 165759..166631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(166722..167156) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815713.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 167257..168225 product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050122195.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene ftrA assembly_gap 168745..168839 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(168988..169587) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207122.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 170102..172444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 assembly_gap 172351..172438 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(172820..173338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 173572..174273 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 174379..175545 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene ada assembly_gap 175343..175457 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 175705..176634 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039561.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(176675..177616) product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704920.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene cynR CDS 177714..178115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 178141..179529 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531968.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 179565..180593 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550569.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(180623..181402) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 assembly_gap 181481..181557 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 181903..183189 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114420.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 183201..184676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(184681..184944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 assembly_gap 184967..185103 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 185112..185318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 185406..186188 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388863.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(186330..187226) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102472.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 187359..187796 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 188072..189070 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147579.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 assembly_gap 189154..189228 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(189271..190365) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266576.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene mnmH CDS complement(190365..191399) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103287.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene selD CDS 191625..192950 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096956.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene gltP assembly_gap 193024..193106 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 193222..194061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 194161..195069 product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804426.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 195059..195571 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 195692..196519 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113300.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 196599..196976 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392702.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(197055..198251) product enoyl-ACP reductase FabV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817460.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene fabV CDS 198469..199413 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039910.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 assembly_gap 199464..199585 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(199623..200963) product outer membrane porin OprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112576.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene oprD CDS complement(201481..202248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(202251..203177) product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248970.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene wtpA assembly_gap 203347..203412 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(203434..203658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(203721..204047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 204243..205214 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729929.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 205341..206081 product two-component system response regulator BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113023.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 gene bfmR CDS 206078..207391 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113022.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 207504..207902 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267535.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 208006..209379 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024682821.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene ppnN CDS 209582..209833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 209830..210171 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(210173..210829) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(210938..211726) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172604.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(211876..212430) product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088492.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(212534..213298) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene tam CDS 213400..214308 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206516.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(214428..214802) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190990.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 214913..215815 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(215889..216326) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143849.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 216404..217552 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971922.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 217815..218690 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925705.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene dapA CDS 218756..218917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 assembly_gap 218899..218908 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(218985..220529) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265659.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 tRNA complement(220735..220811) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 221310..221636 product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554423.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(221779..223089) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene mgtE CDS 223027..223197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 223542..224021 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245069.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene bamE tRNA complement(224062..224138) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 assembly_gap 224236..224245 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(224352..224442) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(224505..224693) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554426.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene csrA assembly_gap 224873..224942 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(224952..226193) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731386.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(226287..228911) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024642718.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene alaS CDS complement(229059..230012) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene ltaE CDS 230570..231061 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616613.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 231202..232722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(232719..233726) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404084.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene astE CDS complement(233744..233956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30650 assembly_gap 233960..234046 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(234188..235534) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103720.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene astB CDS complement(235715..237181) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797808.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene astD CDS complement(237181..238206) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268515.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene astA CDS complement(238279..239295) product arginine/ornithine succinyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404093.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 gene aruF CDS complement(239459..240679) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103718.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 241358..244576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 244653..245192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(245206..246282) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740596.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene argR CDS complement(246323..246514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 assembly_gap 246566..246694 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 246732..247193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(247183..248295) product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767739.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(248298..248996) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103715.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(248993..249682) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369874.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(249774..250550) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767735.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 assembly_gap 251069..251206 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(251265..251828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(251722..253305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 assembly_gap 252075..252160 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 253422..253509 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 253788..254051 product DUF2790 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740605.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 254503..254667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 assembly_gap 254631..254640 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 255149..256396 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393710.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(256473..256769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 assembly_gap 257064..257149 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 257361..257585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(257838..258239) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691454.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(258379..258561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 258512..258841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(258901..259461) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399117.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(259569..260507) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850115.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 260626..261429 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081161376.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(261481..263079) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765488.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(263217..264266) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268359.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 264464..265078 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765127.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 265249..266331 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103632.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 266514..267785 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269298.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 assembly_gap 267602..267717 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 267769..267906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 267990..268517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(268540..269373) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113743.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 269501..270211 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268299.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(270256..270582) product DUF2025 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082265.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 270813..271937 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407635.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 272054..272362 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090497.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS complement(272455..273699) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113624.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(273822..275108) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102111.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 275398..276201 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113625.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(276202..276642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 276927..277949 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104683.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 278070..279683 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115437.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(279735..280631) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038319.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 280753..281511 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 assembly_gap 281619..281753 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 282732..283640 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101696.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(283644..284078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 284168..285022 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090978.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(285030..285872) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045790855.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 285983..286711 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839397.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(286866..288110) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(288107..288598) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974220.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(288664..289008) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 289226..289711 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267263.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 289765..290238 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104651.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(290456..290638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 290660..291652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(291716..292213) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808849.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 292378..292518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(292523..293215) product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene kdpE CDS complement(293212..295893) product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526440.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(296002..297162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 note possible pseudo, frameshifted CDS complement(297059..298084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 note possible pseudo, frameshifted assembly_gap 297141..297150 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(298077..298784) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883955.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene kdpC CDS complement(298795..300501) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883954.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 gene kdpA CDS complement(300981..301466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 301628..302848 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene alaC CDS complement(302974..304326) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107128.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(304424..304954) product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107130.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 305182..306213 product LacI family DNA-binding transcriptional regulator GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107131.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene gntR CDS 306425..307174 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103399.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(307215..308660) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 308928..309494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(309605..310924) product biofilm dispersion protein BdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082971.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene bdlA CDS complement(311324..312190) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731454.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 312299..312904 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene gstA CDS complement(312908..314350) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530835.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(314401..315405) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222366.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(315430..316359) product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210033.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(316359..317372) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268640.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(317469..320171) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(320263..321222) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114875.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS complement(321224..321733) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114876.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(321965..322759) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114463.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(322769..323710) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533777.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(323826..323945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 324034..324471 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667376.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS 324531..325364 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246274.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(325368..325907) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268642.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene def CDS complement(325910..326854) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767549.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(327044..327232) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402493.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 327433..327813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363371.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(327971..329038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 note possible pseudo, frameshifted CDS complement(328987..329673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 note possible pseudo, frameshifted assembly_gap 329039..329048 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 329808..329875 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(330149..331837) product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268684.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene fadD2 CDS 332097..333041 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 333101..333571 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740134.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 assembly_gap 333742..333978 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(334115..334582) product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615514.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 334789..335025 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 335042..336226 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(336516..337181) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764046.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(337199..337912) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266837.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene pgl CDS complement(337894..339453) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266836.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene zwf assembly_gap 338023..338107 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 339655..340524 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552324.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 assembly_gap 340607..340738 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 340739..341431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(341692..343041) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266835.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(343131..343571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 assembly_gap 343586..343677 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(344466..345308) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406653.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 assembly_gap 344478..344561 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(345301..346209) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375907.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(346354..347691) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736422.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(347766..348965) product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104472.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 349371..350015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(349984..351444) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197678549.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(351434..352165) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764051.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(352300..353259) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266830.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(353256..355082) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406660.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene edd CDS 355294..356295 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375919.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene gap CDS 356335..356799 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454351.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 assembly_gap 356812..356893 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(356965..357162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(357189..357908) product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405954.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(357913..358593) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739535.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(358785..360065) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268827.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(360055..360738) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(361010..362656) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010439729.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene groL CDS complement(362706..362999) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304675.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(363258..363731) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768585.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene fxsA CDS complement(363797..364528) product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(364581..365588) product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620274.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 365753..366103 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768582.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 366148..367698 product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268831.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 367815..369530 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104817.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 369548..370501 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245435.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(370606..371667) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406165.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene dinB assembly_gap 371981..372128 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 372337..372413 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 372694..375336 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266997.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene mprF CDS 375336..376616 product virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266996.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(376686..378584) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766050.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(378653..378973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 378972..380309 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266994.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene rimO CDS 380416..380865 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766046.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 381039..381749 product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266992.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 381807..382268 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766044.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 382395..383165 product 3-oxoacyl-ACP reductase RhlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113116.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene rhlG assembly_gap 383228..383237 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(383393..384487) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112514.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 384410..384643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 384793..385968 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071545.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene nhaA CDS complement(386107..386571) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381490.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 386745..387023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082053.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(386975..387622) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268697.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene pdxH CDS complement(387662..388879) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268698.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(389008..390153) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764919.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(390302..392674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(392764..394908) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764917.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene dinG CDS 395007..395471 product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619982.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(395574..396332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381499.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(396325..396603) product DUF1145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268704.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 396850..397347 product DUF6231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381502.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 397352..397828 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268706.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(397821..398324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764901.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 398523..398984 product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081986.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(399257..400645) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(400642..401352) product two-component system response regulator BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113023.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene bfmR CDS 401549..403936 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037900.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 403943..404623 product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812970.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 404655..405773 product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene yiuA CDS 405852..406922 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128344.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 406919..407701 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161751.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(407706..408257) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103847.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 408450..410903 product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104884.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 411230..412009 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268711.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 412066..412794 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463429.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 412791..413501 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268712.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 413513..414631 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764877.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 414639..415403 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246637.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 assembly_gap 415467..415476 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(415577..416413) product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092003.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene pheC CDS complement(416541..416747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(416855..417421) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554836.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene dcd CDS 417808..418017 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554837.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(418190..419284) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268717.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene apbC CDS 419469..421520 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268718.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene metG CDS 421632..422219 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723764.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 gene rsxA CDS 422216..423220 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268719.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene rsxB CDS 423207..424280 product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 assembly_gap 423607..423680 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 424277..424876 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene rsxG CDS 424869..425474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 425482..426120 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092050.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene nth CDS 426228..426407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268720.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(426543..427169) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554843.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 428084..428623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764857.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(428795..430012) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363593.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(430141..431046) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268722.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 431203..432249 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764852.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene pyrC CDS 432246..432923 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412908.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene rnt CDS complement(432999..433601) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 433901..434119 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396478.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 434319..434792 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554851.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene bfr CDS complement(434884..435222) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene grxD CDS complement(435397..437502) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(437640..437930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246626.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 438358..439281 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104892.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene argF CDS 439278..440336 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390643.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(440366..441148) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 assembly_gap 441310..441388 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 442159..443010 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405433.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 443104..444609 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405430.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene glpK CDS 444791..445546 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011169330.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 445842..447380 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764831.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene glpD CDS 447805..448731 product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004664079.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 448934..449680 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268727.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 449680..450351 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246619.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 450348..451082 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 assembly_gap 451218..451227 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 451294..453195 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246618.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 453192..454517 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268730.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 454838..455758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 455755..456129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 456160..456561 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393711.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 assembly_gap 456663..456672 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(456711..457571) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105030.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(457709..458482) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918240.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 458711..459430 product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 459423..460817 product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 460820..461680 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 461691..462815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 462815..464608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 464598..465998 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(466211..466867) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(466876..468000) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268732.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 assembly_gap 466979..467070 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 468130..468325 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 468439..469356 product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764812.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene metR CDS complement(469372..470010) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532366.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(470053..470481) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268734.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(470603..471955) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102481.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 472203..474467 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946038.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 474467..476341 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119442.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 476378..477334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 477331..479145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 479142..480560 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120048.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 assembly_gap 480403..480412 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(480704..482029) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(482450..483271) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092205.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 483423..484223 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092207.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 484257..485957 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 assembly_gap 484918..485009 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 486182..487024 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535735.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 487262..488398 product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268737.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(488469..489890) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103066.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 490284..493391 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420345.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(493427..493915) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103763.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 assembly_gap 494306..494401 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 494868..495650 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268742.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(495803..496468) product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268743.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(496478..496702) product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187599223.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 496994..499018 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 499501..501963 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268745.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 502254..502538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(502786..503439) product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268743.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 sequence56 source 1..67475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(45..452) product PA2817 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770653.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(516..2963) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104757.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 3210..3869 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 3913..4536 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267140.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 4670..5602 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104755.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 5599..6378 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090884.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 assembly_gap 6413..6422 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6466..6987) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 7126..9438 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 assembly_gap 8144..8209 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 9492..9578 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9779..10414 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 10411..10839 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 10839..11849 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770644.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene lpxK CDS 11876..12061 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381112.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 12058..12822 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene kdsB CDS 12822..13286 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 13283..14302 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267145.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene murB CDS 14534..15004 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089521.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 15001..17319 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114512.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 17319..18305 product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818502.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 18298..18906 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 assembly_gap 19194..19301 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19694..22504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 note possible pseudo, internal stop codon, frameshifted assembly_gap 19737..19828 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23224..24180 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317474.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene rluC CDS 24170..24832 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408320.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 24853..25842 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene sppA CDS complement(25984..26562) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104746.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 26668..27195 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 27209..27391 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552688.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 gene rpmF CDS 27395..28405 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054091481.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene plsX CDS 28544..29482 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267150.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 gene fabD CDS 29499..30239 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318510.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene fabG CDS 30436..30672 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381096.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene acpP CDS 30814..32112 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104743.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene fabF assembly_gap 31120..31214 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 32112..32927 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020799938.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 gene pabC CDS 32944..34143 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430993.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene mltG CDS 34163..34795 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 gene tmk CDS 34788..35771 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 35826..36182 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(36186..36458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 36342..36983 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104742.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 37471..38109 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770607.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 38296..39264 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920859.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene moaA CDS 39614..40219 product DUF4823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 40237..40812 product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104740.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 40926..41603 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268086.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 41600..42604 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400821.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 42714..44180 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400819.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 assembly_gap 45032..45297 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 45419..46288 product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094463.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene lpxO CDS complement(46393..46995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(47241..48107) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992426.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 48216..48794 product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836457.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 48781..48915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 48961..49464 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246884.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 assembly_gap 49515..49624 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(49650..51020) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(51174..52025) product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170439.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene copD CDS complement(52030..52404) product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042893410.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene yobA CDS complement(52543..52824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 assembly_gap 52843..52936 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(53382..53600) product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228805.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 53862..54407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(54452..55531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(55622..56932) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192161.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(57283..57915) product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(57930..58682) product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807356.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(58755..59564) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807374.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(59561..60709) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926295.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 61022..62074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038753.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 62334..62783 product MarR family transcriptional regulator BpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820159.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene bpsR assembly_gap 62943..63167 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 63378..63854 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 63871..67425 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086601.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 sequence57 source 1..11950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 656..731 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(895..1842) product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086181.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(1852..3090) product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198608.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene proP CDS 3258..4181 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(4162..5409) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104023.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(5502..6890) product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268395.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(6887..7558) product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095515.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(7696..7950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 7864..8055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 8301..8837 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096519.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 9046..10191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 assembly_gap 11266..11342 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence58 source 1..137543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(39..1784) product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112847.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(1986..2165) product DUF6026 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400675.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(2338..3846) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene dacB CDS complement(4043..5092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS complement(5092..7443) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112644.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 7379..7561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(7781..8767) product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112643.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(8764..9345) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112642.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 9509..10021 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406806.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 10060..10983 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266783.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 11083..13431 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266782.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(13500..13913) product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764200.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 assembly_gap 14074..14140 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14273..15472) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194774.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 15648..17036 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400962.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 17194..17523 product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266781.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(17520..18686) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039013.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(18755..20284) product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039014.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 20540..20881 product YXWGXW repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266780.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(20931..21431) product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316964.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 21802..22065 product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091854.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(22169..23188) product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 23370..24173 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768735.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(24170..25525) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113504.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(25645..26283) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113505.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 gene maiA CDS complement(26296..27600) product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100400.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene fahA CDS complement(27604..28902) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100397.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene hmgA CDS 29082..29879 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111362.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(29892..31967) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114487.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 assembly_gap 32048..32136 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 32778..33557 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210870.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(33726..35093) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114488.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(35117..36886) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266754.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(36936..37169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 37578..38102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(38149..38556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS complement(38765..39676) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(39810..40712) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(40712..41542) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114490.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(41645..42331) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102323.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 assembly_gap 42433..42535 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 42897..43793 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114492.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(43774..44229) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102319.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 44384..44848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 44917..45522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103458.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(45536..46495) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 46707..47276 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346204.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 47390..48100 product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091895.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene folM CDS 48125..48685 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346200.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene folE CDS 48688..49059 product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316983.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene folX CDS 49170..49466 product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 49459..49797 product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768752.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 assembly_gap 49896..49970 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(50029..50991) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736511.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene trxB CDS 51306..52061 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408742.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene cysZ CDS complement(52101..52679) product DUF4234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112490.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 52818..54038 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266767.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(54007..55110) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(55267..55749) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244088.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(55885..56370) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 56354..56677 product DUF3565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244089.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 56734..58833 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244090.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene pta CDS 58834..59739 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103454.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 assembly_gap 59932..60011 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(60030..61928) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105005.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene cysN CDS complement(61942..62859) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313577.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene cysD CDS complement(63125..63883) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377592.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 63985..65145 product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 gene algW assembly_gap 65210..65288 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(65302..66354) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268858.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene hisC CDS complement(66351..67688) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene hisD CDS complement(67830..68465) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739058.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene hisG CDS complement(68621..69886) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555078.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene murA CDS complement(69911..70162) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377577.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(70277..70582) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766523.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(70575..71234) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400251.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(71246..71713) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313587.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene mlaD CDS complement(71713..72510) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313588.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene mlaE CDS complement(72510..73319) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313589.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 73610..74584 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400250.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 74585..75109 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413390.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 75118..75690 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400249.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene lptC CDS 75677..76222 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424523.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene lptA CDS 76222..76947 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 gene lptB CDS 77176..78627 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377556.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 78705..79010 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377554.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene raiA CDS 79020..79484 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene ptsN CDS 79487..80344 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene rapZ CDS 80361..80633 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094362.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS complement(80858..81469) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268863.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(81471..81911) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766501.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(81938..83314) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105011.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(83307..83702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105012.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(83855..85201) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243694.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene pmbA assembly_gap 85776..85851 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(85955..87397) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268865.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene tldD CDS complement(87418..87963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 assembly_gap 88003..88114 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(88397..92212) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(92291..93748) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364105.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene rng CDS complement(93805..94410) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 assembly_gap 94614..94720 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(95085..96170) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080115853.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene mreC CDS complement(96343..97380) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene mreB CDS 97679..97966 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene gatC CDS 97983..99434 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene gatA CDS 99585..101030 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 gene gatB assembly_gap 101061..101129 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 101275..101646 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003307318.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 101673..102752 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268872.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 102764..103144 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400208.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(103173..104129) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418432.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(104173..104646) product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094965.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(104650..105207) product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 105394..106032 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552170.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene upp CDS 106034..107308 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266747.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(107483..108508) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406934.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene hemH CDS complement(108522..109424) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 109620..110606 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768828.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS 110603..110818 product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768830.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 110933..111901 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 111904..112833 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266744.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 112863..114308 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768836.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene phrB CDS 114301..114723 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736559.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 114720..115502 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266741.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 115499..116746 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 116743..117543 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768843.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS 117530..118801 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266739.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(118812..122105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(122087..123772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35130 assembly_gap 122293..122418 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(123894..128849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35140 assembly_gap 127483..127576 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 129055..129276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 129425..134101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 assembly_gap 133355..133446 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 134001..135995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS complement(136016..136534) product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382556.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(136652..137443) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404950.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene murI sequence59 source 1..51236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..821) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836251.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 assembly_gap 866..971 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1162..1680 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836250.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(1668..3008) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192161.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(3087..4028) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(4025..5218) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(5338..6246) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(6294..6965) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(6976..7839) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(7917..8489) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206879.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(8834..9982) product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104943.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene yiaY CDS 10136..11140 product DUF4917 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119745.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(11152..11622) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112674.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 11855..12637 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084054.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 12680..13573 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101895.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS complement(13604..14956) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269247.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(14949..16370) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063688.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 assembly_gap 16534..16664 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16686..17435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(17440..18216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(18227..19156) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103705.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 assembly_gap 19205..19293 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19327..21882) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764409.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 assembly_gap 20032..20124 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21911..22408) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764401.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(22498..24075) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268063.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(24325..25509) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(25543..26499) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705147.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(26514..27332) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(27322..27675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 assembly_gap 27699..27827 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28196..28417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(28336..29541) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766812.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(29538..30311) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268530.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(30314..31030) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268531.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 assembly_gap 31059..31148 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(31368..32270) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767686.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 32376..33011 product 3-mercaptopropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113364.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 33008..34591 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113365.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 assembly_gap 34617..34768 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34888..35427 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 assembly_gap 35652..35721 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 35756..36460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 36578..39142 product heme receptor HxuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112363.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene hxuC CDS complement(39120..39428) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101146.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(39443..40024) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 40231..41142 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186089.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(41130..42347) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 42670..43617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 43656..45830 product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030632.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(45898..46350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(46626..47243) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406246.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(47276..47986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(48057..48665) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350422.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 48909..51200 product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993324.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene bglX sequence60 source 1..414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence61 source 1..54974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 355..437 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 500..1567 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035321.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 assembly_gap 1954..2162 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2417..2713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 3283..3555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(3599..3859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 4170..4370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(4380..4790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 4978..5604 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729782.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 5605..7170 product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539579.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(7221..7553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(7679..9439) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974489.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS 9628..10227 product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974481.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS 10355..11317 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974487.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS 11340..12851 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974486.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 12870..13946 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974485.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 13952..14764 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974484.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 14757..15152 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974483.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 15333..16529 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112098710.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 16522..17418 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974477.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 17510..18544 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974478.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene proX assembly_gap 18571..18662 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18923..20389 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530323.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS 20407..21792 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530322.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS 21928..22419 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401300.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(22416..23138) product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 23382..23582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(23587..23994) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(24021..24443) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 24684..25439 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112385.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 25661..26791 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921367.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(26798..27679) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974609.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 27774..28697 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114756.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 28763..29350 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168558.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(29352..30815) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(30812..31528) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS 31699..32217 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109730.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene msrB CDS 32254..34062 product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252802.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 34083..34808 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528688.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene msrA CDS complement(34938..36557) product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401346.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 assembly_gap 36783..36862 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 36959..37642 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381155.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 37620..39014 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246072.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(39073..39234) product DUF2986 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266868.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(39341..39850) product transporter suffix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017719.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(39974..40564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(40670..40864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 assembly_gap 41691..41764 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 41773..42552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 42955..44310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 44595..44840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 assembly_gap 45923..46007 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(46306..47199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS complement(47211..48353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36140 note possible pseudo, frameshifted assembly_gap 47254..47351 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 48850..49500 product STY4534 family ICE replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267041.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 49607..50101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 50474..50935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 51098..51715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(52042..52452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 52805..53080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 53270..53548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 53560..54000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 assembly_gap 54559..54646 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence62 source 1..225152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..3619 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266563.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene recC CDS 3616..7311 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103276.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene recB CDS 7308..9398 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene recD CDS complement(9530..9811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 note possible pseudo, frameshifted CDS complement(9729..11120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 note possible pseudo, frameshifted assembly_gap 9812..9821 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 11153..11315 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(11379..12170) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531705.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(12208..13266) product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827578.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(13279..14130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS 14452..15027 product diguanylate cyclase inhibitor YfiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115307.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene yfiR CDS 15024..16295 product diguanylate cyclase TpbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082256.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene tpbB CDS 16300..16803 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082254.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 16929..18050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36340 assembly_gap 18337..18553 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18902..19186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 19594..19872 product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 19850..20101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(20124..21113) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769228.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 21216..22739 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266571.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 22754..23641 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103280.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene mmsB CDS 23752..24288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 24349..25332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS 25368..27764 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267622.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 27947..28198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 28293..29183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 assembly_gap 29048..29124 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29150..29608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 assembly_gap 29770..29881 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(29985..30230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(30408..32039) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267440.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 assembly_gap 31146..31155 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 33145..34128 product transcriptional regulator HrpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266878.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene hrpS CDS 34161..34487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 34681..35571 product harpin HrpZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266879.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 35629..35988 product type III secretion system inner rod subunit SctI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763898.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 gene sctI CDS 35997..36800 product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763897.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 gene sctJ CDS 36797..37327 product type III secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266881.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 37350..37925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 38022..38246 product type III secretion protein HrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375722.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS 38233..38664 product type III secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763889.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 38666..40837 product type III secretion system outer membrane ring subunit SctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266883.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 gene sctC assembly_gap 40598..40685 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 40834..41049 product HrpT family type III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266884.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene hrpT CDS 41055..41414 product HrpRS complex negative regulator HrpV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244826.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene hrpV CDS complement(41421..42920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(42911..43873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(43950..45026) product type III secretion system export apparatus subunit SctU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406538.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene sctU CDS complement(45023..45817) product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339813.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene sctT CDS complement(45817..46083) product type III secretion system export apparatus subunit SctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375712.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene sctS CDS complement(46092..46745) product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375709.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 gene sctR CDS complement(46742..47080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(47070..47801) product type III secretion protein hrcQa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103535.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(47798..48355) product type III secretion system protein HrpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266889.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene hrpP CDS complement(48363..48812) product type III secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103537.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(48809..50158) product type III secretion system ATPase HrcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763862.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 gene hrcN CDS complement(50155..51120) product type III secretion system inner membrane ring subunit SctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763855.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 gene sctD CDS complement(51139..51900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36730 assembly_gap 51902..51993 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52920..53321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(53326..54420) product type III secretion system gatekeeper subunit SctW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615731.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene sctW CDS 54669..55205 product RNA polymerase sigma factor HrpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103538.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene hrpL CDS 55285..57501 product type III secretion system helper protein HrpK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103539.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene hrpK1 assembly_gap 57254..57339 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 57435..57620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 57774..59360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36790 assembly_gap 59181..59273 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(59413..59760) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090818.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(59865..60749) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388444.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 60833..61600 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103289.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 61660..62556 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098210.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(62619..63176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(63335..64621) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 64962..65855 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 66096..67319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS 67332..67811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 67992..69341 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266384.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 assembly_gap 69348..69438 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 69885..69978 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 70378..71832 product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266382.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 71933..72301 product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706716.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS 72378..72623 product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 72620..73039 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(73080..75095) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266704.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 assembly_gap 73779..73907 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 75967..76082 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(76373..77779) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267898.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(77937..79772) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706842.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene ggt CDS complement(79894..80247) product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(80438..83929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 assembly_gap 80548..80643 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 84222..85877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 86090..86794 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(87005..87418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 87552..88430 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398412.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(88502..90622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(90682..91419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(91416..91832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(91816..92280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS complement(92280..92774) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946364.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS complement(92916..93827) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096538.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 93991..94740 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619652.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(94819..95280) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119669.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(95502..96125) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764543.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 96140..96370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 96778..97197 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228304.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(97256..98197) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027239.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 98329..99060 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(99189..99794) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249559.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS complement(100168..100947) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097624.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(101177..102160) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087054.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 102518..103792 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037154163.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 103955..105130 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203095.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(105114..105329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 105400..108492 product multidrug efflux RND transporter permease subunit CeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188522.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene ceoB CDS 108507..110012 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198562.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 110140..110871 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619926.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 111032..113209 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104229.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 assembly_gap 113459..113557 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 113739..114107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(114628..115110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 115345..116139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS 116141..117880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 117852..119585 product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787447.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS complement(119746..121200) product DUF726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266538.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 122086..124278 product anti-phage ZorAB system protein ZorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036639.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene zorA CDS 124292..125035 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036640.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 125032..126795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 assembly_gap 126613..126714 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 126734..129982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 130427..132910 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985413.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 132901..134148 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263394.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 134145..135554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 135547..137520 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 137531..140692 product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 140692..141408 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 141630..142541 product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(142584..143108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(143830..144237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103354.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(144234..144926) product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208432.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(145285..145524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267313.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 tmRNA complement(145603..145992) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(146079..146357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(146464..149271) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(149352..150497) product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100494.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene lldD CDS complement(150567..151295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 151360..152388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37510 assembly_gap 151403..151482 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 152606..153373 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(153510..153992) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377471.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene smpB CDS 154120..154554 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400153.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 assembly_gap 154860..154968 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(155108..155635) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400155.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 155733..156137 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555142.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene fur CDS complement(156256..157929) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418848.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 gene recN CDS 158163..158729 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377479.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene grpE CDS 158830..160746 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105024.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 gene dnaK CDS 160907..162031 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377482.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 gene dnaJ CDS 162042..162848 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 gene dapB CDS 163196..164332 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243710.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene carA CDS 164437..167658 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340565.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene carB CDS 167655..168137 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400161.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene greA CDS 168166..168570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113906.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(168583..168891) product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377487.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 168998..169627 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620411.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene rlmE CDS 169820..171739 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105023.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene ftsH CDS 171820..172599 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268884.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene folP CDS 172616..173953 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268883.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene glmM CDS 174053..174775 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100513.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene tpiA CDS 174780..175163 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313628.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene secG tRNA 175193..175278 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 175375..175451 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 175577..176053 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004411704.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 gene rimP CDS 176101..177582 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340582.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene nusA CDS 177610..180135 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377503.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene infB CDS 180295..180711 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene rbfA CDS 180715..181632 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766456.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene truB CDS 181775..182044 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555121.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene rpsO CDS 182268..184373 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268879.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene pnp CDS 184665..185021 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004656644.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(185192..185491) product DUF2845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268877.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(185494..188418) product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060708255.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(188528..189544) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766463.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(189681..191618) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene acs CDS complement(191890..193554) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266656.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene pgi CDS complement(193893..194753) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109313.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene panC CDS complement(194750..195550) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266658.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene panB CDS complement(195919..196401) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266659.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene folK CDS complement(196406..197794) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345072.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(198546..199979) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412367.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(200002..202950) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017684227.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(202940..203116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552060.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(203194..204093) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246099.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene gluQRS CDS complement(204190..204636) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406657.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene dksA CDS 205035..206207 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406662.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 206207..206914 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406665.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene sfsA CDS complement(206919..207236) product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246097.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 207442..208317 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095100.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 208314..209351 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121063.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS 209351..210118 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095098.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS 210335..211126 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266664.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene deoC CDS complement(211333..212133) product cAMP-binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene cbpA CDS complement(212149..212421) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095094.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(212676..213020) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266665.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(213111..214667) product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268952.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 214785..217109 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427455.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene mrcB CDS 217126..217878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266667.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 217878..218207 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406693.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(218256..218687) product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS 219114..220814 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246092.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 220816..221307 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552075.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene ilvN CDS 221355..222371 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552076.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene ilvC CDS 222517..223374 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene pssA CDS 223438..224451 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770490.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene msrP CDS 224451..225077 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201804.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 gene msrQ sequence63 source 1..253573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..932 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266457.1:dihydrolipoyllysine-residue acetyltransferase locus_tag LOCUS_38160 CDS 1261..3954 product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244549.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 4034..4681 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269219.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene msrA CDS complement(4847..5683) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402281.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene rlmJ CDS 5831..6325 product DUF2165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209941.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 6497..7765 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704479.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(7827..9311) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440098.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene putP CDS 9769..13722 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105271.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 gene putA CDS complement(13773..14855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS 15078..16880 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 16983..18725 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771787.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 18762..22112 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463895.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 gene mscK CDS 22166..23629 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105279.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(23651..24052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(24055..24345) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530736.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 24546..25013 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 gene trxC CDS complement(25010..25783) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765433.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 26146..26865 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266402.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS 26841..27659 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402969.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 27628..27900 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551687.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 27910..28164 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765439.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 28161..28706 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266400.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 28703..30373 product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765442.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 30366..31211 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105311.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS 31208..32146 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105312.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 32127..33671 product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245619.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 33664..34089 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765450.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS 34197..34793 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266396.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS 34777..37116 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237739.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 37113..38270 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010212054.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 38261..39508 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266394.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 39505..40239 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266393.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 40236..40718 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765461.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS 40715..41911 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 41908..42372 product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346295.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 42365..43093 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765466.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene fabG CDS 43093..44319 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266389.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS 44348..44791 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460588.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 44828..45274 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(45378..46277) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765469.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 46396..47673 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(47690..48160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS complement(48157..49251) product GspL family type II secretion system protein XcpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103522.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene xcpY CDS complement(49248..50108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(50105..50650) product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene xcpW CDS complement(50643..51023) product GspI family T2SS minor pseudopilin variant XcpV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103528.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene xcpV CDS complement(51013..51483) product GspH family T2SS minor pseudopilin variant XcpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103530.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene xcpU CDS complement(51487..51927) product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 gene xcpT CDS complement(51931..53142) product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene xcpS CDS complement(53145..53477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38650 note possible pseudo, frameshifted CDS complement(53429..54616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 note possible pseudo, frameshifted assembly_gap 53490..53499 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(54613..56523) product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 gene xcpQ CDS complement(56524..57033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(57292..58863) product N-acetylglucosamine-binding protein GbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925831.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene gbpA CDS complement(59198..60265) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403024.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene hemE CDS complement(60504..61922) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(61954..66402) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266380.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene gltB assembly_gap 66538..66628 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(66818..68416) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105328.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(68427..69527) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene aroB CDS complement(69677..70138) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266378.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene aroK CDS complement(70200..72290) product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS complement(72290..72817) product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266376.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene pilP CDS complement(72814..73437) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403037.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene pilO CDS complement(73434..74000) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403038.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(74000..75064) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105329.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 75268..77703 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105330.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(77796..79064) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378855.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(79248..79751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 assembly_gap 80018..80108 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(80177..80431) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378857.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 gene rpmE CDS 80560..82872 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105332.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 assembly_gap 81433..81526 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 82962..85121 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105333.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene argS assembly_gap 83269..83334 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 84790..84880 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 85440..85547 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 85555..85821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS 86039..86527 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378861.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene hslV CDS 86584..87921 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316641.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene hslU CDS 88031..88411 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463876.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 88654..90333 product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene phaC tRNA complement(89306..89398) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 assembly_gap 90707..90799 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 90826..91425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 91645..93327 product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105335.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 gene phaC CDS 93391..94011 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105336.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(94133..95143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 note possible pseudo, internal stop codon, frameshifted assembly_gap 94426..94503 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(95154..95576) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103463.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS complement(95738..96013) product polyhydroxyalkanoic acid system family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266368.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS 96171..96941 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378884.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 gene ubiE CDS 96941..97558 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105338.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 97555..99159 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266367.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene ubiB CDS 99240..99632 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403068.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene hisI CDS 99635..99967 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105340.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 99993..100286 product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316632.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 CDS 100297..100788 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266365.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene tatB CDS 100785..101576 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765541.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene tatC CDS 101573..102280 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105341.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 tRNA complement(102955..103028) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 assembly_gap 103595..103710 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 103772..104383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 104555..106510 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105343.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(106514..107314) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095910.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(107580..110150) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266360.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene mdoH CDS complement(110143..111888) product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266359.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS complement(112215..112652) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266358.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene dtd CDS complement(112649..113647) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414210.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene pip CDS 113871..114791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 assembly_gap 114809..114885 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(114959..115762) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105403.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene hutG CDS complement(115773..117056) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269253.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene hutI assembly_gap 116167..116258 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(117073..118482) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105401.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 assembly_gap 118713..118803 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(118909..120441) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105400.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene hutH CDS complement(120556..122079) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105399.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(122193..123023) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247035.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(123020..123871) product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343849.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(123943..124911) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405245.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(125030..125872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 assembly_gap 125900..125980 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 125994..126497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(126708..128408) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269249.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene hutU assembly_gap 128778..128925 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(128952..129530) product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266354.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS complement(129527..130276) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161420743.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene hutC CDS 130383..131747 product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266356.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(131892..132449) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304589.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(132480..132734) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403102.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 gene bamE CDS 133008..134900 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104030.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(135088..135690) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101790.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(135695..136705) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381390.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 assembly_gap 136916..137322 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 137657..137902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(138534..142166) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114470.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(142286..144736) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403097.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 145002..145436 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551717.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 assembly_gap 145464..145654 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(145758..147578) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405222.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene typA CDS complement(147718..148623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39390 assembly_gap 148680..148770 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 148790..149260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 149691..151004 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763515.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene glnA CDS 151251..151667 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083588.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 151729..152376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 152460..152987 product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463602.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS 152995..153633 product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103113.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 153885..154970 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene glnL CDS 154967..156403 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555721.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene ntrC assembly_gap 156511..156644 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(156968..157408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105424.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS 157407..157862 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105425.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(157995..158477) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621582.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene secB CDS complement(158519..158773) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269283.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene grxC CDS complement(158775..159188) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269284.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS 159337..160872 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105426.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene gpmI CDS 161012..162307 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269286.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 162339..163661 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767110.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 163663..164454 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246844.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS complement(164472..165104) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106330.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 assembly_gap 165172..165254 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(165380..166150) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551458.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 gene hisF CDS complement(166160..166897) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372206.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene hisA CDS complement(166939..167199) product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397145.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS complement(167200..167838) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 gene hisH CDS complement(167838..168431) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551454.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 gene hisB CDS complement(168712..170373) product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269292.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 170899..173121 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269293.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 173118..174185 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767127.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 gene mutY CDS 174182..174454 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555777.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 tRNA 174558..174633 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 174790..175728 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550164.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 175862..176266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269299.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(176427..177818) product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407279.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 gene gabP CDS 178353..179126 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737152.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 179140..179889 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 179956..180648 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003342249.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 180648..181337 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318320.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS 181530..182741 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105444.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 tRNA 183185..183260 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 assembly_gap 183332..183414 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 183607..184113 product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013556.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 184113..184466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(185148..185396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(186630..186956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 187023..187313 product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531766.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 187334..188548 product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533246.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 188545..189216 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533247.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(189217..190011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533240.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS complement(189989..190639) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533239.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(190636..191655) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533238.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(191659..192015) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533237.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(192012..192284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39860 assembly_gap 193293..193408 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 193454..193861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39870 assembly_gap 193900..193979 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 194403..195575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS 195849..196832 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969366.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS 196997..198031 product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557313.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 198179..198982 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096744.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 199018..199833 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039297.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS 199847..200620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967557.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(200989..203052) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971066.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(203228..204130) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417992.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(204273..205559) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099122.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 assembly_gap 205659..205760 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 206079..208172 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704434.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(208235..208435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(208682..209788) product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269318.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 gene aguA CDS complement(209794..210672) product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372277.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 gene aguB CDS complement(210886..213882) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269319.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 assembly_gap 212558..212678 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 214068..215150 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269320.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 gene rfbB CDS 215147..216019 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103413.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 gene rfbA CDS 216016..216561 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 gene rfbC CDS 216558..217442 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 gene rfbD CDS 217471..219294 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033832452.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 219291..220682 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406997.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 220705..221160 product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269323.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS complement(221199..222041) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269324.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 gene cysQ CDS complement(222038..222604) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372295.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene nudE CDS 222836..223507 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 gene yrfG assembly_gap 223425..223454 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(223663..224103) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096210.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 gene lysM CDS 224241..225128 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401941.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 assembly_gap 225876..225973 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 226156..228504 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105470.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS 228697..229137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS 229366..231390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 231419..232561 product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 assembly_gap 231444..231555 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 232951..233101 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 233122..233334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 233572..234483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS 234932..236020 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770011.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 236056..236421 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553206.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS 236429..236746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 236750..238804 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275321.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 238783..240420 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037458.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 240431..240958 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS 240960..241772 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770000.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 241769..242260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 242257..243312 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 243524..244129 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765089.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(244114..244542) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(244569..245507) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767067.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS 245583..246197 product DUF6436 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 246317..248683 product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269269.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 assembly_gap 248794..248957 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(248960..249868) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113225.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 249983..250324 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084980.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 assembly_gap 250631..250753 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(250773..251738) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090405.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 251622..251972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS 251990..252676 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS 252882..253523 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090406.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 sequence64 source 1..95958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(32..1183) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419537.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS complement(1269..2729) product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707523.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS complement(2867..3781) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976316.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 3980..4699 product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106298.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(4832..6493) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390495.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 6798..8351 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765904.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS 8351..8869 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377717.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS 8866..10218 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266948.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 assembly_gap 8998..9081 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10215..10898 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765908.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 11316..13268 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266949.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 note possible pseudo, frameshifted assembly_gap 11330..11408 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13265..14275 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266950.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 14327..15340 product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406328.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS 15357..16556 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096102164.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 gene prfB CDS 16639..18141 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266952.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 gene lysS CDS 18250..18966 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266953.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS 19017..20294 product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339622.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS 20392..21303 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS 21300..21626 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103581.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS complement(21820..22611) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266956.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS complement(22669..23091) product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409265.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(23377..23721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 assembly_gap 23812..23889 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 24031..25965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40610 assembly_gap 25694..25790 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25962..26756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 assembly_gap 26815..26909 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 27117..27764 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene adk CDS 27853..28527 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765933.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 gene tsaB CDS 28773..29072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554750.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS 29086..29955 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245396.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 29989..30831 product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098657.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS complement(30860..31474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406299.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 31567..32349 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266962.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS complement(32416..33051) product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene mexL CDS 33145..34245 product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 gene mexJ CDS 34252..37317 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(37480..38169) product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS complement(38318..38938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(39061..41559) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266965.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 gene plsB CDS 41843..42052 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(42239..42616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765957.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(42701..43510) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615949.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(43510..44778) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765961.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 gene dapE CDS complement(44882..47473) product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 gene ndvB CDS 47751..48560 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406281.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 gene tcdA CDS complement(48648..49055) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103588.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(49052..50257) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103589.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(50335..51369) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 gene dapD CDS complement(51415..51777) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377785.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 52177..53151 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089011.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS complement(53226..53933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS complement(53828..54961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40880 assembly_gap 53984..54095 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(55043..56242) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103591.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 gene dapC assembly_gap 56296..56401 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(56411..59107) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245412.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS complement(59129..59911) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765976.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 gene map CDS 60309..61046 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615972.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 gene rpsB CDS 61393..62256 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765978.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 gene tsf CDS 62458..63201 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554728.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 gene pyrH CDS 63198..63755 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004657953.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 gene frr CDS 63772..64527 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765985.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 gene uppS CDS 64527..65423 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 assembly_gap 65093..65176 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 65748..65839 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 65905..66699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 66754..68106 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 gene rseP CDS 68182..70569 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245414.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 gene bamA CDS 70615..71118 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554721.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 71122..72177 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266978.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 gene lpxD CDS 72244..72732 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092375.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 gene fabZ CDS 72729..73505 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314305.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 gene lpxA CDS 73508..74638 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103595.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 gene lpxB assembly_gap 75030..75123 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 75440..78961 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266980.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 gene dnaE CDS 79111..80058 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377825.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 gene accA CDS 80237..81565 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113867.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 gene tilS CDS 81840..83471 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377829.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 83477..84322 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266982.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene kdsA CDS 84398..85810 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003339565.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 gene eno assembly_gap 84410..84496 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 85979..86257 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314315.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 gene ftsB CDS 86254..86964 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766007.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 gene ispD assembly_gap 87067..87202 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(87444..88379) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377838.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS 88487..89599 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266984.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 89608..90465 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027907389.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 gene fghA CDS 90560..91033 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266985.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene ispF CDS 91030..92088 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266986.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene truD CDS 92076..92825 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406214.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene surE CDS 92825..93499 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766015.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 assembly_gap 93763..93842 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 94188..94305 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 94554..94796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 94904..95908 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314325.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 gene rpoS sequence65 source 1..24019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1246 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090208471.1:non-ribosomal peptide synthetase note possible pseudo, frameshifted locus_tag LOCUS_41230 assembly_gap 1225..1234 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1251..5177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41240 note possible pseudo, frameshifted CDS 5272..6504 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010216538.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene macA assembly_gap 5341..5419 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6507..8465 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104221.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(8549..9301) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376912.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 9454..10089 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816195.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene yfcF CDS complement(10228..10755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS complement(11081..11977) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 12099..13430 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551357.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 13528..14433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS 14815..15498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764319.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(15506..15835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316621.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(16033..17556) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203086395.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS 17701..18189 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS 18424..19137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 assembly_gap 19278..19287 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(19706..20122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 20789..22075 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098144.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS 22085..22384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 22403..22711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 assembly_gap 23108..23200 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23234..23509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 sequence66 source 1..73551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..910) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388220.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS 1173..2486 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965836.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(2669..3517) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968043.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS 3621..4328 product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968042.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS 4333..5118 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968041.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 5198..6373 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403189.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 6561..7388 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104080.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 gene phnC CDS 7437..8441 product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246947.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 gene phnD CDS 8512..9300 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267540.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene phnE CDS 9335..10039 product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104081.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 gene phnF CDS 10039..10503 product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246944.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene phnG CDS 10503..11102 product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113122.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 gene phnH CDS 11142..12257 product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267544.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 assembly_gap 11238..11332 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12257..13123 product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267545.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS 13120..13941 product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091781.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 gene phnK assembly_gap 14625..14717 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14771..15916 product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403601.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS 15916..16479 product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403600.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene phnN assembly_gap 16569..16679 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17261..18205) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704494.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 assembly_gap 19255..19705 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19813..20610 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704492.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS 20631..21047 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140838.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS 21148..21816 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103641.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS 21813..24302 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268626.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 24292..25371 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103639.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS 25494..27698 product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS 27935..28339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41670 assembly_gap 28380..28807 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 29179..29444 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(30360..30509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(30512..31765) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728426.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS complement(32076..33038) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016558605.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS complement(33081..34358) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096918.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 34748..37354 product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036233.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 gene acnD CDS 37386..38534 product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 gene prpF CDS 39231..39839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS 39872..40585 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106697.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS 40582..41334 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815414.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(41441..41752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(42005..42241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS complement(42268..42753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 assembly_gap 42869..42959 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(43343..43897) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705740.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 gene lrp CDS complement(44631..45371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS complement(45644..46042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(46389..47663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 assembly_gap 47884..48118 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(48241..48441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 49104..49424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 49444..51372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41860 assembly_gap 51201..51297 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 51360..52508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 assembly_gap 52280..52376 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52426..54735 product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024696519.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 assembly_gap 54501..54696 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 56242..56453 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 56530..58029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS 58403..59332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS 59385..60026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(60820..61449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS complement(61446..62507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS complement(62889..64082) product IS1182-like element ISBma2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200740.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 assembly_gap 64239..64325 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 64663..64754 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(65516..65791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 66169..66789 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS 67310..67582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS 67586..69517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 assembly_gap 67934..68024 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 69595..71184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS 71616..72047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS complement(72403..72819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 assembly_gap 73039..73048 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 73288..73297 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence67 source 1..416834 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS complement(335..2482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073425.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS complement(2469..3671) product DUF3142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073424.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS complement(3746..5176) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104175.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS complement(5180..8299) product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 gene mdtC CDS complement(8305..11370) product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 tRNA 10834..10925 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(11381..12475) product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214676.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 12808..13374 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 gene idi CDS 13481..15400 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 gene dxs CDS 15397..16329 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187484.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene ispH CDS 16353..17342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 17339..18622 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 gene ispG assembly_gap 19029..19109 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 19194..19703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS 19706..20878 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527290.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS complement(20855..23104) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268078.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS complement(23101..24753) product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104467.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(24859..26325) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400832.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS complement(26337..27803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764454.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 assembly_gap 27944..28050 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28501..29523) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104344.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 29836..30750 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS 30784..31407 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS complement(31417..32634) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707131.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene gltS CDS 33038..34294 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411228.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS 34307..37492 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380455.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 assembly_gap 37120..37129 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 37600..37675 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 38574..38655 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 38702..39061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS 39299..40567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS 40711..40995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS 41182..43287 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625994.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS 43403..44302 product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853391.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS 44379..45434 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268125.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS 45547..47049 product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267691.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS 47046..48221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42330 assembly_gap 47930..48022 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 48176..48811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS complement(48833..49210) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382842.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS complement(49276..50469) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104155.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS complement(50463..51068) product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104154.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS complement(51065..51880) product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025991008.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS complement(51880..55371) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104152.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS 55629..55988 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762602.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS 56437..56622 product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766274.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS 56663..57364 product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104406.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 57361..57786 product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400608.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS 57850..58596 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268159.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 gene cobM CDS 58614..59042 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107683.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(59253..59837) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267703.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 gene nfuA CDS complement(59971..62262) product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032606839.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 62415..66125 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267702.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 gene metH CDS 66179..66397 product DUF2970 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098182.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(66446..67519) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267701.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS 68200..69858 product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267700.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS 69842..70336 product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762572.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 assembly_gap 70372..70444 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(70449..74771) product NEL-type E3 ubiquitin ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268678.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 assembly_gap 74159..74269 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 74776..74875 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(75603..76625) product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762574.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 gene sohB CDS 76832..77542 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762577.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS 77600..77914 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382829.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 assembly_gap 78010..78019 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(78038..79573) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243735.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(79570..80583) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105043.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS complement(80570..81658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42590 assembly_gap 80755..80842 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(81655..82512) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268896.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(82509..83456) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268897.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(83453..84346) product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 84517..85281 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105046.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS 85372..86271 product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268899.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 CDS 86484..87551 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS 87577..88344 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762581.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS 88529..89644 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104158.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS 89758..90144 product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104226.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS 90240..92372 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114901.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(92467..93483) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268640.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 CDS complement(93650..94096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397144.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS 94726..94956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS 95036..95449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(95529..97154) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246966.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(97345..97749) product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554078.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS complement(98192..99229) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380853.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(99290..100861) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104585.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS complement(100937..101875) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246965.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(101946..102128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS complement(102356..104062) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199468.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS complement(104086..105384) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103263.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS complement(105381..106289) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(106293..107645) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS complement(107676..110135) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810115.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 assembly_gap 110261..110366 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(110630..112087) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123403.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS complement(112210..112734) product alkane oxidation protein activator PraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119407.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 gene praA CDS complement(112878..113369) product alkane oxidation protein activator PraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119407.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 gene praA CDS complement(113517..114794) product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 assembly_gap 115209..115298 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 116015..116108 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 116550..118073 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202677.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS 118070..118972 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202679.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS 119006..119836 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS complement(119859..120149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS complement(120161..121093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42930 assembly_gap 120192..120278 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(121090..122757) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202254.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS complement(122934..123338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42950 assembly_gap 123582..123674 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 123691..124188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 124185..126176 product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267892.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 gene arnA CDS 126176..127060 product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267893.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 gene arnD CDS 127057..128811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42990 assembly_gap 127711..127866 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 128808..129152 product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267895.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 gene arnE CDS 129149..129556 product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074997376.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 gene arnF assembly_gap 130059..130131 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 130182..131087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 assembly_gap 130984..131067 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 131256..132875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS complement(133065..134903) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096401.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS complement(135005..136546) product serralysin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104500.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(136654..138009) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767364.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(138011..139339) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371807.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS complement(139336..141144) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405043.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS complement(141504..141677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43090 assembly_gap 141715..141810 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(142026..143474) product serralysin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405046.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS complement(143794..144888) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083160.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS complement(144985..145353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43120 assembly_gap 145382..145523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 146747..147595 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS 147647..148258 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 148407..149348 product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268082.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 assembly_gap 149379..149560 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(150756..152381) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103145.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(152756..153835) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114385.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS complement(153888..154229) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091873.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS complement(154273..155649) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102335.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS complement(155729..156544) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119583.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS 156717..157007 product DUF1652 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762465.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS complement(157071..159536) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267734.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 assembly_gap 160039..160128 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(160784..162508) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268077.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 gene pgm assembly_gap 161958..162033 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 162646..162693 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(162724..162993) product DUF1652 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403781.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 assembly_gap 163138..163220 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 163509..163991 product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114416.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 gene eco CDS 164010..164315 product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528914.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS complement(164326..165381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS 165642..165842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS 165842..166621 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114411.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 gene map CDS complement(166727..167668) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267746.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(167681..169162) product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420659.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS 169357..170328 product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698838.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 note possible pseudo, internal stop codon assembly_gap 170230..170310 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 170352..170540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS complement(170519..171670) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402514.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS complement(171718..172074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS 172429..174849 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217865935.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS complement(174934..175119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS 175545..177110 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024666072.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS 177324..178517 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417591.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS complement(178519..179550) product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463775.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS complement(179807..180418) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268148.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS 180548..181456 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113474.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS 181468..181812 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268151.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(181821..182255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(182252..183082) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113476.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS 183372..185006 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104682.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 185161..185724 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400615.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene pnuC CDS 185721..186269 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113477.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 tRNA complement(186346..186441) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 186597..187043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 187045..187620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113479.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 assembly_gap 188033..188155 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 188833..189513 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS 189556..190305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895591.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 190412..191647 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088309.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 assembly_gap 191689..191800 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(191808..193070) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113486.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 192963..193160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS 193469..193732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766263.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS complement(193798..195291) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104175.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS complement(195288..198395) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104174.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(198392..198610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS complement(198610..201576) product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267713.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 assembly_gap 198620..198714 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(201573..202862) product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267712.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS complement(203054..203554) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 gene tpx CDS complement(203744..204244) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 gene tpx assembly_gap 204570..204662 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 205563..205741 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 205764..206096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(206147..206641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS complement(206715..207515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 207606..208298 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461579.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS 208622..209464 product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268390.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS 209473..210666 product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268391.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 gene efeO CDS 210685..212025 product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765224.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 gene efeB CDS 212049..212873 product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104625.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 gene efeO CDS complement(212998..214341) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268302.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 gene pssA CDS 214563..216200 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104672.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS 216274..216867 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS 216986..217465 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096727.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS 217667..218239 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528613.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS 218309..218851 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064548891.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS 218906..219403 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367629.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS 219400..220185 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704786.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 220375..221043 product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268238.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 gene pncA CDS complement(221000..222820) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192099.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(222849..223184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS complement(223124..224077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43830 assembly_gap 223351..223445 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(224177..225286) product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104474.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS 225445..226758 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103763.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS 226911..227924 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105506.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS complement(227943..229460) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS complement(229620..230294) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 230409..231296 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087853.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS complement(231274..232251) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902703.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS complement(232255..232809) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975243.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS complement(232887..234557) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091546.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS complement(234554..234727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43930 assembly_gap 235464..235577 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 235590..236303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS 236435..236989 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705973.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS complement(237044..237226) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617534.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS complement(237230..237361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 237609..238715 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407468.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 gene pstS assembly_gap 238547..238632 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 238786..239781 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770815.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 gene pstC CDS 239778..240650 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005618859.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 gene pstA CDS 240650..241429 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553918.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 gene pstB CDS complement(241557..241874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44020 assembly_gap 242085..242181 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(242949..244562) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267533.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS complement(244694..245314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS 245508..246383 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010206379.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 CDS complement(246393..247073) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268379.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 assembly_gap 247393..247481 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 248435..248514 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 248612..251644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS 251655..254228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44080 assembly_gap 254081..254171 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 254225..255628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS 255615..257138 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 gene argH assembly_gap 257209..257362 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(257472..257762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS complement(257781..258590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 assembly_gap 258685..258783 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(259382..260671) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526010.1 transl_table 11 codon_start 1 locus_tag LOCUS_44130 assembly_gap 261150..261242 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 261248..261889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS complement(261896..264265) product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS complement(264317..265066) product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706737.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 gene tauC CDS complement(265074..266075) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089196.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS complement(266072..266878) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113103.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS 267059..267802 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 assembly_gap 267886..268100 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 268227..268874 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766154.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS complement(268944..269450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193862510.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 assembly_gap 269890..269978 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(270490..271269) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208776.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS complement(271266..272081) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171322.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(272110..273162) product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077838.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 assembly_gap 273363..273459 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 273602..274408 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089047.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS 274488..275216 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089046.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS 275220..275906 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113694.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(275940..276161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS complement(276186..277133) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 assembly_gap 277350..277445 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(277918..279342) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275526.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS complement(279339..280925) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037485.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS complement(280918..281295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS complement(281238..282110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44330 note possible pseudo, frameshifted assembly_gap 281372..281457 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 282210..282917 product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168102.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 gene cecR CDS complement(282956..283312) product DUF1937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083172.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS complement(283388..283729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS 283640..284422 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083169.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(284602..286044) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229315.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(286328..287743) product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114294.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS complement(287769..289007) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114295.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS complement(288997..290406) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895572.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 assembly_gap 290672..290764 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 291108..292010 product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967904.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 assembly_gap 292047..292139 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 292184..292978 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115566.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS 293114..294289 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527146.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS 294383..295486 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266806.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 assembly_gap 294432..294503 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(295523..296065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44460 assembly_gap 296231..296526 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 296810..297553 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894813.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS complement(297573..298496) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062802403.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 gene gcvA assembly_gap 298700..298789 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 299555..299896 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807759.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 assembly_gap 300023..300124 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 300271..301269 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS complement(301328..302395) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS complement(302572..303357) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS complement(303354..304352) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS complement(304429..305664) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226921.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 CDS complement(305661..308081) product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS complement(308078..309244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44560 assembly_gap 308682..308774 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(309244..310602) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS complement(310642..312264) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104994.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS 312490..313437 product transcriptional regulator NodD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084820.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 gene nodD1 CDS complement(313570..314349) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225350.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS complement(314479..315342) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS complement(315342..316040) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402117.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS 316162..317004 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921637.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 assembly_gap 317110..317229 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(317278..318012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS 318173..319225 product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049034212.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 assembly_gap 318506..318593 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 319304..320482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS complement(320534..321421) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530571.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS 321520..322356 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172659.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS 322523..323899 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100955.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS 323896..325074 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS 325178..325657 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114391.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS 325808..326353 product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS 326584..327651 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084015.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS complement(327679..328845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS complement(329095..331050) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827630.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS 331252..331803 product PilL N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048687.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS 331803..332495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS 332506..333234 product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS 333231..333794 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267029.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS 333791..334306 product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS 334309..336456 product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 gene traD assembly_gap 336638..336708 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 336730..337290 product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS 337394..337723 product RAQPRD family integrative conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103322.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS 337720..337959 product TIGR03758 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS 337998..338360 product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS 338374..338778 product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS 338775..339449 product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203388111.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 assembly_gap 339556..339656 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 340439..341896 product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267022.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS 341877..342296 product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740043.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 assembly_gap 342805..342889 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 342972..345128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44900 CDS complement(345144..346463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS complement(346460..347170) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919066.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 assembly_gap 347196..347273 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 347422..348204 product MlaA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921519.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS 348600..349667 product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS 349682..350497 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS 350494..351282 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268763.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS 351275..351988 product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764729.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS 351999..352625 product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405298.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 assembly_gap 353148..353391 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 353566..356505 product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104917.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 gene uca CDS 356502..358265 product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268766.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 gene atzF CDS complement(358322..358606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS 358716..359786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS complement(359862..361376) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972889.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS complement(361402..362400) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208802.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS complement(362427..363950) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208803.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(364024..365112) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208804.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS complement(365197..365907) product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208805.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 gene rpiA CDS complement(365949..366788) product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768321.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 gene hexR CDS complement(366785..367459) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338841.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 gene gph CDS complement(367483..368997) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208806.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 gene xylB CDS complement(369001..370485) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208807.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 CDS 370772..371914 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208808.1 transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS 371926..372876 product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS 372900..373661 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208810.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS 373671..374705 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969998.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 CDS complement(374823..375107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS complement(375299..376222) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529397.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS complement(376357..376836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45180 CDS complement(376912..379971) product alpha-ketoglutarate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040186.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 gene mdeB assembly_gap 377218..377314 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 380092..380562 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 assembly_gap 380943..381040 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 381264..382139 product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267008.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS 382165..383565 product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038856.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS complement(383619..384182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS complement(384234..384425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS complement(384733..385287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS complement(385284..385715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS 386311..387636 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817163.1 transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS 387851..389182 product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269280.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS 389438..390466 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195765892.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS 390482..391489 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817165.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS complement(391497..392411) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062802403.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 gene gcvA CDS 392640..393386 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS complement(393375..394076) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113216.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 assembly_gap 394146..394243 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(394320..395024) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090296.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS 395172..396092 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211684.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS complement(396074..396859) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268904.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 CDS complement(397116..397406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS complement(397578..398393) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084969.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 assembly_gap 398513..398588 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(399132..400034) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407625.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS 400177..400875 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 CDS 400907..401566 product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 assembly_gap 402314..402402 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 402933..403691 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS complement(403688..404662) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268051.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS complement(404659..405666) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104324.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS complement(405653..407197) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268053.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS complement(407197..408183) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268054.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 assembly_gap 408638..408718 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(408774..409196) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973696.1 transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(409226..409624) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088362.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS complement(409667..410695) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967763.1 transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS 410907..412088 product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 transl_table 11 codon_start 1 locus_tag LOCUS_45500 CDS 412101..412955 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS 412963..413604 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338205.1 transl_table 11 codon_start 1 locus_tag LOCUS_45520 assembly_gap 413692..413797 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 414490..414580 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 414604..415575 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267228.1 transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS 415579..416730 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770780.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 sequence68 source 1..699925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..1068) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405317.1 transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS complement(1061..2575) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104915.1 transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS complement(2577..3035) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268760.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS complement(3092..4072) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764747.1 transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS complement(4111..5403) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114177.1 transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS 5672..6343 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739198.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS 6336..7721 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104914.1 transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS complement(7871..8692) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764752.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS complement(8716..9657) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032609198.1 transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS 9809..10063 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378499.1 transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS 10047..10499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104913.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS complement(10468..12084) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405338.1 transl_table 11 codon_start 1 locus_tag LOCUS_45660 gene nadB CDS 12622..13203 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 gene rpoE CDS 13235..13825 product anti sigma-E factor RseA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405339.1 transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS 13834..14814 product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS 15075..16493 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 transl_table 11 codon_start 1 locus_tag LOCUS_45700 assembly_gap 16544..16607 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16630..17118) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 transl_table 11 codon_start 1 locus_tag LOCUS_45710 assembly_gap 17203..17426 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17947..19071) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266821.1 transl_table 11 codon_start 1 locus_tag LOCUS_45720 gene gcvT CDS complement(19121..20497) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS complement(20589..23438) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266822.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 gene gcvP CDS complement(23448..23831) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266823.1 transl_table 11 codon_start 1 locus_tag LOCUS_45750 gene gcvH CDS complement(24255..25763) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244904.1 transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS complement(26001..26360) product DUF5064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764067.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS complement(26431..27360) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267887.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 gene arcC CDS complement(27447..28457) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267886.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 CDS complement(28479..29735) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267885.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 gene arcA CDS complement(29767..31194) product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267884.1 transl_table 11 codon_start 1 locus_tag LOCUS_45810 gene arcD assembly_gap 31518..31595 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31716..33143 product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192541.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 gene arcD CDS complement(33356..34708) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198768.1 transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS complement(34777..36915) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113383.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 assembly_gap 35172..35181 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37105..37560) product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003375928.1 transl_table 11 codon_start 1 locus_tag LOCUS_45850 assembly_gap 37624..37696 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37726..38334) product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266826.1 transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS complement(38478..41078) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764059.1 transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS complement(41194..42162) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244900.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 CDS complement(42248..42766) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764054.1 transl_table 11 codon_start 1 locus_tag LOCUS_45890 CDS complement(43336..43659) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS complement(43802..46381) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234442.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 gene mutS CDS 46665..47312 product transcriptional regulator PrtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113202.1 transl_table 11 codon_start 1 locus_tag LOCUS_45920 gene prtR CDS 47916..48263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45930 CDS 48287..48478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS 48558..49049 product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113190.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS 49058..49405 product phage tail assembly chaperone family protein, TAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113189.1 transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS 49435..49689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113188.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 CDS 49750..51171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS 51209..51547 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072856.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS 51544..53295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS 53292..53618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS 53674..54357 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113185.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS 54360..55151 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113184.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 assembly_gap 55439..55726 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 55914..59447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46040 assembly_gap 59301..59394 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 59444..59623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS 59770..60354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269116.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS 60351..60533 product DUF2635 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401999.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 CDS 60533..62029 product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269115.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS 62064..62645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS 62731..63078 product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269114.1 transl_table 11 codon_start 1 locus_tag LOCUS_46100 CDS 63075..63371 product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316280.1 transl_table 11 codon_start 1 locus_tag LOCUS_46110 CDS 63502..65184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46120 assembly_gap 64618..64704 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 65268..66524 product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269112.1 transl_table 11 codon_start 1 locus_tag LOCUS_46130 assembly_gap 65316..65396 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 66528..67565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401994.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS 67678..68238 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372720.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 CDS 68238..68636 product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269111.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 CDS 68626..69666 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401993.1 transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS 69654..70253 product DUF2313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010439013.1 transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS 70265..71911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46190 assembly_gap 70959..71049 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 71908..72255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS 72589..74217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46210 CDS 74227..74508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS 74622..75185 product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269108.1 transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS 75167..75703 product lysis system i-spanin subunit Rz inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269107.1 transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS 76058..76558 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092262.1 transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS 76642..77703 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397594.1 transl_table 11 codon_start 1 locus_tag LOCUS_46260 gene recA CDS 77712..78179 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406202.1 transl_table 11 codon_start 1 locus_tag LOCUS_46270 gene recX CDS complement(78180..79298) product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266989.1 transl_table 11 codon_start 1 locus_tag LOCUS_46280 CDS 79621..79815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46290 CDS complement(79816..80241) product quorum-sensing-regulated virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397588.1 transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS 80471..81190 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406193.1 transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS complement(81165..82142) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119360.1 transl_table 11 codon_start 1 locus_tag LOCUS_46320 CDS 82308..82958 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319664.1 transl_table 11 codon_start 1 locus_tag LOCUS_46330 CDS 83033..83398 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766041.1 transl_table 11 codon_start 1 locus_tag LOCUS_46340 CDS complement(83395..84264) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 transl_table 11 codon_start 1 locus_tag LOCUS_46350 CDS 84458..85237 product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554680.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 gene fpr assembly_gap 85310..85395 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(85418..86113) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766043.1 transl_table 11 codon_start 1 locus_tag LOCUS_46370 gene tsaA CDS complement(86125..87738) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS complement(87847..88518) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381486.1 transl_table 11 codon_start 1 locus_tag LOCUS_46390 CDS complement(88711..89310) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS 89415..90323 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082110.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS complement(90469..90972) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931206.1 transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS complement(90969..91640) product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931205.1 transl_table 11 codon_start 1 locus_tag LOCUS_46430 CDS complement(91742..92473) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665800.1 transl_table 11 codon_start 1 locus_tag LOCUS_46440 CDS 92357..92623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46450 CDS complement(92659..92958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS complement(93198..93899) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393371.1 transl_table 11 codon_start 1 locus_tag LOCUS_46470 CDS complement(93900..94667) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268695.1 transl_table 11 codon_start 1 locus_tag LOCUS_46480 gene livG CDS complement(94664..95917) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268694.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS complement(95914..96837) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268693.1 transl_table 11 codon_start 1 locus_tag LOCUS_46500 gene livH assembly_gap 97018..97080 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(97128..98246) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268692.1 transl_table 11 codon_start 1 locus_tag LOCUS_46510 CDS 98594..98899 product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268691.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 CDS complement(99019..101193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS complement(101525..103813) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463431.1 transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS complement(103940..104308) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114826.1 transl_table 11 codon_start 1 locus_tag LOCUS_46550 CDS 104534..105880 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764944.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS complement(106032..108878) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764946.1 transl_table 11 codon_start 1 locus_tag LOCUS_46570 gene rapA CDS 109134..109475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268688.1 transl_table 11 codon_start 1 locus_tag LOCUS_46580 CDS complement(109445..110689) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930593.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS complement(110686..111156) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930594.1 transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS complement(111245..112123) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242200.1 transl_table 11 codon_start 1 locus_tag LOCUS_46610 gene gcvA CDS 112306..112473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS complement(112874..114349) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363847.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS complement(114738..114938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554967.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS 115697..116539 product pca regulon transcriptional regulator PcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363842.1 transl_table 11 codon_start 1 locus_tag LOCUS_46650 gene pcaR CDS 116900..118246 product 4-hydroxybenzoate transporter PcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101875.1 transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS 118428..119285 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406329.1 transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS 119285..120064 product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246196.1 transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS 120064..121266 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010433944.1 transl_table 11 codon_start 1 locus_tag LOCUS_46690 gene pcaF CDS 121454..122749 product MFS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246194.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS 122796..124154 product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765672.1 transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS 124166..124975 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268150.1 transl_table 11 codon_start 1 locus_tag LOCUS_46720 gene pcaD CDS 125013..125405 product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112676.1 transl_table 11 codon_start 1 locus_tag LOCUS_46730 gene pcaC CDS 125707..126606 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267748.1 transl_table 11 codon_start 1 locus_tag LOCUS_46740 CDS complement(126672..127934) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266703.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(128227..129159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46760 CDS complement(129225..129539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46770 assembly_gap 129368..129377 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(129818..130603) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765329.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS complement(130975..132330) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083208.1 transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS complement(132462..133136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46800 assembly_gap 132818..132827 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(133133..136285) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268787.1 transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS complement(136289..137449) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246191.1 transl_table 11 codon_start 1 locus_tag LOCUS_46820 CDS 137704..138336 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768695.1 transl_table 11 codon_start 1 locus_tag LOCUS_46830 CDS 138494..139381 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS complement(139397..140215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103631.1 transl_table 11 codon_start 1 locus_tag LOCUS_46850 assembly_gap 140838..140847 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(141051..142256) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112805.1 transl_table 11 codon_start 1 locus_tag LOCUS_46860 CDS complement(142437..142886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46870 CDS complement(143132..144181) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104980.1 transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS complement(144203..145369) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104979.1 transl_table 11 codon_start 1 locus_tag LOCUS_46890 CDS complement(145384..145686) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104978.1 transl_table 11 codon_start 1 locus_tag LOCUS_46900 assembly_gap 146169..146276 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 146524..146610 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(146684..147484) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268813.1 transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS complement(147484..148239) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768625.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 CDS 148370..149248 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093969.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS 149324..150424 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010218977.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS 150421..150750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093963.1 transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS 150815..151393 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268811.1 transl_table 11 codon_start 1 locus_tag LOCUS_46960 assembly_gap 151894..151995 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 152072..152635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46970 CDS 152736..153374 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508644.1 transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS 153455..154732 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071311.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS 154880..155134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47000 assembly_gap 155675..155767 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(156055..156402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47010 CDS 156912..157997 product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005746663.1 transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS complement(158123..158947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47030 CDS 159393..160685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47040 tRNA complement(160792..160865) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(161033..161920) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104920.1 transl_table 11 codon_start 1 locus_tag LOCUS_47050 CDS complement(162232..162924) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268769.1 transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS complement(162963..163181) product cysteine-rich CWC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268768.1 transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS complement(163174..164664) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS 164830..165678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47090 CDS complement(165727..167244) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406314.1 transl_table 11 codon_start 1 locus_tag LOCUS_47100 CDS complement(167448..168632) product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103764.1 transl_table 11 codon_start 1 locus_tag LOCUS_47110 gene pobA CDS 168807..169688 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 transl_table 11 codon_start 1 locus_tag LOCUS_47120 CDS complement(169992..170804) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810537.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 assembly_gap 170850..170941 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 171097..171993 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267516.1 transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS 172042..172656 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088577.1 transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS complement(172848..173273) product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086072.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 CDS complement(173266..173871) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 gene wrbA CDS complement(173868..174221) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 transl_table 11 codon_start 1 locus_tag LOCUS_47180 gene arsC CDS 174328..174798 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739010.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS complement(174807..175895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS complement(175903..177048) product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266707.1 transl_table 11 codon_start 1 locus_tag LOCUS_47210 gene lldD CDS 177202..178083 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266708.1 transl_table 11 codon_start 1 locus_tag LOCUS_47220 CDS complement(178146..178550) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103672.1 transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS complement(178550..178984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407729.1 transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS complement(179081..180070) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS complement(180140..182893) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268595.1 transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS 183127..184029 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554618.1 transl_table 11 codon_start 1 locus_tag LOCUS_47270 gene cysM CDS 184029..185381 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103674.1 transl_table 11 codon_start 1 locus_tag LOCUS_47280 gene rlmD CDS 185501..187744 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268592.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 gene relA CDS 187956..188789 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103676.1 transl_table 11 codon_start 1 locus_tag LOCUS_47300 gene mazG CDS 188816..189361 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616372.1 transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS complement(189470..189721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS 190273..190719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266235.1 transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS complement(190742..191005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS 190917..191642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS complement(191710..192423) product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381583.1 transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS complement(192432..193094) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766657.1 transl_table 11 codon_start 1 locus_tag LOCUS_47370 gene purN CDS complement(193094..194221) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381585.1 transl_table 11 codon_start 1 locus_tag LOCUS_47380 gene purM CDS 194528..196729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47390 assembly_gap 195380..195568 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 196983..197687 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369632.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 gene hda CDS 197919..198554 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268584.1 transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS 198786..199322 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369637.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS 199505..200167 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS 200237..200887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS complement(200955..202268) product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS complement(202342..202920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS 203381..203992 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766671.1 transl_table 11 codon_start 1 locus_tag LOCUS_47470 gene cobO CDS 203989..205368 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766673.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS 205365..206015 product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404272.1 transl_table 11 codon_start 1 locus_tag LOCUS_47490 gene bluB CDS 206012..206920 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103680.1 transl_table 11 codon_start 1 locus_tag LOCUS_47500 gene cbiB CDS 206913..207905 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103681.1 transl_table 11 codon_start 1 locus_tag LOCUS_47510 gene cobD CDS 207902..209356 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766682.1 transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS 209366..209893 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766684.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 gene cobU CDS 209890..210945 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766686.1 transl_table 11 codon_start 1 locus_tag LOCUS_47540 gene cobT CDS 210942..211520 product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 CDS 211517..212254 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 CDS 212314..212727 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895547.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 CDS 212780..213988 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268578.1 transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS 214162..214713 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314628.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS complement(214792..216072) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103336.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 CDS complement(216218..216700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS complement(216968..217192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554588.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 assembly_gap 217678..217765 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 218296..218529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS 218608..220086 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699212.1 transl_table 11 codon_start 1 locus_tag LOCUS_47640 CDS complement(220374..223844) product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770431.1 transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS complement(223967..224515) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766294.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 assembly_gap 225470..225570 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 225575..225895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS 226003..226758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS complement(226731..227687) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113809.1 transl_table 11 codon_start 1 locus_tag LOCUS_47690 CDS 227813..228439 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529947.1 transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS 228436..228747 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196156.1 transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS 228853..230007 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428856.1 transl_table 11 codon_start 1 locus_tag LOCUS_47720 assembly_gap 230800..230886 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 230951..232057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47730 assembly_gap 232148..232248 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(232256..232573) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091603.1 transl_table 11 codon_start 1 locus_tag LOCUS_47740 gene sugE CDS complement(232691..233656) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770435.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS complement(233902..234822) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317427.1 transl_table 11 codon_start 1 locus_tag LOCUS_47760 gene rdgC tRNA 234983..235058 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 235141..235217 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 assembly_gap 235394..235403 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 235546..235842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47770 assembly_gap 235890..235899 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 236203..237066 product DUF2242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267162.1 transl_table 11 codon_start 1 locus_tag LOCUS_47780 assembly_gap 237018..237027 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(237217..238353) product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113490.1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS complement(238391..240199) product di-heme-cytochrome C peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113489.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 CDS 240468..241184 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770450.1 transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS 241482..241937 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770452.1 transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS 242051..242392 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770454.1 transl_table 11 codon_start 1 locus_tag LOCUS_47830 assembly_gap 242467..242554 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(242867..244528) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 transl_table 11 codon_start 1 locus_tag LOCUS_47840 assembly_gap 244591..244676 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(244916..247033) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS 247183..248145 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739770.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS complement(248308..248961) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382736.1 transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS complement(249011..250000) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267122.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS complement(249997..250812) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408565.1 transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS complement(250799..251644) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770467.1 transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS complement(251641..252447) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267123.1 transl_table 11 codon_start 1 locus_tag LOCUS_47910 assembly_gap 252568..252577 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(252624..253691) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104766.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS 254083..254796 product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419698.1 transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS complement(254933..257119) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111156.1 transl_table 11 codon_start 1 locus_tag LOCUS_47940 CDS complement(257168..257350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS complement(257593..258882) product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267127.1 transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS complement(259064..259699) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770474.1 transl_table 11 codon_start 1 locus_tag LOCUS_47970 assembly_gap 259776..259888 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(259936..260190) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552653.1 transl_table 11 codon_start 1 locus_tag LOCUS_47980 gene minE CDS complement(260194..261006) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317454.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 gene minD CDS complement(261210..261947) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368369.1 transl_table 11 codon_start 1 locus_tag LOCUS_48000 gene minC CDS 262068..263078 product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267129.1 transl_table 11 codon_start 1 locus_tag LOCUS_48010 assembly_gap 262149..262229 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 263165..264349 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408362.1 transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS complement(264417..265220) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478981.1 transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS complement(265345..266133) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402525.1 transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS complement(266126..267424) product serine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268631.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS 267662..268021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48060 CDS complement(268144..269694) product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS 270026..270877 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268630.1 transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS 271092..271403 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314526.1 transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS 271400..273058 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402531.1 transl_table 11 codon_start 1 locus_tag LOCUS_48100 assembly_gap 273195..273396 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(273428..276166) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267136.1 transl_table 11 codon_start 1 locus_tag LOCUS_48110 gene aceE assembly_gap 275558..275667 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 276346..276816 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408348.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS complement(276839..277885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770657.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 CDS complement(278234..279259) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267164.1 transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS complement(279271..280410) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267165.1 transl_table 11 codon_start 1 locus_tag LOCUS_48150 CDS 280622..282658 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS 282739..283656 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267167.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS complement(283646..284215) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 transl_table 11 codon_start 1 locus_tag LOCUS_48180 CDS 284388..284735 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017131138.1 transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS 284779..286065 product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267173.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS complement(285986..287026) product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104731.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 CDS 287132..288022 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS 288022..288993 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406489.1 transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS 288990..289862 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463338.1 transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS 289894..290154 product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554502.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS 290151..290981 product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208878.1 transl_table 11 codon_start 1 locus_tag LOCUS_48260 CDS 290994..293663 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267176.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 gene pepN CDS 294247..295245 product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS 295281..297656 product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104717.1 transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS 297850..298143 product DUF5629 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368505.1 transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS 298130..299305 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423190.1 transl_table 11 codon_start 1 locus_tag LOCUS_48310 CDS 299461..299640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS 300086..300292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS complement(300307..300924) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS complement(300921..304562) product exonuclease SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267196.1 transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS complement(304559..305803) product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104710.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS complement(305954..307597) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS complement(307594..309360) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769148.1 transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(309357..310433) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769151.1 transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS complement(310426..310920) product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104708.1 transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS complement(310917..311861) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 transl_table 11 codon_start 1 locus_tag LOCUS_48410 CDS complement(311870..312829) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS complement(313040..313792) product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369135.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS complement(313896..314300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406543.1 transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS 314559..315479 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103406.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 315648..316976 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387739.1 transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS 317022..317876 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 assembly_gap 318375..318462 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 318552..320030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48480 CDS 320032..323535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS 323919..328781 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267201.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS 329087..334090 product NEL-type E3 ubiquitin ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104869.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 CDS complement(334169..334432) product DUF4404 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407026.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 CDS complement(334554..335165) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464043.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 CDS 335366..336052 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267309.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS complement(336132..336416) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407020.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 CDS 336821..338002 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407019.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS 338002..338484 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315067.1 transl_table 11 codon_start 1 locus_tag LOCUS_48570 assembly_gap 338766..338775 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(338799..339737) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267331.1 transl_table 11 codon_start 1 locus_tag LOCUS_48580 gene dusA CDS 339913..341055 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 CDS 341235..342665 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 CDS 342662..343273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48610 CDS complement(343317..343604) product pyocin activator PrtN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267327.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS complement(343654..344955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS complement(344952..345494) product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217433129.1 transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS complement(345494..345715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS complement(345712..346140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS complement(346187..346513) product pyocin activator PrtN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104549.1 transl_table 11 codon_start 1 locus_tag LOCUS_48670 CDS complement(346510..346914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48680 CDS complement(347055..347339) product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104547.1 transl_table 11 codon_start 1 locus_tag LOCUS_48690 CDS complement(347349..347930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104546.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 CDS complement(347927..348103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48710 CDS complement(348191..348442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS 348994..349254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48730 CDS 349583..350107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767964.1 transl_table 11 codon_start 1 locus_tag LOCUS_48740 CDS 350094..350315 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104543.1 transl_table 11 codon_start 1 locus_tag LOCUS_48750 CDS 350308..352524 product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104542.1 transl_table 11 codon_start 1 locus_tag LOCUS_48760 CDS 352517..352879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104541.1 transl_table 11 codon_start 1 locus_tag LOCUS_48770 CDS complement(353569..353835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48780 CDS 353929..354276 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118908.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 note possible pseudo, internal stop codon CDS complement(354398..354688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48800 CDS 355056..355658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104538.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 CDS 355663..357708 product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS 357710..357916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377401.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 CDS 357913..359394 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104536.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 CDS 359391..360545 product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104535.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS 360548..360895 product head decoration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104534.1 transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS 360956..361951 product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104533.1 transl_table 11 codon_start 1 locus_tag LOCUS_48870 CDS 361954..362268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244790.1 transl_table 11 codon_start 1 locus_tag LOCUS_48880 CDS 362265..362930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244789.1 transl_table 11 codon_start 1 locus_tag LOCUS_48890 CDS 362920..363429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104532.1 transl_table 11 codon_start 1 locus_tag LOCUS_48900 CDS 363426..363986 product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244787.1 transl_table 11 codon_start 1 locus_tag LOCUS_48910 CDS 364043..364291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244786.1 transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS 364297..364623 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244785.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 CDS 364620..365504 product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104531.1 transl_table 11 codon_start 1 locus_tag LOCUS_48940 CDS 365504..366115 product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104530.1 transl_table 11 codon_start 1 locus_tag LOCUS_48950 CDS 366108..367979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48960 CDS 367991..368419 product phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895512.1 transl_table 11 codon_start 1 locus_tag LOCUS_48970 assembly_gap 368430..368512 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 368591..369754 product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104528.1 transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS 369767..370276 product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247634.1 transl_table 11 codon_start 1 locus_tag LOCUS_48990 CDS 370310..370606 product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104527.1 transl_table 11 codon_start 1 locus_tag LOCUS_49000 CDS 370738..373356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49010 assembly_gap 372657..372734 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 373366..374211 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443159.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 assembly_gap 374313..374401 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 374524..375570 product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104523.1 transl_table 11 codon_start 1 locus_tag LOCUS_49030 CDS 375598..376155 product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269108.1 transl_table 11 codon_start 1 locus_tag LOCUS_49040 CDS 376143..376685 product lysis system i-spanin subunit Rz inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269107.1 transl_table 11 codon_start 1 locus_tag LOCUS_49050 CDS 376928..377629 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104521.1 transl_table 11 codon_start 1 locus_tag LOCUS_49060 assembly_gap 378185..378630 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 379516..379635 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 379682..379855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49070 assembly_gap 379897..379969 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(380156..381487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49080 CDS complement(382323..382820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49090 CDS 383150..383845 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114586.1 transl_table 11 codon_start 1 locus_tag LOCUS_49100 assembly_gap 383953..384023 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(384220..384711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49110 assembly_gap 384746..384815 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(384914..385774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49120 CDS complement(386162..386443) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS complement(386433..386681) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172325.1 transl_table 11 codon_start 1 locus_tag LOCUS_49140 CDS complement(386949..387767) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS complement(387978..389267) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051965637.1 transl_table 11 codon_start 1 locus_tag LOCUS_49160 assembly_gap 389294..389405 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(389662..389946) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS complement(389943..390221) product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 transl_table 11 codon_start 1 locus_tag LOCUS_49180 CDS 390395..390652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49190 CDS complement(390698..391018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49200 assembly_gap 391271..391348 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 391756..392391 product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060707867.1 transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS 392440..393480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS complement(393585..394082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS complement(394079..394516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49240 CDS complement(394513..395067) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527960.1 transl_table 11 codon_start 1 locus_tag LOCUS_49250 CDS complement(395177..395497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49260 CDS complement(395999..396367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS complement(396371..396652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS 397143..398015 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532086.1 transl_table 11 codon_start 1 locus_tag LOCUS_49290 CDS complement(398230..398565) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112498.1 transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS complement(398779..399372) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 transl_table 11 codon_start 1 locus_tag LOCUS_49310 CDS complement(399493..401652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49320 CDS complement(401798..402277) product mischarged aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138039.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 gene yeaK CDS complement(402288..402959) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 transl_table 11 codon_start 1 locus_tag LOCUS_49340 assembly_gap 403005..403096 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(403148..404035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49350 assembly_gap 404172..404253 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 405123..405244 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(405424..406038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49360 assembly_gap 406084..406178 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 406546..407838 product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267876.1 transl_table 11 codon_start 1 locus_tag LOCUS_49370 CDS 407840..409207 product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267877.1 transl_table 11 codon_start 1 locus_tag LOCUS_49380 CDS 409204..409533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401137.1 transl_table 11 codon_start 1 locus_tag LOCUS_49390 CDS complement(409540..410733) product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198032110.1 transl_table 11 codon_start 1 locus_tag LOCUS_49400 gene lhgO assembly_gap 410838..410847 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(410939..412228) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769631.1 transl_table 11 codon_start 1 locus_tag LOCUS_49410 gene gltA CDS 412582..412968 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 transl_table 11 codon_start 1 locus_tag LOCUS_49420 gene sdhC CDS 412962..413330 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382006.1 transl_table 11 codon_start 1 locus_tag LOCUS_49430 gene sdhD CDS 413334..415106 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769628.1 transl_table 11 codon_start 1 locus_tag LOCUS_49440 gene sdhA CDS 415109..415822 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382004.1 transl_table 11 codon_start 1 locus_tag LOCUS_49450 CDS 416114..418945 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366703.1 transl_table 11 codon_start 1 locus_tag LOCUS_49460 CDS 418987..420210 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769624.1 transl_table 11 codon_start 1 locus_tag LOCUS_49470 gene odhB CDS 420324..421760 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382001.1 transl_table 11 codon_start 1 locus_tag LOCUS_49480 gene lpdA CDS 421958..423124 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552981.1 transl_table 11 codon_start 1 locus_tag LOCUS_49490 gene sucC CDS 423124..424005 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316562.1 transl_table 11 codon_start 1 locus_tag LOCUS_49500 gene sucD CDS 424424..425737 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406141.1 transl_table 11 codon_start 1 locus_tag LOCUS_49510 gene brnQ CDS complement(425981..426226) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738079.1 transl_table 11 codon_start 1 locus_tag LOCUS_49520 CDS 426390..426866 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 transl_table 11 codon_start 1 locus_tag LOCUS_49530 CDS 426863..427318 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 transl_table 11 codon_start 1 locus_tag LOCUS_49540 CDS 427408..429312 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406139.1 transl_table 11 codon_start 1 locus_tag LOCUS_49550 gene htpG CDS 429378..430106 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406137.1 transl_table 11 codon_start 1 locus_tag LOCUS_49560 assembly_gap 430152..430376 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(430676..431539) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189178.1 transl_table 11 codon_start 1 locus_tag LOCUS_49570 CDS complement(431599..432015) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814742.1 transl_table 11 codon_start 1 locus_tag LOCUS_49580 CDS 432301..433929 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103145.1 transl_table 11 codon_start 1 locus_tag LOCUS_49590 CDS complement(434122..435342) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769613.1 transl_table 11 codon_start 1 locus_tag LOCUS_49600 gene fabB CDS complement(435354..435869) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316569.1 transl_table 11 codon_start 1 locus_tag LOCUS_49610 gene fabA CDS complement(436107..438002) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114254.1 transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS complement(437999..438934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49630 CDS complement(438937..441030) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 transl_table 11 codon_start 1 locus_tag LOCUS_49640 CDS 441264..442289 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769608.1 transl_table 11 codon_start 1 locus_tag LOCUS_49650 CDS 442311..442646 product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114251.1 transl_table 11 codon_start 1 locus_tag LOCUS_49660 CDS 442643..443092 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769602.1 transl_table 11 codon_start 1 locus_tag LOCUS_49670 gene sixA CDS complement(443135..443842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49680 CDS 444149..445804 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 transl_table 11 codon_start 1 locus_tag LOCUS_49690 CDS 445829..446272 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087490.1 transl_table 11 codon_start 1 locus_tag LOCUS_49700 CDS 446384..447193 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103894.1 transl_table 11 codon_start 1 locus_tag LOCUS_49710 CDS 447190..448044 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765844.1 transl_table 11 codon_start 1 locus_tag LOCUS_49720 CDS 448174..448992 product DUF4892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054081893.1 transl_table 11 codon_start 1 locus_tag LOCUS_49730 CDS 449065..450198 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765838.1 transl_table 11 codon_start 1 locus_tag LOCUS_49740 assembly_gap 449719..449808 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 450237..450443 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(450492..451292) product XopAW family type III secretion system calcium-binding effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267385.1 transl_table 11 codon_start 1 locus_tag LOCUS_49750 gene xopAW CDS complement(451407..452240) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765836.1 transl_table 11 codon_start 1 locus_tag LOCUS_49760 note possible pseudo, frameshifted assembly_gap 452372..452451 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(452544..453308) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244755.1 transl_table 11 codon_start 1 locus_tag LOCUS_49770 CDS 453774..455483 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103910.1 transl_table 11 codon_start 1 locus_tag LOCUS_49780 gene kdpA CDS 455494..457548 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267400.1 transl_table 11 codon_start 1 locus_tag LOCUS_49790 gene kdpB assembly_gap 458179..458368 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 458463..461195 product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267402.1 transl_table 11 codon_start 1 locus_tag LOCUS_49800 assembly_gap 460253..460336 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 461232..461927 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103914.1 transl_table 11 codon_start 1 locus_tag LOCUS_49810 CDS complement(462097..463137) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087542.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 CDS 463333..463611 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765788.1 transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS 463768..464685 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 CDS 464682..465638 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417868.1 transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS 465635..467605 product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463435.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 CDS 467612..468376 product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103916.1 transl_table 11 codon_start 1 locus_tag LOCUS_49870 CDS 468526..469323 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 transl_table 11 codon_start 1 locus_tag LOCUS_49880 CDS complement(469651..469884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49890 CDS complement(469969..471447) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267410.1 transl_table 11 codon_start 1 locus_tag LOCUS_49900 CDS complement(471534..472340) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103918.1 transl_table 11 codon_start 1 locus_tag LOCUS_49910 CDS 472619..474103 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765770.1 transl_table 11 codon_start 1 locus_tag LOCUS_49920 assembly_gap 472674..472750 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 474207..474641 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765767.1 transl_table 11 codon_start 1 locus_tag LOCUS_49930 CDS 474888..475196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267414.1 transl_table 11 codon_start 1 locus_tag LOCUS_49940 CDS complement(475355..475852) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090951.1 transl_table 11 codon_start 1 locus_tag LOCUS_49950 gene greB CDS complement(475888..478230) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765750.1 transl_table 11 codon_start 1 locus_tag LOCUS_49960 assembly_gap 478279..478361 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(478469..479152) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 transl_table 11 codon_start 1 locus_tag LOCUS_49970 CDS 479163..479768 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 transl_table 11 codon_start 1 locus_tag LOCUS_49980 CDS 479824..480117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315714.1 transl_table 11 codon_start 1 locus_tag LOCUS_49990 CDS 480239..481207 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267417.1 transl_table 11 codon_start 1 locus_tag LOCUS_50000 assembly_gap 481411..481487 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 482301..482582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50010 CDS complement(482652..483728) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382491.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 CDS complement(483854..484300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50030 CDS 484299..484685 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122849.1 transl_table 11 codon_start 1 locus_tag LOCUS_50040 CDS complement(484595..484822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50050 assembly_gap 484926..485018 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 485754..486713 product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103928.1 transl_table 11 codon_start 1 locus_tag LOCUS_50060 CDS 486733..487644 product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS 487727..488227 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 transl_table 11 codon_start 1 locus_tag LOCUS_50080 CDS 488340..489314 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382487.1 transl_table 11 codon_start 1 locus_tag LOCUS_50090 gene cysB CDS complement(489391..490125) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267420.1 transl_table 11 codon_start 1 locus_tag LOCUS_50100 CDS 490248..490985 product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 transl_table 11 codon_start 1 locus_tag LOCUS_50110 gene thrH assembly_gap 490279..490351 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(490990..492333) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267422.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 gene pabB CDS complement(492508..493494) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797774.1 transl_table 11 codon_start 1 locus_tag LOCUS_50130 CDS complement(493494..495026) product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765727.1 transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS complement(495032..495571) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267424.1 transl_table 11 codon_start 1 locus_tag LOCUS_50150 CDS 495825..496589 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 transl_table 11 codon_start 1 locus_tag LOCUS_50160 CDS 496586..497476 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 transl_table 11 codon_start 1 locus_tag LOCUS_50170 gene prpB CDS 497533..498660 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103932.1 transl_table 11 codon_start 1 locus_tag LOCUS_50180 gene prpC CDS 498864..501458 product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267428.1 transl_table 11 codon_start 1 locus_tag LOCUS_50190 gene acnD assembly_gap 501567..501653 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 501699..502889 product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267429.1 transl_table 11 codon_start 1 locus_tag LOCUS_50200 gene prpF CDS 503110..504594 product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103059.1 transl_table 11 codon_start 1 locus_tag LOCUS_50210 gene prpD assembly_gap 504662..504863 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(504887..505828) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120268.1 transl_table 11 codon_start 1 locus_tag LOCUS_50220 CDS 505921..507348 product transcriptional regulator MdrR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106149.1 transl_table 11 codon_start 1 locus_tag LOCUS_50230 gene mdrR2 CDS complement(507341..508159) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347114.1 transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS complement(508238..508528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50250 CDS 508418..510709 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406749.1 transl_table 11 codon_start 1 locus_tag LOCUS_50260 gene ppsA CDS 510856..512016 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267430.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 assembly_gap 510893..510986 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 512176..512667 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 transl_table 11 codon_start 1 locus_tag LOCUS_50280 gene rraA CDS 512697..513692 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382467.1 transl_table 11 codon_start 1 locus_tag LOCUS_50290 CDS 513757..514002 product crfX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406745.1 transl_table 11 codon_start 1 locus_tag LOCUS_50300 CDS 514005..514829 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315687.1 transl_table 11 codon_start 1 locus_tag LOCUS_50310 CDS 514944..515510 product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015096065.1 transl_table 11 codon_start 1 locus_tag LOCUS_50320 gene sigX CDS 515617..516597 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406743.1 transl_table 11 codon_start 1 locus_tag LOCUS_50330 CDS complement(516674..518344) product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463440.1 transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS complement(518352..519224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50350 assembly_gap 519349..519440 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(519893..520468) product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406734.1 transl_table 11 codon_start 1 locus_tag LOCUS_50360 CDS complement(520483..521394) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103941.1 transl_table 11 codon_start 1 locus_tag LOCUS_50370 assembly_gap 521426..521550 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 522075..522830 product type III secretion system transcriptional activator InvF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001674874.1 transl_table 11 codon_start 1 locus_tag LOCUS_50380 gene invF assembly_gap 522343..522411 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 522827..524491 product type III secretion system outer membrane ring protein InvG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848103.1 transl_table 11 codon_start 1 locus_tag LOCUS_50390 gene invG CDS 524496..525605 product type III secretion system gatekeeper InvE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612166.1 transl_table 11 codon_start 1 locus_tag LOCUS_50400 gene invE CDS 525614..527668 product type III secretion system export apparatus protein InvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927219.1 transl_table 11 codon_start 1 locus_tag LOCUS_50410 gene invA CDS 527681..528088 product SPI-1 type III secretion system chaperone SpaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164066.1 transl_table 11 codon_start 1 locus_tag LOCUS_50420 gene spaK CDS 528085..529374 product SctN family type III secretion system ATPase InvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856766.1 transl_table 11 codon_start 1 locus_tag LOCUS_50430 gene invC assembly_gap 529451..529534 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 529585..529896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS 529893..530804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50450 CDS 530801..531769 product SPI-1 type III secretion system protein SpaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058738.1 transl_table 11 codon_start 1 locus_tag LOCUS_50460 gene spaO CDS 531759..532418 product type III secretion system export apparatus protein Spa24/SpaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947539.1 transl_table 11 codon_start 1 locus_tag LOCUS_50470 gene spa24 CDS 532429..532683 product SPI-1 type III secretion system export apparatus protein SpaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342503.1 transl_table 11 codon_start 1 locus_tag LOCUS_50480 gene spaQ CDS 532691..533464 product SPI-1 type III secretion system export apparatus protein SpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964941.1 transl_table 11 codon_start 1 locus_tag LOCUS_50490 gene spaR CDS 533466..534500 product SPI-1 type III secretion system export apparatus protein SpaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097721.1 transl_table 11 codon_start 1 locus_tag LOCUS_50500 gene spaS CDS 534615..535106 product SycD/LcrH family type III secretion system chaperone SicA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386309.1 transl_table 11 codon_start 1 locus_tag LOCUS_50510 gene sicA CDS 535103..536881 product SPI-1 type III secretion system needle tip complex protein SipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245782.1 transl_table 11 codon_start 1 locus_tag LOCUS_50520 gene sipB CDS 536904..537896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50530 CDS 537906..538985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50540 CDS 539078..539374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50550 CDS 539585..540829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50560 CDS 540826..541266 product SPI-1 type III secretion system invasion protein IagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558926.1 transl_table 11 codon_start 1 locus_tag LOCUS_50570 gene iagB CDS 541386..542531 product type III secretion system inner membrane ring protein PrgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450189.1 transl_table 11 codon_start 1 locus_tag LOCUS_50580 gene prgH CDS 542544..542804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50590 CDS 542816..543124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50600 CDS 543121..543834 product type III secretion system inner membrane ring lipoprotein PrgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621241.1 transl_table 11 codon_start 1 locus_tag LOCUS_50610 gene prgK CDS 543831..544391 product oxygen-regulated invasion protein OrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001574876.1 transl_table 11 codon_start 1 locus_tag LOCUS_50620 gene orgA CDS 544366..545079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50630 CDS 545069..545500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50640 CDS 545572..546594 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103942.1 transl_table 11 codon_start 1 locus_tag LOCUS_50650 assembly_gap 547686..547774 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 548274..548368 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 548424..550064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50660 assembly_gap 548743..548822 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 550200..552149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50670 CDS complement(552228..553670) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765687.1 transl_table 11 codon_start 1 locus_tag LOCUS_50680 gene dacB CDS 553915..554259 product 50S ribosome-binding protein YggL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346101.1 transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS complement(554389..555159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032621400.1 transl_table 11 codon_start 1 locus_tag LOCUS_50700 tRNA 555506..555581 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 555584..555659 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(555808..556116) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114441661.1 transl_table 11 codon_start 1 locus_tag LOCUS_50710 CDS complement(556113..556421) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967242.1 transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS complement(556789..558528) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103517.1 transl_table 11 codon_start 1 locus_tag LOCUS_50730 CDS complement(558598..559239) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114256.1 transl_table 11 codon_start 1 locus_tag LOCUS_50740 CDS 559331..560296 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816572.1 transl_table 11 codon_start 1 locus_tag LOCUS_50750 assembly_gap 560414..560423 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(560783..561472) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054996466.1 transl_table 11 codon_start 1 locus_tag LOCUS_50760 CDS complement(561695..562297) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195598.1 transl_table 11 codon_start 1 locus_tag LOCUS_50770 CDS complement(562444..563232) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206755.1 transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS complement(563244..564005) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206756.1 transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS complement(564014..564775) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206757.1 transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS complement(564968..567433) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206751.1 transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS complement(567583..569847) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 transl_table 11 codon_start 1 locus_tag LOCUS_50820 CDS complement(570197..571255) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209743.1 transl_table 11 codon_start 1 locus_tag LOCUS_50830 CDS complement(571291..572340) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209743.1 transl_table 11 codon_start 1 locus_tag LOCUS_50840 CDS complement(572360..573511) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206759.1 transl_table 11 codon_start 1 locus_tag LOCUS_50850 CDS complement(573710..575554) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206749.1 transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS complement(575547..577313) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206748.1 transl_table 11 codon_start 1 locus_tag LOCUS_50870 CDS complement(577366..578598) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206747.1 transl_table 11 codon_start 1 locus_tag LOCUS_50880 CDS 578876..579919 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060708.1 transl_table 11 codon_start 1 locus_tag LOCUS_50890 CDS 579935..580666 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209266.1 transl_table 11 codon_start 1 locus_tag LOCUS_50900 assembly_gap 580740..580831 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 581250..581343 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 581470..582081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50910 CDS 582082..583641 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206743.1 transl_table 11 codon_start 1 locus_tag LOCUS_50920 CDS 583634..584692 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206744.1 transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS 584689..585516 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206745.1 transl_table 11 codon_start 1 locus_tag LOCUS_50940 CDS 585513..587291 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206746.1 transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS complement(587415..588500) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005131911.1 transl_table 11 codon_start 1 locus_tag LOCUS_50960 CDS complement(588520..591081) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206762.1 transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS complement(591127..592488) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206761.1 transl_table 11 codon_start 1 locus_tag LOCUS_50980 assembly_gap 592559..592642 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(592776..593981) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013197887.1 transl_table 11 codon_start 1 locus_tag LOCUS_50990 CDS complement(593995..595221) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206752.1 transl_table 11 codon_start 1 locus_tag LOCUS_51000 CDS complement(595236..596312) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206758.1 transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS 596615..597688 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115339.1 transl_table 11 codon_start 1 locus_tag LOCUS_51020 CDS complement(597833..599194) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 transl_table 11 codon_start 1 locus_tag LOCUS_51030 CDS complement(599210..600991) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266754.1 transl_table 11 codon_start 1 locus_tag LOCUS_51040 CDS complement(601262..603163) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193082.1 transl_table 11 codon_start 1 locus_tag LOCUS_51050 CDS complement(603163..604116) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224790.1 transl_table 11 codon_start 1 locus_tag LOCUS_51060 CDS complement(604203..605291) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS complement(605379..605993) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140311.1 transl_table 11 codon_start 1 locus_tag LOCUS_51080 CDS 606268..607341 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_51090 CDS complement(607401..608060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS complement(608142..609737) product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007421.1 transl_table 11 codon_start 1 locus_tag LOCUS_51110 CDS complement(610044..611495) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 transl_table 11 codon_start 1 locus_tag LOCUS_51120 gene gabD CDS complement(611537..612274) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096148.1 transl_table 11 codon_start 1 locus_tag LOCUS_51130 CDS 612567..613658 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269125.1 transl_table 11 codon_start 1 locus_tag LOCUS_51140 CDS 613713..614741 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209788.1 transl_table 11 codon_start 1 locus_tag LOCUS_51150 CDS 614802..616064 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209787.1 transl_table 11 codon_start 1 locus_tag LOCUS_51160 CDS 616073..616897 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209786.1 transl_table 11 codon_start 1 locus_tag LOCUS_51170 CDS complement(616973..618343) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086907.1 transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS 618503..619168 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967933.1 transl_table 11 codon_start 1 locus_tag LOCUS_51190 CDS 619523..620377 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 transl_table 11 codon_start 1 locus_tag LOCUS_51200 CDS 620461..621969 product amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315104.1 transl_table 11 codon_start 1 locus_tag LOCUS_51210 CDS 621987..622652 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105278.1 transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS 622667..623518 product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698836.1 transl_table 11 codon_start 1 locus_tag LOCUS_51230 CDS 623598..624350 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 transl_table 11 codon_start 1 locus_tag LOCUS_51240 assembly_gap 624859..624949 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 625139..626023 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 transl_table 11 codon_start 1 locus_tag LOCUS_51250 assembly_gap 625923..626006 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(626194..627225) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966058.1 transl_table 11 codon_start 1 locus_tag LOCUS_51260 CDS complement(627308..628627) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392014.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 CDS complement(628829..629731) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930233.1 transl_table 11 codon_start 1 locus_tag LOCUS_51280 CDS 629854..630516 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175134.1 transl_table 11 codon_start 1 locus_tag LOCUS_51290 CDS 630525..631733 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530392.1 transl_table 11 codon_start 1 locus_tag LOCUS_51300 CDS 631825..633177 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789589.1 transl_table 11 codon_start 1 locus_tag LOCUS_51310 gene gltP CDS complement(633111..634313) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101497.1 transl_table 11 codon_start 1 locus_tag LOCUS_51320 CDS 634619..635623 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141824.1 transl_table 11 codon_start 1 locus_tag LOCUS_51330 CDS 635840..636826 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114314.1 transl_table 11 codon_start 1 locus_tag LOCUS_51340 gene tauA CDS 637047..638192 product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244527.1 transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS 638680..639864 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203095.1 transl_table 11 codon_start 1 locus_tag LOCUS_51360 CDS 639880..643128 product multidrug efflux RND transporter permease subunit CeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188522.1 transl_table 11 codon_start 1 locus_tag LOCUS_51370 gene ceoB CDS 643139..644650 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927472.1 transl_table 11 codon_start 1 locus_tag LOCUS_51380 CDS 644717..646264 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529928.1 transl_table 11 codon_start 1 locus_tag LOCUS_51390 CDS 646392..647036 product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003517288.1 transl_table 11 codon_start 1 locus_tag LOCUS_51400 CDS complement(647113..648084) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095765.1 transl_table 11 codon_start 1 locus_tag LOCUS_51410 assembly_gap 647812..647886 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(648304..649014) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088678.1 transl_table 11 codon_start 1 locus_tag LOCUS_51420 CDS complement(649059..649709) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 transl_table 11 codon_start 1 locus_tag LOCUS_51430 CDS complement(649706..649921) product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388926.1 transl_table 11 codon_start 1 locus_tag LOCUS_51440 CDS complement(650099..651313) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919408.1 transl_table 11 codon_start 1 locus_tag LOCUS_51450 CDS complement(651310..651972) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727135.1 transl_table 11 codon_start 1 locus_tag LOCUS_51460 CDS complement(651969..652652) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104434.1 transl_table 11 codon_start 1 locus_tag LOCUS_51470 CDS 652758..653651 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970995.1 transl_table 11 codon_start 1 locus_tag LOCUS_51480 CDS complement(653779..654081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51490 assembly_gap 654160..654233 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 654285..654683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51500 CDS complement(654744..656108) product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976328.1 transl_table 11 codon_start 1 locus_tag LOCUS_51510 assembly_gap 654873..654957 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(656128..657225) product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 transl_table 11 codon_start 1 locus_tag LOCUS_51520 gene nspC CDS complement(657312..657827) product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228926.1 transl_table 11 codon_start 1 locus_tag LOCUS_51530 gene mug CDS complement(657850..658473) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966769.1 transl_table 11 codon_start 1 locus_tag LOCUS_51540 CDS 658594..659832 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088998.1 transl_table 11 codon_start 1 locus_tag LOCUS_51550 assembly_gap 658739..658834 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 659829..661292 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088997.1 transl_table 11 codon_start 1 locus_tag LOCUS_51560 CDS 661312..662790 product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926880.1 transl_table 11 codon_start 1 locus_tag LOCUS_51570 CDS 662795..663736 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088996.1 transl_table 11 codon_start 1 locus_tag LOCUS_51580 CDS complement(663885..665891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51590 CDS 666115..666843 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095970.1 transl_table 11 codon_start 1 locus_tag LOCUS_51600 gene hutC assembly_gap 667640..667732 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 667762..668178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51610 CDS 668249..669361 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972859.1 transl_table 11 codon_start 1 locus_tag LOCUS_51620 CDS 669358..670008 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229697.1 transl_table 11 codon_start 1 locus_tag LOCUS_51630 CDS 670005..670706 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 transl_table 11 codon_start 1 locus_tag LOCUS_51640 CDS 670760..671638 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743594.1 transl_table 11 codon_start 1 locus_tag LOCUS_51650 CDS 671700..673247 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 transl_table 11 codon_start 1 locus_tag LOCUS_51660 gene hutH CDS 673471..674337 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194709.1 transl_table 11 codon_start 1 locus_tag LOCUS_51670 CDS complement(674380..675597) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 transl_table 11 codon_start 1 locus_tag LOCUS_51680 CDS complement(675601..676953) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 transl_table 11 codon_start 1 locus_tag LOCUS_51690 CDS complement(677020..677862) product arginine/ornithine transport ATP-binding protein AotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085940.1 transl_table 11 codon_start 1 locus_tag LOCUS_51700 gene aotP CDS complement(677877..678596) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 transl_table 11 codon_start 1 locus_tag LOCUS_51710 CDS complement(678593..679279) product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815927.1 transl_table 11 codon_start 1 locus_tag LOCUS_51720 CDS complement(679290..681419) product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967138.1 transl_table 11 codon_start 1 locus_tag LOCUS_51730 CDS complement(681474..682250) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207231.1 transl_table 11 codon_start 1 locus_tag LOCUS_51740 CDS complement(682279..683088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51750 assembly_gap 683146..683236 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(683733..685304) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 transl_table 11 codon_start 1 locus_tag LOCUS_51760 gene pruA CDS complement(685455..686411) product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804931.1 transl_table 11 codon_start 1 locus_tag LOCUS_51770 CDS 686699..687082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51780 CDS complement(687249..688763) product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010437016.1 transl_table 11 codon_start 1 locus_tag LOCUS_51790 assembly_gap 688377..688464 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(688836..689642) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267787.1 transl_table 11 codon_start 1 locus_tag LOCUS_51800 assembly_gap 689946..690069 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 690254..693025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51810 assembly_gap 692728..692888 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 693019..693531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51820 assembly_gap 694769..694853 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 696328..696337 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 697235..697244 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 699389..699485 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence69 source 1..174489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 432..821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51830 CDS complement(947..1177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51840 CDS complement(1446..1820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51850 assembly_gap 1877..1950 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2251..2679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51860 note possible pseudo, frameshifted CDS complement(2567..4099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51870 note possible pseudo, frameshifted assembly_gap 2734..2743 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4130..4672) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094294.1 transl_table 11 codon_start 1 locus_tag LOCUS_51880 CDS 4879..5094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51890 CDS complement(5178..6206) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530315.1 transl_table 11 codon_start 1 locus_tag LOCUS_51900 CDS 6309..7190 product virulence transcriptional regulator RovM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210280.1 transl_table 11 codon_start 1 locus_tag LOCUS_51910 gene rovM CDS complement(7240..8592) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084265.1 transl_table 11 codon_start 1 locus_tag LOCUS_51920 assembly_gap 8924..9050 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9819..10397 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463775.1 transl_table 11 codon_start 1 locus_tag LOCUS_51930 CDS complement(10427..11806) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102887.1 transl_table 11 codon_start 1 locus_tag LOCUS_51940 CDS complement(12131..13228) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 transl_table 11 codon_start 1 locus_tag LOCUS_51950 CDS complement(13245..13841) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095727.1 transl_table 11 codon_start 1 locus_tag LOCUS_51960 assembly_gap 13931..14070 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14082..16130) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 transl_table 11 codon_start 1 locus_tag LOCUS_51970 assembly_gap 15525..15626 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 16369..17154 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 transl_table 11 codon_start 1 locus_tag LOCUS_51980 assembly_gap 17222..17347 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(17394..18686) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113729.1 transl_table 11 codon_start 1 locus_tag LOCUS_51990 gene lpdA CDS complement(18785..19462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52000 assembly_gap 19502..19605 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20167..21222) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089248.1 transl_table 11 codon_start 1 locus_tag LOCUS_52010 CDS complement(21226..22461) product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523292.1 transl_table 11 codon_start 1 locus_tag LOCUS_52020 CDS 22657..23145 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187998.1 transl_table 11 codon_start 1 locus_tag LOCUS_52030 CDS complement(23236..23430) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554157.1 transl_table 11 codon_start 1 locus_tag LOCUS_52040 gene csrA CDS 23683..24021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS complement(24223..24912) product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765647.1 transl_table 11 codon_start 1 locus_tag LOCUS_52060 CDS complement(24917..25165) product DUF1654 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765646.1 transl_table 11 codon_start 1 locus_tag LOCUS_52070 assembly_gap 25390..25817 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25863..26096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52080 CDS 26317..27273 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765644.1 transl_table 11 codon_start 1 locus_tag LOCUS_52090 CDS 27338..28891 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103969.1 transl_table 11 codon_start 1 locus_tag LOCUS_52100 CDS 28888..29865 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103970.1 transl_table 11 codon_start 1 locus_tag LOCUS_52110 CDS 29869..30879 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267463.1 transl_table 11 codon_start 1 locus_tag LOCUS_52120 CDS 30935..31855 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 transl_table 11 codon_start 1 locus_tag LOCUS_52130 gene rbsK CDS 31852..32256 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765637.1 transl_table 11 codon_start 1 locus_tag LOCUS_52140 gene rbsD CDS 32285..33313 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267466.1 transl_table 11 codon_start 1 locus_tag LOCUS_52150 CDS 33441..33746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52160 CDS 33916..34239 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267468.1 transl_table 11 codon_start 1 locus_tag LOCUS_52170 CDS complement(34311..34523) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553156.1 transl_table 11 codon_start 1 locus_tag LOCUS_52180 assembly_gap 34735..34800 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34881..35180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52190 CDS 35569..37491 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267470.1 transl_table 11 codon_start 1 locus_tag LOCUS_52200 gene thrS CDS 37509..38042 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367017.1 transl_table 11 codon_start 1 locus_tag LOCUS_52210 gene infC CDS 38103..38297 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553160.1 transl_table 11 codon_start 1 locus_tag LOCUS_52220 gene rpmI CDS 38328..38684 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553161.1 transl_table 11 codon_start 1 locus_tag LOCUS_52230 gene rplT CDS 38796..39812 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 transl_table 11 codon_start 1 locus_tag LOCUS_52240 gene pheS CDS 39840..42221 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267471.1 transl_table 11 codon_start 1 locus_tag LOCUS_52250 gene pheT CDS 42225..42527 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 transl_table 11 codon_start 1 locus_tag LOCUS_52260 gene ihfA CDS 42508..42864 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 transl_table 11 codon_start 1 locus_tag LOCUS_52270 tRNA 42954..43030 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 43265..43909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52280 CDS complement(44004..45104) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812183.1 transl_table 11 codon_start 1 locus_tag LOCUS_52290 assembly_gap 44231..44315 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(45101..46453) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_52300 CDS complement(46471..48573) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967780.1 transl_table 11 codon_start 1 locus_tag LOCUS_52310 assembly_gap 48631..48734 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(48789..49253) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967781.1 transl_table 11 codon_start 1 locus_tag LOCUS_52320 CDS complement(49331..50281) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048324208.1 transl_table 11 codon_start 1 locus_tag LOCUS_52330 CDS complement(50368..51048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52340 CDS complement(51195..52448) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521485.1 transl_table 11 codon_start 1 locus_tag LOCUS_52350 CDS complement(52445..53686) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535871.1 transl_table 11 codon_start 1 locus_tag LOCUS_52360 assembly_gap 53715..53791 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 54055..54963 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527033.1 transl_table 11 codon_start 1 locus_tag LOCUS_52370 CDS 55147..56247 product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521482.1 transl_table 11 codon_start 1 locus_tag LOCUS_52380 assembly_gap 56300..56376 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 56389..57969 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521481.1 transl_table 11 codon_start 1 locus_tag LOCUS_52390 CDS 58015..59334 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527034.1 transl_table 11 codon_start 1 locus_tag LOCUS_52400 CDS 59399..61045 product aromatic amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531312.1 transl_table 11 codon_start 1 locus_tag LOCUS_52410 CDS complement(61110..61781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52420 CDS complement(61865..62074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52430 CDS 62551..64065 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268376.1 transl_table 11 codon_start 1 locus_tag LOCUS_52440 assembly_gap 63888..63961 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 64062..64244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52450 CDS 64424..65608 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771500.1 transl_table 11 codon_start 1 locus_tag LOCUS_52460 CDS complement(65661..66248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52470 CDS 66489..67634 product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970388.1 transl_table 11 codon_start 1 locus_tag LOCUS_52480 CDS complement(68303..69541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52490 CDS complement(69544..71034) product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 transl_table 11 codon_start 1 locus_tag LOCUS_52500 gene hxsB CDS complement(71037..71354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52510 CDS complement(71900..72205) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626063.1 transl_table 11 codon_start 1 locus_tag LOCUS_52520 CDS complement(72186..72569) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388677.1 transl_table 11 codon_start 1 locus_tag LOCUS_52530 CDS 73234..73620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52540 CDS complement(73693..74529) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530446.1 transl_table 11 codon_start 1 locus_tag LOCUS_52550 CDS complement(74517..75320) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530445.1 transl_table 11 codon_start 1 locus_tag LOCUS_52560 CDS complement(75329..76315) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530444.1 transl_table 11 codon_start 1 locus_tag LOCUS_52570 CDS complement(76614..78248) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530447.1 transl_table 11 codon_start 1 locus_tag LOCUS_52580 CDS complement(78323..79813) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112672.1 transl_table 11 codon_start 1 locus_tag LOCUS_52590 CDS 80202..81116 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 transl_table 11 codon_start 1 locus_tag LOCUS_52600 CDS complement(81123..82274) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106035.1 transl_table 11 codon_start 1 locus_tag LOCUS_52610 gene argE CDS complement(82275..82949) product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 transl_table 11 codon_start 1 locus_tag LOCUS_52620 CDS complement(83140..84405) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112673.1 transl_table 11 codon_start 1 locus_tag LOCUS_52630 assembly_gap 84492..84589 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 84751..85374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52640 CDS 85496..86803 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114443.1 transl_table 11 codon_start 1 locus_tag LOCUS_52650 CDS 86875..87312 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096732.1 transl_table 11 codon_start 1 locus_tag LOCUS_52660 CDS complement(87336..87794) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293639.1 transl_table 11 codon_start 1 locus_tag LOCUS_52670 CDS 87865..89358 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029917.1 transl_table 11 codon_start 1 locus_tag LOCUS_52680 CDS complement(89331..90803) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 transl_table 11 codon_start 1 locus_tag LOCUS_52690 CDS complement(90796..91623) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976300.1 transl_table 11 codon_start 1 locus_tag LOCUS_52700 CDS complement(91625..92542) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723477.1 transl_table 11 codon_start 1 locus_tag LOCUS_52710 CDS complement(92574..93716) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528933.1 transl_table 11 codon_start 1 locus_tag LOCUS_52720 CDS complement(93756..94883) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528932.1 transl_table 11 codon_start 1 locus_tag LOCUS_52730 CDS complement(94989..95798) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310827.1 transl_table 11 codon_start 1 locus_tag LOCUS_52740 CDS complement(96050..96343) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 transl_table 11 codon_start 1 locus_tag LOCUS_52750 CDS complement(96336..96581) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010433119.1 transl_table 11 codon_start 1 locus_tag LOCUS_52760 CDS complement(96708..97679) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096540.1 transl_table 11 codon_start 1 locus_tag LOCUS_52770 CDS complement(97679..98674) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703224.1 transl_table 11 codon_start 1 locus_tag LOCUS_52780 CDS complement(98671..99552) product D,D-dipeptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979608.1 transl_table 11 codon_start 1 locus_tag LOCUS_52790 CDS complement(99554..100570) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370098.1 transl_table 11 codon_start 1 locus_tag LOCUS_52800 CDS complement(100645..102243) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370099.1 transl_table 11 codon_start 1 locus_tag LOCUS_52810 CDS complement(102432..102971) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370100.1 transl_table 11 codon_start 1 locus_tag LOCUS_52820 gene ddpX CDS complement(103007..103867) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198422.1 transl_table 11 codon_start 1 locus_tag LOCUS_52830 CDS 104169..104720 product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526835.1 transl_table 11 codon_start 1 locus_tag LOCUS_52840 CDS 104717..105136 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072053.1 transl_table 11 codon_start 1 locus_tag LOCUS_52850 CDS complement(105112..105594) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086962.1 transl_table 11 codon_start 1 locus_tag LOCUS_52860 CDS 105708..106976 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895556.1 transl_table 11 codon_start 1 locus_tag LOCUS_52870 gene fabF CDS 107134..108117 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369595.1 transl_table 11 codon_start 1 locus_tag LOCUS_52880 CDS complement(108181..108828) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267780.1 transl_table 11 codon_start 1 locus_tag LOCUS_52890 gene dhaL CDS complement(108832..109833) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267781.1 transl_table 11 codon_start 1 locus_tag LOCUS_52900 CDS complement(109869..110627) product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267782.1 transl_table 11 codon_start 1 locus_tag LOCUS_52910 CDS complement(110732..111727) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317694.1 transl_table 11 codon_start 1 locus_tag LOCUS_52920 CDS complement(111724..113211) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267784.1 transl_table 11 codon_start 1 locus_tag LOCUS_52930 CDS 113481..113960 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402606.1 transl_table 11 codon_start 1 locus_tag LOCUS_52940 gene rpiB CDS 114043..116064 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405179.1 transl_table 11 codon_start 1 locus_tag LOCUS_52950 gene tkt assembly_gap 116113..116181 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 116538..117587 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103126.1 transl_table 11 codon_start 1 locus_tag LOCUS_52960 gene epd CDS 117605..118768 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763560.1 transl_table 11 codon_start 1 locus_tag LOCUS_52970 assembly_gap 118940..119013 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 119157..119495 product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003320832.1 transl_table 11 codon_start 1 locus_tag LOCUS_52980 CDS 119575..120639 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084964.1 transl_table 11 codon_start 1 locus_tag LOCUS_52990 gene fba CDS complement(120702..121040) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400923.1 transl_table 11 codon_start 1 locus_tag LOCUS_53000 CDS complement(122020..122547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53010 CDS 122853..123146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53020 CDS complement(123305..123976) product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266450.1 transl_table 11 codon_start 1 locus_tag LOCUS_53030 CDS complement(124228..124908) product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378216.1 transl_table 11 codon_start 1 locus_tag LOCUS_53040 CDS 125148..127271 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762944.1 transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS 127317..127829 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404609.1 transl_table 11 codon_start 1 locus_tag LOCUS_53060 CDS 127851..128147 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762949.1 transl_table 11 codon_start 1 locus_tag LOCUS_53070 CDS complement(128154..128606) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620970.1 transl_table 11 codon_start 1 locus_tag LOCUS_53080 CDS 128903..129640 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266453.1 transl_table 11 codon_start 1 locus_tag LOCUS_53090 CDS complement(129761..131953) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266454.1 transl_table 11 codon_start 1 locus_tag LOCUS_53100 gene yccS CDS complement(132455..133633) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266455.1 transl_table 11 codon_start 1 locus_tag LOCUS_53110 assembly_gap 133698..133807 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(133924..135075) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153222447.1 transl_table 11 codon_start 1 locus_tag LOCUS_53120 gene dbpA note possible pseudo, frameshifted CDS complement(135114..135332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53130 note possible pseudo, frameshifted assembly_gap 135155..135164 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(135538..136968) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154742258.1 transl_table 11 codon_start 1 locus_tag LOCUS_53140 gene mdtD CDS complement(137002..137880) product 3-(3-hydroxydecanoyloxy)decanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113897.1 transl_table 11 codon_start 1 locus_tag LOCUS_53150 gene rhlA CDS complement(138183..139520) product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269217.1 transl_table 11 codon_start 1 locus_tag LOCUS_53160 CDS complement(139520..140962) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763601.1 transl_table 11 codon_start 1 locus_tag LOCUS_53170 assembly_gap 141078..141183 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(141297..141992) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970706.1 transl_table 11 codon_start 1 locus_tag LOCUS_53180 CDS complement(142258..143961) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402225.1 transl_table 11 codon_start 1 locus_tag LOCUS_53190 gene betA CDS complement(144138..145610) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393629.1 transl_table 11 codon_start 1 locus_tag LOCUS_53200 gene betB CDS complement(145718..146311) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555619.1 transl_table 11 codon_start 1 locus_tag LOCUS_53210 gene betI CDS 146734..148743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53220 assembly_gap 148880..149052 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(149246..150424) product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763692.1 transl_table 11 codon_start 1 locus_tag LOCUS_53230 gene choV CDS complement(150421..151266) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555599.1 transl_table 11 codon_start 1 locus_tag LOCUS_53240 gene choW CDS complement(151336..152283) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269185.1 transl_table 11 codon_start 1 locus_tag LOCUS_53250 CDS 152723..154033 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111339.1 transl_table 11 codon_start 1 locus_tag LOCUS_53260 assembly_gap 153911..154019 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 154030..154194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53270 CDS 154799..155902 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763696.1 transl_table 11 codon_start 1 locus_tag LOCUS_53280 CDS complement(156086..156349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269221.1 transl_table 11 codon_start 1 locus_tag LOCUS_53290 CDS complement(156815..157330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53300 CDS 157472..157645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53310 CDS complement(157843..159006) product gamma-butyrobetaine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 transl_table 11 codon_start 1 locus_tag LOCUS_53320 CDS complement(159031..159507) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268085.1 transl_table 11 codon_start 1 locus_tag LOCUS_53330 CDS complement(159681..160646) product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268084.1 transl_table 11 codon_start 1 locus_tag LOCUS_53340 assembly_gap 160694..160830 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(160851..161738) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268083.1 transl_table 11 codon_start 1 locus_tag LOCUS_53350 CDS complement(161811..162755) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268082.1 transl_table 11 codon_start 1 locus_tag LOCUS_53360 CDS 162951..163895 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435534.1 transl_table 11 codon_start 1 locus_tag LOCUS_53370 assembly_gap 163926..163935 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(164015..164431) product DUF3010 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763565.1 transl_table 11 codon_start 1 locus_tag LOCUS_53380 CDS complement(164481..165257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53390 CDS complement(165381..165869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53400 CDS complement(165912..166313) product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405168.1 transl_table 11 codon_start 1 locus_tag LOCUS_53410 CDS 166558..167535 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382379.1 transl_table 11 codon_start 1 locus_tag LOCUS_53420 CDS 167633..168163 product DUF5943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405158.1 transl_table 11 codon_start 1 locus_tag LOCUS_53430 CDS 168179..170239 product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405157.1 transl_table 11 codon_start 1 locus_tag LOCUS_53440 gene dgcA CDS 170402..172345 product dimethylglycine demethylation protein DgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054992464.1 transl_table 11 codon_start 1 locus_tag LOCUS_53450 gene dgcB CDS 172342..173553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53460 assembly_gap 173259..173358 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 173457..173660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53470 CDS 173676..174446 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103131.1 transl_table 11 codon_start 1 locus_tag LOCUS_53480 sequence70 source 1..389245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 400..475 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1183..1992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105153.1 transl_table 11 codon_start 1 locus_tag LOCUS_53490 CDS complement(2101..2415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53500 CDS 2809..3570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53510 CDS complement(3643..4962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53520 CDS complement(5160..6563) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769494.1 transl_table 11 codon_start 1 locus_tag LOCUS_53530 CDS 6858..7289 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268377.1 transl_table 11 codon_start 1 locus_tag LOCUS_53540 assembly_gap 7306..7379 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7599..8102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53550 CDS complement(8353..8937) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086782.1 transl_table 11 codon_start 1 locus_tag LOCUS_53560 CDS 9162..10025 product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225563.1 transl_table 11 codon_start 1 locus_tag LOCUS_53570 CDS 10084..10731 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974682.1 transl_table 11 codon_start 1 locus_tag LOCUS_53580 CDS 10829..11038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53590 CDS complement(11092..11946) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113846.1 transl_table 11 codon_start 1 locus_tag LOCUS_53600 CDS 12146..12379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53610 CDS complement(12416..13147) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 transl_table 11 codon_start 1 locus_tag LOCUS_53620 CDS 13271..14167 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225603.1 transl_table 11 codon_start 1 locus_tag LOCUS_53630 CDS complement(14175..14885) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389414.1 transl_table 11 codon_start 1 locus_tag LOCUS_53640 CDS complement(15006..16874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53650 assembly_gap 16068..16152 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16947..18110) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171553.1 transl_table 11 codon_start 1 locus_tag LOCUS_53660 CDS complement(18118..18924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838623.1 transl_table 11 codon_start 1 locus_tag LOCUS_53670 CDS complement(18937..19872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53680 note possible pseudo, frameshifted assembly_gap 19884..19988 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20464..23052) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091311140.1 transl_table 11 codon_start 1 locus_tag LOCUS_53690 CDS 23520..23699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53700 assembly_gap 23769..23897 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(24460..26025) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069405.1 transl_table 11 codon_start 1 locus_tag LOCUS_53710 CDS complement(26022..27074) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090320.1 transl_table 11 codon_start 1 locus_tag LOCUS_53720 CDS complement(27194..27715) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086962.1 transl_table 11 codon_start 1 locus_tag LOCUS_53730 assembly_gap 28232..28822 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28851..30752 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268217.1 transl_table 11 codon_start 1 locus_tag LOCUS_53740 CDS 30914..32170 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707070.1 transl_table 11 codon_start 1 locus_tag LOCUS_53750 CDS 32167..32883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53760 CDS 32880..33944 product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209066719.1 transl_table 11 codon_start 1 locus_tag LOCUS_53770 CDS 33889..34581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53780 CDS complement(34722..35198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53790 assembly_gap 35240..35313 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(35689..36369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53800 CDS complement(36359..40528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53810 note possible pseudo, frameshifted CDS 40440..44105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53820 assembly_gap 40539..40624 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 43757..43854 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 44259..45482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53830 assembly_gap 44603..44694 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(45779..49939) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267242.1 transl_table 11 codon_start 1 locus_tag LOCUS_53840 CDS complement(49936..58245) product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267241.1 transl_table 11 codon_start 1 locus_tag LOCUS_53850 CDS 58145..60454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53860 assembly_gap 58390..58522 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(60552..60842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53870 CDS complement(60878..63337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53880 assembly_gap 60881..60986 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(63295..68979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53890 note possible pseudo, frameshifted assembly_gap 63347..63449 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 67458..67467 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 68920..69228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53900 CDS complement(69262..70752) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522654.1 transl_table 11 codon_start 1 locus_tag LOCUS_53910 gene xylB CDS complement(70781..71308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53920 assembly_gap 71344..71453 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(71883..72278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53930 assembly_gap 72358..72439 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(72965..73951) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551207.1 transl_table 11 codon_start 1 locus_tag LOCUS_53940 CDS complement(74007..75551) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523590.1 transl_table 11 codon_start 1 locus_tag LOCUS_53950 assembly_gap 75958..76088 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(76271..76753) product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084016.1 transl_table 11 codon_start 1 locus_tag LOCUS_53960 CDS complement(76832..77032) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094856.1 transl_table 11 codon_start 1 locus_tag LOCUS_53970 assembly_gap 77226..77341 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(77362..77826) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249558.1 transl_table 11 codon_start 1 locus_tag LOCUS_53980 CDS complement(77856..78461) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007249559.1 transl_table 11 codon_start 1 locus_tag LOCUS_53990 CDS complement(78581..79000) product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104228.1 transl_table 11 codon_start 1 locus_tag LOCUS_54000 CDS complement(79104..79544) product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200892.1 transl_table 11 codon_start 1 locus_tag LOCUS_54010 CDS 79688..80302 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200889.1 transl_table 11 codon_start 1 locus_tag LOCUS_54020 assembly_gap 80347..80439 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 80747..80831 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(80942..82429) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337079.1 transl_table 11 codon_start 1 locus_tag LOCUS_54030 CDS 82457..84214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54040 CDS 84540..85511 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 transl_table 11 codon_start 1 locus_tag LOCUS_54050 CDS 86362..87735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54060 assembly_gap 87501..87600 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 87675..89252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54070 assembly_gap 89406..89504 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 89704..93369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54080 assembly_gap 89750..89877 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 93493..93502 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(93524..94570) product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253027.1 transl_table 11 codon_start 1 locus_tag LOCUS_54090 CDS complement(94567..95382) product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040116147.1 transl_table 11 codon_start 1 locus_tag LOCUS_54100 gene sctT CDS complement(95388..95657) product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331082.1 transl_table 11 codon_start 1 locus_tag LOCUS_54110 CDS complement(95661..96317) product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037381869.1 transl_table 11 codon_start 1 locus_tag LOCUS_54120 gene sctR CDS complement(96314..97366) product type III secretion system cytoplasmic ring protein SctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066868854.1 transl_table 11 codon_start 1 locus_tag LOCUS_54130 gene sctQ CDS complement(97363..97833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54140 CDS complement(97830..98213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54150 CDS complement(98135..99247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54160 assembly_gap 98323..98426 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(99244..99837) product nodulation protein NolV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857560.1 transl_table 11 codon_start 1 locus_tag LOCUS_54170 gene nolV CDS complement(99830..100474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54180 CDS complement(100471..101235) product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253017.1 transl_table 11 codon_start 1 locus_tag LOCUS_54190 gene sctJ assembly_gap 101418..101516 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(101825..102046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54200 CDS complement(102096..102677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54210 assembly_gap 103290..103387 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 103578..103709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54220 CDS complement(103736..104149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066868812.1 transl_table 11 codon_start 1 locus_tag LOCUS_54230 CDS complement(104166..105299) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253024.1 transl_table 11 codon_start 1 locus_tag LOCUS_54240 assembly_gap 105315..105414 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(105567..107708) product type III secretion system export apparatus subunit SctV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253023.1 transl_table 11 codon_start 1 locus_tag LOCUS_54250 gene sctV CDS complement(107705..108040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54260 CDS complement(108037..108396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54270 CDS complement(108425..109042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54280 assembly_gap 109046..109131 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 109170..109502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54290 CDS complement(109653..109814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54300 assembly_gap 109982..110065 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(110324..111076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54310 assembly_gap 111286..111367 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 112015..112100 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 112320..113519 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112805.1 transl_table 11 codon_start 1 locus_tag LOCUS_54320 CDS 113533..115002 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103137.1 transl_table 11 codon_start 1 locus_tag LOCUS_54330 CDS 114992..116272 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112807.1 transl_table 11 codon_start 1 locus_tag LOCUS_54340 assembly_gap 116332..116446 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(116462..117394) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765006.1 transl_table 11 codon_start 1 locus_tag LOCUS_54350 assembly_gap 117414..117540 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(117723..118394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54360 assembly_gap 118420..118533 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(118846..120783) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268320.1 transl_table 11 codon_start 1 locus_tag LOCUS_54370 gene iolD CDS complement(120780..121604) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765016.1 transl_table 11 codon_start 1 locus_tag LOCUS_54380 CDS complement(121640..122449) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765020.1 transl_table 11 codon_start 1 locus_tag LOCUS_54390 gene iolB CDS complement(122446..123339) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268323.1 transl_table 11 codon_start 1 locus_tag LOCUS_54400 gene iolE assembly_gap 123430..123561 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(123576..125516) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104589.1 transl_table 11 codon_start 1 locus_tag LOCUS_54410 gene iolC assembly_gap 125759..125875 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 125910..126824 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619235.1 transl_table 11 codon_start 1 locus_tag LOCUS_54420 CDS 127250..127624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54430 CDS complement(127529..128494) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266560.1 transl_table 11 codon_start 1 locus_tag LOCUS_54440 CDS 128790..130217 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061896.1 transl_table 11 codon_start 1 locus_tag LOCUS_54450 gene argH CDS 130366..131244 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172971.1 transl_table 11 codon_start 1 locus_tag LOCUS_54460 CDS 131265..132029 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061894.1 transl_table 11 codon_start 1 locus_tag LOCUS_54470 CDS 132068..132886 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061893.1 transl_table 11 codon_start 1 locus_tag LOCUS_54480 CDS 132916..133758 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728730.1 transl_table 11 codon_start 1 locus_tag LOCUS_54490 CDS 133751..134689 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947364.1 transl_table 11 codon_start 1 locus_tag LOCUS_54500 CDS 134682..136037 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243160.1 transl_table 11 codon_start 1 locus_tag LOCUS_54510 CDS 136181..137353 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211973.1 transl_table 11 codon_start 1 locus_tag LOCUS_54520 CDS 137511..138230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54530 assembly_gap 138395..138523 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(138586..139380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54540 CDS complement(139446..139679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54550 assembly_gap 139690..139775 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 139778..142807 product bifunctional nitrate reductase/sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205569.1 transl_table 11 codon_start 1 locus_tag LOCUS_54560 note possible pseudo, frameshifted CDS 143186..145744 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104464.1 transl_table 11 codon_start 1 locus_tag LOCUS_54570 gene nirB CDS 145744..146118 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268220.1 transl_table 11 codon_start 1 locus_tag LOCUS_54580 gene nirD CDS complement(146153..146773) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245851.1 transl_table 11 codon_start 1 locus_tag LOCUS_54590 CDS complement(146827..147828) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268155.1 transl_table 11 codon_start 1 locus_tag LOCUS_54600 CDS complement(147841..151614) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268156.1 transl_table 11 codon_start 1 locus_tag LOCUS_54610 gene cobN CDS complement(151619..152686) product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268157.1 transl_table 11 codon_start 1 locus_tag LOCUS_54620 gene cobW CDS 153220..154509 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417625.1 transl_table 11 codon_start 1 locus_tag LOCUS_54630 CDS complement(154525..155010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54640 CDS complement(154977..156902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54650 note possible pseudo, frameshifted assembly_gap 155051..155135 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(157030..157788) product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267684.1 transl_table 11 codon_start 1 locus_tag LOCUS_54660 gene cobF CDS 157921..158910 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 transl_table 11 codon_start 1 locus_tag LOCUS_54670 assembly_gap 158549..158635 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 159234..160544 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382856.1 transl_table 11 codon_start 1 locus_tag LOCUS_54680 CDS 160700..161626 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267681.1 transl_table 11 codon_start 1 locus_tag LOCUS_54690 CDS 161637..162473 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369336.1 transl_table 11 codon_start 1 locus_tag LOCUS_54700 assembly_gap 162523..162648 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(163681..164529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54710 assembly_gap 165140..165278 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 165383..166873 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762617.1 transl_table 11 codon_start 1 locus_tag LOCUS_54720 gene xylB CDS 166880..167818 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762619.1 transl_table 11 codon_start 1 locus_tag LOCUS_54730 CDS 167930..168367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54740 CDS 168530..169765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54750 CDS complement(169796..170965) product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400837.1 transl_table 11 codon_start 1 locus_tag LOCUS_54760 CDS 171101..173635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54770 CDS 173694..173969 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003373489.1 transl_table 11 codon_start 1 locus_tag LOCUS_54780 assembly_gap 174075..174145 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(174165..175091) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267733.1 transl_table 11 codon_start 1 locus_tag LOCUS_54790 CDS complement(175203..176420) product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762472.1 transl_table 11 codon_start 1 locus_tag LOCUS_54800 CDS complement(176456..177220) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267731.1 transl_table 11 codon_start 1 locus_tag LOCUS_54810 CDS complement(177308..177694) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762476.1 transl_table 11 codon_start 1 locus_tag LOCUS_54820 CDS complement(177716..178507) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267730.1 transl_table 11 codon_start 1 locus_tag LOCUS_54830 CDS complement(178504..179166) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104188.1 transl_table 11 codon_start 1 locus_tag LOCUS_54840 CDS complement(179176..179844) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410344.1 transl_table 11 codon_start 1 locus_tag LOCUS_54850 CDS complement(179898..180746) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416527.1 transl_table 11 codon_start 1 locus_tag LOCUS_54860 CDS 181590..181856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54870 CDS complement(181949..182707) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408460.1 transl_table 11 codon_start 1 locus_tag LOCUS_54880 CDS 182804..184336 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114761.1 transl_table 11 codon_start 1 locus_tag LOCUS_54890 CDS 184333..185361 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114760.1 transl_table 11 codon_start 1 locus_tag LOCUS_54900 assembly_gap 185843..186185 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(187199..187732) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082887.1 transl_table 11 codon_start 1 locus_tag LOCUS_54910 CDS complement(187882..189252) product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 transl_table 11 codon_start 1 locus_tag LOCUS_54920 gene pelG CDS complement(189253..190785) product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 transl_table 11 codon_start 1 locus_tag LOCUS_54930 gene pelF CDS complement(190782..191771) product pellicle/biofilm biosynthesis protein PelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113953.1 transl_table 11 codon_start 1 locus_tag LOCUS_54940 CDS complement(191749..192501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54950 assembly_gap 192573..192667 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(193210..193731) product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 transl_table 11 codon_start 1 locus_tag LOCUS_54960 CDS complement(193760..197350) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113951.1 transl_table 11 codon_start 1 locus_tag LOCUS_54970 CDS complement(197328..198872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54980 CDS complement(198856..200232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54990 assembly_gap 198891..198976 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(200313..201188) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400349.1 transl_table 11 codon_start 1 locus_tag LOCUS_55000 CDS complement(201681..202661) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098443.1 transl_table 11 codon_start 1 locus_tag LOCUS_55010 CDS complement(202716..203669) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098445.1 transl_table 11 codon_start 1 locus_tag LOCUS_55020 CDS complement(203666..204178) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085375.1 transl_table 11 codon_start 1 locus_tag LOCUS_55030 CDS complement(204175..204822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55040 CDS complement(204839..206563) product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 transl_table 11 codon_start 1 locus_tag LOCUS_55050 CDS complement(206604..207311) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098450.1 transl_table 11 codon_start 1 locus_tag LOCUS_55060 CDS complement(207314..207739) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 transl_table 11 codon_start 1 locus_tag LOCUS_55070 CDS complement(207751..209595) product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 transl_table 11 codon_start 1 locus_tag LOCUS_55080 CDS complement(209619..211229) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112718.1 transl_table 11 codon_start 1 locus_tag LOCUS_55090 CDS complement(211304..211906) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098455.1 transl_table 11 codon_start 1 locus_tag LOCUS_55100 CDS complement(212106..224582) product filamentous hemagglutinin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147216.1 transl_table 11 codon_start 1 locus_tag LOCUS_55110 CDS complement(224848..225981) product alkaline phosphatase LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112123.1 transl_table 11 codon_start 1 locus_tag LOCUS_55120 gene lapA CDS 226408..226989 product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404973.1 transl_table 11 codon_start 1 locus_tag LOCUS_55130 CDS complement(227137..228213) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438666.1 transl_table 11 codon_start 1 locus_tag LOCUS_55140 gene hppD CDS complement(228425..229363) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 transl_table 11 codon_start 1 locus_tag LOCUS_55150 CDS 229452..230324 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207505.1 transl_table 11 codon_start 1 locus_tag LOCUS_55160 CDS 230391..231935 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119288.1 transl_table 11 codon_start 1 locus_tag LOCUS_55170 CDS 232193..232552 product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553302.1 transl_table 11 codon_start 1 locus_tag LOCUS_55180 assembly_gap 232759..232853 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 233295..233825 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268127.1 transl_table 11 codon_start 1 locus_tag LOCUS_55190 gene gloA assembly_gap 233915..234046 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(234057..235622) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111221.1 transl_table 11 codon_start 1 locus_tag LOCUS_55200 gene ahpF CDS complement(235748..236311) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380444.1 transl_table 11 codon_start 1 locus_tag LOCUS_55210 gene ahpC CDS complement(236444..237388) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268128.1 transl_table 11 codon_start 1 locus_tag LOCUS_55220 assembly_gap 237891..237968 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 237989..238630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55230 CDS complement(238634..240595) product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533592.1 transl_table 11 codon_start 1 locus_tag LOCUS_55240 gene fhuB CDS complement(240630..241577) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533593.1 transl_table 11 codon_start 1 locus_tag LOCUS_55250 CDS complement(241574..242401) product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167185.1 transl_table 11 codon_start 1 locus_tag LOCUS_55260 gene fhuC CDS complement(242398..243987) product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193739.1 transl_table 11 codon_start 1 locus_tag LOCUS_55270 CDS complement(244111..246129) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112989.1 transl_table 11 codon_start 1 locus_tag LOCUS_55280 CDS 246351..247229 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004351567.1 transl_table 11 codon_start 1 locus_tag LOCUS_55290 CDS complement(247251..247895) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966091.1 transl_table 11 codon_start 1 locus_tag LOCUS_55300 CDS 247994..248557 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090707.1 transl_table 11 codon_start 1 locus_tag LOCUS_55310 CDS 248874..249431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55320 CDS 249592..249957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55330 CDS complement(250022..250900) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 transl_table 11 codon_start 1 locus_tag LOCUS_55340 gene yghU CDS complement(250919..252406) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196794.1 transl_table 11 codon_start 1 locus_tag LOCUS_55350 CDS complement(252399..253586) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 transl_table 11 codon_start 1 locus_tag LOCUS_55360 CDS complement(253588..255429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55370 CDS complement(255372..256859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55380 assembly_gap 255450..255557 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 257245..257718 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530114.1 transl_table 11 codon_start 1 locus_tag LOCUS_55390 CDS complement(257733..258515) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242985.1 transl_table 11 codon_start 1 locus_tag LOCUS_55400 CDS complement(258576..259628) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115019.1 transl_table 11 codon_start 1 locus_tag LOCUS_55410 assembly_gap 258707..258786 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 259774..260679 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 transl_table 11 codon_start 1 locus_tag LOCUS_55420 CDS complement(260738..261718) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 transl_table 11 codon_start 1 locus_tag LOCUS_55430 CDS complement(261722..262456) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 transl_table 11 codon_start 1 locus_tag LOCUS_55440 assembly_gap 262474..262556 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(262783..263886) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904740.1 transl_table 11 codon_start 1 locus_tag LOCUS_55450 CDS complement(264075..264872) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051065148.1 transl_table 11 codon_start 1 locus_tag LOCUS_55460 gene fabG CDS complement(264886..266397) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103981.1 transl_table 11 codon_start 1 locus_tag LOCUS_55470 CDS complement(266419..267369) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103982.1 transl_table 11 codon_start 1 locus_tag LOCUS_55480 CDS complement(267428..268414) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971942.1 transl_table 11 codon_start 1 locus_tag LOCUS_55490 CDS complement(268468..268983) product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312118.1 transl_table 11 codon_start 1 locus_tag LOCUS_55500 gene rutF CDS 269273..270232 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357040.1 transl_table 11 codon_start 1 locus_tag LOCUS_55510 CDS complement(270258..271220) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529929.1 transl_table 11 codon_start 1 locus_tag LOCUS_55520 CDS 271401..272975 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529928.1 transl_table 11 codon_start 1 locus_tag LOCUS_55530 CDS 273199..273600 product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809516.1 transl_table 11 codon_start 1 locus_tag LOCUS_55540 CDS complement(273642..274094) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032706451.1 transl_table 11 codon_start 1 locus_tag LOCUS_55550 CDS 274351..274968 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703356.1 transl_table 11 codon_start 1 locus_tag LOCUS_55560 CDS complement(274974..275606) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112419.1 transl_table 11 codon_start 1 locus_tag LOCUS_55570 CDS 275688..276347 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082920.1 transl_table 11 codon_start 1 locus_tag LOCUS_55580 assembly_gap 276398..276482 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(276483..277091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55590 CDS complement(277096..278193) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974748.1 transl_table 11 codon_start 1 locus_tag LOCUS_55600 CDS complement(278257..279258) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813011.1 transl_table 11 codon_start 1 locus_tag LOCUS_55610 CDS complement(279264..279971) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966750.1 transl_table 11 codon_start 1 locus_tag LOCUS_55620 CDS complement(279968..281779) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089150.1 transl_table 11 codon_start 1 locus_tag LOCUS_55630 CDS complement(281772..282605) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 transl_table 11 codon_start 1 locus_tag LOCUS_55640 CDS complement(282664..283827) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 transl_table 11 codon_start 1 locus_tag LOCUS_55650 gene urtA CDS complement(283865..284710) product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894369.1 transl_table 11 codon_start 1 locus_tag LOCUS_55660 assembly_gap 284719..284787 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(285070..285414) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742073.1 transl_table 11 codon_start 1 locus_tag LOCUS_55670 CDS 285509..286258 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223997.1 transl_table 11 codon_start 1 locus_tag LOCUS_55680 CDS complement(286311..286757) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969632.1 transl_table 11 codon_start 1 locus_tag LOCUS_55690 CDS complement(286950..288113) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113304.1 transl_table 11 codon_start 1 locus_tag LOCUS_55700 CDS 288258..289073 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100594.1 transl_table 11 codon_start 1 locus_tag LOCUS_55710 CDS complement(289103..289477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55720 assembly_gap 289503..289616 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(290264..291850) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328264.1 transl_table 11 codon_start 1 locus_tag LOCUS_55730 CDS complement(291914..292795) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393373.1 transl_table 11 codon_start 1 locus_tag LOCUS_55740 CDS complement(292905..294017) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606692.1 transl_table 11 codon_start 1 locus_tag LOCUS_55750 assembly_gap 293532..293629 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(294004..295050) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606692.1 transl_table 11 codon_start 1 locus_tag LOCUS_55760 CDS 295527..296393 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887692.1 transl_table 11 codon_start 1 locus_tag LOCUS_55770 CDS complement(296384..297484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55780 CDS 298045..299205 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530805.1 transl_table 11 codon_start 1 locus_tag LOCUS_55790 CDS 299301..300236 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 transl_table 11 codon_start 1 locus_tag LOCUS_55800 CDS 300265..301056 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113878.1 transl_table 11 codon_start 1 locus_tag LOCUS_55810 CDS 301062..302141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55820 CDS complement(302310..303593) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827738.1 transl_table 11 codon_start 1 locus_tag LOCUS_55830 gene hisD CDS 303985..304710 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970384.1 transl_table 11 codon_start 1 locus_tag LOCUS_55840 CDS 304707..306494 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393370.1 transl_table 11 codon_start 1 locus_tag LOCUS_55850 CDS 306512..308110 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973724.1 transl_table 11 codon_start 1 locus_tag LOCUS_55860 CDS complement(308150..309235) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284156.1 transl_table 11 codon_start 1 locus_tag LOCUS_55870 CDS complement(309309..310394) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 transl_table 11 codon_start 1 locus_tag LOCUS_55880 CDS 310692..311954 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227636.1 transl_table 11 codon_start 1 locus_tag LOCUS_55890 CDS complement(311957..312631) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967933.1 transl_table 11 codon_start 1 locus_tag LOCUS_55900 CDS complement(312765..314048) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 transl_table 11 codon_start 1 locus_tag LOCUS_55910 gene hemL CDS complement(314038..315048) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 transl_table 11 codon_start 1 locus_tag LOCUS_55920 CDS complement(315045..315848) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 transl_table 11 codon_start 1 locus_tag LOCUS_55930 CDS 316117..317508 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813182.1 transl_table 11 codon_start 1 locus_tag LOCUS_55940 CDS 317508..318614 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768050.1 transl_table 11 codon_start 1 locus_tag LOCUS_55950 CDS 318764..319816 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101898.1 transl_table 11 codon_start 1 locus_tag LOCUS_55960 CDS 319829..321229 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626293.1 transl_table 11 codon_start 1 locus_tag LOCUS_55970 assembly_gap 319862..319949 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 321243..322061 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188908242.1 transl_table 11 codon_start 1 locus_tag LOCUS_55980 CDS 322093..322827 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_55990 CDS complement(322886..324169) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769588.1 transl_table 11 codon_start 1 locus_tag LOCUS_56000 CDS complement(324244..324555) product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227201.1 transl_table 11 codon_start 1 locus_tag LOCUS_56010 CDS complement(324558..325922) product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227202.1 transl_table 11 codon_start 1 locus_tag LOCUS_56020 CDS 326049..327242 product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083014.1 transl_table 11 codon_start 1 locus_tag LOCUS_56030 CDS complement(327381..328739) product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 transl_table 11 codon_start 1 locus_tag LOCUS_56040 CDS complement(328750..330246) product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 transl_table 11 codon_start 1 locus_tag LOCUS_56050 assembly_gap 330329..330418 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 330936..331466 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261973.1 transl_table 11 codon_start 1 locus_tag LOCUS_56060 CDS 331619..332095 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113663.1 transl_table 11 codon_start 1 locus_tag LOCUS_56070 CDS 332247..332678 product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113677.1 transl_table 11 codon_start 1 locus_tag LOCUS_56080 CDS 333136..333414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56090 CDS 333565..334020 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921390.1 transl_table 11 codon_start 1 locus_tag LOCUS_56100 CDS 334219..335892 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266674.1 transl_table 11 codon_start 1 locus_tag LOCUS_56110 CDS complement(335914..336375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56120 CDS 336470..337501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56130 CDS 337595..337789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56140 CDS 337786..338280 product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266738.1 transl_table 11 codon_start 1 locus_tag LOCUS_56150 CDS complement(338300..339253) product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243875.1 transl_table 11 codon_start 1 locus_tag LOCUS_56160 CDS complement(339305..340822) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066806.1 transl_table 11 codon_start 1 locus_tag LOCUS_56170 CDS complement(340819..341859) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969988.1 transl_table 11 codon_start 1 locus_tag LOCUS_56180 CDS complement(341856..343115) product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269222.1 transl_table 11 codon_start 1 locus_tag LOCUS_56190 gene gbcA CDS complement(343137..344339) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532879.1 transl_table 11 codon_start 1 locus_tag LOCUS_56200 CDS 344478..345425 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202658.1 transl_table 11 codon_start 1 locus_tag LOCUS_56210 CDS complement(345490..346485) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267240.1 transl_table 11 codon_start 1 locus_tag LOCUS_56220 CDS complement(346534..346827) product muconolactone Delta-isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532552.1 transl_table 11 codon_start 1 locus_tag LOCUS_56230 CDS 346933..347838 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704494.1 transl_table 11 codon_start 1 locus_tag LOCUS_56240 CDS complement(347885..348895) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 transl_table 11 codon_start 1 locus_tag LOCUS_56250 CDS 349061..349975 product putative multidrug efflux transcriptional regulator CeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188318.1 transl_table 11 codon_start 1 locus_tag LOCUS_56260 gene ceoR CDS complement(350048..350557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56270 CDS complement(350554..351663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56280 assembly_gap 352151..352231 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 352334..352582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56290 CDS complement(353247..354194) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974938.1 transl_table 11 codon_start 1 locus_tag LOCUS_56300 CDS complement(354215..355084) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030032.1 transl_table 11 codon_start 1 locus_tag LOCUS_56310 CDS 355185..356090 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096566.1 transl_table 11 codon_start 1 locus_tag LOCUS_56320 CDS complement(356107..356451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56330 CDS complement(356628..358301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56340 CDS complement(358444..358998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56350 CDS complement(359124..359624) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195428.1 transl_table 11 codon_start 1 locus_tag LOCUS_56360 CDS 359744..360778 product acetylpolyamine amidohydrolase AphB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112950.1 transl_table 11 codon_start 1 locus_tag LOCUS_56370 gene aphB CDS 360829..361881 product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530320.1 transl_table 11 codon_start 1 locus_tag LOCUS_56380 CDS 362033..363448 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206138.1 transl_table 11 codon_start 1 locus_tag LOCUS_56390 CDS complement(364106..364300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56400 CDS 364561..366540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56410 assembly_gap 364641..364744 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 366565..366765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56420 assembly_gap 366869..366943 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 367165..367503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56430 CDS 367566..368114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56440 CDS 368167..368880 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 transl_table 11 codon_start 1 locus_tag LOCUS_56450 CDS complement(369069..369491) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 transl_table 11 codon_start 1 locus_tag LOCUS_56460 CDS complement(369516..370706) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495369.1 transl_table 11 codon_start 1 locus_tag LOCUS_56470 CDS complement(370699..371499) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230914.1 transl_table 11 codon_start 1 locus_tag LOCUS_56480 CDS complement(371496..372155) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887210.1 transl_table 11 codon_start 1 locus_tag LOCUS_56490 CDS complement(372152..372805) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389051.1 transl_table 11 codon_start 1 locus_tag LOCUS_56500 CDS complement(372816..373616) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167356.1 transl_table 11 codon_start 1 locus_tag LOCUS_56510 assembly_gap 373900..373973 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(374035..374586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56520 CDS complement(374911..375264) product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704246.1 transl_table 11 codon_start 1 locus_tag LOCUS_56530 gene cusF CDS complement(375394..375738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56540 CDS complement(375911..376822) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895502.1 transl_table 11 codon_start 1 locus_tag LOCUS_56550 CDS complement(376859..377584) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 transl_table 11 codon_start 1 locus_tag LOCUS_56560 gene fabG CDS complement(377608..378531) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024161.1 transl_table 11 codon_start 1 locus_tag LOCUS_56570 gene rfbB CDS complement(378541..379371) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727392.1 transl_table 11 codon_start 1 locus_tag LOCUS_56580 CDS complement(379386..380342) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 transl_table 11 codon_start 1 locus_tag LOCUS_56590 gene speB CDS complement(380408..381832) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269252.1 transl_table 11 codon_start 1 locus_tag LOCUS_56600 CDS 382197..382346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202284.1 transl_table 11 codon_start 1 locus_tag LOCUS_56610 CDS 382384..383961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103602.1 transl_table 11 codon_start 1 locus_tag LOCUS_56620 CDS complement(384106..384285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56630 CDS 384839..385840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56640 CDS 386039..386425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56650 CDS 386427..387944 product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267399.1 transl_table 11 codon_start 1 locus_tag LOCUS_56660 CDS complement(387955..388314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56670 CDS 388454..388726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56680 CDS complement(388807..389145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56690 sequence71 source 1..148224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..1259) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269097.1 transl_table 11 codon_start 1 locus_tag LOCUS_56700 gene tyrS CDS 1470..2888 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 transl_table 11 codon_start 1 locus_tag LOCUS_56710 CDS 2892..3995 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614195.1 transl_table 11 codon_start 1 locus_tag LOCUS_56720 CDS complement(4074..4424) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 transl_table 11 codon_start 1 locus_tag LOCUS_56730 gene erpA CDS complement(4594..5628) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 transl_table 11 codon_start 1 locus_tag LOCUS_56740 gene argC CDS 5764..6192 product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 transl_table 11 codon_start 1 locus_tag LOCUS_56750 gene hemJ CDS 6226..7194 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 transl_table 11 codon_start 1 locus_tag LOCUS_56760 CDS 7267..8157 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269100.1 transl_table 11 codon_start 1 locus_tag LOCUS_56770 CDS 8219..9007 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269101.1 transl_table 11 codon_start 1 locus_tag LOCUS_56780 CDS 9071..9409 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269102.1 transl_table 11 codon_start 1 locus_tag LOCUS_56790 CDS 9506..10243 product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085224.1 transl_table 11 codon_start 1 locus_tag LOCUS_56800 gene coq7 CDS complement(10328..10750) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 transl_table 11 codon_start 1 locus_tag LOCUS_56810 CDS 10958..11608 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 transl_table 11 codon_start 1 locus_tag LOCUS_56820 gene crp CDS complement(11605..12306) product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103216.1 transl_table 11 codon_start 1 locus_tag LOCUS_56830 assembly_gap 12385..12579 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(12636..13475) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767891.1 transl_table 11 codon_start 1 locus_tag LOCUS_56840 gene trpC CDS complement(13472..14521) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316297.1 transl_table 11 codon_start 1 locus_tag LOCUS_56850 gene trpD CDS complement(14531..15124) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 transl_table 11 codon_start 1 locus_tag LOCUS_56860 CDS complement(15138..16625) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 transl_table 11 codon_start 1 locus_tag LOCUS_56870 gene trpE CDS complement(16696..17514) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402021.1 transl_table 11 codon_start 1 locus_tag LOCUS_56880 CDS complement(17511..18185) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739815.1 transl_table 11 codon_start 1 locus_tag LOCUS_56890 gene rpe CDS complement(18302..19450) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 transl_table 11 codon_start 1 locus_tag LOCUS_56900 CDS complement(19587..20411) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269123.1 transl_table 11 codon_start 1 locus_tag LOCUS_56910 CDS complement(20425..21672) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103195.1 transl_table 11 codon_start 1 locus_tag LOCUS_56920 CDS complement(21895..22938) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377314.1 transl_table 11 codon_start 1 locus_tag LOCUS_56930 CDS complement(23009..24133) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768050.1 transl_table 11 codon_start 1 locus_tag LOCUS_56940 CDS complement(24393..25022) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 transl_table 11 codon_start 1 locus_tag LOCUS_56950 CDS complement(25051..27420) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113207.1 transl_table 11 codon_start 1 locus_tag LOCUS_56960 CDS 27545..28531 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667176.1 transl_table 11 codon_start 1 locus_tag LOCUS_56970 assembly_gap 28552..28778 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 29049..29516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56980 CDS complement(29425..30099) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 transl_table 11 codon_start 1 locus_tag LOCUS_56990 CDS complement(30096..31121) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 transl_table 11 codon_start 1 locus_tag LOCUS_57000 CDS 31292..34075 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269131.1 transl_table 11 codon_start 1 locus_tag LOCUS_57010 CDS 34050..35372 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079997984.1 transl_table 11 codon_start 1 locus_tag LOCUS_57020 CDS 35369..36358 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103187.1 transl_table 11 codon_start 1 locus_tag LOCUS_57030 gene pdxA CDS 36355..37173 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768067.1 transl_table 11 codon_start 1 locus_tag LOCUS_57040 gene rsmA CDS 37260..37673 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768068.1 transl_table 11 codon_start 1 locus_tag LOCUS_57050 gene apaG CDS 37673..38548 product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103186.1 transl_table 11 codon_start 1 locus_tag LOCUS_57060 CDS 38584..38913 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269136.1 transl_table 11 codon_start 1 locus_tag LOCUS_57070 gene glpE CDS 39214..41136 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316247.1 transl_table 11 codon_start 1 locus_tag LOCUS_57080 CDS 41275..42546 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269137.1 transl_table 11 codon_start 1 locus_tag LOCUS_57090 CDS 42543..44114 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402050.1 transl_table 11 codon_start 1 locus_tag LOCUS_57100 CDS 44179..45408 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103183.1 transl_table 11 codon_start 1 locus_tag LOCUS_57110 assembly_gap 45441..45574 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(45598..46128) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103182.1 transl_table 11 codon_start 1 locus_tag LOCUS_57120 gene folK CDS complement(46119..46463) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103181.1 transl_table 11 codon_start 1 locus_tag LOCUS_57130 gene folB CDS 46547..47116 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614129.1 transl_table 11 codon_start 1 locus_tag LOCUS_57140 gene plsY CDS complement(47160..48185) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614128.1 transl_table 11 codon_start 1 locus_tag LOCUS_57150 gene tsaD CDS 48381..48596 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551877.1 transl_table 11 codon_start 1 locus_tag LOCUS_57160 gene rpsU CDS 49006..50997 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269141.1 transl_table 11 codon_start 1 locus_tag LOCUS_57170 gene dnaG CDS 51065..52912 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411788.1 transl_table 11 codon_start 1 locus_tag LOCUS_57180 gene rpoD CDS 53035..56778 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183090287.1 transl_table 11 codon_start 1 locus_tag LOCUS_57190 tRNA 56794..56870 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 56996..58051 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463959.1 transl_table 11 codon_start 1 locus_tag LOCUS_57200 CDS 58555..59274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57210 CDS 59306..59560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066612727.1 transl_table 11 codon_start 1 locus_tag LOCUS_57220 CDS 59888..60637 product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040069.1 transl_table 11 codon_start 1 locus_tag LOCUS_57230 gene virB5 CDS 61125..61376 product EexN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040067.1 transl_table 11 codon_start 1 locus_tag LOCUS_57240 CDS 61391..62458 product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040066.1 transl_table 11 codon_start 1 locus_tag LOCUS_57250 CDS 62528..62917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57260 CDS 63580..63840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57270 CDS 64098..64643 product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103176.1 transl_table 11 codon_start 1 locus_tag LOCUS_57280 gene mobC CDS 64738..65805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57290 CDS complement(65851..66522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57300 CDS complement(66509..67591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789323.1 transl_table 11 codon_start 1 locus_tag LOCUS_57310 CDS complement(67588..68643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57320 CDS complement(69431..69820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57330 CDS complement(70429..70734) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 transl_table 11 codon_start 1 locus_tag LOCUS_57340 CDS complement(70727..71098) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 transl_table 11 codon_start 1 locus_tag LOCUS_57350 CDS 71310..71771 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402109.1 transl_table 11 codon_start 1 locus_tag LOCUS_57360 assembly_gap 71824..71833 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 72128..73810 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763807.1 transl_table 11 codon_start 1 locus_tag LOCUS_57370 CDS 73825..74619 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763805.1 transl_table 11 codon_start 1 locus_tag LOCUS_57380 CDS 74668..77133 product pyrroloquinoline quinone biosynthesis protein PqqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443183.1 transl_table 11 codon_start 1 locus_tag LOCUS_57390 gene pqqF CDS 77497..78408 product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269163.1 transl_table 11 codon_start 1 locus_tag LOCUS_57400 gene pqqB CDS 78535..79287 product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402120.1 transl_table 11 codon_start 1 locus_tag LOCUS_57410 gene pqqC CDS 79284..79559 product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269164.1 transl_table 11 codon_start 1 locus_tag LOCUS_57420 gene pqqD CDS 79552..80700 product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269165.1 transl_table 11 codon_start 1 locus_tag LOCUS_57430 gene pqqE CDS complement(80714..81034) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526806.1 transl_table 11 codon_start 1 locus_tag LOCUS_57440 CDS complement(80991..81383) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004151518.1 transl_table 11 codon_start 1 locus_tag LOCUS_57450 CDS complement(81612..82895) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084899.1 transl_table 11 codon_start 1 locus_tag LOCUS_57460 CDS 83000..83929 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084893.1 transl_table 11 codon_start 1 locus_tag LOCUS_57470 CDS complement(84162..85940) product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103167.1 transl_table 11 codon_start 1 locus_tag LOCUS_57480 assembly_gap 86069..86198 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(86287..88083) product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103343.1 transl_table 11 codon_start 1 locus_tag LOCUS_57490 CDS complement(88174..89469) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269168.1 transl_table 11 codon_start 1 locus_tag LOCUS_57500 CDS complement(89717..91531) product phenylacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103162.1 transl_table 11 codon_start 1 locus_tag LOCUS_57510 assembly_gap 91048..91057 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(91965..92258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382340.1 transl_table 11 codon_start 1 locus_tag LOCUS_57520 CDS complement(92366..93046) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269170.1 transl_table 11 codon_start 1 locus_tag LOCUS_57530 gene bioD CDS complement(93043..93855) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103161.1 transl_table 11 codon_start 1 locus_tag LOCUS_57540 gene bioC CDS complement(93848..94579) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763768.1 transl_table 11 codon_start 1 locus_tag LOCUS_57550 CDS complement(94572..95762) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 transl_table 11 codon_start 1 locus_tag LOCUS_57560 gene bioF CDS complement(95925..96980) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372416.1 transl_table 11 codon_start 1 locus_tag LOCUS_57570 gene bioB CDS 97073..97810 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 transl_table 11 codon_start 1 locus_tag LOCUS_57580 CDS 98011..98775 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269173.1 transl_table 11 codon_start 1 locus_tag LOCUS_57590 CDS 98933..100834 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103159.1 transl_table 11 codon_start 1 locus_tag LOCUS_57600 assembly_gap 100864..100917 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 101172..102146 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763737.1 transl_table 11 codon_start 1 locus_tag LOCUS_57610 CDS 102171..103325 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763735.1 transl_table 11 codon_start 1 locus_tag LOCUS_57620 gene rarD assembly_gap 102213..102293 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(103542..104060) product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 transl_table 11 codon_start 1 locus_tag LOCUS_57630 CDS 104483..106660 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763731.1 transl_table 11 codon_start 1 locus_tag LOCUS_57640 CDS complement(106826..107269) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402175.1 transl_table 11 codon_start 1 locus_tag LOCUS_57650 CDS 107511..109445 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269181.1 transl_table 11 codon_start 1 locus_tag LOCUS_57660 CDS 109442..110149 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269182.1 transl_table 11 codon_start 1 locus_tag LOCUS_57670 assembly_gap 110185..110331 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 110513..110989 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244528.1 transl_table 11 codon_start 1 locus_tag LOCUS_57680 CDS 110986..111966 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103142.1 transl_table 11 codon_start 1 locus_tag LOCUS_57690 CDS 112277..114703 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 transl_table 11 codon_start 1 locus_tag LOCUS_57700 CDS 114798..115922 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269198.1 transl_table 11 codon_start 1 locus_tag LOCUS_57710 CDS 115919..116107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57720 CDS 116506..117798 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024656430.1 transl_table 11 codon_start 1 locus_tag LOCUS_57730 CDS complement(117876..119249) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 transl_table 11 codon_start 1 locus_tag LOCUS_57740 gene creD CDS complement(119348..120766) product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 transl_table 11 codon_start 1 locus_tag LOCUS_57750 gene creC CDS complement(120766..121446) product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113268.1 transl_table 11 codon_start 1 locus_tag LOCUS_57760 gene creB CDS complement(121505..122044) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613972.1 transl_table 11 codon_start 1 locus_tag LOCUS_57770 CDS 122270..123157 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432549.1 transl_table 11 codon_start 1 locus_tag LOCUS_57780 CDS complement(123161..124138) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406507.1 transl_table 11 codon_start 1 locus_tag LOCUS_57790 assembly_gap 124289..124378 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 124705..124837 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(125264..125692) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267180.1 transl_table 11 codon_start 1 locus_tag LOCUS_57800 CDS complement(125850..126392) product DUF2780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402209.1 transl_table 11 codon_start 1 locus_tag LOCUS_57810 CDS 126678..127232 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 transl_table 11 codon_start 1 locus_tag LOCUS_57820 CDS 127229..127903 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816759.1 transl_table 11 codon_start 1 locus_tag LOCUS_57830 CDS complement(127926..128585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275369.1 transl_table 11 codon_start 1 locus_tag LOCUS_57840 CDS complement(128585..128929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57850 CDS 129300..129560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57860 CDS 129780..130364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57870 CDS 130432..130962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57880 CDS complement(131062..132261) product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316157.1 transl_table 11 codon_start 1 locus_tag LOCUS_57890 gene fdhA CDS complement(132587..133444) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402204.1 transl_table 11 codon_start 1 locus_tag LOCUS_57900 gene purU assembly_gap 133531..133705 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(133791..134423) product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103144.1 transl_table 11 codon_start 1 locus_tag LOCUS_57910 gene soxG CDS complement(134555..137572) product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269189.1 transl_table 11 codon_start 1 locus_tag LOCUS_57920 CDS complement(137569..137898) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316160.1 transl_table 11 codon_start 1 locus_tag LOCUS_57930 CDS complement(137913..139163) product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763688.1 transl_table 11 codon_start 1 locus_tag LOCUS_57940 CDS complement(139187..140440) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269187.1 transl_table 11 codon_start 1 locus_tag LOCUS_57950 assembly_gap 140675..140778 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 140945..141991 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269215.1 transl_table 11 codon_start 1 locus_tag LOCUS_57960 assembly_gap 142038..142108 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 142238..142444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57970 CDS complement(142577..142879) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379947.1 transl_table 11 codon_start 1 locus_tag LOCUS_57980 CDS complement(142876..143106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402183.1 transl_table 11 codon_start 1 locus_tag LOCUS_57990 CDS complement(143312..143542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58000 CDS 143454..145013 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103145.1 transl_table 11 codon_start 1 locus_tag LOCUS_58010 assembly_gap 145231..145423 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(145523..146623) product glycine-betaine demethylase subunit GbcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763583.1 transl_table 11 codon_start 1 locus_tag LOCUS_58020 gene gbcB CDS 146908..148203 product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244552.1 transl_table 11 codon_start 1 locus_tag LOCUS_58030 gene gbcA sequence72 source 1..436402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..1286) product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 transl_table 11 codon_start 1 locus_tag LOCUS_58040 CDS complement(1319..1645) product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 transl_table 11 codon_start 1 locus_tag LOCUS_58050 CDS complement(1647..2675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58060 CDS complement(2668..3228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58070 CDS complement(3244..4344) product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 transl_table 11 codon_start 1 locus_tag LOCUS_58080 CDS complement(4337..5374) product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877947.1 transl_table 11 codon_start 1 locus_tag LOCUS_58090 CDS complement(5402..5884) product MSMEG_0572 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 transl_table 11 codon_start 1 locus_tag LOCUS_58100 CDS complement(6157..6843) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731349.1 transl_table 11 codon_start 1 locus_tag LOCUS_58110 assembly_gap 6891..6969 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7251..8810 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243748.1 transl_table 11 codon_start 1 locus_tag LOCUS_58120 CDS 8820..9899 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 transl_table 11 codon_start 1 locus_tag LOCUS_58130 CDS 9951..11069 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 transl_table 11 codon_start 1 locus_tag LOCUS_58140 CDS 11150..12043 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197421.1 transl_table 11 codon_start 1 locus_tag LOCUS_58150 CDS complement(12077..12709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 transl_table 11 codon_start 1 locus_tag LOCUS_58160 CDS complement(12727..13176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58170 CDS 13175..13510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58180 CDS 13552..15543 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967198.1 transl_table 11 codon_start 1 locus_tag LOCUS_58190 assembly_gap 15249..15352 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15665..17293 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 transl_table 11 codon_start 1 locus_tag LOCUS_58200 CDS 17477..18484 product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095118.1 transl_table 11 codon_start 1 locus_tag LOCUS_58210 gene kdgT CDS 18481..19761 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063966.1 transl_table 11 codon_start 1 locus_tag LOCUS_58220 CDS 19758..20756 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 transl_table 11 codon_start 1 locus_tag LOCUS_58230 gene pdxA CDS complement(20814..21590) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224211.1 transl_table 11 codon_start 1 locus_tag LOCUS_58240 CDS complement(21730..23178) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102149.1 transl_table 11 codon_start 1 locus_tag LOCUS_58250 CDS complement(23220..24740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58260 assembly_gap 23475..23572 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 24813..25727 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966458.1 transl_table 11 codon_start 1 locus_tag LOCUS_58270 CDS complement(25744..27033) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113027.1 transl_table 11 codon_start 1 locus_tag LOCUS_58280 CDS complement(27116..28477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58290 CDS complement(28576..29703) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 transl_table 11 codon_start 1 locus_tag LOCUS_58300 CDS complement(29723..31192) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107137.1 transl_table 11 codon_start 1 locus_tag LOCUS_58310 CDS complement(31242..32237) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729503.1 transl_table 11 codon_start 1 locus_tag LOCUS_58320 CDS complement(32252..33181) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087139.1 transl_table 11 codon_start 1 locus_tag LOCUS_58330 CDS complement(33230..34162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58340 assembly_gap 33368..33452 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(34173..35837) product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007409.1 transl_table 11 codon_start 1 locus_tag LOCUS_58350 CDS complement(35856..36695) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100181062.1 transl_table 11 codon_start 1 locus_tag LOCUS_58360 CDS complement(36699..37550) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 transl_table 11 codon_start 1 locus_tag LOCUS_58370 CDS complement(37570..38925) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113292.1 transl_table 11 codon_start 1 locus_tag LOCUS_58380 CDS complement(39240..39713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58390 assembly_gap 39755..39860 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(40481..41680) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228549.1 transl_table 11 codon_start 1 locus_tag LOCUS_58400 CDS 41813..42709 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 transl_table 11 codon_start 1 locus_tag LOCUS_58410 CDS complement(42675..43196) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039904.1 transl_table 11 codon_start 1 locus_tag LOCUS_58420 CDS complement(43193..44347) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 transl_table 11 codon_start 1 locus_tag LOCUS_58430 CDS 44543..45343 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181512989.1 transl_table 11 codon_start 1 locus_tag LOCUS_58440 CDS 45525..46751 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083559.1 transl_table 11 codon_start 1 locus_tag LOCUS_58450 CDS 46741..47565 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893601.1 transl_table 11 codon_start 1 locus_tag LOCUS_58460 CDS 47558..48346 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 transl_table 11 codon_start 1 locus_tag LOCUS_58470 assembly_gap 48596..48682 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 48757..50538 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063807.1 transl_table 11 codon_start 1 locus_tag LOCUS_58480 CDS 50535..51716 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063808.1 transl_table 11 codon_start 1 locus_tag LOCUS_58490 CDS 51759..53099 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730167.1 transl_table 11 codon_start 1 locus_tag LOCUS_58500 CDS 53116..54576 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040525.1 transl_table 11 codon_start 1 locus_tag LOCUS_58510 assembly_gap 55074..55167 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 55655..56995 product carbohydrate porin OprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003116413.1 transl_table 11 codon_start 1 locus_tag LOCUS_58520 gene oprB CDS 57207..57683 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173437.1 transl_table 11 codon_start 1 locus_tag LOCUS_58530 CDS 57680..59854 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965397.1 transl_table 11 codon_start 1 locus_tag LOCUS_58540 CDS 60038..61360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58550 assembly_gap 61126..61205 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 61357..61728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58560 CDS 61725..62051 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530816.1 transl_table 11 codon_start 1 locus_tag LOCUS_58570 CDS complement(62027..63001) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390572.1 transl_table 11 codon_start 1 locus_tag LOCUS_58580 CDS complement(63171..63758) product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083079845.1 transl_table 11 codon_start 1 locus_tag LOCUS_58590 CDS complement(64062..64574) product type VI secretion system effector Hcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705044.1 transl_table 11 codon_start 1 locus_tag LOCUS_58600 gene hcp1 CDS complement(64701..65507) product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634228.1 transl_table 11 codon_start 1 locus_tag LOCUS_58610 gene icmH CDS complement(65500..66810) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458007.1 transl_table 11 codon_start 1 locus_tag LOCUS_58620 gene tssK CDS complement(66884..68305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58630 CDS complement(68302..69330) product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510181.1 transl_table 11 codon_start 1 locus_tag LOCUS_58640 gene tssG CDS complement(69294..71060) product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189792.1 transl_table 11 codon_start 1 locus_tag LOCUS_58650 gene tssF CDS complement(71095..71505) product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705714.1 transl_table 11 codon_start 1 locus_tag LOCUS_58660 gene tssE CDS complement(71506..72984) product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108140.1 transl_table 11 codon_start 1 locus_tag LOCUS_58670 gene tssC CDS complement(73036..73539) product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031391.1 transl_table 11 codon_start 1 locus_tag LOCUS_58680 gene tssB CDS 74003..74566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58690 CDS 74554..75972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58700 CDS 75975..78029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58710 CDS 77998..78888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58720 CDS 78885..81227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58730 CDS 81220..82254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58740 assembly_gap 82640..82745 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 82849..83493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58750 CDS 83680..84357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58760 CDS 84409..88011 product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882971.1 transl_table 11 codon_start 1 locus_tag LOCUS_58770 gene tssM CDS complement(88378..89298) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268357.1 transl_table 11 codon_start 1 locus_tag LOCUS_58780 CDS 89474..90091 product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464330.1 transl_table 11 codon_start 1 locus_tag LOCUS_58790 CDS 90088..91653 product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 transl_table 11 codon_start 1 locus_tag LOCUS_58800 CDS 91628..92509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58810 CDS 92519..93646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58820 CDS 93624..94964 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228287.1 transl_table 11 codon_start 1 locus_tag LOCUS_58830 assembly_gap 95451..95542 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 95954..96041 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 96061..96549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58840 CDS complement(96556..97464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58850 CDS complement(97615..98805) product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268358.1 transl_table 11 codon_start 1 locus_tag LOCUS_58860 CDS complement(98958..99410) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528667.1 transl_table 11 codon_start 1 locus_tag LOCUS_58870 CDS complement(99582..100409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58880 assembly_gap 100509..100588 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(100795..103182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58890 CDS complement(103193..104332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58900 CDS complement(104311..105753) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 transl_table 11 codon_start 1 locus_tag LOCUS_58910 CDS complement(105743..106981) product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 transl_table 11 codon_start 1 locus_tag LOCUS_58920 gene eboE CDS complement(106978..107862) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 transl_table 11 codon_start 1 locus_tag LOCUS_58930 CDS complement(107920..108678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58940 CDS complement(108675..109565) product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176762490.1 transl_table 11 codon_start 1 locus_tag LOCUS_58950 CDS complement(109562..111202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58960 assembly_gap 111217..111298 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(111800..112522) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766806.1 transl_table 11 codon_start 1 locus_tag LOCUS_58970 CDS 112722..114251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58980 assembly_gap 113490..113620 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(114243..117038) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088995.1 transl_table 11 codon_start 1 locus_tag LOCUS_58990 CDS complement(117243..117698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59000 CDS 117963..118886 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 transl_table 11 codon_start 1 locus_tag LOCUS_59010 CDS 119048..119419 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095409.1 transl_table 11 codon_start 1 locus_tag LOCUS_59020 CDS 119468..121306 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114380.1 transl_table 11 codon_start 1 locus_tag LOCUS_59030 CDS 121373..121999 product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771485.1 transl_table 11 codon_start 1 locus_tag LOCUS_59040 gene ycaC CDS 122267..123163 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245106.1 transl_table 11 codon_start 1 locus_tag LOCUS_59050 CDS 123265..124032 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192698.1 transl_table 11 codon_start 1 locus_tag LOCUS_59060 CDS 124076..124513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193824.1 transl_table 11 codon_start 1 locus_tag LOCUS_59070 CDS 124642..125307 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 transl_table 11 codon_start 1 locus_tag LOCUS_59080 CDS 125283..126641 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931889.1 transl_table 11 codon_start 1 locus_tag LOCUS_59090 CDS 126793..130194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59100 assembly_gap 130040..130173 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(130554..131945) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267650.1 transl_table 11 codon_start 1 locus_tag LOCUS_59110 CDS 132047..132982 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762697.1 transl_table 11 codon_start 1 locus_tag LOCUS_59120 CDS complement(132899..133393) product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391245.1 transl_table 11 codon_start 1 locus_tag LOCUS_59130 CDS 133648..134463 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139968.1 transl_table 11 codon_start 1 locus_tag LOCUS_59140 gene dapF CDS 134558..135052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59150 CDS 135184..135480 product DUF3144 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118682.1 transl_table 11 codon_start 1 locus_tag LOCUS_59160 CDS complement(135501..136562) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971004.1 transl_table 11 codon_start 1 locus_tag LOCUS_59170 CDS 136729..137598 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088921.1 transl_table 11 codon_start 1 locus_tag LOCUS_59180 CDS complement(137605..138309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59190 CDS 138488..141412 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267676.1 transl_table 11 codon_start 1 locus_tag LOCUS_59200 CDS 141602..142357 product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 transl_table 11 codon_start 1 locus_tag LOCUS_59210 gene nagR CDS 142759..143556 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266216.1 transl_table 11 codon_start 1 locus_tag LOCUS_59220 CDS 143588..144286 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103062.1 transl_table 11 codon_start 1 locus_tag LOCUS_59230 CDS 144288..144689 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106175.1 transl_table 11 codon_start 1 locus_tag LOCUS_59240 CDS 144686..145672 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231023.1 transl_table 11 codon_start 1 locus_tag LOCUS_59250 CDS 145689..146378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59260 CDS 146375..147748 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088882.1 transl_table 11 codon_start 1 locus_tag LOCUS_59270 CDS 147882..150053 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269073.1 transl_table 11 codon_start 1 locus_tag LOCUS_59280 CDS complement(150080..150259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59290 CDS 150416..151147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59300 CDS 151166..152287 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035548.1 transl_table 11 codon_start 1 locus_tag LOCUS_59310 CDS complement(152378..152740) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245808.1 transl_table 11 codon_start 1 locus_tag LOCUS_59320 CDS 152853..153587 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529053.1 transl_table 11 codon_start 1 locus_tag LOCUS_59330 CDS complement(153470..153802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59340 CDS complement(153768..154220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59350 CDS 154404..155342 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027477.1 transl_table 11 codon_start 1 locus_tag LOCUS_59360 CDS 155370..155990 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027478.1 transl_table 11 codon_start 1 locus_tag LOCUS_59370 CDS complement(156419..157513) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530775.1 transl_table 11 codon_start 1 locus_tag LOCUS_59380 CDS complement(157628..158419) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106182.1 transl_table 11 codon_start 1 locus_tag LOCUS_59390 CDS 158628..159974 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064276.1 transl_table 11 codon_start 1 locus_tag LOCUS_59400 CDS 160022..161575 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 transl_table 11 codon_start 1 locus_tag LOCUS_59410 CDS 161572..162951 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 transl_table 11 codon_start 1 locus_tag LOCUS_59420 CDS 163169..164422 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266223.1 transl_table 11 codon_start 1 locus_tag LOCUS_59430 gene gabT CDS 164551..165957 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228361.1 transl_table 11 codon_start 1 locus_tag LOCUS_59440 CDS 165967..166296 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227991.1 transl_table 11 codon_start 1 locus_tag LOCUS_59450 CDS 166317..167090 product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404012.1 transl_table 11 codon_start 1 locus_tag LOCUS_59460 CDS 167169..168023 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083056.1 transl_table 11 codon_start 1 locus_tag LOCUS_59470 CDS 168233..169354 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099985.1 transl_table 11 codon_start 1 locus_tag LOCUS_59480 CDS 169428..170342 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266504.1 transl_table 11 codon_start 1 locus_tag LOCUS_59490 CDS 170344..171624 product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099983.1 transl_table 11 codon_start 1 locus_tag LOCUS_59500 gene livM CDS 171621..172493 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095566.1 transl_table 11 codon_start 1 locus_tag LOCUS_59510 CDS 172490..173206 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095563.1 transl_table 11 codon_start 1 locus_tag LOCUS_59520 CDS complement(173277..174842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59530 CDS complement(174954..177860) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 transl_table 11 codon_start 1 locus_tag LOCUS_59540 CDS complement(178064..179104) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099539.1 transl_table 11 codon_start 1 locus_tag LOCUS_59550 CDS complement(179440..179976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59560 CDS 179879..180076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59570 CDS complement(180614..180940) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 transl_table 11 codon_start 1 locus_tag LOCUS_59580 CDS 181437..182312 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975164.1 transl_table 11 codon_start 1 locus_tag LOCUS_59590 CDS 182378..183178 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266305.1 transl_table 11 codon_start 1 locus_tag LOCUS_59600 CDS 183181..184566 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 transl_table 11 codon_start 1 locus_tag LOCUS_59610 CDS 184563..185219 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402670.1 transl_table 11 codon_start 1 locus_tag LOCUS_59620 CDS 185231..185875 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971583.1 transl_table 11 codon_start 1 locus_tag LOCUS_59630 assembly_gap 186147..186234 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 186235..186744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59640 CDS 186807..187772 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 transl_table 11 codon_start 1 locus_tag LOCUS_59650 CDS 187856..188266 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096732.1 transl_table 11 codon_start 1 locus_tag LOCUS_59660 CDS 188324..188545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59670 CDS complement(188548..189690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59680 CDS 189969..190664 product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974725.1 transl_table 11 codon_start 1 locus_tag LOCUS_59690 CDS 190823..191098 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267062.1 transl_table 11 codon_start 1 locus_tag LOCUS_59700 CDS 191118..192041 product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178076624.1 transl_table 11 codon_start 1 locus_tag LOCUS_59710 gene dmeF CDS complement(192186..192389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59720 CDS 192575..193039 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_59730 CDS 193097..193993 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096819.1 transl_table 11 codon_start 1 locus_tag LOCUS_59740 CDS 194270..195580 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267750.1 transl_table 11 codon_start 1 locus_tag LOCUS_59750 CDS 195674..196678 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551127.1 transl_table 11 codon_start 1 locus_tag LOCUS_59760 assembly_gap 197339..197420 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 197998..198075 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 198079..198270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59770 CDS complement(198308..198892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59780 CDS 199045..200082 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215921.1 transl_table 11 codon_start 1 locus_tag LOCUS_59790 CDS complement(200192..201328) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400873.1 transl_table 11 codon_start 1 locus_tag LOCUS_59800 gene gguB CDS complement(201329..202885) product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797778.1 transl_table 11 codon_start 1 locus_tag LOCUS_59810 gene xylG CDS complement(202918..203919) product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764395.1 transl_table 11 codon_start 1 locus_tag LOCUS_59820 gene xylF CDS complement(204061..205377) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400879.1 transl_table 11 codon_start 1 locus_tag LOCUS_59830 gene xylA CDS 205543..206730 product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268059.1 transl_table 11 codon_start 1 locus_tag LOCUS_59840 CDS complement(206747..207895) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405591.1 transl_table 11 codon_start 1 locus_tag LOCUS_59850 CDS complement(207913..208860) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268178.1 transl_table 11 codon_start 1 locus_tag LOCUS_59860 CDS 208931..209824 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245876.1 transl_table 11 codon_start 1 locus_tag LOCUS_59870 CDS 210147..211112 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113959.1 transl_table 11 codon_start 1 locus_tag LOCUS_59880 CDS 211150..211596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59890 CDS complement(211701..212465) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144067654.1 transl_table 11 codon_start 1 locus_tag LOCUS_59900 CDS complement(212478..213095) product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812310.1 transl_table 11 codon_start 1 locus_tag LOCUS_59910 CDS 213179..214663 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063675.1 transl_table 11 codon_start 1 locus_tag LOCUS_59920 CDS 214749..216461 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101313.1 transl_table 11 codon_start 1 locus_tag LOCUS_59930 CDS complement(216582..217805) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388555.1 transl_table 11 codon_start 1 locus_tag LOCUS_59940 CDS complement(218044..220029) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237583.1 transl_table 11 codon_start 1 locus_tag LOCUS_59950 assembly_gap 218433..218588 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(220126..220806) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969187.1 transl_table 11 codon_start 1 locus_tag LOCUS_59960 CDS complement(220924..222342) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815708.1 transl_table 11 codon_start 1 locus_tag LOCUS_59970 CDS 222467..222922 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086201.1 transl_table 11 codon_start 1 locus_tag LOCUS_59980 CDS 222985..223305 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171053.1 transl_table 11 codon_start 1 locus_tag LOCUS_59990 gene sugE CDS 223420..224637 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816722.1 transl_table 11 codon_start 1 locus_tag LOCUS_60000 CDS 224763..225242 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 transl_table 11 codon_start 1 locus_tag LOCUS_60010 CDS complement(225336..226130) product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036974.1 transl_table 11 codon_start 1 locus_tag LOCUS_60020 CDS 226208..227782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60030 CDS complement(227800..230139) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 transl_table 11 codon_start 1 locus_tag LOCUS_60040 CDS 230355..231026 product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073705668.1 transl_table 11 codon_start 1 locus_tag LOCUS_60050 CDS complement(231196..233052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60060 assembly_gap 233087..233200 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(233882..235468) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926619.1 transl_table 11 codon_start 1 locus_tag LOCUS_60070 CDS complement(235547..236593) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930475.1 transl_table 11 codon_start 1 locus_tag LOCUS_60080 CDS complement(236590..237645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60090 CDS complement(237642..239222) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930477.1 transl_table 11 codon_start 1 locus_tag LOCUS_60100 CDS complement(239222..240214) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930478.1 transl_table 11 codon_start 1 locus_tag LOCUS_60110 CDS complement(240201..240692) product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926614.1 transl_table 11 codon_start 1 locus_tag LOCUS_60120 CDS complement(240689..241639) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926613.1 transl_table 11 codon_start 1 locus_tag LOCUS_60130 CDS complement(241653..242141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60140 assembly_gap 242172..242266 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(242724..242903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60150 assembly_gap 242924..243381 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(243546..244316) product DUF2092 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050980063.1 transl_table 11 codon_start 1 locus_tag LOCUS_60160 CDS complement(244329..245369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 transl_table 11 codon_start 1 locus_tag LOCUS_60170 CDS complement(245376..246281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60180 CDS complement(246304..247761) product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969475.1 transl_table 11 codon_start 1 locus_tag LOCUS_60190 CDS complement(247771..248499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60200 CDS complement(248770..249150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60210 CDS 249210..250157 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836266.1 transl_table 11 codon_start 1 locus_tag LOCUS_60220 CDS 250224..250622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60230 assembly_gap 250963..251047 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 251082..252299 product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969343.1 transl_table 11 codon_start 1 locus_tag LOCUS_60240 CDS 252359..253852 product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969474.1 transl_table 11 codon_start 1 locus_tag LOCUS_60250 CDS complement(253892..254626) product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267058.1 transl_table 11 codon_start 1 locus_tag LOCUS_60260 gene arsH CDS complement(254626..255096) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267059.1 transl_table 11 codon_start 1 locus_tag LOCUS_60270 tRNA complement(255345..255419) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(255455..256306) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266731.1 transl_table 11 codon_start 1 locus_tag LOCUS_60280 gene ispE CDS complement(256308..256925) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768866.1 transl_table 11 codon_start 1 locus_tag LOCUS_60290 gene lolB CDS complement(256930..258636) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 transl_table 11 codon_start 1 locus_tag LOCUS_60300 CDS 258840..260129 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615192.1 transl_table 11 codon_start 1 locus_tag LOCUS_60310 gene hemA CDS 260126..261208 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404940.1 transl_table 11 codon_start 1 locus_tag LOCUS_60320 gene prfA CDS 261209..262039 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103431.1 transl_table 11 codon_start 1 locus_tag LOCUS_60330 gene prmC CDS complement(262003..262551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60340 CDS complement(262557..263783) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388773.1 transl_table 11 codon_start 1 locus_tag LOCUS_60350 assembly_gap 262699..262708 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(263785..264693) product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209979.1 transl_table 11 codon_start 1 locus_tag LOCUS_60360 gene aguB CDS complement(264698..265750) product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091679.1 transl_table 11 codon_start 1 locus_tag LOCUS_60370 CDS 265884..266786 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707685.1 transl_table 11 codon_start 1 locus_tag LOCUS_60380 CDS complement(266756..268600) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930910.1 transl_table 11 codon_start 1 locus_tag LOCUS_60390 CDS complement(268612..270117) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021337.1 transl_table 11 codon_start 1 locus_tag LOCUS_60400 gene argH CDS complement(270124..271704) product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211308.1 transl_table 11 codon_start 1 locus_tag LOCUS_60410 CDS complement(271766..272260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60420 CDS 272322..272690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60430 CDS complement(272637..273557) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_60440 CDS 273750..274733 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065702830.1 transl_table 11 codon_start 1 locus_tag LOCUS_60450 CDS complement(274712..275704) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967956.1 transl_table 11 codon_start 1 locus_tag LOCUS_60460 CDS complement(275837..276454) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 transl_table 11 codon_start 1 locus_tag LOCUS_60470 CDS 276676..278196 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000248.1 transl_table 11 codon_start 1 locus_tag LOCUS_60480 CDS 278189..279352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60490 CDS complement(279392..280207) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081161376.1 transl_table 11 codon_start 1 locus_tag LOCUS_60500 assembly_gap 280854..280953 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 280981..281415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60510 CDS complement(281496..282347) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 transl_table 11 codon_start 1 locus_tag LOCUS_60520 CDS complement(282349..283302) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 transl_table 11 codon_start 1 locus_tag LOCUS_60530 CDS complement(283405..284517) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705996.1 transl_table 11 codon_start 1 locus_tag LOCUS_60540 CDS complement(284508..285620) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 transl_table 11 codon_start 1 locus_tag LOCUS_60550 gene wecB CDS complement(285627..287696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60560 CDS complement(287689..288414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60570 CDS complement(288411..289733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60580 CDS complement(289730..291013) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895561.1 transl_table 11 codon_start 1 locus_tag LOCUS_60590 CDS complement(291003..291710) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 transl_table 11 codon_start 1 locus_tag LOCUS_60600 CDS complement(292277..292768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60610 assembly_gap 292854..292937 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(293403..294509) product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 transl_table 11 codon_start 1 locus_tag LOCUS_60620 CDS 294622..296031 product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868897.1 transl_table 11 codon_start 1 locus_tag LOCUS_60630 gene gcvPA CDS 296024..297562 product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 transl_table 11 codon_start 1 locus_tag LOCUS_60640 gene gcvPB assembly_gap 297584..297679 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(297688..299091) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253525.1 transl_table 11 codon_start 1 locus_tag LOCUS_60650 CDS 299206..300663 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968294.1 transl_table 11 codon_start 1 locus_tag LOCUS_60660 gene gabD CDS 300728..301522 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533811.1 transl_table 11 codon_start 1 locus_tag LOCUS_60670 CDS 301906..302673 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401354.1 transl_table 11 codon_start 1 locus_tag LOCUS_60680 CDS 302816..303622 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082561.1 transl_table 11 codon_start 1 locus_tag LOCUS_60690 assembly_gap 303810..303896 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 304438..305193 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464032.1 transl_table 11 codon_start 1 locus_tag LOCUS_60700 CDS 305105..305842 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 transl_table 11 codon_start 1 locus_tag LOCUS_60710 CDS 305921..307621 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926009.1 transl_table 11 codon_start 1 locus_tag LOCUS_60720 CDS 307798..308733 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172098.1 transl_table 11 codon_start 1 locus_tag LOCUS_60730 gene dapA CDS 308747..309874 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 transl_table 11 codon_start 1 locus_tag LOCUS_60740 CDS 309897..311027 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268410.1 transl_table 11 codon_start 1 locus_tag LOCUS_60750 CDS complement(311112..311480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60760 CDS complement(311560..312264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60770 CDS complement(312521..313354) product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763753.1 transl_table 11 codon_start 1 locus_tag LOCUS_60780 CDS complement(313380..314102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60790 note possible pseudo, frameshifted assembly_gap 313998..314007 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 314032..314505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60800 CDS complement(314415..315209) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244499.1 transl_table 11 codon_start 1 locus_tag LOCUS_60810 CDS complement(315206..316003) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763744.1 transl_table 11 codon_start 1 locus_tag LOCUS_60820 assembly_gap 316036..316119 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(316159..317163) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402156.1 transl_table 11 codon_start 1 locus_tag LOCUS_60830 CDS complement(317147..318166) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763739.1 transl_table 11 codon_start 1 locus_tag LOCUS_60840 CDS 318878..320554 product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044309634.1 transl_table 11 codon_start 1 locus_tag LOCUS_60850 gene mqo CDS 320732..321829 product bifunctional delta(1)-pyrroline-2-carboxylate/delta(1)-piperideine-2-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082545.1 transl_table 11 codon_start 1 locus_tag LOCUS_60860 gene lhpD assembly_gap 321240..321330 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 321926..322052 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(322099..323679) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113704.1 transl_table 11 codon_start 1 locus_tag LOCUS_60870 CDS complement(323884..324801) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105052.1 transl_table 11 codon_start 1 locus_tag LOCUS_60880 CDS complement(324916..326055) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114965.1 transl_table 11 codon_start 1 locus_tag LOCUS_60890 assembly_gap 325002..325085 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(326110..326832) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114964.1 transl_table 11 codon_start 1 locus_tag LOCUS_60900 CDS complement(326825..327475) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114963.1 transl_table 11 codon_start 1 locus_tag LOCUS_60910 CDS complement(327488..328153) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082559.1 transl_table 11 codon_start 1 locus_tag LOCUS_60920 CDS complement(328146..329915) product aconitase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114962.1 transl_table 11 codon_start 1 locus_tag LOCUS_60930 CDS complement(329926..330744) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082561.1 transl_table 11 codon_start 1 locus_tag LOCUS_60940 CDS complement(330991..331818) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082563.1 transl_table 11 codon_start 1 locus_tag LOCUS_60950 CDS complement(331815..333071) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114957.1 transl_table 11 codon_start 1 locus_tag LOCUS_60960 CDS complement(333068..333304) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188713.1 transl_table 11 codon_start 1 locus_tag LOCUS_60970 CDS complement(333297..334412) product D-hydroxyproline dehydrogenase subunit beta LhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114955.1 transl_table 11 codon_start 1 locus_tag LOCUS_60980 gene lhpB CDS complement(334409..335341) product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 transl_table 11 codon_start 1 locus_tag LOCUS_60990 CDS complement(335451..336164) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 transl_table 11 codon_start 1 locus_tag LOCUS_61000 assembly_gap 336261..336345 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(336357..336776) product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975642.1 transl_table 11 codon_start 1 locus_tag LOCUS_61010 CDS complement(336760..336975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61020 CDS 337392..338681 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103770.1 transl_table 11 codon_start 1 locus_tag LOCUS_61030 CDS complement(338709..339386) product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268146.1 transl_table 11 codon_start 1 locus_tag LOCUS_61040 CDS complement(339383..339982) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246306.1 transl_table 11 codon_start 1 locus_tag LOCUS_61050 CDS complement(339979..340755) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268144.1 transl_table 11 codon_start 1 locus_tag LOCUS_61060 CDS complement(340752..341792) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268143.1 transl_table 11 codon_start 1 locus_tag LOCUS_61070 CDS complement(341816..342448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61080 CDS complement(342696..343496) product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211028.1 transl_table 11 codon_start 1 locus_tag LOCUS_61090 CDS 343680..344732 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764509.1 transl_table 11 codon_start 1 locus_tag LOCUS_61100 CDS 344856..346577 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051183874.1 transl_table 11 codon_start 1 locus_tag LOCUS_61110 CDS complement(346574..347629) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211598.1 transl_table 11 codon_start 1 locus_tag LOCUS_61120 CDS complement(347626..349239) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215840.1 transl_table 11 codon_start 1 locus_tag LOCUS_61130 CDS complement(349240..350256) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815879.1 transl_table 11 codon_start 1 locus_tag LOCUS_61140 CDS complement(350447..351322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61150 CDS 351570..352430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112677.1 transl_table 11 codon_start 1 locus_tag LOCUS_61160 CDS 352604..353869 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_61170 CDS 354057..354890 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 transl_table 11 codon_start 1 locus_tag LOCUS_61180 CDS 354887..357160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61190 assembly_gap 355616..355725 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 357157..358503 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037401.1 transl_table 11 codon_start 1 locus_tag LOCUS_61200 CDS 358541..358870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61210 CDS complement(358843..359901) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463326.1 transl_table 11 codon_start 1 locus_tag LOCUS_61220 CDS 360089..360988 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268225.1 transl_table 11 codon_start 1 locus_tag LOCUS_61230 CDS 361095..361373 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 transl_table 11 codon_start 1 locus_tag LOCUS_61240 CDS 361387..361668 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 transl_table 11 codon_start 1 locus_tag LOCUS_61250 CDS complement(361679..362494) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400736.1 transl_table 11 codon_start 1 locus_tag LOCUS_61260 assembly_gap 362243..362281 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(362487..363137) product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268121.1 transl_table 11 codon_start 1 locus_tag LOCUS_61270 gene ehuD CDS complement(363154..363492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61280 note possible pseudo, frameshifted assembly_gap 363423..363432 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(363891..364766) product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268119.1 transl_table 11 codon_start 1 locus_tag LOCUS_61290 gene ehuB CDS 365167..366378 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090111.1 transl_table 11 codon_start 1 locus_tag LOCUS_61300 CDS complement(366487..367086) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528578.1 transl_table 11 codon_start 1 locus_tag LOCUS_61310 CDS 367459..368385 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534449.1 transl_table 11 codon_start 1 locus_tag LOCUS_61320 CDS 368576..369568 product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549880.1 transl_table 11 codon_start 1 locus_tag LOCUS_61330 CDS complement(369689..370048) product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268312.1 transl_table 11 codon_start 1 locus_tag LOCUS_61340 CDS complement(370045..370323) product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771169.1 transl_table 11 codon_start 1 locus_tag LOCUS_61350 CDS complement(370320..370808) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771170.1 transl_table 11 codon_start 1 locus_tag LOCUS_61360 CDS complement(370805..372484) product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771172.1 transl_table 11 codon_start 1 locus_tag LOCUS_61370 CDS complement(372481..372825) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268310.1 transl_table 11 codon_start 1 locus_tag LOCUS_61380 CDS complement(372825..375761) product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268309.1 transl_table 11 codon_start 1 locus_tag LOCUS_61390 CDS complement(376021..377001) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104575.1 transl_table 11 codon_start 1 locus_tag LOCUS_61400 CDS 377055..377618 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268307.1 transl_table 11 codon_start 1 locus_tag LOCUS_61410 CDS 377796..378998 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764602.1 transl_table 11 codon_start 1 locus_tag LOCUS_61420 CDS 379008..379463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61430 CDS 379453..380742 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268048.1 transl_table 11 codon_start 1 locus_tag LOCUS_61440 assembly_gap 380554..380645 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 380685..380939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61450 CDS 381200..382195 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463411.1 transl_table 11 codon_start 1 locus_tag LOCUS_61460 CDS 382192..382968 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104320.1 transl_table 11 codon_start 1 locus_tag LOCUS_61470 CDS 382968..383849 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104319.1 transl_table 11 codon_start 1 locus_tag LOCUS_61480 CDS 383853..384980 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246481.1 transl_table 11 codon_start 1 locus_tag LOCUS_61490 assembly_gap 384527..384604 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 385017..386357 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104318.1 transl_table 11 codon_start 1 locus_tag LOCUS_61500 CDS 386361..387128 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 transl_table 11 codon_start 1 locus_tag LOCUS_61510 CDS 387141..388598 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268306.1 transl_table 11 codon_start 1 locus_tag LOCUS_61520 tRNA 388747..388820 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 388996..389796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61530 CDS 390349..391407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61540 CDS complement(391879..392358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61550 CDS 392984..393409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61560 CDS 393434..393634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556012.1 transl_table 11 codon_start 1 locus_tag LOCUS_61570 CDS complement(393770..394084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61580 assembly_gap 394283..394395 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 394611..395081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61590 CDS 395363..395719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61600 CDS 395865..396050 product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229783.1 transl_table 11 codon_start 1 locus_tag LOCUS_61610 CDS 396472..397692 product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405604.1 transl_table 11 codon_start 1 locus_tag LOCUS_61620 CDS 397689..398537 product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267625.1 transl_table 11 codon_start 1 locus_tag LOCUS_61630 CDS complement(398678..399580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61640 CDS complement(399620..403165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61650 CDS complement(403202..404509) product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258475.1 transl_table 11 codon_start 1 locus_tag LOCUS_61660 CDS complement(404602..405852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61670 assembly_gap 406387..406487 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(406524..407180) product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028480.1 transl_table 11 codon_start 1 locus_tag LOCUS_61680 CDS 407286..408203 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039278.1 transl_table 11 codon_start 1 locus_tag LOCUS_61690 tRNA 408476..408562 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 408918..409154 product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402169.1 transl_table 11 codon_start 1 locus_tag LOCUS_61700 CDS 409151..409480 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210267663.1 transl_table 11 codon_start 1 locus_tag LOCUS_61710 CDS complement(409779..410675) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087264598.1 transl_table 11 codon_start 1 locus_tag LOCUS_61720 CDS 410812..411438 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269309.1 transl_table 11 codon_start 1 locus_tag LOCUS_61730 CDS complement(411465..412991) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 transl_table 11 codon_start 1 locus_tag LOCUS_61740 CDS complement(413041..413376) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_61750 gene tnpB CDS complement(414098..415096) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844124.1 transl_table 11 codon_start 1 locus_tag LOCUS_61760 CDS complement(415099..415431) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296337.1 transl_table 11 codon_start 1 locus_tag LOCUS_61770 CDS complement(415444..416880) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_61780 CDS 417188..418114 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198340.1 transl_table 11 codon_start 1 locus_tag LOCUS_61790 assembly_gap 418484..418493 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 418610..420196 product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767359.1 transl_table 11 codon_start 1 locus_tag LOCUS_61800 CDS complement(420287..421633) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392014.1 transl_table 11 codon_start 1 locus_tag LOCUS_61810 assembly_gap 421720..421816 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(421901..422797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61820 assembly_gap 422870..422879 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 422902..423054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61830 CDS 423064..424224 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532972.1 transl_table 11 codon_start 1 locus_tag LOCUS_61840 CDS 424225..425106 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532973.1 transl_table 11 codon_start 1 locus_tag LOCUS_61850 CDS 425103..425900 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532974.1 transl_table 11 codon_start 1 locus_tag LOCUS_61860 CDS 426176..427114 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532971.1 transl_table 11 codon_start 1 locus_tag LOCUS_61870 CDS 427221..428204 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083943.1 transl_table 11 codon_start 1 locus_tag LOCUS_61880 CDS 428213..429061 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083944.1 transl_table 11 codon_start 1 locus_tag LOCUS_61890 CDS 429087..429671 product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268672.1 transl_table 11 codon_start 1 locus_tag LOCUS_61900 CDS 429682..430122 product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532181.1 transl_table 11 codon_start 1 locus_tag LOCUS_61910 CDS complement(430254..431810) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 transl_table 11 codon_start 1 locus_tag LOCUS_61920 CDS complement(432007..432960) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064273.1 transl_table 11 codon_start 1 locus_tag LOCUS_61930 CDS 433189..434001 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530407.1 transl_table 11 codon_start 1 locus_tag LOCUS_61940 CDS 434035..435282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61950 assembly_gap 435727..435979 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence73 source 1..240660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..1276) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420380.1 transl_table 11 codon_start 1 locus_tag LOCUS_61960 CDS complement(1291..2472) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105512.1 transl_table 11 codon_start 1 locus_tag LOCUS_61970 CDS 2630..3529 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237633.1 transl_table 11 codon_start 1 locus_tag LOCUS_61980 CDS 3967..5088 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269378.1 transl_table 11 codon_start 1 locus_tag LOCUS_61990 CDS 5104..5427 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555867.1 transl_table 11 codon_start 1 locus_tag LOCUS_62000 CDS 5427..6863 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768392.1 transl_table 11 codon_start 1 locus_tag LOCUS_62010 CDS 7044..8537 product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096875.1 transl_table 11 codon_start 1 locus_tag LOCUS_62020 CDS 8857..9072 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555870.1 transl_table 11 codon_start 1 locus_tag LOCUS_62030 assembly_gap 9116..9201 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9326..9604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62040 CDS 9525..9842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62050 CDS 10069..10362 product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105515.1 transl_table 11 codon_start 1 locus_tag LOCUS_62060 CDS 10389..10709 product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316115.1 transl_table 11 codon_start 1 locus_tag LOCUS_62070 CDS 10706..12667 product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269381.1 transl_table 11 codon_start 1 locus_tag LOCUS_62080 CDS 13059..14366 product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769588.1 transl_table 11 codon_start 1 locus_tag LOCUS_62090 CDS 14457..15227 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096920.1 transl_table 11 codon_start 1 locus_tag LOCUS_62100 CDS 15446..17104 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266164.1 transl_table 11 codon_start 1 locus_tag LOCUS_62110 CDS 17160..18374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62120 assembly_gap 18071..18164 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 18364..18645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62130 CDS 18854..19894 product DUF5924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266162.1 transl_table 11 codon_start 1 locus_tag LOCUS_62140 CDS 19958..21103 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114824.1 transl_table 11 codon_start 1 locus_tag LOCUS_62150 CDS 21100..21921 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 transl_table 11 codon_start 1 locus_tag LOCUS_62160 CDS 21923..22861 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 transl_table 11 codon_start 1 locus_tag LOCUS_62170 CDS 22858..23490 product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 transl_table 11 codon_start 1 locus_tag LOCUS_62180 assembly_gap 23512..23610 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23849..25078) product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266161.1 transl_table 11 codon_start 1 locus_tag LOCUS_62190 assembly_gap 25274..25320 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(25331..26746) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401762.1 transl_table 11 codon_start 1 locus_tag LOCUS_62200 gene gltP assembly_gap 25805..25924 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27418..27885) product inhibitor of vertebrate lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103099.1 transl_table 11 codon_start 1 locus_tag LOCUS_62210 CDS complement(27888..28052) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 transl_table 11 codon_start 1 locus_tag LOCUS_62220 CDS complement(28154..28438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103100.1 transl_table 11 codon_start 1 locus_tag LOCUS_62230 CDS 28880..30226 product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380235.1 transl_table 11 codon_start 1 locus_tag LOCUS_62240 gene algB CDS 30249..32015 product KinB sensor domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266285.1 transl_table 11 codon_start 1 locus_tag LOCUS_62250 CDS complement(32019..33638) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038952.1 transl_table 11 codon_start 1 locus_tag LOCUS_62260 CDS complement(33712..34341) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103103.1 transl_table 11 codon_start 1 locus_tag LOCUS_62270 CDS 34306..34518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62280 CDS complement(34592..35983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62290 assembly_gap 36056..36357 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(36895..37752) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 transl_table 11 codon_start 1 locus_tag LOCUS_62300 CDS complement(37764..38414) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 transl_table 11 codon_start 1 locus_tag LOCUS_62310 CDS complement(38618..39223) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 transl_table 11 codon_start 1 locus_tag LOCUS_62320 CDS complement(39269..39559) product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096979.1 transl_table 11 codon_start 1 locus_tag LOCUS_62330 CDS 39748..40392 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341625.1 transl_table 11 codon_start 1 locus_tag LOCUS_62340 gene yihA assembly_gap 40821..41061 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41080..43890) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763493.1 transl_table 11 codon_start 1 locus_tag LOCUS_62350 gene polA CDS 43965..44255 product DUF2782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 transl_table 11 codon_start 1 locus_tag LOCUS_62360 CDS 44314..45264 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763495.1 transl_table 11 codon_start 1 locus_tag LOCUS_62370 CDS complement(45424..46392) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403882.1 transl_table 11 codon_start 1 locus_tag LOCUS_62380 gene znuA CDS 46461..46943 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425978.1 transl_table 11 codon_start 1 locus_tag LOCUS_62390 CDS 46943..47731 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266293.1 transl_table 11 codon_start 1 locus_tag LOCUS_62400 gene znuC CDS 47724..48512 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247039.1 transl_table 11 codon_start 1 locus_tag LOCUS_62410 gene znuB CDS 48550..49266 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266294.1 transl_table 11 codon_start 1 locus_tag LOCUS_62420 assembly_gap 49302..49388 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(49627..50334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62430 CDS complement(50321..51874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62440 assembly_gap 50366..50465 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 52114..53121 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010203924.1 transl_table 11 codon_start 1 locus_tag LOCUS_62450 CDS 53121..53795 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105395.1 transl_table 11 codon_start 1 locus_tag LOCUS_62460 CDS 53879..54652 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 transl_table 11 codon_start 1 locus_tag LOCUS_62470 CDS 54752..55666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62480 CDS 55760..56185 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 transl_table 11 codon_start 1 locus_tag LOCUS_62490 CDS complement(56392..57027) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105394.1 transl_table 11 codon_start 1 locus_tag LOCUS_62500 CDS complement(57024..57923) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 transl_table 11 codon_start 1 locus_tag LOCUS_62510 gene cyoE CDS complement(57911..58990) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 transl_table 11 codon_start 1 locus_tag LOCUS_62520 CDS complement(59001..59594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 transl_table 11 codon_start 1 locus_tag LOCUS_62530 CDS complement(59560..60306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 transl_table 11 codon_start 1 locus_tag LOCUS_62540 CDS 60378..60581 product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101213.1 transl_table 11 codon_start 1 locus_tag LOCUS_62550 CDS complement(60593..61489) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 transl_table 11 codon_start 1 locus_tag LOCUS_62560 CDS complement(61524..62072) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 transl_table 11 codon_start 1 locus_tag LOCUS_62570 CDS complement(62089..63678) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 transl_table 11 codon_start 1 locus_tag LOCUS_62580 gene ctaD CDS complement(63758..64885) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 transl_table 11 codon_start 1 locus_tag LOCUS_62590 gene coxB CDS 65245..65895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266299.1 transl_table 11 codon_start 1 locus_tag LOCUS_62600 CDS complement(65911..67449) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105392.1 transl_table 11 codon_start 1 locus_tag LOCUS_62610 CDS complement(67545..68276) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380033.1 transl_table 11 codon_start 1 locus_tag LOCUS_62620 CDS complement(68540..69598) product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768437.1 transl_table 11 codon_start 1 locus_tag LOCUS_62630 CDS 69772..70416 product tyrosine phosphatase TpbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105672.1 transl_table 11 codon_start 1 locus_tag LOCUS_62640 gene tpbA CDS complement(70394..71320) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966458.1 transl_table 11 codon_start 1 locus_tag LOCUS_62650 CDS 71229..71450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62660 CDS 71553..72041 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975016.1 transl_table 11 codon_start 1 locus_tag LOCUS_62670 CDS 72115..73101 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266127.1 transl_table 11 codon_start 1 locus_tag LOCUS_62680 CDS 73222..74508 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113027.1 transl_table 11 codon_start 1 locus_tag LOCUS_62690 assembly_gap 74674..74774 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 74922..76115 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085473.1 transl_table 11 codon_start 1 locus_tag LOCUS_62700 CDS 76207..77157 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206215.1 transl_table 11 codon_start 1 locus_tag LOCUS_62710 CDS complement(77222..77506) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769461.1 transl_table 11 codon_start 1 locus_tag LOCUS_62720 CDS complement(77503..79554) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103009.1 transl_table 11 codon_start 1 locus_tag LOCUS_62730 gene prlC CDS 79657..80205 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 transl_table 11 codon_start 1 locus_tag LOCUS_62740 assembly_gap 80847..80930 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(81069..82049) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103011.1 transl_table 11 codon_start 1 locus_tag LOCUS_62750 CDS 82311..82724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083612.1 transl_table 11 codon_start 1 locus_tag LOCUS_62760 CDS complement(82731..82970) product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379415.1 transl_table 11 codon_start 1 locus_tag LOCUS_62770 CDS complement(83244..83675) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768138.1 transl_table 11 codon_start 1 locus_tag LOCUS_62780 CDS 84020..85021 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266144.1 transl_table 11 codon_start 1 locus_tag LOCUS_62790 CDS complement(85083..85316) product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379418.1 transl_table 11 codon_start 1 locus_tag LOCUS_62800 CDS complement(85451..85666) product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097345.1 transl_table 11 codon_start 1 locus_tag LOCUS_62810 CDS 85818..86144 product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768141.1 transl_table 11 codon_start 1 locus_tag LOCUS_62820 assembly_gap 86259..86420 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(86430..87326) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103013.1 transl_table 11 codon_start 1 locus_tag LOCUS_62830 CDS 87438..88658 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097340.1 transl_table 11 codon_start 1 locus_tag LOCUS_62840 gene trpB CDS 88658..89467 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115801.1 transl_table 11 codon_start 1 locus_tag LOCUS_62850 gene trpA assembly_gap 89519..89591 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 89860..89952 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 90247..90310 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 90559..90644 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 90990..92093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62860 CDS 92277..92723 product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768144.1 transl_table 11 codon_start 1 locus_tag LOCUS_62870 CDS complement(92758..93087) product DOPA 4,5-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114635.1 transl_table 11 codon_start 1 locus_tag LOCUS_62880 CDS complement(93126..94076) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266140.1 transl_table 11 codon_start 1 locus_tag LOCUS_62890 CDS 94173..95705 product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768150.1 transl_table 11 codon_start 1 locus_tag LOCUS_62900 gene betC CDS 95725..96645 product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266138.1 transl_table 11 codon_start 1 locus_tag LOCUS_62910 CDS 96821..98389 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103017.1 transl_table 11 codon_start 1 locus_tag LOCUS_62920 CDS complement(98477..99298) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266136.1 transl_table 11 codon_start 1 locus_tag LOCUS_62930 gene aroE CDS complement(99298..100218) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768167.1 transl_table 11 codon_start 1 locus_tag LOCUS_62940 gene hemF CDS 100390..101367 product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103021.1 transl_table 11 codon_start 1 locus_tag LOCUS_62950 assembly_gap 101408..101568 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(101596..102099) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340101.1 transl_table 11 codon_start 1 locus_tag LOCUS_62960 CDS complement(102202..103302) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463633.1 transl_table 11 codon_start 1 locus_tag LOCUS_62970 gene dprA CDS complement(103493..104515) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103024.1 transl_table 11 codon_start 1 locus_tag LOCUS_62980 CDS 104668..105174 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 transl_table 11 codon_start 1 locus_tag LOCUS_62990 gene def CDS 105234..106178 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768186.1 transl_table 11 codon_start 1 locus_tag LOCUS_63000 gene fmt CDS 106175..107485 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103025.1 transl_table 11 codon_start 1 locus_tag LOCUS_63010 gene rsmB CDS 107508..108881 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 transl_table 11 codon_start 1 locus_tag LOCUS_63020 gene trkA CDS 108894..109217 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120685.1 transl_table 11 codon_start 1 locus_tag LOCUS_63030 CDS complement(109204..109449) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114645.1 transl_table 11 codon_start 1 locus_tag LOCUS_63040 CDS complement(109526..110413) product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 transl_table 11 codon_start 1 locus_tag LOCUS_63050 CDS complement(110447..110971) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266129.1 transl_table 11 codon_start 1 locus_tag LOCUS_63060 CDS 111174..112046 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379468.1 transl_table 11 codon_start 1 locus_tag LOCUS_63070 gene glyQ CDS 112043..114097 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401442.1 transl_table 11 codon_start 1 locus_tag LOCUS_63080 gene glyS CDS 114107..114640 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401440.1 transl_table 11 codon_start 1 locus_tag LOCUS_63090 gene gmhB CDS 114724..115494 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266128.1 transl_table 11 codon_start 1 locus_tag LOCUS_63100 CDS complement(115669..117291) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106293.1 transl_table 11 codon_start 1 locus_tag LOCUS_63110 CDS complement(117392..119053) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113843.1 transl_table 11 codon_start 1 locus_tag LOCUS_63120 CDS 119189..120076 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092552.1 transl_table 11 codon_start 1 locus_tag LOCUS_63130 CDS complement(120174..122591) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340175.1 transl_table 11 codon_start 1 locus_tag LOCUS_63140 gene gyrB CDS complement(122596..123699) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266123.1 transl_table 11 codon_start 1 locus_tag LOCUS_63150 gene recF CDS complement(123735..124838) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 transl_table 11 codon_start 1 locus_tag LOCUS_63160 gene dnaN CDS complement(124877..126394) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401422.1 transl_table 11 codon_start 1 locus_tag LOCUS_63170 gene dnaA CDS 127043..127513 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768230.1 transl_table 11 codon_start 1 locus_tag LOCUS_63180 gene rnpA CDS 127506..127751 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551313.1 transl_table 11 codon_start 1 locus_tag LOCUS_63190 gene yidD CDS 127754..129433 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 transl_table 11 codon_start 1 locus_tag LOCUS_63200 gene yidC CDS 129515..130885 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244945.1 transl_table 11 codon_start 1 locus_tag LOCUS_63210 gene mnmE CDS 130990..131439 product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192119.1 transl_table 11 codon_start 1 locus_tag LOCUS_63220 assembly_gap 131814..131882 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 132323..132411 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 132423..134042 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993407.1 transl_table 11 codon_start 1 locus_tag LOCUS_63230 gene mnmG CDS 134039..134683 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367844.1 transl_table 11 codon_start 1 locus_tag LOCUS_63240 gene rsmG CDS 134702..135496 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555991.1 transl_table 11 codon_start 1 locus_tag LOCUS_63250 CDS 135506..136378 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377885.1 transl_table 11 codon_start 1 locus_tag LOCUS_63260 CDS 136605..136934 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105593.1 transl_table 11 codon_start 1 locus_tag LOCUS_63270 CDS 136951..137820 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315954.1 transl_table 11 codon_start 1 locus_tag LOCUS_63280 gene atpB CDS 137954..138211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63290 CDS 138269..138739 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401414.1 transl_table 11 codon_start 1 locus_tag LOCUS_63300 CDS 138752..139288 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315956.1 transl_table 11 codon_start 1 locus_tag LOCUS_63310 CDS 139310..140854 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377895.1 transl_table 11 codon_start 1 locus_tag LOCUS_63320 gene atpA CDS 140905..141765 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367855.1 transl_table 11 codon_start 1 locus_tag LOCUS_63330 gene atpG CDS 141793..143169 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555982.1 transl_table 11 codon_start 1 locus_tag LOCUS_63340 gene atpD CDS 143215..143640 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004882435.1 transl_table 11 codon_start 1 locus_tag LOCUS_63350 CDS 143847..145121 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105590.1 transl_table 11 codon_start 1 locus_tag LOCUS_63360 gene glmU CDS 145281..146048 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244951.1 transl_table 11 codon_start 1 locus_tag LOCUS_63370 CDS 146060..147895 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269442.1 transl_table 11 codon_start 1 locus_tag LOCUS_63380 gene glmS CDS 148153..149043 product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097953302.1 transl_table 11 codon_start 1 locus_tag LOCUS_63390 CDS 149045..151234 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351437.1 transl_table 11 codon_start 1 locus_tag LOCUS_63400 CDS 152125..152697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63410 CDS complement(154427..155500) product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 transl_table 11 codon_start 1 locus_tag LOCUS_63420 CDS complement(155531..156019) product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819239.1 transl_table 11 codon_start 1 locus_tag LOCUS_63430 CDS complement(156030..156743) product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267058.1 transl_table 11 codon_start 1 locus_tag LOCUS_63440 gene arsH CDS complement(156773..157243) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112098.1 transl_table 11 codon_start 1 locus_tag LOCUS_63450 CDS complement(157259..158542) product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540054.1 transl_table 11 codon_start 1 locus_tag LOCUS_63460 gene arsB CDS complement(158569..158925) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017131138.1 transl_table 11 codon_start 1 locus_tag LOCUS_63470 CDS complement(158922..159344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63480 CDS complement(159540..160136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63490 CDS complement(161281..161778) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971719.1 transl_table 11 codon_start 1 locus_tag LOCUS_63500 CDS 161976..163181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63510 CDS 163254..164528 product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 transl_table 11 codon_start 1 locus_tag LOCUS_63520 CDS 164540..165421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63530 CDS 165438..166487 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 transl_table 11 codon_start 1 locus_tag LOCUS_63540 CDS 166634..167230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63550 CDS 167369..167914 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 transl_table 11 codon_start 1 locus_tag LOCUS_63560 CDS 168829..169653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63570 CDS complement(170949..171434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63580 CDS 173111..174244 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113787.1 transl_table 11 codon_start 1 locus_tag LOCUS_63590 gene yejK CDS 174247..175509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63600 CDS 175559..176467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63610 CDS 176708..177589 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 transl_table 11 codon_start 1 locus_tag LOCUS_63620 CDS complement(177635..178084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63630 CDS 178318..179133 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768145.1 transl_table 11 codon_start 1 locus_tag LOCUS_63640 CDS 179237..180121 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104037.1 transl_table 11 codon_start 1 locus_tag LOCUS_63650 CDS 180262..180891 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552112.1 transl_table 11 codon_start 1 locus_tag LOCUS_63660 CDS 180947..182992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63670 CDS complement(183152..184654) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775851.1 transl_table 11 codon_start 1 locus_tag LOCUS_63680 assembly_gap 184848..184857 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(184861..185487) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112856.1 transl_table 11 codon_start 1 locus_tag LOCUS_63690 CDS 185639..186121 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112855.1 transl_table 11 codon_start 1 locus_tag LOCUS_63700 CDS complement(186118..187518) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095344.1 transl_table 11 codon_start 1 locus_tag LOCUS_63710 gene lpdA CDS complement(187711..188643) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105554.1 transl_table 11 codon_start 1 locus_tag LOCUS_63720 CDS complement(188645..189265) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105553.1 transl_table 11 codon_start 1 locus_tag LOCUS_63730 CDS complement(189275..189730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105552.1 transl_table 11 codon_start 1 locus_tag LOCUS_63740 CDS complement(189720..191078) product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105551.1 transl_table 11 codon_start 1 locus_tag LOCUS_63750 CDS complement(191078..192835) product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105550.1 transl_table 11 codon_start 1 locus_tag LOCUS_63760 CDS complement(192913..193533) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 transl_table 11 codon_start 1 locus_tag LOCUS_63770 CDS complement(193770..194039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63780 CDS 194862..196904 product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105548.1 transl_table 11 codon_start 1 locus_tag LOCUS_63790 assembly_gap 196498..196581 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 197033..197941 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269416.1 transl_table 11 codon_start 1 locus_tag LOCUS_63800 CDS 197938..198996 product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269415.1 transl_table 11 codon_start 1 locus_tag LOCUS_63810 CDS 198993..200900 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269414.1 transl_table 11 codon_start 1 locus_tag LOCUS_63820 CDS 201201..201452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63830 CDS 201523..202368 product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 transl_table 11 codon_start 1 locus_tag LOCUS_63840 CDS 202359..203147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63850 CDS 203233..204417 product C17 cyclopropane fatty acid synthase CfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269413.1 transl_table 11 codon_start 1 locus_tag LOCUS_63860 gene cfaB CDS complement(204459..205898) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340260.1 transl_table 11 codon_start 1 locus_tag LOCUS_63870 gene cls CDS 206027..206542 product DUF3617 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378325.1 transl_table 11 codon_start 1 locus_tag LOCUS_63880 CDS complement(206657..208549) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 transl_table 11 codon_start 1 locus_tag LOCUS_63890 gene thrS CDS complement(208588..209925) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097095.1 transl_table 11 codon_start 1 locus_tag LOCUS_63900 CDS complement(209928..210488) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617714.1 transl_table 11 codon_start 1 locus_tag LOCUS_63910 CDS complement(210485..210844) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 transl_table 11 codon_start 1 locus_tag LOCUS_63920 gene hisI assembly_gap 210856..210955 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(211005..211892) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883886.1 transl_table 11 codon_start 1 locus_tag LOCUS_63930 CDS complement(211904..212773) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090495.1 transl_table 11 codon_start 1 locus_tag LOCUS_63940 CDS complement(212773..213441) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816887.1 transl_table 11 codon_start 1 locus_tag LOCUS_63950 CDS complement(213438..214346) product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099665.1 transl_table 11 codon_start 1 locus_tag LOCUS_63960 gene folE2 assembly_gap 214868..215010 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 215830..215961 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(215981..216358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269412.1 transl_table 11 codon_start 1 locus_tag LOCUS_63970 CDS 216482..216886 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097086.1 transl_table 11 codon_start 1 locus_tag LOCUS_63980 gene dksA CDS 216914..218125 product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269411.1 transl_table 11 codon_start 1 locus_tag LOCUS_63990 gene zigA CDS 218125..218775 product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269410.1 transl_table 11 codon_start 1 locus_tag LOCUS_64000 CDS complement(218786..219145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244983.1 transl_table 11 codon_start 1 locus_tag LOCUS_64010 CDS 219178..220155 product CobW family GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269408.1 transl_table 11 codon_start 1 locus_tag LOCUS_64020 CDS complement(220323..220727) product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401310.1 transl_table 11 codon_start 1 locus_tag LOCUS_64030 CDS 220842..221714 product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768313.1 transl_table 11 codon_start 1 locus_tag LOCUS_64040 gene pdxY assembly_gap 221800..221923 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(222014..222499) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 transl_table 11 codon_start 1 locus_tag LOCUS_64050 CDS 222785..224548 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401304.1 transl_table 11 codon_start 1 locus_tag LOCUS_64060 CDS complement(224690..225097) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316056.1 transl_table 11 codon_start 1 locus_tag LOCUS_64070 CDS complement(225232..225768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64080 assembly_gap 225784..226198 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(226521..226961) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114104.1 transl_table 11 codon_start 1 locus_tag LOCUS_64090 CDS complement(227000..229180) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269405.1 transl_table 11 codon_start 1 locus_tag LOCUS_64100 gene uvrD CDS 229476..232352 product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096868.1 transl_table 11 codon_start 1 locus_tag LOCUS_64110 CDS 232563..233429 product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768321.1 transl_table 11 codon_start 1 locus_tag LOCUS_64120 gene hexR assembly_gap 233469..233564 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 233769..233960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244987.1 transl_table 11 codon_start 1 locus_tag LOCUS_64130 CDS complement(233902..234849) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768326.1 transl_table 11 codon_start 1 locus_tag LOCUS_64140 CDS 235064..236479 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401293.1 transl_table 11 codon_start 1 locus_tag LOCUS_64150 CDS 236491..238299 product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105539.1 transl_table 11 codon_start 1 locus_tag LOCUS_64160 gene oadA CDS complement(238402..238707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64170 CDS complement(238798..239097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64180 CDS complement(239386..240618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64190 sequence74 source 1..411431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..1456) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104737.1 transl_table 11 codon_start 1 locus_tag LOCUS_64200 gene folC CDS complement(1453..2373) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770594.1 transl_table 11 codon_start 1 locus_tag LOCUS_64210 gene accD CDS complement(2481..3101) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 transl_table 11 codon_start 1 locus_tag LOCUS_64220 CDS complement(3166..3990) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770596.1 transl_table 11 codon_start 1 locus_tag LOCUS_64230 gene truA CDS 4213..4872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64240 CDS complement(4947..7502) product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 transl_table 11 codon_start 1 locus_tag LOCUS_64250 gene fimV CDS complement(7709..8710) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104739.1 transl_table 11 codon_start 1 locus_tag LOCUS_64260 CDS complement(9002..10114) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244780.1 transl_table 11 codon_start 1 locus_tag LOCUS_64270 gene asd CDS complement(10183..11265) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267364.1 transl_table 11 codon_start 1 locus_tag LOCUS_64280 gene leuB CDS complement(11322..12086) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115017.1 transl_table 11 codon_start 1 locus_tag LOCUS_64290 CDS complement(12190..12834) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267363.1 transl_table 11 codon_start 1 locus_tag LOCUS_64300 gene leuD CDS complement(12845..14263) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406190.1 transl_table 11 codon_start 1 locus_tag LOCUS_64310 gene leuC assembly_gap 14718..14819 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 15105..15210 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15577..18852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64320 CDS complement(19017..19466) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091405.1 transl_table 11 codon_start 1 locus_tag LOCUS_64330 CDS complement(19578..20537) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 transl_table 11 codon_start 1 locus_tag LOCUS_64340 CDS complement(20644..21078) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397383.1 transl_table 11 codon_start 1 locus_tag LOCUS_64350 CDS complement(21122..21955) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115024.1 transl_table 11 codon_start 1 locus_tag LOCUS_64360 CDS complement(21988..22527) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115025.1 transl_table 11 codon_start 1 locus_tag LOCUS_64370 assembly_gap 22743..22752 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(22838..22913) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(22970..23045) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 assembly_gap 23210..23219 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(23356..25026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64380 assembly_gap 23667..23767 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 25256..26302 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119737.1 transl_table 11 codon_start 1 locus_tag LOCUS_64390 CDS 26292..27842 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130539.1 transl_table 11 codon_start 1 locus_tag LOCUS_64400 assembly_gap 27878..28001 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28019..28918) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026083402.1 transl_table 11 codon_start 1 locus_tag LOCUS_64410 CDS 29022..30458 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095426.1 transl_table 11 codon_start 1 locus_tag LOCUS_64420 assembly_gap 30531..30635 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 30776..31720 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268300.1 transl_table 11 codon_start 1 locus_tag LOCUS_64430 CDS 31734..32177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105927.1 transl_table 11 codon_start 1 locus_tag LOCUS_64440 CDS 32283..34124 product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104036.1 transl_table 11 codon_start 1 locus_tag LOCUS_64450 CDS complement(34125..35414) product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114177.1 transl_table 11 codon_start 1 locus_tag LOCUS_64460 CDS complement(35484..35963) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206287.1 transl_table 11 codon_start 1 locus_tag LOCUS_64470 CDS complement(35978..37381) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206286.1 transl_table 11 codon_start 1 locus_tag LOCUS_64480 CDS 37495..38388 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368401.1 transl_table 11 codon_start 1 locus_tag LOCUS_64490 CDS complement(38397..39596) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 transl_table 11 codon_start 1 locus_tag LOCUS_64500 CDS complement(39702..40715) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203330501.1 transl_table 11 codon_start 1 locus_tag LOCUS_64510 CDS 40881..41786 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189067.1 transl_table 11 codon_start 1 locus_tag LOCUS_64520 CDS 41945..42448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64530 CDS 42778..44100 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161632413.1 transl_table 11 codon_start 1 locus_tag LOCUS_64540 CDS complement(44147..46282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64550 CDS complement(46690..47793) product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 transl_table 11 codon_start 1 locus_tag LOCUS_64560 gene tssA CDS complement(47790..51599) product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114521.1 transl_table 11 codon_start 1 locus_tag LOCUS_64570 CDS complement(51596..52357) product DotU family type IV/VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104706.1 transl_table 11 codon_start 1 locus_tag LOCUS_64580 CDS complement(52376..53707) product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122697.1 transl_table 11 codon_start 1 locus_tag LOCUS_64590 gene tssK CDS complement(53751..54200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104701.1 transl_table 11 codon_start 1 locus_tag LOCUS_64600 CDS 54429..54980 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089493.1 transl_table 11 codon_start 1 locus_tag LOCUS_64610 gene tssB CDS 55009..56496 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 transl_table 11 codon_start 1 locus_tag LOCUS_64620 gene tssC assembly_gap 56946..57032 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 57033..57158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64630 note possible pseudo, frameshifted CDS 57174..57623 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114519.1 transl_table 11 codon_start 1 locus_tag LOCUS_64640 gene tssE CDS 57607..59400 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 transl_table 11 codon_start 1 locus_tag LOCUS_64650 gene tssF CDS 59364..60383 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114517.1 transl_table 11 codon_start 1 locus_tag LOCUS_64660 gene tssG CDS 60386..61642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64670 assembly_gap 61282..61405 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 61525..63018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64680 CDS 63185..64246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64690 assembly_gap 63297..63382 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 64328..66337 product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 transl_table 11 codon_start 1 locus_tag LOCUS_64700 CDS 66347..66892 product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114514.1 transl_table 11 codon_start 1 locus_tag LOCUS_64710 CDS complement(66896..67291) product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 transl_table 11 codon_start 1 locus_tag LOCUS_64720 CDS 67391..68254 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098205.1 transl_table 11 codon_start 1 locus_tag LOCUS_64730 CDS complement(68258..69361) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071377.1 transl_table 11 codon_start 1 locus_tag LOCUS_64740 CDS 69755..70489 product class II aldolase and adducin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 transl_table 11 codon_start 1 locus_tag LOCUS_64750 CDS complement(70533..71564) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530805.1 transl_table 11 codon_start 1 locus_tag LOCUS_64760 CDS complement(71595..71804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64770 CDS complement(71732..73339) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214391123.1 transl_table 11 codon_start 1 locus_tag LOCUS_64780 gene betA assembly_gap 71815..71909 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(73402..74571) product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704973.1 transl_table 11 codon_start 1 locus_tag LOCUS_64790 CDS 74844..75194 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 transl_table 11 codon_start 1 locus_tag LOCUS_64800 CDS 75184..75498 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 transl_table 11 codon_start 1 locus_tag LOCUS_64810 CDS 75647..76588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 transl_table 11 codon_start 1 locus_tag LOCUS_64820 CDS complement(76595..77515) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704917.1 transl_table 11 codon_start 1 locus_tag LOCUS_64830 CDS complement(77560..78828) product cyanide-forming glycine dehydrogenase subunit HcnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113686.1 transl_table 11 codon_start 1 locus_tag LOCUS_64840 gene hcnC CDS complement(78832..80229) product cyanide-forming glycine dehydrogenase subunit HcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113685.1 transl_table 11 codon_start 1 locus_tag LOCUS_64850 gene hcnB CDS complement(80226..80540) product cyanide-forming glycine dehydrogenase subunit HcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113684.1 transl_table 11 codon_start 1 locus_tag LOCUS_64860 gene hcnA CDS complement(80646..81551) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095765.1 transl_table 11 codon_start 1 locus_tag LOCUS_64870 CDS 81654..82496 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968037.1 transl_table 11 codon_start 1 locus_tag LOCUS_64880 CDS 82614..82985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64890 CDS 82972..84426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64900 CDS complement(84536..87655) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704244.1 transl_table 11 codon_start 1 locus_tag LOCUS_64910 assembly_gap 84546..84620 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(87652..88902) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 transl_table 11 codon_start 1 locus_tag LOCUS_64920 CDS complement(88899..90164) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817191.1 transl_table 11 codon_start 1 locus_tag LOCUS_64930 CDS complement(90265..90585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64940 CDS 90749..91294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64950 CDS complement(91333..91755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64960 CDS complement(91883..94318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64970 CDS 94731..95279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64980 CDS 95404..95928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64990 CDS 95966..96307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65000 CDS 96434..99220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65010 CDS 99207..99803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65020 CDS 99863..100522 product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113192.1 transl_table 11 codon_start 1 locus_tag LOCUS_65030 tRNA 100590..100665 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 assembly_gap 100743..100831 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(100865..102226) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_65040 CDS complement(102239..104014) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110747.1 transl_table 11 codon_start 1 locus_tag LOCUS_65050 CDS complement(104017..104760) product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110746.1 transl_table 11 codon_start 1 locus_tag LOCUS_65060 CDS complement(104923..106605) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895628.1 transl_table 11 codon_start 1 locus_tag LOCUS_65070 CDS complement(106730..107650) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186242.1 transl_table 11 codon_start 1 locus_tag LOCUS_65080 CDS 107759..108655 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119197.1 transl_table 11 codon_start 1 locus_tag LOCUS_65090 CDS 108838..109458 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969298.1 transl_table 11 codon_start 1 locus_tag LOCUS_65100 CDS complement(109472..110140) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072829.1 transl_table 11 codon_start 1 locus_tag LOCUS_65110 gene lepB CDS complement(110245..111018) product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269242.1 transl_table 11 codon_start 1 locus_tag LOCUS_65120 CDS complement(111077..112393) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269241.1 transl_table 11 codon_start 1 locus_tag LOCUS_65130 CDS 112681..113631 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103119.1 transl_table 11 codon_start 1 locus_tag LOCUS_65140 CDS complement(113728..115062) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724359.1 transl_table 11 codon_start 1 locus_tag LOCUS_65150 CDS complement(115137..116195) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111019.1 transl_table 11 codon_start 1 locus_tag LOCUS_65160 CDS complement(116227..116973) product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920743.1 transl_table 11 codon_start 1 locus_tag LOCUS_65170 CDS complement(116970..117821) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265874.1 transl_table 11 codon_start 1 locus_tag LOCUS_65180 CDS complement(117980..118246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 transl_table 11 codon_start 1 locus_tag LOCUS_65190 assembly_gap 118537..118620 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 118780..119130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65200 CDS complement(119204..119641) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 transl_table 11 codon_start 1 locus_tag LOCUS_65210 CDS complement(119638..119913) product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640710.1 transl_table 11 codon_start 1 locus_tag LOCUS_65220 CDS complement(119927..120232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65230 CDS 120189..121436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65240 CDS 121429..121998 product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 transl_table 11 codon_start 1 locus_tag LOCUS_65250 CDS 122018..122407 product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 transl_table 11 codon_start 1 locus_tag LOCUS_65260 CDS 122430..123266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65270 CDS complement(123245..124570) product outer membrane porin OprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112576.1 transl_table 11 codon_start 1 locus_tag LOCUS_65280 gene oprD CDS complement(124988..125959) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 transl_table 11 codon_start 1 locus_tag LOCUS_65290 CDS complement(125959..127092) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 transl_table 11 codon_start 1 locus_tag LOCUS_65300 CDS 127371..128066 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969608.1 transl_table 11 codon_start 1 locus_tag LOCUS_65310 CDS complement(128048..129235) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096932.1 transl_table 11 codon_start 1 locus_tag LOCUS_65320 gene cfa CDS 129612..130106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65330 CDS complement(130230..131426) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104588.1 transl_table 11 codon_start 1 locus_tag LOCUS_65340 assembly_gap 131712..131800 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 131842..133857 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769676.1 transl_table 11 codon_start 1 locus_tag LOCUS_65350 gene uvrB CDS complement(133909..134718) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085615.1 transl_table 11 codon_start 1 locus_tag LOCUS_65360 CDS 134828..135604 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103062.1 transl_table 11 codon_start 1 locus_tag LOCUS_65370 CDS 135631..136869 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195011.1 transl_table 11 codon_start 1 locus_tag LOCUS_65380 gene codA CDS complement(136889..137347) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876692.1 transl_table 11 codon_start 1 locus_tag LOCUS_65390 CDS 137401..138402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65400 CDS complement(138409..138999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65410 CDS complement(139196..140188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65420 CDS 140354..141007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65430 CDS complement(141004..142356) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 transl_table 11 codon_start 1 locus_tag LOCUS_65440 gene gudD CDS complement(142385..143740) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246084.1 transl_table 11 codon_start 1 locus_tag LOCUS_65450 CDS 144090..144806 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268232.1 transl_table 11 codon_start 1 locus_tag LOCUS_65460 CDS complement(144883..145155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65470 assembly_gap 145272..145352 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 145506..146720 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521213.1 transl_table 11 codon_start 1 locus_tag LOCUS_65480 CDS complement(146861..147400) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969913.1 transl_table 11 codon_start 1 locus_tag LOCUS_65490 CDS complement(147397..148476) product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549880.1 transl_table 11 codon_start 1 locus_tag LOCUS_65500 CDS 148637..149164 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524578.1 transl_table 11 codon_start 1 locus_tag LOCUS_65510 CDS 149161..149910 product regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546094.1 transl_table 11 codon_start 1 locus_tag LOCUS_65520 assembly_gap 149982..150214 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 150376..150936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65530 CDS 151160..152188 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104057.1 transl_table 11 codon_start 1 locus_tag LOCUS_65540 CDS 152185..153060 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267600.1 transl_table 11 codon_start 1 locus_tag LOCUS_65550 CDS 153061..153855 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383453.1 transl_table 11 codon_start 1 locus_tag LOCUS_65560 CDS 153863..154153 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246655.1 transl_table 11 codon_start 1 locus_tag LOCUS_65570 CDS 154150..155505 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267599.1 transl_table 11 codon_start 1 locus_tag LOCUS_65580 assembly_gap 156326..156644 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 156759..157811 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267597.1 transl_table 11 codon_start 1 locus_tag LOCUS_65590 CDS complement(157830..158801) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196717.1 transl_table 11 codon_start 1 locus_tag LOCUS_65600 CDS complement(158818..161166) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832203.1 transl_table 11 codon_start 1 locus_tag LOCUS_65610 CDS complement(161186..161980) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526784.1 transl_table 11 codon_start 1 locus_tag LOCUS_65620 CDS complement(162016..162492) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027938.1 transl_table 11 codon_start 1 locus_tag LOCUS_65630 CDS complement(162522..163067) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478315.1 transl_table 11 codon_start 1 locus_tag LOCUS_65640 CDS complement(163079..163603) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526781.1 transl_table 11 codon_start 1 locus_tag LOCUS_65650 CDS complement(163706..164218) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526781.1 transl_table 11 codon_start 1 locus_tag LOCUS_65660 CDS complement(164467..164805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65670 CDS 165168..166277 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895676.1 transl_table 11 codon_start 1 locus_tag LOCUS_65680 gene zapE CDS 166348..167658 product leucine-rich repeat-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463315.1 transl_table 11 codon_start 1 locus_tag LOCUS_65690 CDS complement(167837..168541) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 transl_table 11 codon_start 1 locus_tag LOCUS_65700 CDS 168758..170641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65710 CDS complement(170670..170855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65720 CDS complement(170852..171601) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082684.1 transl_table 11 codon_start 1 locus_tag LOCUS_65730 assembly_gap 170859..170930 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 171715..172839 product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112368.1 transl_table 11 codon_start 1 locus_tag LOCUS_65740 gene phnW CDS 172890..173717 product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112369.1 transl_table 11 codon_start 1 locus_tag LOCUS_65750 CDS complement(173740..174843) product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 transl_table 11 codon_start 1 locus_tag LOCUS_65760 CDS 174899..175561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65770 CDS complement(175565..176122) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404446.1 transl_table 11 codon_start 1 locus_tag LOCUS_65780 CDS 176340..176579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404447.1 transl_table 11 codon_start 1 locus_tag LOCUS_65790 CDS 176680..177576 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095930.1 transl_table 11 codon_start 1 locus_tag LOCUS_65800 CDS complement(177608..178168) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434385.1 transl_table 11 codon_start 1 locus_tag LOCUS_65810 CDS complement(178183..180438) product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 transl_table 11 codon_start 1 locus_tag LOCUS_65820 gene ldcA CDS complement(180557..181312) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 transl_table 11 codon_start 1 locus_tag LOCUS_65830 gene dnaQ CDS complement(181305..181757) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368579.1 transl_table 11 codon_start 1 locus_tag LOCUS_65840 gene rnhA CDS complement(181848..182606) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404449.1 transl_table 11 codon_start 1 locus_tag LOCUS_65850 CDS 182682..183461 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267224.1 transl_table 11 codon_start 1 locus_tag LOCUS_65860 gene gloB CDS 183633..184967 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267223.1 transl_table 11 codon_start 1 locus_tag LOCUS_65870 CDS 185109..186938 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267222.1 transl_table 11 codon_start 1 locus_tag LOCUS_65880 CDS 186935..188779 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104691.1 transl_table 11 codon_start 1 locus_tag LOCUS_65890 CDS 188781..189854 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552742.1 transl_table 11 codon_start 1 locus_tag LOCUS_65900 CDS 189856..190875 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315267.1 transl_table 11 codon_start 1 locus_tag LOCUS_65910 CDS 190877..192490 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267220.1 transl_table 11 codon_start 1 locus_tag LOCUS_65920 CDS complement(192575..194434) product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770757.1 transl_table 11 codon_start 1 locus_tag LOCUS_65930 CDS complement(194678..194950) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552737.1 transl_table 11 codon_start 1 locus_tag LOCUS_65940 CDS complement(195098..197494) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267216.1 transl_table 11 codon_start 1 locus_tag LOCUS_65950 gene lon CDS complement(197665..198948) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 transl_table 11 codon_start 1 locus_tag LOCUS_65960 gene clpX CDS complement(199061..199696) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 transl_table 11 codon_start 1 locus_tag LOCUS_65970 gene clpP CDS complement(199790..201058) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267215.1 transl_table 11 codon_start 1 locus_tag LOCUS_65980 gene tig assembly_gap 201078..201171 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 201558..201621 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(201666..201750) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(201809..201884) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(201917..201993) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 202273..203127 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404473.1 transl_table 11 codon_start 1 locus_tag LOCUS_65990 gene folD CDS complement(203191..204957) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104696.1 transl_table 11 codon_start 1 locus_tag LOCUS_66000 CDS complement(205028..205300) product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376264.1 transl_table 11 codon_start 1 locus_tag LOCUS_66010 CDS complement(205312..206112) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267210.1 transl_table 11 codon_start 1 locus_tag LOCUS_66020 CDS complement(206121..206987) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552729.1 transl_table 11 codon_start 1 locus_tag LOCUS_66030 CDS complement(206984..208081) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104697.1 transl_table 11 codon_start 1 locus_tag LOCUS_66040 CDS complement(208081..209175) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740065.1 transl_table 11 codon_start 1 locus_tag LOCUS_66050 CDS 209404..211281 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267208.1 transl_table 11 codon_start 1 locus_tag LOCUS_66060 assembly_gap 211089..211187 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 211242..211382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66070 CDS complement(211443..212825) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769192.1 transl_table 11 codon_start 1 locus_tag LOCUS_66080 gene cysS CDS complement(212844..214592) product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 transl_table 11 codon_start 1 locus_tag LOCUS_66090 CDS 214786..215289 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404493.1 transl_table 11 codon_start 1 locus_tag LOCUS_66100 CDS 215286..216032 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769188.1 transl_table 11 codon_start 1 locus_tag LOCUS_66110 gene lpxH CDS complement(216046..217575) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010435770.1 transl_table 11 codon_start 1 locus_tag LOCUS_66120 CDS complement(217639..218841) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104700.1 transl_table 11 codon_start 1 locus_tag LOCUS_66130 CDS complement(218857..220278) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112617.1 transl_table 11 codon_start 1 locus_tag LOCUS_66140 assembly_gap 220312..220395 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(220397..220879) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404499.1 transl_table 11 codon_start 1 locus_tag LOCUS_66150 CDS 221186..221368 product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103638.1 transl_table 11 codon_start 1 locus_tag LOCUS_66160 CDS 221392..221796 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767619.1 transl_table 11 codon_start 1 locus_tag LOCUS_66170 CDS complement(221793..222407) product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 transl_table 11 codon_start 1 locus_tag LOCUS_66180 CDS 222647..223507 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087881.1 transl_table 11 codon_start 1 locus_tag LOCUS_66190 CDS complement(223538..224008) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404500.1 transl_table 11 codon_start 1 locus_tag LOCUS_66200 CDS 224344..227013 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218961313.1 transl_table 11 codon_start 1 locus_tag LOCUS_66210 gene acnB CDS complement(227219..228049) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267308.1 transl_table 11 codon_start 1 locus_tag LOCUS_66220 gene queF CDS complement(228131..228667) product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895638.1 transl_table 11 codon_start 1 locus_tag LOCUS_66230 CDS 228823..229500 product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 transl_table 11 codon_start 1 locus_tag LOCUS_66240 CDS 229500..230870 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090883.1 transl_table 11 codon_start 1 locus_tag LOCUS_66250 CDS complement(231001..232245) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405690.1 transl_table 11 codon_start 1 locus_tag LOCUS_66260 CDS complement(232316..233014) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244212.1 transl_table 11 codon_start 1 locus_tag LOCUS_66270 gene lolD CDS complement(233007..234257) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315078.1 transl_table 11 codon_start 1 locus_tag LOCUS_66280 CDS 234369..234956 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405698.1 transl_table 11 codon_start 1 locus_tag LOCUS_66290 CDS 235020..235742 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405702.1 transl_table 11 codon_start 1 locus_tag LOCUS_66300 CDS complement(235785..237179) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436620.1 transl_table 11 codon_start 1 locus_tag LOCUS_66310 gene sthA CDS complement(237361..238380) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113985.1 transl_table 11 codon_start 1 locus_tag LOCUS_66320 CDS 238692..239990 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405709.1 transl_table 11 codon_start 1 locus_tag LOCUS_66330 CDS complement(240177..241562) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244218.1 transl_table 11 codon_start 1 locus_tag LOCUS_66340 CDS 241992..245441 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103850.1 transl_table 11 codon_start 1 locus_tag LOCUS_66350 gene mfd CDS 245454..246020 product CsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267303.1 transl_table 11 codon_start 1 locus_tag LOCUS_66360 CDS 246028..248730 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103848.1 transl_table 11 codon_start 1 locus_tag LOCUS_66370 CDS complement(248734..249744) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268330.1 transl_table 11 codon_start 1 locus_tag LOCUS_66380 gene nagZ CDS complement(249769..250356) product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403692.1 transl_table 11 codon_start 1 locus_tag LOCUS_66390 gene psrA assembly_gap 250368..250461 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 250815..251423 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554100.1 transl_table 11 codon_start 1 locus_tag LOCUS_66400 gene lexA CDS 251434..251901 product SulA-like leucine-rich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245353.1 transl_table 11 codon_start 1 locus_tag LOCUS_66410 CDS complement(252006..252239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315798.1 transl_table 11 codon_start 1 locus_tag LOCUS_66420 CDS complement(252369..252494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66430 assembly_gap 252496..252572 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(253148..255769) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268332.1 transl_table 11 codon_start 1 locus_tag LOCUS_66440 gene topA CDS complement(255885..256121) product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 transl_table 11 codon_start 1 locus_tag LOCUS_66450 CDS complement(256210..257394) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245350.1 transl_table 11 codon_start 1 locus_tag LOCUS_66460 gene fadA CDS complement(257415..259562) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268335.1 transl_table 11 codon_start 1 locus_tag LOCUS_66470 gene fadB CDS complement(260109..260546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104596.1 transl_table 11 codon_start 1 locus_tag LOCUS_66480 CDS 260653..261093 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 transl_table 11 codon_start 1 locus_tag LOCUS_66490 CDS complement(261145..263064) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245346.1 transl_table 11 codon_start 1 locus_tag LOCUS_66500 CDS 263277..265205 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104597.1 transl_table 11 codon_start 1 locus_tag LOCUS_66510 CDS complement(265367..266173) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104598.1 transl_table 11 codon_start 1 locus_tag LOCUS_66520 CDS complement(266278..267207) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378076.1 transl_table 11 codon_start 1 locus_tag LOCUS_66530 CDS 267786..268250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66540 CDS 268747..269652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66550 CDS 269649..270308 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765089.1 transl_table 11 codon_start 1 locus_tag LOCUS_66560 CDS complement(270292..271191) product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765091.1 transl_table 11 codon_start 1 locus_tag LOCUS_66570 gene yegS CDS 271614..273050 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765093.1 transl_table 11 codon_start 1 locus_tag LOCUS_66580 CDS 273051..274508 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104599.1 transl_table 11 codon_start 1 locus_tag LOCUS_66590 CDS 274578..275351 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403729.1 transl_table 11 codon_start 1 locus_tag LOCUS_66600 CDS 275370..277364 product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104600.1 transl_table 11 codon_start 1 locus_tag LOCUS_66610 CDS 277364..278554 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268346.1 transl_table 11 codon_start 1 locus_tag LOCUS_66620 CDS 278544..279869 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104602.1 transl_table 11 codon_start 1 locus_tag LOCUS_66630 CDS 279866..281083 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765099.1 transl_table 11 codon_start 1 locus_tag LOCUS_66640 CDS 281074..282174 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765101.1 transl_table 11 codon_start 1 locus_tag LOCUS_66650 CDS 282174..283562 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268349.1 transl_table 11 codon_start 1 locus_tag LOCUS_66660 CDS 283559..284380 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268350.1 transl_table 11 codon_start 1 locus_tag LOCUS_66670 CDS 284390..285811 product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765108.1 transl_table 11 codon_start 1 locus_tag LOCUS_66680 CDS 285815..286741 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267456.1 transl_table 11 codon_start 1 locus_tag LOCUS_66690 CDS 286889..287221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66700 CDS complement(287293..287895) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408165.1 transl_table 11 codon_start 1 locus_tag LOCUS_66710 gene recR CDS complement(288125..288463) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 transl_table 11 codon_start 1 locus_tag LOCUS_66720 CDS complement(288528..290660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66730 CDS 290810..291598 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765281.1 transl_table 11 codon_start 1 locus_tag LOCUS_66740 CDS complement(291673..293364) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893374.1 transl_table 11 codon_start 1 locus_tag LOCUS_66750 CDS 293721..294035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66760 CDS 294171..294548 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971212.1 transl_table 11 codon_start 1 locus_tag LOCUS_66770 CDS complement(294476..295447) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207777.1 transl_table 11 codon_start 1 locus_tag LOCUS_66780 CDS 295553..296428 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207778.1 transl_table 11 codon_start 1 locus_tag LOCUS_66790 CDS 296512..297414 product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 transl_table 11 codon_start 1 locus_tag LOCUS_66800 assembly_gap 297457..297590 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 298075..298182 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 298354..299175 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879825.1 transl_table 11 codon_start 1 locus_tag LOCUS_66810 CDS 300587..301291 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836535.1 transl_table 11 codon_start 1 locus_tag LOCUS_66820 CDS complement(301334..302179) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 transl_table 11 codon_start 1 locus_tag LOCUS_66830 CDS 302275..303192 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 transl_table 11 codon_start 1 locus_tag LOCUS_66840 assembly_gap 303492..303558 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(303838..304596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_66850 assembly_gap 304895..305005 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 305344..305467 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(305480..307837) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104653.1 transl_table 11 codon_start 1 locus_tag LOCUS_66860 gene ligA CDS complement(308024..308872) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376124.1 transl_table 11 codon_start 1 locus_tag LOCUS_66870 gene zipA CDS complement(309134..312622) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104654.1 transl_table 11 codon_start 1 locus_tag LOCUS_66880 gene smc CDS complement(312625..313284) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267259.1 transl_table 11 codon_start 1 locus_tag LOCUS_66890 CDS 313586..315040 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 transl_table 11 codon_start 1 locus_tag LOCUS_66900 gene xdhA CDS 315033..317432 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267257.1 transl_table 11 codon_start 1 locus_tag LOCUS_66910 gene xdhB assembly_gap 317477..317552 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 317646..318488 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267256.1 transl_table 11 codon_start 1 locus_tag LOCUS_66920 gene xdhC CDS 318498..319841 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419799.1 transl_table 11 codon_start 1 locus_tag LOCUS_66930 gene guaD CDS complement(320029..320793) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 transl_table 11 codon_start 1 locus_tag LOCUS_66940 CDS 321026..322216 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267275.1 transl_table 11 codon_start 1 locus_tag LOCUS_66950 CDS complement(322334..324301) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114601.1 transl_table 11 codon_start 1 locus_tag LOCUS_66960 CDS complement(324416..325840) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098233.1 transl_table 11 codon_start 1 locus_tag LOCUS_66970 CDS complement(326091..326852) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 transl_table 11 codon_start 1 locus_tag LOCUS_66980 CDS 327102..328106 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 transl_table 11 codon_start 1 locus_tag LOCUS_66990 assembly_gap 328153..328235 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(328265..328963) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667462.1 transl_table 11 codon_start 1 locus_tag LOCUS_67000 gene pyrF CDS 329226..330590 product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267271.1 transl_table 11 codon_start 1 locus_tag LOCUS_67010 gene eat CDS 330712..330879 product DUF2897 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405831.1 transl_table 11 codon_start 1 locus_tag LOCUS_67020 CDS 330983..331543 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 transl_table 11 codon_start 1 locus_tag LOCUS_67030 CDS complement(331629..331961) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268558.1 transl_table 11 codon_start 1 locus_tag LOCUS_67040 CDS complement(332073..333992) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404223.1 transl_table 11 codon_start 1 locus_tag LOCUS_67050 CDS complement(334158..335177) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 transl_table 11 codon_start 1 locus_tag LOCUS_67060 CDS complement(335582..335881) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554561.1 transl_table 11 codon_start 1 locus_tag LOCUS_67070 gene ihfB CDS complement(336015..336296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67080 CDS complement(336489..338174) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554562.1 transl_table 11 codon_start 1 locus_tag LOCUS_67090 gene rpsA CDS complement(338295..338984) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616463.1 transl_table 11 codon_start 1 locus_tag LOCUS_67100 gene cmk CDS complement(338981..339436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67110 assembly_gap 339439..339521 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(340019..341131) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 transl_table 11 codon_start 1 locus_tag LOCUS_67120 gene hisC CDS complement(341143..342237) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 transl_table 11 codon_start 1 locus_tag LOCUS_67130 gene pheA CDS complement(342237..343328) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393775.1 transl_table 11 codon_start 1 locus_tag LOCUS_67140 gene serC CDS complement(343532..346330) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091448.1 transl_table 11 codon_start 1 locus_tag LOCUS_67150 gene gyrA CDS complement(346656..347732) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404235.1 transl_table 11 codon_start 1 locus_tag LOCUS_67160 gene mtnA CDS 347842..349173 product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268564.1 transl_table 11 codon_start 1 locus_tag LOCUS_67170 CDS 349240..349938 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766737.1 transl_table 11 codon_start 1 locus_tag LOCUS_67180 CDS 349942..350613 product N-acetylmuramic acid 6-phosphate phosphatase MupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103692.1 transl_table 11 codon_start 1 locus_tag LOCUS_67190 gene mupP assembly_gap 350647..350779 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 350787..351500 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 transl_table 11 codon_start 1 locus_tag LOCUS_67200 CDS 351699..352877 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766730.1 transl_table 11 codon_start 1 locus_tag LOCUS_67210 assembly_gap 351734..351814 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(352896..353684) product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766727.1 transl_table 11 codon_start 1 locus_tag LOCUS_67220 CDS complement(353731..356190) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268569.1 transl_table 11 codon_start 1 locus_tag LOCUS_67230 CDS complement(356402..358210) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268570.1 transl_table 11 codon_start 1 locus_tag LOCUS_67240 CDS complement(358203..358838) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404247.1 transl_table 11 codon_start 1 locus_tag LOCUS_67250 CDS complement(358842..359780) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032607335.1 transl_table 11 codon_start 1 locus_tag LOCUS_67260 CDS complement(359882..360178) product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404250.1 transl_table 11 codon_start 1 locus_tag LOCUS_67270 CDS complement(360191..360709) product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314637.1 transl_table 11 codon_start 1 locus_tag LOCUS_67280 assembly_gap 361035..361112 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 361212..361811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67290 note possible pseudo, frameshifted assembly_gap 361738..361777 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 361852..362397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67300 note possible pseudo, frameshifted CDS complement(362513..363481) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766711.1 transl_table 11 codon_start 1 locus_tag LOCUS_67310 CDS 363695..363898 product DUF6316 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102301.1 transl_table 11 codon_start 1 locus_tag LOCUS_67320 CDS complement(364090..365274) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 transl_table 11 codon_start 1 locus_tag LOCUS_67330 CDS complement(365378..366898) product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103643.1 transl_table 11 codon_start 1 locus_tag LOCUS_67340 gene pap CDS 367038..369107 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103642.1 transl_table 11 codon_start 1 locus_tag LOCUS_67350 gene mnmC assembly_gap 367856..367959 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(369109..373983) product NEL-type E3 ubiquitin ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104869.1 transl_table 11 codon_start 1 locus_tag LOCUS_67360 CDS complement(374000..376327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67370 assembly_gap 376357..376445 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 376909..377358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67380 assembly_gap 378314..378409 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 378537..379745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67390 CDS 379750..381570 product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111433.1 transl_table 11 codon_start 1 locus_tag LOCUS_67400 gene ngg assembly_gap 381133..381210 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 381659..382852 product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402538.1 transl_table 11 codon_start 1 locus_tag LOCUS_67410 CDS 382965..383192 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004879420.1 transl_table 11 codon_start 1 locus_tag LOCUS_67420 CDS complement(383195..383404) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381023.1 transl_table 11 codon_start 1 locus_tag LOCUS_67430 gene csrA CDS complement(383593..384399) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767607.1 transl_table 11 codon_start 1 locus_tag LOCUS_67440 CDS 384731..384883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67450 CDS complement(384979..387132) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135844328.1 transl_table 11 codon_start 1 locus_tag LOCUS_67460 CDS complement(387408..387599) product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315122.1 transl_table 11 codon_start 1 locus_tag LOCUS_67470 CDS complement(387691..388221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405772.1 transl_table 11 codon_start 1 locus_tag LOCUS_67480 CDS complement(388317..388835) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103819.1 transl_table 11 codon_start 1 locus_tag LOCUS_67490 CDS complement(388944..390782) product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208273.1 transl_table 11 codon_start 1 locus_tag LOCUS_67500 CDS 391163..391435 product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315128.1 transl_table 11 codon_start 1 locus_tag LOCUS_67510 CDS complement(391537..391887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67520 CDS complement(392134..392679) product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267284.1 transl_table 11 codon_start 1 locus_tag LOCUS_67530 CDS complement(392705..393859) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 transl_table 11 codon_start 1 locus_tag LOCUS_67540 CDS complement(393859..394950) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405788.1 transl_table 11 codon_start 1 locus_tag LOCUS_67550 gene aroC CDS 395093..396034 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267282.1 transl_table 11 codon_start 1 locus_tag LOCUS_67560 CDS 396134..396925 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103815.1 transl_table 11 codon_start 1 locus_tag LOCUS_67570 assembly_gap 396967..397068 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(397132..398040) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405794.1 transl_table 11 codon_start 1 locus_tag LOCUS_67580 gene prmB CDS 398260..398850 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378637.1 transl_table 11 codon_start 1 locus_tag LOCUS_67590 CDS 398990..399310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378639.1 transl_table 11 codon_start 1 locus_tag LOCUS_67600 CDS 399388..399945 product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378641.1 transl_table 11 codon_start 1 locus_tag LOCUS_67610 CDS 400025..400570 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343112.1 transl_table 11 codon_start 1 locus_tag LOCUS_67620 gene folE CDS 400742..401113 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244324.1 transl_table 11 codon_start 1 locus_tag LOCUS_67630 CDS complement(401126..401497) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267277.1 transl_table 11 codon_start 1 locus_tag LOCUS_67640 CDS complement(401648..402250) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343108.1 transl_table 11 codon_start 1 locus_tag LOCUS_67650 CDS complement(402261..403427) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267276.1 transl_table 11 codon_start 1 locus_tag LOCUS_67660 CDS 403550..403951 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405819.1 transl_table 11 codon_start 1 locus_tag LOCUS_67670 CDS 404209..405558 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 transl_table 11 codon_start 1 locus_tag LOCUS_67680 CDS 405624..406250 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387809.1 transl_table 11 codon_start 1 locus_tag LOCUS_67690 CDS complement(406511..406864) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 transl_table 11 codon_start 1 locus_tag LOCUS_67700 gene uraH CDS 407274..408200 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765316.1 transl_table 11 codon_start 1 locus_tag LOCUS_67710 gene puuE CDS 408197..408712 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 transl_table 11 codon_start 1 locus_tag LOCUS_67720 gene uraD CDS 408791..409786 product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267251.1 transl_table 11 codon_start 1 locus_tag LOCUS_67730 gene alc CDS 409907..410407 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083329.1 transl_table 11 codon_start 1 locus_tag LOCUS_67740 sequence75 source 1..28915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(275..1048) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268167.1 transl_table 11 codon_start 1 locus_tag LOCUS_67750 CDS complement(1064..2191) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 transl_table 11 codon_start 1 locus_tag LOCUS_67760 CDS complement(2200..3390) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268168.1 transl_table 11 codon_start 1 locus_tag LOCUS_67770 CDS complement(3402..4100) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 transl_table 11 codon_start 1 locus_tag LOCUS_67780 assembly_gap 4146..4426 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4446..6092) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 transl_table 11 codon_start 1 locus_tag LOCUS_67790 CDS complement(6261..7277) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113336.1 transl_table 11 codon_start 1 locus_tag LOCUS_67800 CDS 7514..9169 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104278.1 transl_table 11 codon_start 1 locus_tag LOCUS_67810 CDS 9169..10125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67820 CDS 10255..10719 product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 transl_table 11 codon_start 1 locus_tag LOCUS_67830 gene phnB CDS 10841..11716 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523002.1 transl_table 11 codon_start 1 locus_tag LOCUS_67840 CDS 11830..13140 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526010.1 transl_table 11 codon_start 1 locus_tag LOCUS_67850 CDS 13331..14260 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367267.1 transl_table 11 codon_start 1 locus_tag LOCUS_67860 CDS 14497..15726 product DUF2599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112111.1 transl_table 11 codon_start 1 locus_tag LOCUS_67870 CDS complement(15898..16512) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388945.1 transl_table 11 codon_start 1 locus_tag LOCUS_67880 gene leuD CDS complement(16509..17552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67890 assembly_gap 17556..17646 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18219..18878) product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 transl_table 11 codon_start 1 locus_tag LOCUS_67900 CDS complement(18875..19246) product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764124.1 transl_table 11 codon_start 1 locus_tag LOCUS_67910 CDS complement(19277..19963) product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111706.1 transl_table 11 codon_start 1 locus_tag LOCUS_67920 CDS complement(20278..21045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_67930 misc_feature complement(21042..>28915) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104446.1:filamentous hemagglutinin N-terminal domain-containing protein locus_tag LOCUS_67940 assembly_gap 25938..26063 estimated_length known gap_type within scaffold linkage_evidence paired-ends