COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2507656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 note possible pseudo, internal stop codon, frameshifted CDS 1199..1990 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(2112..3047) product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene glsA CDS 3477..4664 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113342.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 4678..5067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 5086..6270 product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene megL CDS complement(6347..7723) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 8016..8687 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167262.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene queE CDS complement(8724..9098) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001329795.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene queD CDS 9336..11141 product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815604.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene cysJ CDS 11141..12874 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene cysI CDS 12871..13605 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(13685..15088) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(15294..15941) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene pgmB CDS complement(15943..18657) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189781.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(18698..20119) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368560.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene treB CDS complement(20241..21206) product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene treR CDS 21552..22964 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815607.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene cysG CDS 22979..23887 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499613.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene cysD CDS 23899..25341 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene cysN CDS 25347..25952 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083931.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene cysC CDS 26336..26635 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209390.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene ftsB CDS 26703..27434 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703297.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene ispD CDS 27438..27950 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene ispF CDS 27916..28965 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815611.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene truD CDS 28943..29704 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene surE CDS 29701..30327 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 30576..31643 product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620533.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene nlpD CDS 31698..32684 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene rpoS CDS complement(33340..34101) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(34103..36664) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene mutS CDS 37375..37533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 note possible pseudo, internal stop codon, frameshifted CDS 37850..38140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 38177..39040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(39307..39507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(39555..40061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 note possible pseudo, internal stop codon, frameshifted CDS complement(40080..41525) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(41540..44107) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043728.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(44104..44835) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(44895..45416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703287.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(46381..47076) product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019213468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(47621..47812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 47778..48335 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 48382..49353 product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(49438..50739) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(50753..51319) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(51316..54234) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 54808..55365 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818910.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 55430..56182 product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(56301..57950) product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020643.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 58453..58722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(58868..59218) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 59656..59967 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562370.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 60094..60555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 60575..61261 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(61263..61634) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 61728..62381 product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene nfsB CDS 62767..63171 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 63823..64716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 64914..65651 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(65779..67053) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097184.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene efeB CDS complement(67065..67964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(67957..68790) product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813578.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(68799..69137) product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(69221..69778) product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 70050..70979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288609.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 assembly_gap 71635..72386 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(72424..72660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 72703..72867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 72950..73591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(73634..75064) product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene dhaM CDS complement(75906..76535) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 77009..78004 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(78053..79507) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene cscA CDS 79801..80745 product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 80980..81906 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene rarD CDS 82019..83197 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366002.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene purT CDS complement(83261..84469) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(85116..86723) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 87203..87643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 88034..90187 product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene btsT CDS 90259..90462 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856610.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 90491..91450 product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene yjiA CDS complement(91530..92849) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(93056..94402) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705398.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 94960..95856 product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(95938..96765) product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(96776..97999) product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 98347..98979 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080191.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(99317..99727) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 99881..100918 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(100982..101329) product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228215.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 101532..103166 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815585.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene cueO CDS complement(103558..103860) product Ada metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(103867..104535) product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene alkB CDS complement(104546..105283) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530732.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(105280..106344) product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene ada CDS 107186..107419 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095533.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(107524..107733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(107741..108877) product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269339.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 109424..109726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 110560..111096 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167149.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene hpt CDS complement(111182..111835) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651604.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene can CDS 112218..113159 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209343.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 113156..113926 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(114048..114428) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156780.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene panD CDS complement(114480..115343) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene panC CDS complement(115377..116168) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167163.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene panB CDS complement(116228..116719) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene folK CDS complement(116721..118073) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815589.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene pcnB CDS complement(118765..119220) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156764.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene dksA CDS complement(119418..120149) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene sfsA CDS 120218..122668 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene hrpB CDS 122999..125530 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815593.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene mrcB CDS complement(126587..127894) product type 2 secretion system lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(129065..130354) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209362.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene hemL CDS 130653..130997 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene erpA CDS complement(131122..131946) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene btuF CDS complement(132228..132920) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167232.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene mtnN CDS 133149..134672 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209369.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene dgt CDS 135293..136612 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene rlmD CDS 136704..138941 product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167242.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene relA CDS 139029..139829 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene mazG CDS 140089..141726 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene pyrG CDS 141881..143182 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene eno CDS 143810..145195 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(145475..146410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(146626..147081) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244522.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 147294..148703 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174164.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(148868..152029) product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167694.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene acrB CDS complement(152045..153232) product efflux RND transporter adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158151.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene acrA CDS 153364..154002 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene acrR CDS 154029..154382 product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene ychN CDS 154469..157849 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208612.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene mscK CDS complement(157856..158026) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene rsmS CDS complement(158043..158591) product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167706.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 158741..159292 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127356.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene apt CDS 159388..161307 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208605.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene dnaX CDS 161357..161686 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 161686..162285 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene recR CDS 162676..164550 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene htpG CDS 164742..165386 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816875.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene adk CDS 165529..166500 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208599.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene hemH CDS 166618..167742 product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene wzz(fepE) CDS 168048..169298 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(169516..169674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(169819..170022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(170538..172277) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158223.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene ybaL CDS complement(172730..173944) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208584.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 174204..175871 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816863.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene ushA CDS complement(176077..176553) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208581.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene ybaK CDS complement(176582..177382) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(177773..178231) product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815869.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 178329..179231 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211617.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(179349..182294) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene copA CDS 182537..182947 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026762.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene cueR CDS complement(182901..183380) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167770.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(183377..184321) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158246.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(184337..185194) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167772.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(185254..186063) product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148963.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene ybbO CDS complement(186107..186745) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene tesA CDS 186716..187402 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 187399..189834 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816856.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 190489..191100 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 191257..192621 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210050.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(193022..194272) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(194775..195857) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208570.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene purK CDS complement(195854..196372) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208569.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene purE CDS complement(196523..197245) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene lpxH CDS complement(197257..197751) product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene ppiB CDS 198267..199655 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222677.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene cysS CDS complement(199987..201681) product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208797.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene fruA CDS complement(201693..202637) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091263.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene fruK CDS complement(202634..203779) product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208799.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene fruB CDS complement(204366..204578) product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene ybcJ CDS complement(204596..205453) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816853.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene folD tRNA 205641..205717 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 206031..206285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 206592..206939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 208007..208987 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene cysB CDS complement(209093..210277) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(210978..212303) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(212322..212798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(212798..213598) product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(214946..215719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(216181..217083) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026083402.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(217128..217844) product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(217866..218687) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189232801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(219066..219863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(219877..220704) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039297.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(220839..221180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 note possible pseudo, frameshifted CDS complement(221246..221635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 note possible pseudo, frameshifted CDS complement(221738..222760) product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(223198..224130) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(224580..225482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(225535..226083) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(226109..226861) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018304.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(226885..229398) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(229529..230158) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(231623..231811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 note possible pseudo, internal stop codon, frameshifted CDS 232057..232251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(232694..241273) product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 242719..243567 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 243571..245205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 245229..245888 product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(245993..247327) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(247327..248487) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(248650..249411) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243284.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(249421..250092) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(250157..250954) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227109.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(250957..251490) product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene snaB CDS complement(251505..252869) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene purB CDS 253370..254998 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 254976..255932 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 255929..256792 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 256792..258447 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384275.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(258568..258765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 258902..259270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(259441..259656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 261092..261583 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686745.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene napF CDS 261573..261851 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene napD CDS 261832..264318 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene napA CDS 264325..265020 product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene napG CDS 265007..265870 product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene napH CDS 265867..266316 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835182.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene napB CDS 266326..266928 product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene napC CDS 267615..268352 product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene ccmC CDS 268352..268564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 268561..269040 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene ccmE CDS 269037..270968 product cytochrome c-type biogenesis heme lyase CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene ccmF CDS 270965..271522 product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene dsbE CDS 271519..272595 product cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene ccmH CDS 273472..275505 product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(275656..277035) product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314112.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene galP CDS complement(277769..278653) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209231.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene robA CDS complement(278863..281316) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene glgP CDS complement(281321..282613) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817364.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene glgC CDS 283237..283491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(283761..284756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(285096..285932) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 286494..288005 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 288017..289954 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene iolD CDS 290536..292218 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 292240..297636 product contact-dependent inhibition toxin CdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene cdiA CDS 297633..298010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 298241..298552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 298718..299197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 299194..299469 product colicin immunity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214798.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 299671..299868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 300888..301874 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene iolG CDS 301993..302166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 302422..303828 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816648.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 303883..304311 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168621.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 304642..305775 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 305801..307705 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene iolC CDS 307739..308632 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene iolE CDS 308906..309739 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098250.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene iolB CDS 309977..311089 product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(311141..311782) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110820.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(312127..313095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 313314..313931 product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099044.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(314064..314693) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011507991.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 315096..315653 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 315668..316246 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 316593..317402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 317862..318941 product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973985.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 319131..320018 product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168976.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene tehB CDS complement(320074..321465) product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368182.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene clcA CDS 321955..323607 product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816026.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene hcp CDS 323653..324657 product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211360.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene hcr CDS complement(324957..325178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 325236..325412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 326024..327094 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097209.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(327124..327654) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228059.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 327784..328164 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 328166..328603 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 328609..329022 product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 329505..331196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(331482..331673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(332130..333284) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene metK CDS 334013..335917 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene speA CDS 336019..336951 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene speB CDS 337282..338061 product acetoin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 338967..339152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(339297..340166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 340371..340616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170100.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(340752..341435) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165371.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene mutH CDS complement(341581..341769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(342081..343754) product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene sgrR assembly_gap 344013..344880 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(345088..345690) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025800380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene leuD CDS complement(345704..347122) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140680.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene leuC CDS complement(347124..348215) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene leuB CDS complement(348218..349798) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene leuA CDS 350682..351635 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167050.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene leuO CDS 351900..353711 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 354061..355764 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene ilvI CDS 355767..356258 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene ilvN CDS 356504..357514 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene cra CDS 358213..358671 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167064.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene mraZ CDS 358674..359624 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene rsmH CDS 359627..359947 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704398.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene ftsL CDS 359960..361726 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156878.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 361713..363200 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene murE CDS 363197..364570 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626691.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene murF CDS 364564..365646 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene mraY CDS 365648..366973 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095572.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene murD CDS 366973..368166 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295532.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene ftsW CDS 368163..369236 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016582.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene murG CDS 369295..370758 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815569.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene murC CDS 370761..371681 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 371683..372492 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene ftsQ CDS 372529..373785 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210431.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene ftsA CDS 373842..375002 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501978.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene ftsZ CDS 375101..376018 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595482.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene lpxC CDS complement(376085..376606) product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 376796..377254 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210427.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene secM CDS 377359..380070 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene secA CDS 380124..380513 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167088.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene mutT CDS complement(380939..381214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 assembly_gap 381227..381494 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(382641..382838) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene yacG CDS complement(382855..383613) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene zapD CDS complement(383610..384239) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209319.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene coaE CDS complement(384528..385715) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(385715..387115) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050163663.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene gspE CDS complement(387129..387554) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene ppdD CDS complement(387946..388500) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene ampD CDS 388598..389521 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene nadC CDS 390562..391332 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene pdhR CDS 391498..394164 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene aceE CDS 394178..396034 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene aceF CDS 396240..397667 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene lpdA CDS 398322..400919 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704419.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene acnB CDS 401052..401423 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167120.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene yacL CDS 401562..402437 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209961.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene mscS CDS 402815..403432 product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209960.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene argO CDS 403553..404287 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173525.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(404455..405456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(405836..406738) product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163344.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 406940..407596 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene rpiA CDS 408041..409291 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene serA CDS complement(409341..409931) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173520.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(410370..410699) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706812.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene zapA CDS 410698..410844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 410871..411449 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209953.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 411737..413053 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene pepP CDS 413082..414260 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052899460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene ubiH CDS 414286..415515 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene ubiI CDS 416125..417219 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209949.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene gcvT CDS 417271..417666 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene gcvH CDS 417759..420635 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194962.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene gcvP CDS complement(420775..421395) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(421407..422396) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene ygfZ CDS 422649..422915 product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene sdhE CDS 422896..423306 product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(423350..423868) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209934.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene fldB CDS 423940..424875 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173453.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene xerD CDS 424895..425596 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817020.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene dsbC CDS 425606..427339 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173449.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene recJ CDS 427832..428578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 note possible pseudo, frameshifted CDS 428586..430103 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene lysS CDS 430865..431419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 assembly_gap 432696..434055 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(435291..436115) product virulence regulon transcriptional activator VirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176447.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene virF CDS complement(437333..437683) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098481.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(437888..438106) product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 438380..438856 product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene eco CDS complement(439044..439481) product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096287.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene uspF CDS 439889..440821 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198019.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 441366..441560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 441485..441862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 note possible pseudo, internal stop codon, frameshifted CDS 442225..443265 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482303.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene galM CDS 443520..444524 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456547.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(444679..446133) product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(446148..447311) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285909.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene prpC CDS complement(447362..448246) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052184.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene prpB CDS 448627..450219 product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene prpR CDS 450212..450412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 450753..451916 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(451997..452941) product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 453340..454248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087190.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 454640..455818 product tetracycline efflux MFS transporter Tet(30) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene tet CDS 455949..456206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(456267..456833) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207150.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 456928..458166 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207151.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 458294..458824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(459287..459715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(460312..461148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 repeat_region 462389..462609 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgtttccaccgccgtttccaccaccgttt assembly_gap 463982..465195 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 465250..465507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 465541..465708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 466002..466862 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 466901..467977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 468048..469619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 469601..469891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(470081..470797) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(470794..473886) product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(473917..475884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(475877..477289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(477432..478700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(478697..481117) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985413.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 481933..483141 product IS256-like element ISEc39 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048255367.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(483485..483988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 assembly_gap 484286..484787 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 484889..485137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 note possible pseudo, frameshifted CDS 485098..485403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 note possible pseudo, frameshifted CDS complement(485530..486051) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206142.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(486472..486921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(486921..487784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(488213..488812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(488812..492747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(493039..493962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(493962..495113) product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(495103..497079) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(497192..498316) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883155.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 498216..498416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(498516..499352) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(499424..499849) product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(499920..500807) product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007869717.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(501152..501508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 501699..501914 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 501938..503146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 503837..505273 product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035339735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 505700..506284 product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263371.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(506425..506643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 506795..508036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 508497..511091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 511364..511960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 512016..513395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(513812..514219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 514466..514627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(514918..516159) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 tmRNA complement(516343..516706) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(516755..517237) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene smpB CDS 517380..517826 product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 517810..518112 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(518319..518807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(518920..521583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 521667..522251 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172778.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene grpE CDS complement(522325..523005) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209663.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene ung CDS 523326..523709 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene grcA CDS 523867..525324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(525352..526692) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene srmB CDS complement(526841..527029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 note possible pseudo, frameshifted CDS complement(527227..528144) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene hutG CDS complement(528147..528878) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482748.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 529035..529772 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(529942..531546) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene nadB CDS 531917..532495 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209672.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene rpoE CDS 532600..533223 product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene rseA CDS 533223..534173 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene rseB CDS 534177..534641 product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209675.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene rseC CDS 534877..536679 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene lepA CDS 536697..537668 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene lepB CDS 538072..538752 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene rnc CDS 538749..539657 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159414.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene era CDS 539669..540385 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209680.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene recO CDS 540615..541346 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704752.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene pdxJ CDS 541346..541732 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene acpS CDS complement(542004..542264) product 4Fe-4S dicluster ferredoxin YfhL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene yfhL CDS complement(542849..543295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 543447..544094 product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704095.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene leuE CDS 544168..544689 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene tadA CDS complement(545028..546704) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene mltF CDS 547089..550976 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene purL CDS complement(551509..552303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(552669..554996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(555718..557727) product T3SS effector E3 ubiquitin-protein ligase IpaH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005031414.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(558338..559780) product NEL-type E3 ubiquitin ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 561180..561704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 562488..566672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 566663..566920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 567680..569353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 569970..570503 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463204.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 570851..571108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463168.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 571108..571659 product type III secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463172.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 571733..572119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 572142..572639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478153.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 572656..573852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 574175..575278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 575612..576655 product type III secretion system translocator protein VopB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene vopB2 CDS 576665..577405 product type III secretion system translocator protein VopD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478342.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene vopD2 CDS 577450..578040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 578009..578437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 578437..579006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 579013..579297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 579299..579520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 579468..582035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 582392..582994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 582987..584879 product FHIPEP family type III secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 584882..585922 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 585909..586727 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 586724..587104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 587106..588104 product VPA1351 family putative T3SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 588115..588762 product VPA1350 family putative T3SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 588772..588984 product FliM/FliN family flagellar motor C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(589174..589647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(589650..590318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 590824..591141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 591301..592506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 593015..593326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 593807..594094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478231.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 594436..594729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478231.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 594879..595583 product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478169.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 595586..596275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478260.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 596272..596535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 596528..598012 product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 598012..599274 product type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463220.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 599228..599617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 599629..600231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 600218..600451 product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 600479..600856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(601097..602137) product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene fbpC CDS complement(602154..604232) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(604313..605344) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(605357..606625) product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene uhpC CDS complement(606790..608316) product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168581.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(608322..608948) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168584.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(609086..610114) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815985.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 611518..612957 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216114.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 612960..613811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 613798..615138 product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene glrR CDS 615376..616998 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 617011..617349 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene glnB CDS complement(617512..618711) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene hmpA CDS 619065..620318 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211552.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 620457..621608 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(621613..622323) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(622338..623129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 623194..623463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(623429..625942) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094836.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(625956..626645) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(626688..627272) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094838.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(627773..628576) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213305.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene suhB CDS 628701..629432 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene trmJ CDS 629539..630036 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene iscR CDS 630164..631378 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 631402..631788 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene iscU CDS 631937..632260 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene iscA CDS 632583..633104 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene hscB CDS 633116..634966 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172623.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene hscA CDS 634969..635304 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004713939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene fdx CDS 635333..635533 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene iscX CDS 635867..637162 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081828.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene pepB CDS 637298..637753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(638434..640734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 assembly_gap 640796..641197 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(641991..643073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(643097..643354) product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226101.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(643435..643740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(643772..644737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(644978..645946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(646189..647157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(647268..648992) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(649158..649691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 assembly_gap 649863..650306 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(650508..651041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 assembly_gap 651209..651673 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(651749..653425) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(653467..654252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 assembly_gap 654271..655355 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 656709..661757 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815782.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 661993..664314 product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175631705.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene pbpC CDS 665063..665488 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172605.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene ndk CDS 665898..667079 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081821.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 667273..668229 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene rodZ CDS 668504..669625 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene ispG CDS 669842..671134 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene hisS CDS 671145..671768 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172568.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 671916..673088 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815787.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene bamB CDS 673227..674699 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene der CDS 674913..675968 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032012.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 675979..676680 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220944.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 677004..677879 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368793.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rluF CDS complement(677958..679106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(679252..680169) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208526.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene hemF CDS 680305..680736 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 680851..681447 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815850.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 681717..682613 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 683012..684034 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815856.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 684034..684864 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene cysT CDS 684864..685712 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene cysW CDS 685725..686813 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene cysA CDS 687483..688367 product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene cysM CDS complement(688450..688959) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene crr CDS complement(689267..690994) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene ptsI CDS complement(691141..691398) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene ptsH CDS complement(691750..692703) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene cysK CDS complement(692981..693745) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083653.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene cysZ CDS 694113..695141 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene zipA CDS 695199..697214 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene ligA CDS 697702..698886 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172189.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 698955..699170 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213369.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 tRNA complement(699505..699580) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(699619..699694) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 699849..700037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(700162..701583) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene gltX tRNA 702045..702120 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 702149..702224 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 702259..702334 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 702361..702436 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 assembly_gap 702448..702888 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 704727..705026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 705563..705799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(706261..706929) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(706926..707939) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(707943..709403) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243944.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(709408..710532) product alkylhydroperoxidase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 710706..711593 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084189.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 711937..712674 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485222.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 712880..713659 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704666.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 713669..714469 product MoaF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704665.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(714506..715756) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 716531..718489 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 718501..719652 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817444.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 719756..720286 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene mtlR CDS 720834..721004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 721006..721173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 note possible pseudo, internal stop codon CDS 722110..723513 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 724105..725832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 725843..726319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 726739..726897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(727176..727940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(727951..728997) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464856.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 729547..730917 product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene pcaB CDS complement(730983..731870) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 732161..733531 product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705380.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene dcuC CDS 733580..735274 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 tRNA complement(735958..736032) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 736597..737349 product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209701.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene mlaA CDS complement(738132..739409) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209702.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene fadL CDS 739764..740060 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 740484..741803 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815905.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene fadI CDS 741803..743980 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209705.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene fadJ CDS 744713..745216 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene sixA CDS complement(745658..746200) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene smrB CDS 746627..747865 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163359289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene hutI CDS 748714..749382 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704791.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 750059..751738 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene hutU CDS 751751..753283 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene hutH CDS 753386..754783 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(754792..755151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(755216..756142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(756207..756680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 note possible pseudo, internal stop codon CDS complement(756756..757148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(757305..758096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(758184..758561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 759099..760031 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098152.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene prmB CDS 760110..761198 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene aroC CDS 761384..762187 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209713.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 762204..762755 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 762782..763054 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209715.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 763115..763651 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(763759..765801) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815908.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene mnmC CDS 766004..767218 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene fabB CDS complement(767329..768189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 768299..768820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(769908..770843) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 770943..771740 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 771902..773113 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene pdxB CDS 773313..774323 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209726.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 774323..775138 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene truA CDS 775265..775951 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 776056..777039 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene accD CDS 777032..778321 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209730.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene folC CDS 778327..779010 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209731.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene dedD CDS 779332..779835 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209732.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene cvpA CDS 779850..781367 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene purF CDS 781611..782708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 782736..783326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 783493..784317 product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799764.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 784391..784963 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171802.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(785244..786158) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 786458..786997 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene yfcD CDS 787642..788877 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816570.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 788897..789094 product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 789091..790551 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208498.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(790740..791210) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836250.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 791314..792222 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(792277..794421) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene pta CDS complement(794625..795869) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210288.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene ackA CDS 796638..797093 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106616.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene yfbV CDS 797221..797715 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 797736..798410 product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 798585..800393 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(800544..801125) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210283.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene yfbR CDS complement(801990..803204) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 803976..804905 product virulence transcriptional regulator RovM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene rovM CDS 805647..806090 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210279.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 806108..806782 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913178.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene nuoB CDS 806857..808653 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene nuoC CDS 808656..809195 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene nuoE CDS 809192..810553 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene nuoF CDS 810653..813376 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815941.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene nuoG CDS 813373..814353 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene nuoH CDS 814368..814910 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene nuoI CDS 814923..815468 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene nuoJ CDS 815468..815770 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene nuoK CDS 815767..817629 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene nuoL CDS 817649..819169 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene nuoM CDS 819176..820639 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210268.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene nuoN CDS complement(820698..821711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(821726..822934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 823467..823688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 824431..825753 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene menF CDS 826364..828037 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene menD CDS 828037..828801 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210246.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene menH CDS 828814..829671 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098093.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene menB CDS 829671..830642 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene menC CDS 830630..832042 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298357.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene menE CDS 832055..832201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 note possible pseudo, internal stop codon, frameshifted CDS 832381..832635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 note possible pseudo, internal stop codon, frameshifted CDS complement(832731..834179) product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175627974.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene katA CDS 834476..835021 product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(835167..836390) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221775.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene tyrP CDS 836817..838157 product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368823.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene dcuB CDS complement(838233..838496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(838499..839635) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene nrdB CDS complement(839647..841938) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene nrdA CDS complement(842273..842995) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 843393..845993 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene gyrA CDS 846591..848969 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene rcsC CDS complement(849044..849694) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210824.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene rcsB CDS complement(849696..852320) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815976.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene rcsD tRNA 852612..852699 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 852705..852780 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(852839..853123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 note possible pseudo, internal stop codon, frameshifted CDS complement(853781..854008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 855165..855428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 855855..856070 product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(856286..857593) product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene gltP CDS complement(858258..858926) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105278.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 859320..860558 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 860574..861344 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105454.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 861344..862150 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973421.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 862160..863764 product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105456.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 863751..865499 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105457.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(865880..866149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 866585..867127 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168228.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(867207..867803) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228419.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(867937..868713) product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211604.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(868715..869332) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene dmsB CDS complement(869344..871773) product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(872074..873336) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210192.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(874024..874599) product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 874993..875841 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(875862..876443) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(876662..878023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(878013..878690) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 878866..879111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(879377..879637) product DinI-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000618110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 879898..880431 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(880559..881119) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267085.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(881144..881821) product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 tRNA complement(882214..882290) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(882364..884082) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171465.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene yejM CDS complement(884104..884331) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208836.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 884564..885565 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815986.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene yejK CDS complement(885653..885934) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494192.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene rplY CDS complement(886500..888260) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 888488..889192 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208832.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene rsuA CDS 889219..890406 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208831.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 891090..891431 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171447.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(891535..892119) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene mepS CDS complement(892705..893322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(894120..894692) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815996.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene yeiP CDS complement(894821..896065) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815997.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene mtr CDS complement(896232..896669) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816000.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 896970..897905 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171387.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene fruK CDS complement(897944..898786) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171345.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene nfo CDS complement(898909..899988) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139344285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 900182..901045 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171339.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene yieE CDS 901282..902772 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161755.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 903450..904544 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 904541..905329 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161751.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 905848..907821 product colicin FY TonB-dependent receptor YuiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene yuiR CDS 908208..908423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 908413..909795 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 910408..912147 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene dld CDS complement(912289..913716) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene sbcB CDS 914226..914420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 914914..915075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 915072..916337 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703337.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 916840..917172 product PTS system regulator TmaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217522.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene tmaR CDS complement(917212..917838) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(918052..921330) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827413.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene rne CDS 921874..922833 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene rluC CDS complement(922958..923542) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 923685..924209 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene yceD CDS 924222..924392 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210931.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene rpmF CDS 924416..925456 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene plsX CDS 925460..926410 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 926429..927361 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210934.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene fabD CDS 927369..928103 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007236.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene fabG CDS 928259..928495 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene acpP CDS 928574..929824 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene fabF CDS 930169..930885 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816077.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene pabC CDS 930904..931932 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene mltG CDS 931934..932560 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene tmk CDS 932570..933562 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene holB CDS 933576..934367 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213084.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 934584..934934 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene hinT CDS 934945..935361 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 935361..935939 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene lpoB CDS 935926..936804 product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517652.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene thiK CDS 936882..937901 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene nagZ CDS 939277..940632 product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 940671..942290 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 942728..944032 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 944480..945082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(945473..946438) product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666006.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene rlmF CDS 947077..947235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 947433..947915 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090910.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(948219..951662) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene mfd CDS 951858..953060 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222341.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene lolC CDS 953053..953754 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene lolD CDS 953754..955001 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene lolE CDS complement(955142..955699) product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene cyaB assembly_gap 956566..957115 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 957185..957376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(957419..957697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 assembly_gap 957711..958321 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 959317..959910 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771200.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene ssuE CDS 959916..960695 product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene ssuC CDS 960692..961453 product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427335.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene ssuB CDS 961495..962658 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528162.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene ssuD CDS 962929..963876 product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550694.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(964225..965955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 966748..967980 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210920.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene pepT CDS complement(968357..969481) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(969568..971025) product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210918.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene phoQ CDS complement(971027..971701) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene phoP CDS complement(972356..973726) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene purB CDS complement(973747..974379) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene hflD CDS complement(974382..975485) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene mnmA CDS complement(975618..976067) product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene nudJ CDS complement(976060..976734) product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249410.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene rluE CDS 977560..978813 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene icd CDS 978976..980025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(980015..980290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(980981..981247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 981665..982249 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 982249..983190 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(983663..984496) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100923.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 984725..985015 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 tRNA 986341..986418 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(986736..987662) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209056.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 987886..989130 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649362.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 989169..990359 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001357669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene metC CDS complement(990535..991377) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(991568..993208) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367342.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 993763..994101 product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 994226..994645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(994809..995960) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849007.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 996323..996622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 note possible pseudo, internal stop codon CDS 997455..997832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(997956..998330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(998976..999212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 999849..1001306 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 1001499..1002425 product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene yddG CDS complement(1002544..1003359) product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209641.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene yidA CDS complement(1003731..1004114) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816156.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 1005155..1006537 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170536.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(1006622..1007143) product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene pagP CDS 1007130..1007348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 1007739..1008536 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene thiD CDS complement(1008696..1009745) product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365768.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene fbaB CDS complement(1009793..1010698) product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene yegS CDS complement(1011138..1012517) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene yegQ CDS complement(1012938..1013633) product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene baeR CDS complement(1013630..1015024) product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097903.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene baeS CDS complement(1015051..1018128) product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene mdtC CDS complement(1018128..1021250) product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(1021250..1022488) product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(1022762..1024117) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 1025206..1026168 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(1026165..1027100) product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene mdcH CDS complement(1027097..1027771) product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(1027866..1028870) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(1028984..1029790) product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099046.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene mdcE CDS complement(1029787..1030623) product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(1030616..1030930) product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene mdcC CDS complement(1030917..1031807) product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(1031807..1033468) product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene mdcA CDS complement(1033991..1035451) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815810.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene mgtE CDS complement(1035640..1037169) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072076535.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene ppx CDS complement(1037174..1039243) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209782.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene ppk1 CDS complement(1039299..1039886) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene speG CDS complement(1040139..1040774) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209778.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene purN CDS complement(1040774..1041814) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene purM CDS 1042048..1042674 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene upp CDS 1042739..1044040 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098238.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene uraA CDS 1044284..1044898 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208566.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene hda CDS complement(1045060..1045416) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208565.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene arsC CDS complement(1045429..1046892) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489659.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene bepA CDS 1047032..1048102 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 1048116..1048637 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 repeat_region 1048718..1050124 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcacctgcgtgaggtgcgac CDS complement(1050299..1050592) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene cas2 CDS complement(1050595..1051626) product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene cas1c CDS complement(1051623..1052249) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene cas4 CDS complement(1052253..1053122) product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene cas7c CDS complement(1053136..1055139) product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene cas8c CDS complement(1055136..1055840) product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene cas5c CDS complement(1055884..1058442) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922513.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 1058936..1059922 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(1060153..1060623) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene bcp CDS complement(1060638..1061195) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162088.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 1061470..1062378 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017534.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene dapA CDS 1062395..1063444 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208557.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene bamC CDS 1064396..1065109 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(1065244..1065888) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(1066172..1066966) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(1066950..1067795) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520421.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(1067786..1068490) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(1068493..1069074) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124315.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(1069111..1069551) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988707.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 1069980..1070864 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365467.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 1070881..1071174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 1071421..1071873 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172363.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 1071881..1073893 product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(1073874..1074065) product YpfN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 1074238..1074633 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(1074675..1075343) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(1075340..1076470) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene dapE CDS complement(1076485..1076856) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258241.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(1077243..1077863) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 1078313..1080592 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172316.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene maeB CDS 1080750..1081580 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012000798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1081717..1082514 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981091.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 1082535..1084700 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211088.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 1085065..1087320 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(1087502..1088884) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene xseA CDS 1088961..1090523 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172545.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene guaB CDS 1090738..1092315 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene guaA CDS 1092474..1092623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(1092855..1093793) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367316.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 1093855..1094838 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 1094835..1096022 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704940.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(1096763..1097032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 note possible pseudo, internal stop codon, frameshifted CDS 1098022..1098363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 1098812..1099549 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283643.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 1100419..1100604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 1100844..1101665 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143339.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene rlmA CDS complement(1101961..1102545) product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene mntP CDS complement(1102881..1103339) product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211066.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(1103430..1104281) product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(1104294..1105097) product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406926.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene manY CDS complement(1105185..1106156) product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170493.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene manX CDS complement(1106820..1108184) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene sdaA CDS complement(1108357..1108917) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096136.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(1108910..1110283) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855029.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene pabB CDS 1110543..1110809 product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1110989..1111354 product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene yebF CDS complement(1111452..1111682) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096102.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1112235..1112738 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene ftnA CDS 1112926..1113312 product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170441.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene yobA CDS 1113315..1114211 product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene copD CDS 1114254..1114601 product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(1114964..1115197) product DUF1480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164922.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(1115344..1117683) product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(1117658..1118446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 1119021..1119503 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 1119615..1120307 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431401.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene proQ CDS 1120327..1122369 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene prc CDS 1122813..1123694 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene htpX CDS 1124085..1124366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(1124803..1125024) product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211175.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 1125318..1126175 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225209.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1126365..1127567 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 1127706..1128038 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 1128063..1128380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(1128467..1128988) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene dsbB CDS complement(1129245..1130792) product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211689.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene nhaB CDS 1131015..1131731 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene fadR CDS 1132430..1133731 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211686.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 1133845..1134918 product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816439.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene dadX CDS 1135193..1135945 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(1136019..1136900) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1137307..1138302) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224141.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene gapA CDS 1138658..1139071 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211677.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene msrB CDS 1139190..1139492 product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(1139564..1140274) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654516.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(1140306..1141568) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(1141580..1142401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 1142707..1144890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(1144981..1146948) product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene fhuB CDS complement(1146938..1147870) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(1147861..1148643) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1148694..1150769) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478019.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1150975..1151631) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211676.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene pncA CDS complement(1151618..1152637) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366152.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene ansA CDS complement(1152964..1154820) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816426.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene sppA CDS 1155139..1155690 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166137.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1155705..1156745 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169286.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene selD CDS 1156749..1158677 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211670.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1159004..1159816) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211667.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene xthA CDS 1160244..1161152 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211665.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 tRNA complement(1161154..1161238) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(1161376..1162224) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166151.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene purU CDS complement(1162315..1162683) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210666.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1162925..1163935 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169304.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene rssB CDS 1164094..1165023 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene galU CDS complement(1165463..1165873) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169306.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene hns CDS 1166423..1167052 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(1168238..1170898) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210657.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene adhE CDS 1171321..1171965 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164160.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1172496..1174109 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079516.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 1174335..1175975 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene oppA CDS 1176469..1177389 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene oppB CDS 1177405..1178313 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164168.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene oppC CDS 1178325..1179314 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169311.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1179311..1180312 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096274.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene oppF CDS complement(1180393..1180725) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418542.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1180749..1182209) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210648.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene cls CDS 1182510..1182692 product YciY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309467.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1182809..1183549 product TonB system transport protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367050.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene tonB CDS complement(1183650..1184066) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210641.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene yciA CDS 1184596..1184790 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523495.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1184871..1185443) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1185668..1187389 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1187543..1188295) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1189062..1189700 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene ompW CDS complement(1190173..1190487) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1190726..1191532) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene trpA CDS complement(1191532..1192734) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076940213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene trpB CDS complement(1192912..1194273) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075568.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene trpCF CDS complement(1194275..1195276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 note possible pseudo, internal stop codon CDS complement(1195298..1195906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 note possible pseudo, internal stop codon CDS complement(1195906..1197480) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1197774..1198646 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098057497.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1198800..1199420 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816405.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1199561..1200478 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene rluB CDS 1201154..1202245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1202311..1202619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1202686..1203276) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210626.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene cobO CDS complement(1203282..1204046) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1204226..1205272 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816401.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene sohB CDS complement(1205364..1205612) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1205901..1208495 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816400.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene topA CDS 1209080..1210756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1210953..1211522 product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167260.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1211808..1213841) product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 1214298..1215272 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210621.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene cysB CDS 1215684..1218356 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816260.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene acnA CDS 1218849..1219304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1219366..1220352) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene hemB CDS complement(1220545..1221153) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene ribA CDS 1221350..1222072 product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816261.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene pgpB CDS 1222211..1222528 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876301.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1222535..1223704 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene lapB CDS 1223757..1224494 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027957.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene pyrF CDS 1224491..1224817 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene yciH CDS complement(1224875..1225093) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene osmB CDS complement(1225280..1227223) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169906.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1227332..1227973) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene nth CDS complement(1227989..1228705) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169892.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1228708..1229337) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene rsxG CDS complement(1229347..1230432) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene rsxD CDS complement(1230446..1230823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 assembly_gap 1230894..1231380 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1233157..1233783) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene rsxB CDS complement(1233783..1234364) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene rsxA CDS complement(1234452..1234892) product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210594.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1235010..1236053 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816290.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1236057..1236338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1236388..1237077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1237357..1238826 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(1238916..1239917) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene add CDS complement(1240042..1241688) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816295.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(1241801..1242976) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene manA CDS 1243157..1244554 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169824.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene fumC CDS complement(1244619..1245539) product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene tus CDS complement(1245680..1246243) product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(1246361..1247620) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816300.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 1247732..1248634 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816301.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1248736..1249944 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1250087..1250761 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138097372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene bioD CDS complement(1250813..1251046) product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165762.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1251073..1251441) product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1251522..1252271) product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078046.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene ydfG CDS 1252704..1253156 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1253242..1253556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 note possible pseudo, frameshifted CDS 1253627..1253755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1253752..1253976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1254335..1254955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1254856..1255986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1255988..1258456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1258449..1258907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1259116..1259313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1259400..1259966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1260362..1260718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 1260849..1261121 product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179111.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1261240..1261455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 note possible pseudo, internal stop codon, frameshifted CDS complement(1261594..1262052) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368396.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1262386..1262766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1262759..1263202) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1263306..1263641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1263690..1264268) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529959.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 1264513..1264749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 1264750..1265121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1265185..1266819) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1267001..1267513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(1267734..1268378) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975554.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1268722..1269234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1269435..1269854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1270287..1270556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 note possible pseudo, frameshifted CDS complement(1270550..1271041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 note possible pseudo, frameshifted CDS complement(1271086..1272027) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1272140..1273000 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970541.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1272997..1273935) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1274059..1274745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1274911..1275930 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098144.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1276021..1277037) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210909.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 assembly_gap 1277291..1278193 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1278428..1279441 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(1279873..1281762) product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene gss CDS 1282578..1284398 product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene atzF CDS 1284401..1288018 product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene uca CDS 1288031..1288732 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267779.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1288759..1290030 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene urtA CDS 1290091..1291656 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210793.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene urtB CDS 1291656..1292732 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene urtC CDS 1292725..1293516 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene urtD CDS 1293518..1294216 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene urtE CDS complement(1294325..1294618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1294921..1295811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1295808..1296350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1296347..1296892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(1297069..1298079) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 1298759..1299142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1299672..1299950 product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(1300085..1301017) product aromatic alcohol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1301163..1302059 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359197.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1302297..1302908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1303330..1303821 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1303939..1306095) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1306414..1306920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1306895..1307638) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764492.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1308129..1309442) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1310009..1310902) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1310964..1311818 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 1311815..1312111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1312202..1313401) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097617.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene mtnK CDS 1313536..1314573 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097616.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene mtnA CDS complement(1314632..1315174) product 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097614.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1315174..1315860) product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097613.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene mtnC CDS complement(1315857..1316471) product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097612.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1316878..1318380 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1318377..1319372 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367760.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1319389..1320453 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 1320466..1321710 product LVIVD repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097619.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1322081..1322668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1322689..1324032) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1324498..1325637 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190793.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 1326296..1327384 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704627.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene mnmH CDS complement(1328145..1329254) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162928777.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene ompF CDS complement(1330764..1331027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1331282..1331740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1331831..1333231) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261780.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1333612..1334619 product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1334704..1335363) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1335489..1336040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1336037..1337392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114398.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(1337400..1343657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(1343687..1344316) product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1344320..1346158) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1346358..1346828 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 1346919..1347344 product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118992.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1347736..1347978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1348138..1348578 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1348720..1349175) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158137.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1349285..1350187) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266617.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1350321..1351184 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1351184..1352053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(1352117..1353331) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 1353443..1354024 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1354137..1355162) product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1355440..1355706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 note possible pseudo, internal stop codon CDS complement(1355740..1356900) product type 3 secretion system effector OspC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene ospC1 note possible pseudo, internal stop codon CDS complement(1357139..1357336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1357414..1358271) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1358274..1359752) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095207.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1360036..1360461) product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065780.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene arsC CDS complement(1360472..1361761) product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene arsB CDS complement(1361817..1363574) product arsenite efflux transporter ATPase subunit ArsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817073.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene arsA CDS complement(1363588..1363953) product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene arsD CDS complement(1364001..1364336) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 1364954..1365307 product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078608513.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(1365425..1367482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1367479..1368648) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292758.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(1368641..1371199) product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1371268..1372377) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1372402..1376145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 1376535..1376918 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1376944..1377909 product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090528.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1378109..1378732 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552471.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1378818..1380956) product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481757.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1381628..1382353) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1382757..1384130) product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene phnY CDS complement(1384131..1385303) product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene aepY CDS complement(1385327..1386235) product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261863.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene aepX CDS 1386789..1387688 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(1387845..1388729) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098280.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(1388744..1389616) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098281.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1389619..1390242) product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene dmsB CDS complement(1390239..1392638) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1393426..1394583 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 1395188..1397629 product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211602.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 1397643..1398260 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211603.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene dmsB CDS 1398264..1398896 product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544919.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1399133..1400554) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388869.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1400653..1401438 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1402155..1403345 product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054206.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene ydeE CDS complement(1403425..1404831) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1404983..1405144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1405146..1405817) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704916.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene crp CDS complement(1405835..1407103) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073499.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(1407122..1408369) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1408762..1409946) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1410008..1410964 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811189.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 1411621..1412439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 1412445..1412963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 1413056..1414627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1414654..1417674 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1418497..1419837 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1419856..1420845 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816587.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(1420961..1422133) product cytotoxic necrotizing factor Rho-activating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077174694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1422760..1423095) product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478088.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene yqfB CDS complement(1423160..1423990) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene fghA CDS complement(1424081..1425199) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1425212..1425484) product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene frmR CDS 1425748..1426530 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947879.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1426574..1427173) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481530.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1427214..1427747) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477143.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1428206..1428976) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1429069..1429866 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene hisN CDS 1429896..1431053 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1431182..1432012) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1432504..1433505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1433509..1434282 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947879.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(1434384..1435487) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095807.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene ddlA CDS complement(1435690..1436181) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1436255..1437592) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1437726..1438601 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1438674..1439264) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531693.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1439422..1440621 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1440691..1441332) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457211.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene leuE CDS 1442006..1442707 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1442704..1443018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1443696..1444169 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1444334..1445236) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707466.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1445316..1446017) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365890.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(1446180..1447139) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391685.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene accA CDS complement(1447268..1447684) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1447779..1448318) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1448333..1449799) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169715.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1450413..1450955 product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1451007..1451582) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1452197..1452655) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206377.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1452763..1454238 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159678901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 1454429..1455010 product YebB family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024939.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1455094..1456320) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210868.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene alr CDS complement(1456964..1457311) product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367133.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene yajD CDS complement(1457715..1459196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 assembly_gap 1459458..1460558 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1460631..1462205) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979839.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene ahpF CDS complement(1462288..1462851) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene ahpC CDS complement(1463032..1464159) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368483.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1464163..1466919) product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704251.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene rbbA CDS complement(1466916..1467986) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361489.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1468338..1468814) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084777.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1469198..1470943 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1471243..1471401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1471448..1471990) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1472452..1473660) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221775.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene tyrP CDS complement(1473682..1475622) product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286400.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene tdc CDS complement(1476031..1477041) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 1477385..1478140 product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1478270..1479214 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene uspE CDS complement(1479632..1481023) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096868.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene pntB CDS complement(1481034..1482566) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene pntA CDS 1482951..1483901 product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene ydgH CDS 1484403..1485791 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366823.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1486790..1490680) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072088404.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene hrpA CDS 1490993..1491442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 note possible pseudo, internal stop codon, frameshifted CDS complement(1491569..1491895) product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1491892..1492098) product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160956.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1492109..1494697) product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981411.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1495055..1496053 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 1496066..1496506 product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene hslJ CDS complement(1496715..1497353) product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene grxB CDS complement(1497602..1498009) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246697.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1498129..1498281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1498752..1499846 product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367104.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene chaA CDS complement(1500228..1500740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1501689..1502579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 note possible pseudo, frameshifted CDS complement(1502570..1502761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 note possible pseudo, frameshifted CDS complement(1503004..1504422) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1505250..1505693) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1505665..1506036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1506832..1507275) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1507296..1507952) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211740.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(1507973..1509061) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298239.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1509108..1509380) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096146.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1509510..1510229 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene minC CDS 1510253..1511068 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene minD CDS 1511072..1511350 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211180.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene minE CDS complement(1512044..1513168) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211181.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene rnd CDS complement(1513256..1514944) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene fadD CDS complement(1515417..1516013) product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096141.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1516431..1517126) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene tsaB CDS complement(1517250..1519097) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1519417..1519764 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211186.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(1519866..1520198) product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene mdtI CDS complement(1520201..1520617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1521649..1522497 product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene pdxK CDS complement(1522851..1524326) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene zwf CDS 1524734..1525579 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 assembly_gap 1525828..1526198 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1526285..1527727 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211193.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene pyk CDS complement(1527824..1528255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1528438..1529400) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene lpxM CDS complement(1529509..1530855) product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228437.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene mepM CDS complement(1530875..1531759) product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene znuA CDS 1531911..1532678 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene znuC CDS 1532671..1533456 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096087.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene znuB CDS complement(1533611..1534621) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705957.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene ruvB CDS complement(1534638..1535255) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816524.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene ruvA CDS complement(1535328..1535849) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene ruvC CDS complement(1536070..1536813) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165984.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1536844..1537275) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075476.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene nudB CDS complement(1537286..1539058) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene aspS CDS 1539590..1539994 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026141403.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 1540278..1540676 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1540808..1541563 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene cmoA CDS 1541560..1542531 product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211208.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene cmoB CDS complement(1542585..1543346) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169161.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene cutC CDS complement(1543525..1544079) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169160.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 1544415..1546145 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816530.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene argS CDS 1546948..1547967 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene tauA CDS 1547978..1548748 product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene tauC CDS 1548748..1549554 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 1549557..1550291 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1550564..1550776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1551363..1551668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 1551815..1553092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 note possible pseudo, frameshifted CDS 1553199..1554194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1554631..1556130) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene murJ CDS complement(1556349..1556714) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 1556838..1557368 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896302.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1557743..1558330) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene rimJ CDS 1558565..1559716 product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816537.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene mdtH CDS 1559993..1560553 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211218.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1560690..1561235) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1561435..1562376) product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161303.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene ghrA tRNA 1562695..1562784 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(1563082..1564566) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1565212..1566606 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1566658..1567572 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816202.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1567990..1568625 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209770.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1568622..1570388 product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 1570558..1571895 product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209766.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1571895..1572302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209765.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1572542..1574230 product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene dauA assembly_gap 1574535..1575162 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1575337..1576239) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1576252..1577094) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene kdsA CDS complement(1577151..1577960) product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211233.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene sirB1 CDS complement(1577976..1578818) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096234.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene prmC CDS complement(1578818..1579900) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161322.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene prfA CDS complement(1579932..1581194) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene hemA CDS 1581172..1581357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 1581894..1582556 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816542.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene lolB CDS 1582553..1583431 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene ispE CDS 1583499..1584446 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211240.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene prs CDS complement(1585052..1585324) product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161340.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene ychH CDS 1585668..1586258 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218168.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene pth CDS 1586380..1587471 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene ychF CDS complement(1587733..1589031) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1589024..1591300) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114258.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1591297..1591770) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1592385..1593464) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207030.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 1593590..1594456 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058660535.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1594727..1595566) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene yghU CDS complement(1595694..1595867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 note possible pseudo, internal stop codon, frameshifted CDS complement(1596060..1596305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 note possible pseudo, internal stop codon CDS 1596633..1598762 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815510.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 1598781..1599917 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1600167..1601540) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096453.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene dbpA CDS 1601769..1602314 product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1602325..1602726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(1602861..1603634) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079692.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1603744..1604685 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1605071..1605637) product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene ves CDS complement(1605732..1607156) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1607405..1608742 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1608732..1609742 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169023.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene cydB CDS 1609699..1609878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1610047..1610886 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1611214..1611870 product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169066.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene zinT CDS complement(1611950..1612735) product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367231.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene phoH CDS complement(1613263..1614255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1614781..1615245) product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(1615242..1616054) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166994.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 1616673..1617305 product efflux system transcriptional repressor NalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene nalC CDS complement(1617309..1617713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 1617967..1618260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1618805..1619242) product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276167.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene uspG CDS complement(1619436..1619774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884122.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1620099..1620527) product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene uspG CDS 1621113..1622720 product cholesterol oxidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113002.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1623149..1623583) product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(1623700..1624593) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023517656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1625017..1625757) product YaeF family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1626635..1627654) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210302.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1627665..1629221) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098255.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1629279..1630256) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098256.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 1630677..1631369 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1631886..1632128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1633149..1633886) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1634004..1634999) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 1635080..1635649 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090406.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 note possible pseudo, frameshifted CDS 1635859..1636068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1636537..1637451 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene ttcA CDS complement(1638011..1638994) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169583.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene zntB CDS complement(1639475..1641097) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1641712..1642215 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene tpx CDS complement(1642266..1642640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(1643078..1644637) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169566.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene tyrR CDS complement(1644876..1645934) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1645931..1647328) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1647458..1647640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1647749..1648105) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096405.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene pspC CDS complement(1648105..1648335) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274953.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene pspB CDS complement(1648424..1649095) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene pspA CDS 1649348..1650343 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298101.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene pspF CDS 1650909..1652528 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816365.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene sapA CDS 1652525..1653490 product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene sapB CDS 1653477..1654367 product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210971.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene sapC CDS 1654367..1655362 product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210970.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene sapD CDS 1655362..1656165 product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene sapF CDS 1656316..1657104 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366239.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene fabI CDS complement(1657175..1658041) product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1658186..1658998) product IS982-like element ISSod20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 1659458..1660063 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene gstA CDS 1660442..1661431 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367132.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 1661472..1661984 product outer membrane lipoprotein Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene blc CDS complement(1662255..1663118) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene pdxY CDS complement(1663230..1664504) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene tyrS CDS complement(1664663..1665319) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210959.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene pdxH CDS complement(1665324..1666472) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene anmK CDS 1667005..1667472 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210956.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1667957..1668391) product virulence master transcriptional regulator RovA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210955.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene rovA CDS complement(1669047..1669292) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798795.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 1669459..1669866 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene gloA CDS 1670114..1670755 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169454.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene rnt CDS complement(1670869..1671216) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1672334..1673359 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165644.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene purR CDS complement(1673361..1674266) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene punR CDS 1674390..1675613 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210941.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene punC CDS 1675978..1677120 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene cfa CDS 1677574..1678326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 1678356..1678628 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1678799..1679455) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 1679738..1681111 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816381.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 tRNA 1681270..1681346 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 assembly_gap 1681369..1681815 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 1681842..1681918 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 1682330..1683742 product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816382.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene pykF CDS 1684137..1684373 product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227902.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(1684935..1686014) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165628.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1686231..1686647) product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816383.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene sufE CDS complement(1686974..1688212) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211805.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene sufS CDS complement(1688220..1689524) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene sufD CDS complement(1689499..1690245) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene sufC CDS complement(1690289..1691788) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene sufB CDS complement(1691805..1692173) product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene sufA CDS complement(1692545..1692961) product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene menI CDS complement(1692958..1696014) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1696283..1697398 product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169418.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene ydiK CDS complement(1698239..1700614) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211813.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene ppsA CDS 1700880..1701740 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1702043..1703092 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 1703433..1703618 product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene hemP CDS 1703800..1704024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1704256..1706241 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 1706268..1707317 product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209061.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1707678..1708499 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 1708496..1709497 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209059.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 1709502..1710278 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 1711030..1711401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(1711501..1712517) product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1712592..1713080) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1713293..1713700) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene arnF CDS complement(1713697..1714044) product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211820.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene arnE CDS complement(1714041..1715699) product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211821.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene arnT CDS complement(1715707..1716600) product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169389.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene arnD CDS complement(1716600..1718582) product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211823.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene arnA CDS complement(1718582..1719574) product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816394.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene arnC CDS complement(1719574..1720719) product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816395.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene arnB CDS complement(1720844..1721629) product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050983.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene btuD CDS complement(1721620..1722621) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816398.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene btuC CDS complement(1722991..1723287) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211830.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene ihfA CDS complement(1723292..1725679) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097002.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene pheT CDS complement(1725694..1726677) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161570.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene pheS CDS 1726755..1726952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1727015..1727371) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211833.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene rplT CDS complement(1727415..1727627) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211834.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene rpmI CDS complement(1727707..1728186) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106936.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene infC CDS complement(1728608..1729039) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene infC CDS complement(1729151..1731079) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene thrS CDS complement(1731586..1731759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1731927..1732376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1732482..1732910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1733039..1733563) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706248.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(1733626..1734042) product FosA/FosA2 family fosfomycin resistance glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418600.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene fosA CDS 1734682..1735395 product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(1735392..1736039) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1736332..1737243 product iron/manganese ABC transporter substrate-binding protein YfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene yfeA CDS 1737245..1738135 product iron/manganese ABC transporter ATP-binding protein YfeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170112.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene yfeB CDS 1738132..1739022 product iron/manganese ABC transporter permease subunit YfeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene yfeC CDS 1739015..1739881 product iron/manganese ABC transporter permease subunit YfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211845.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene yfeD CDS complement(1740346..1742634) product acid resistance putative oxidoreductase YdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726696.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene ydeP CDS 1743086..1743955 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211846.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(1743996..1744535) product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211847.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1745118..1745783 product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816215.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene hxpB CDS 1745975..1746550 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1746739..1748130 product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010696.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene tcyP CDS 1748680..1749555 product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1750547..1750933 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079506.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 1751247..1751963 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208011.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1751952..1752833) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1752948..1753952) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130415.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1754375..1754698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1754967..1755155 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1755248..1755568) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1755571..1756227) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703937.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 1756310..1756870 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1756957..1758141) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1758211..1759446) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(1759454..1760677) product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356229.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1760780..1760971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1761598..1762890) product RbtT/DalT/CsbX family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706077.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1762991..1764460) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706072.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene xylB CDS complement(1764473..1765861) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1766064..1766993 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 1767350..1767808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1768016..1768432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 1768488..1769279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1769344..1769760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1769773..1770114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(1770380..1770760) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene crcB CDS complement(1771027..1772349) product citrate/malate transporter CimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene cimH CDS complement(1772749..1773375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1773302..1773520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 1773735..1774637 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815123.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1774620..1775582) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209407.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(1775748..1776401) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267780.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene dhaL CDS complement(1776413..1777414) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228229.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(1777427..1778698) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1778795..1779907) product erythritol/L-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209403.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 1780230..1780682 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene rpiB CDS 1780713..1780934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1781188..1781949) product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209404.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 1782984..1783637 product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene fetA CDS 1783647..1784423 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene fetB CDS complement(1784493..1785524) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706074.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1785781..1786509 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365771.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 1786540..1788168 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706076.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1788326..1788715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 1790038..1790328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(1790459..1791493) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 1791729..1792172 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 1792192..1792479 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 1792491..1793747 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1793844..1794656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 1794686..1794892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1795293..1795775) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 1796517..1797116 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene nqrE CDS complement(1797934..1798674) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 1798797..1799210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 note possible pseudo, frameshifted CDS 1799258..1799683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 note possible pseudo, frameshifted CDS complement(1799765..1801051) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114420.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(1801402..1801752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1802356..1802784) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070734.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1802787..1803245) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070733.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 1803345..1804268 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1804373..1805167) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114411.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene map CDS complement(1805160..1805366) product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945919.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 1805963..1806388 product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene uspF CDS 1806852..1807166 product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004151769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 assembly_gap 1808015..1808773 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1809097..1809309) product cold shock protein CspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163087.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene cspG CDS complement(1809746..1810501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1810549..1813548) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206009.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1813567..1814916) product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(1815100..1815849) product transferrin-binding protein-like solute binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 1816799..1817164 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647571.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(1817226..1818308) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1818337..1819686) product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573503.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1819698..1820060) product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816883.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1820079..1820975) product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006973.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1820968..1822206) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1822199..1823371) product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815770.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1823446..1823805) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(1823830..1824822) product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254807.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene yhfZ CDS complement(1825102..1825857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209912.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1826296..1826796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(1827462..1827653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 tRNA complement(1828297..1828383) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(1828490..1828576) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(1828584..1828657) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(1828682..1828757) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(1828911..1829462) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene pgsA CDS complement(1829517..1831349) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene uvrC CDS complement(1831343..1832002) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene uvrY CDS complement(1832335..1833567) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211633.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene pepT CDS complement(1833954..1834370) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705335.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene psiE CDS complement(1834608..1835012) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1835081..1835344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1835542..1838319) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 1839130..1840053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 1840205..1841188 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704437.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene glpX CDS 1841482..1841964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1842123..1842908 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1842967..1844436) product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366858.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene dtpA CDS 1845719..1846765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1846914..1847597) product two-component response regulator DpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene dpiA CDS complement(1847590..1849080) product sensor histidine kinase DpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene dpiB CDS 1849597..1850673 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467705.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene citC CDS 1850670..1850966 product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700679.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene citD CDS 1850966..1851862 product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene citE CDS 1851873..1853399 product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene citF CDS 1853404..1853949 product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550422.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene citX CDS 1853930..1854844 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062473.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene citG CDS 1855091..1856524 product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368319.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1856753..1857808 product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704356.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(1857924..1859060) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1859057..1859668) product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097134.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1860337..1861653) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083499.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1862512..1863603 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705363.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1863680..1864000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1864226..1864534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 note possible pseudo, internal stop codon CDS complement(1864544..1865098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 note possible pseudo, internal stop codon CDS complement(1865395..1866867) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218844.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 1867658..1868005 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095256.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene cutA CDS complement(1868614..1870290) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220180.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene betA CDS complement(1870330..1871808) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene betB CDS complement(1871838..1872419) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene betI CDS 1872751..1874685 product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002430091.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1874744..1875106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1875540..1876325) product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460804.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene kdgR CDS 1876554..1877525 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1877509..1878126 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(1878476..1879213) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160341.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(1879451..1880572) product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211152.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 1880913..1882340 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816592.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene fliD CDS 1882346..1882744 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene fliS CDS 1882734..1883123 product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene fliT CDS complement(1883164..1883667) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072489.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene def CDS complement(1884368..1884544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(1884926..1885237) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene fliE CDS 1885476..1887158 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704955.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene fliF CDS 1887161..1888150 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160381.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene fliG CDS 1888143..1888874 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene fliH CDS 1888871..1890235 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene fliI CDS 1890246..1890689 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367295.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene fliJ CDS 1890690..1892045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 1892209..1892691 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367297.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene fliL CDS 1892697..1893704 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160396.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene fliM CDS 1893697..1894113 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene fliN CDS 1894115..1894561 product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704951.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene fliO CDS 1894574..1895317 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene fliP CDS 1895868..1896137 product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene fliQ CDS 1896140..1896919 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168816.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene fliR repeat_region 1897057..1897565 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctatgcggcagtgaac CDS 1898140..1898835 product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene entD CDS complement(1898997..1899563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1899586..1900380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(1900397..1902292) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706745.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1902933..1903781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 repeat_region 1904031..1904778 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctatgcggcagtgaac CDS complement(1904909..1905550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1905559..1906590) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene csy3 CDS complement(1906594..1907559) product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene csy2 CDS complement(1907556..1908827) product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene csy1 CDS complement(1909101..1912586) product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene cas3f CDS complement(1912583..1913503) product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene cas1f CDS complement(1914039..1914233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1914706..1915629) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1915622..1916155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 repeat_region 1916341..1917330 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctgtgtggcagtgaac CDS complement(1917720..1918655) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981404.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene flgL CDS complement(1918684..1920324) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene flgK CDS complement(1920468..1921436) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene flgJ CDS complement(1921436..1922539) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1922581..1923312) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367324.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene flgH CDS complement(1923421..1924203) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene flgG CDS complement(1924223..1924978) product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704934.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(1924994..1926214) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367327.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene flgE CDS complement(1926245..1927063) product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811889.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1927076..1927480) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene flgC CDS complement(1927486..1927899) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene flgB CDS 1928151..1928807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1929145..1929456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 1929458..1929898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1930482..1932578) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704931.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene flhA CDS complement(1932571..1933722) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene flhB CDS complement(1935026..1935664) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene cheZ CDS complement(1935689..1936081) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210873.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene cheY CDS complement(1936121..1937188) product protein-glutamate methylesterase/protein glutamine deamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene cheB CDS complement(1937201..1938025) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080859.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene cheR CDS complement(1938394..1939959) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816617.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1940069..1941670) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367342.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1942123..1942620) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367343.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene cheW CDS complement(1942652..1944700) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene cheA CDS complement(1944944..1945804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1945812..1946699) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene motA CDS complement(1946798..1947388) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367347.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene flhC CDS complement(1947388..1947735) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene flhD CDS 1949619..1950047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211610.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1950187..1952310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1952343..1953050) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174866.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1953327..1954877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1954896..1957481) product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097537.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene mngB CDS complement(1957580..1958695) product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722978.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1958682..1959002) product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1959026..1959469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1959761..1959910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1960654..1962057 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174531811.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene cycA CDS complement(1962138..1963622) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene putP CDS 1964126..1968109 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene putA CDS complement(1968447..1968959) product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene fliZ CDS complement(1969803..1970006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 1970728..1971039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1971488..1974190) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050122726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene mgtA CDS complement(1974345..1975043) product MgtC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075347.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1975449..1975652) product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210892.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene dsrB CDS complement(1975759..1975971) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210893.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene cspE CDS 1976443..1976961 product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 tRNA 1977083..1977158 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(1977655..1978431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1978468..1978953) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(1979046..1980056) product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708646.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene fimH CDS complement(1980074..1982710) product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1982751..1983455) product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene fimC CDS complement(1983491..1984033) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1984120..1984680) product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095930.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene fimA CDS complement(1984804..1985094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 tRNA 1986319..1986394 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 1986623..1986698 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 1986885..1987934 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene pyrC CDS 1988138..1988392 product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157914.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene bssS CDS 1988640..1989233 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1989620..1990666) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097157.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 1991146..1991688 product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1991679..1992701 product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1992987..1996070) product tetrathionate reductase subunit TtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816071.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene ttrA CDS complement(1996063..1997091) product tetrathionate reductase subunit TtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149765.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene ttrC CDS complement(1997091..1997828) product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269830.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene ttrB CDS 1998192..1999892 product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene ttrS CDS complement(1999825..2000061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 2000124..2000720 product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083413.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene ttrR CDS 2000988..2001932 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 2001997..2003217 product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene mdtG CDS 2003711..2005243 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 2005516..2006310 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 2006519..2006923 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092635.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(2007350..2007517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 2007761..2008327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 2008702..2009139 product universal stress protein UspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene uspF CDS complement(2009546..2010799) product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene agp CDS complement(2011182..2012192) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene gap CDS complement(2012272..2013249) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096169.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 2013499..2013942 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094870.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 2013954..2014223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 note possible pseudo, internal stop codon CDS complement(2014508..2014966) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368396.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(2015193..2015873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(2016035..2016331) product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene lsrG CDS complement(2016335..2017216) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene lsrF CDS complement(2017265..2018284) product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene lsrB CDS complement(2018313..2019329) product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene lsrD CDS complement(2019316..2020332) product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661592.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene lsrC CDS complement(2020326..2021900) product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene lsrA CDS 2022202..2023155 product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815489.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene lsrR CDS 2023270..2024865 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042661593.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene lsrK CDS complement(2025111..2025764) product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene fdnI CDS complement(2025757..2026644) product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240581.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene fdnH CDS complement(2026656..2029703) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154231912.1 transl_table 11 codon_start 1 transl_except (pos:2029116..2029118,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_17430 gene fdnG CDS complement(2030487..2030750) product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072932.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 2031111..2031647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(2031733..2032821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(2032917..2033939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(2033966..2034901) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115801845.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 2035075..2035347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(2035298..2035963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(2036212..2036877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(2036870..2037577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(2037593..2038639) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277848.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(2038651..2039865) product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367826.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(2039862..2042114) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095703.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 assembly_gap 2042130..2042693 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2043002..2044138) product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838077.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(2044159..2044464) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(2044493..2045062) product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704571.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(2045157..2045828) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302777.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 note possible pseudo, frameshifted CDS complement(2045847..2046215) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene acpS CDS complement(2046290..2048815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(2049202..2050209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(2050223..2052181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(2052218..2054281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(2054495..2055646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(2055659..2056627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(2056624..2057271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(2057279..2057812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(2057830..2058498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211517.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(2058517..2060805) product TcfC E-set like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(2060853..2061404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 2061898..2062242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(2062561..2063160) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(2063418..2063666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 2064139..2065056 product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 2066281..2067411 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267549.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 2067435..2068865 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(2069673..2070680) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000740092.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene msrP CDS complement(2071067..2071957) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 2072191..2073207 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(2073331..2074689) product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(2074686..2075357) product response regulator transcription factor HprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001395354.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene hprR CDS 2075727..2076119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 note possible pseudo, frameshifted CDS 2076172..2076396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 note possible pseudo, frameshifted CDS complement(2077448..2079193) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(2079497..2080216) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(2080213..2080947) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene urtD CDS complement(2080940..2082022) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083027.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(2082032..2082916) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene urtB CDS complement(2083135..2084379) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267505.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene urtA CDS complement(2085284..2086045) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene tam CDS 2086414..2086749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 2086703..2087506 product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene dkgB CDS complement(2087540..2088436) product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648592.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene yafC CDS 2088816..2089370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 2089374..2089574 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921103.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 2090023..2090379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(2090977..2091882) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(2091882..2092616) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704607.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 2092945..2093643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(2094021..2095361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(2095371..2096528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(2096533..2099277) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(2099355..2100173) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703410.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(2100196..2100927) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(2100946..2101530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(2101544..2102137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(2102153..2102731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(2102715..2103425) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(2103516..2104040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(2104262..2104618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 2105474..2106115 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275459.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 2106377..2106751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 2107325..2107546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 tRNA complement(2107720..2107807) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 2107990..2108319 product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene tusE CDS complement(2108377..2108658) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene yccX CDS 2108893..2109213 product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160102.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene hspQ CDS complement(2109287..2109700) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 2109816..2110274 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene mgsA CDS complement(2110316..2112370) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816055.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene helD CDS 2112493..2114661 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816054.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene yccS CDS complement(2115162..2115764) product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213064.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 2115997..2116518 product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213065.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene sulA CDS 2116874..2117947 product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005047463.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene ompA CDS complement(2118238..2118702) product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367432.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene matP CDS 2119223..2120959 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 2121044..2121562 product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160035.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene fabA CDS complement(2121742..2121912) product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene rmf CDS complement(2122226..2122783) product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene pqiC CDS complement(2122783..2124432) product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050078426.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene pqiB CDS complement(2124429..2125703) product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017889.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene pqiA CDS complement(2125740..2127647) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816049.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(2127662..2129770) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene rlmKL CDS 2129869..2130984 product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(2131080..2131625) product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816046.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(2132183..2133193) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211296.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene pyrD CDS 2133676..2133807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(2133974..2136592) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene pepN CDS 2137423..2138637 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene pncB CDS 2139214..2140614 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159985.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene asnS CDS 2141150..2142247 product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162928777.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene ompF CDS 2142623..2143813 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816042.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(2144004..2144651) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170954.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(2144691..2145239) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(2145561..2147288) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene ldtD CDS complement(2147940..2148653) product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724436.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene aphA CDS complement(2149427..2153872) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170968.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene mukB CDS complement(2153869..2154597) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene mukE CDS complement(2154578..2155903) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene mukF CDS complement(2155900..2156688) product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene cmoM CDS 2156981..2157808 product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816039.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene elyC CDS complement(2157946..2158689) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097299.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene kdsB CDS complement(2158695..2158874) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2159018..2159233) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211317.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(2159619..2160524) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170991.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene lpxK CDS complement(2160614..2162359) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene msbA CDS complement(2162395..2164476) product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 2164537..2164764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 assembly_gap 2165031..2165341 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2165528..2165815) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004100704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene ihfB CDS complement(2165871..2167544) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene rpsA CDS complement(2167721..2168404) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene cmk CDS complement(2168608..2169882) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene aroA CDS complement(2169987..2171075) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171026.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene serC CDS complement(2171356..2172990) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049438.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene pgm CDS complement(2173047..2173589) product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene seqA CDS 2173904..2174686 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene ybfF CDS 2175032..2177119 product RTX toxin T1SS ABC transporter subunit RtxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560561.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene rtxB CDS 2177137..2178465 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625978.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 2178469..2180577 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097339.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 2180745..2181038 product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602226.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene ybfE CDS 2181193..2181720 product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215386.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene fldA CDS 2181892..2182341 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131702.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene fur CDS 2183350..2183856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(2184399..2185823) product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 2186413..2187855 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(2188020..2189063) product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171031.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene ansB CDS 2189257..2191011 product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816035.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 2191356..2192222 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211331.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene focA CDS 2192262..2194565 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene pflB CDS 2194769..2195509 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171041.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene pflA CDS complement(2195889..2196164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 2196350..2196832 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 2197399..2198232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 2198726..2199115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 2199133..2199615 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 2199661..2200404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 2200421..2201278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 2201465..2202505 product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384594.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 2202505..2203068 product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene hxlB CDS complement(2203127..2205859) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989569.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(2206324..2207613) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162747.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene serS CDS complement(2208032..2209375) product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067740.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene rarA CDS complement(2209385..2210005) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene lolA CDS complement(2210210..2214007) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171070.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(2214496..2214990) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene lrp CDS 2215535..2216497 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene trxB CDS 2217610..2219376 product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816031.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene cydD CDS 2219376..2221121 product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene cydC CDS 2221130..2221834 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816030.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene aat CDS 2221972..2222190 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene infA CDS complement(2222266..2224551) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162786.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene clpA CDS complement(2224711..2225031) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene clpS CDS 2225360..2225668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(2225776..2226708) product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391755.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2226825..2227574) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086029.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(2227571..2228416) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2228427..2229773) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814314.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(2230061..2232004) product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene macB CDS complement(2232006..2233076) product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079890.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene macA CDS complement(2233208..2234872) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 2235323..2236222 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211358.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 2236365..2237840 product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816021.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 2238037..2238675 product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene artP CDS 2238711..2239454 product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097361.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene artJ CDS 2239467..2240207 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001693.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene artQ CDS 2240204..2240872 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene artM CDS 2241212..2241340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 2241350..2241958 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151738075.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2242029..2243162) product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene rlmC CDS complement(2243174..2243671) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162876.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(2243793..2244122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 2244404..2244667 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495513.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 2245306..2247363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 2247783..2248391 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301859.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene ybjG CDS 2249375..2250691 product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450473.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene sdaC CDS 2250815..2252182 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816009.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(2252557..2254008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2254275..2255480) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 2255641..2256264 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208781.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(2256265..2257092) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 2257616..2258515 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene hisG CDS 2258518..2259837 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene hisD CDS 2259841..2260911 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211894.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene hisC CDS 2260933..2262000 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene hisB CDS 2262000..2262593 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene hisH CDS 2262599..2263336 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211891.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene hisA CDS 2263318..2264094 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880182.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene hisF CDS 2264088..2264699 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene hisIE CDS complement(2264905..2265528) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2266086..2266877) product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704731.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(2266887..2267534) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2267547..2268851) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660710.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(2269442..2270428) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(2270616..2272790) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268707.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 2273422..2273916 product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 2274012..2274254 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096686.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2274397..2275026) product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078533.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(2275165..2276352) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816438.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(2276753..2277511) product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833679.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene uxuR CDS complement(2277946..2279364) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene uxaC CDS complement(2279378..2280844) product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(2280984..2282168) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene uxuA CDS 2282663..2283841 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033613.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(2284165..2285571) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene gndA CDS 2285815..2287389 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168322.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2287472..2289082) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817398.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(2289710..2291557) product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene asmA CDS complement(2292090..2292671) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene dcd CDS complement(2292721..2293365) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene udk CDS complement(2293814..2294773) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957652.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene htpX CDS complement(2294849..2295409) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020842.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(2295692..2296804) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene apbC CDS 2297236..2299263 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene metG CDS 2299419..2299898 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816723.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 2299892..2300587 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162334.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 2301286..2302173 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene cdd CDS complement(2302249..2302509) product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2302770..2303768 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601775.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2303771..2304457 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096946.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 2304521..2305345 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645414.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 assembly_gap 2305425..2305892 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2306127..2307824 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168296.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 2308163..2309038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(2309164..2310012) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208514.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(2310028..2311392) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361665.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2311475..2312392) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369100.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene murQ CDS complement(2312581..2313273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 2313258..2313470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(2313648..2316893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2317786..2318493 product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene sanA CDS complement(2318529..2319695) product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440926.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene yeiB CDS complement(2319702..2320361) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene folE CDS complement(2320574..2321743) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816744.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 2321987..2323228 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene moeA CDS 2323228..2323986 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene moeB CDS 2324165..2324500 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095115.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(2324694..2326292) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367567.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2326473..2326958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 note possible pseudo, internal stop codon CDS complement(2327684..2327872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(2328019..2328552) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 2328962..2329849 product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213809.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene rhtA CDS 2330268..2330771 product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100805.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene dps CDS complement(2330917..2331246) product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2331338..2333467) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816769.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene dinG CDS 2333899..2334738 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210799.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene sseA CDS complement(2334852..2335100) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158887.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2335295..2336245) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264861.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene dusC CDS complement(2336245..2337600) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007058.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene rhlE CDS 2337913..2338599 product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168102.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene cecR CDS 2338681..2339676 product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704812.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene hlyD CDS 2339686..2341428 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168099.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 2341425..2342564 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 2342577..2343683 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2343815..2344522) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2344769..2345221) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene moaE CDS complement(2345224..2345469) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168089.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene moaD CDS complement(2345466..2345945) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene moaC CDS complement(2345973..2346953) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210771.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene moaA CDS complement(2347406..2348134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 2348470..2349378 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene yvcK CDS complement(2349513..2349953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2350066..2352084) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816794.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene uvrB CDS complement(2352468..2352647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2352796..2353470) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216554.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene bioD CDS complement(2353463..2354248) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210764.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene bioC CDS complement(2354229..2355383) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene bioF CDS complement(2355383..2356420) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097502.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene bioB CDS 2356513..2357784 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210761.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene bioA CDS complement(2357855..2358841) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816799.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene pgl CDS 2359385..2360203 product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816800.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(2360351..2361070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(2361211..2362035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2363234..2364301) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210758.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene modC CDS complement(2364303..2364998) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158971.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene modB CDS complement(2365011..2365781) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene modA CDS complement(2366007..2366156) product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2366487..2367278 product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168058.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene modE CDS 2367873..2369351 product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816802.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene modF CDS 2369583..2370410 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2370605..2371357 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159006.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene gpmA CDS complement(2371454..2372008) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098813.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 2372219..2373220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 assembly_gap 2373368..2373749 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2374231..2375286) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704774.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene aroG CDS complement(2375656..2376378) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168038.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene pnuC CDS complement(2376583..2377629) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210741.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene nadA CDS 2377975..2378850 product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947862.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(2378967..2379713) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705781.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 assembly_gap 2380254..2381026 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(2381038..2381113) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(2381441..2381516) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(2381705..2382475) product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165506.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene cpoB CDS complement(2382498..2382995) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene pal CDS complement(2383039..2384331) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165502.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene tolB CDS complement(2384474..2385640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2385674..2386096) product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393306.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene tolR CDS complement(2386114..2386797) product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene tolQ CDS complement(2386785..2387189) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210734.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene ybgC CDS complement(2387742..2388881) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene cydB CDS complement(2388896..2390464) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene cydA CDS complement(2391195..2392067) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene sucD CDS complement(2392067..2393233) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210728.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene sucC CDS complement(2393365..2394582) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704768.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene odhB CDS complement(2394598..2397405) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210726.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene sucA CDS complement(2397709..2398425) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2398461..2400227) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168015.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene sdhA CDS complement(2400228..2400572) product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210723.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene sdhD CDS complement(2400566..2400955) product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001539490.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene sdhC CDS 2401717..2403003 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210721.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2403072..2403836) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705836.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 2403940..2405073 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2405147..2405890) product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(2406241..2406450) product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167995.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 2406969..2408672 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816819.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene kdpA CDS 2408686..2410749 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene kdpB CDS 2410760..2411350 product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816821.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene kdpC CDS 2411437..2414160 product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209649.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene kdpD CDS 2414132..2414815 product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025470747.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene kdpE CDS 2415458..2416855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2416852..2417355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 2417558..2417725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 2417722..2418213 product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 2418311..2418811 product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 2419159..2419650 product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 2419760..2420251 product DUF6392 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098592.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 assembly_gap 2420390..2420888 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2420950..2422626) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210354.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene glnS CDS 2422972..2423181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(2423662..2424564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(2424757..2425830) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(2425823..2427595) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208545.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(2427670..2428755) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208546.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2429274..2430089) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206823.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(2430438..2432468) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene nagE CDS 2432965..2433771 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464933.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene nagB CDS 2433837..2435000 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene nagA CDS 2435012..2436235 product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051352.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 tRNA 2436775..2436851 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 2436859..2436943 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 2436972..2437046 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 2437081..2437155 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 2437222..2437298 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 2437305..2437389 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 2437418..2437492 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 2437973..2439325 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119617.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 assembly_gap 2439383..2440529 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2440627..2441814) product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210347.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene ubiF CDS 2442252..2443637 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167929.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene miaB CDS 2443652..2444722 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210345.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 2444723..2445190 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene ybeY CDS 2445261..2446145 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158416.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene corC CDS 2446145..2447686 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367717.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene lnt CDS 2448836..2449039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 note possible pseudo, internal stop codon, frameshifted CDS complement(2449135..2450061) product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2450058..2451080) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 2451228..2451944 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(2452017..2452517) product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907521.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2452525..2453253) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707457.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(2453250..2455307) product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815918.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(2455355..2455750) product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118904.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 2456238..2457131 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167919.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 2457245..2457985 product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020944.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene gltJ CDS 2457987..2458667 product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167916.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene gltK CDS 2458664..2459389 product glutamate/aspartate ABC transporter ATP-binding protein GltL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631369.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene gltL CDS 2459947..2462529 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210333.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene leuS CDS 2462542..2463081 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210332.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene lptE CDS 2463081..2464115 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210331.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene holA CDS 2464105..2464761 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene nadD CDS complement(2464758..2465474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 2465862..2466179 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167894.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene rsfS CDS 2466182..2466652 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene rlmH CDS 2466730..2468574 product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167891.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene mrdA CDS 2468579..2469691 product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210325.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene mrdB CDS 2469704..2470687 product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene rlpA CDS 2470812..2472023 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene dacA CDS 2472127..2472390 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210322.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene ybeD CDS 2473130..2473366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 2473400..2474206 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene lipB CDS 2474331..2475296 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004712243.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene lipA CDS complement(2475517..2475726) product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210315.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene cspE CDS complement(2475943..2476401) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2476693..2476920 product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815707.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2476930..2477343 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098420.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene nrdI CDS 2477354..2479486 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212212.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene nrdE CDS 2479500..2480471 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212211.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene nrdF CDS 2481187..2482389 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene proV CDS 2482379..2483557 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815703.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene proW CDS 2483957..2484988 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215933.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene proX CDS 2485948..2487147 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298533.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 2487765..2488289 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167476.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene mprA CDS 2488510..2489691 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208745.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene emrA CDS 2489706..2491244 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816951.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene emrB CDS complement(2491436..2491978) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208449.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 2492062..2492598 product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368844.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 assembly_gap 2492933..2493203 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2493865..2495100) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(2495140..2495922) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207439.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(2495922..2496245) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207438.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 2496352..2497254 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207437.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 2498050..2498385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(2498454..2498990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989686.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2499465..2500511) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167464.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 2500940..2501503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 2501823..2504468 product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816953.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 2504619..2505977 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene pssA CDS 2506046..2506393 product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816956.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2506532..2507173) product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702308.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 sequence2 source 1..771910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 59..135 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 144..219 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(1816..2655) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212020.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene hdfR CDS 2773..3111 product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene maoP CDS complement(3193..4722) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815318.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 5428..7074 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815319.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene ilvG CDS 7071..7340 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene ilvM CDS 7353..8279 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212015.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 8345..10195 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene ilvD CDS 10198..11772 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176085.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene ilvA CDS complement(11764..12660) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176081.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene ilvY CDS 12835..14310 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176079.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene ilvC CDS 15221..17242 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176228.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene rep CDS complement(17297..18802) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032900842.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene ppx CDS complement(18814..20100) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228177.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene rhlB CDS 20218..20544 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280776.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene trxA CDS 21252..22511 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene rho CDS 23357..24442 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211988.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene wecA CDS 24474..25532 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080212.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene wzzE CDS 25633..26763 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176215.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene wecB CDS 26760..28022 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815329.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene wecC CDS 28019..29086 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848110.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene rffG CDS 29096..29977 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211983.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene rfbA CDS 29955..30695 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848112.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene rffC CDS 30682..31812 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176203.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene rffA CDS 31812..33062 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176202.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene wzxE CDS 33059..34141 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815333.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 34138..35493 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815334.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene wzyE CDS 35503..36240 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176198.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene wecG CDS 36610..37998 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 tRNA 38155..38231 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 38313..38388 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 38406..38491 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 38522..38598 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 assembly_gap 39148..40039 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(41460..42653) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene hemY CDS complement(42656..43876) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene hemX CDS complement(43880..44635) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883127.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene hemD CDS complement(44632..45576) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602475.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene hemC CDS complement(46065..46301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 46319..48907 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211468.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(48933..49250) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999925.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene cyaY CDS complement(49359..49541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 49706..49915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 49958..50146 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099260.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 50168..50992 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176172.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene dapF CDS 51020..51724 product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211472.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 51700..52635 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815341.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene xerC CDS 52635..53351 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815342.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene yigB CDS 53422..55584 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383406.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene uvrD CDS 55850..56434 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454888.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(56668..57276) product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602103.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene prfH CDS complement(57276..58412) product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528894.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(58687..60408) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815882.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(60689..62041) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815881.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(63383..64273) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211481.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene rarD CDS complement(64690..65160) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176136.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 65327..66220 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211483.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene pldA CDS 66351..68177 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene recQ CDS 68194..69189 product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene pldB CDS 69203..70012 product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211488.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene yigL CDS 70398..71186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(71346..71675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(71751..75092) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080723.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene mscM CDS complement(75241..76158) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209141.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene asd CDS complement(76474..77526) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815419.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene rsgA CDS 77643..78185 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095280.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene orn tRNA 78550..78625 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 78666..78741 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 78781..78856 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(79690..80847) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815421.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene queG CDS 81170..81634 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene tsaE CDS 81649..82938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 82951..84909 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815425.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene mutL CDS 84902..85843 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704169.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene miaA CDS 85950..86243 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051875.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene hfq CDS 86342..87622 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209152.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene hflX CDS 87710..88915 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312504.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene hflK CDS 88918..89919 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156425.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene hflC CDS 90190..91488 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006178975.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(91585..92787) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004147504.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 93401..93823 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217229.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene nsrR CDS 93866..96388 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene rnr CDS 96455..97192 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209161.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene rlmB CDS 97360..97755 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210153.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene rpsF CDS 97764..98081 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene priB CDS 98086..98313 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene rpsR CDS 98352..98801 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175476.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene rplI CDS complement(98932..99540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 99772..100392 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311330.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene fklB CDS 100522..101262 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628026.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene cysQ CDS complement(101429..102922) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083116.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene mqo CDS complement(102932..103321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083117.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(104031..104624) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706131.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(104817..105221) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731552.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 105400..106062 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369657.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene qseB CDS 106059..107405 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673402.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene qseC CDS complement(107633..107782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 note possible pseudo, internal stop codon CDS complement(108014..108193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 108500..108706 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(108921..110288) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815438.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(110437..111078) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210165.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene msrA CDS 111212..112954 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695507.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 112951..116721 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154295113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 116779..117069 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(117256..117786) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055079.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene ppa CDS complement(117997..119004) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216946.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene fbp CDS 120070..121413 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210171.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene mpl CDS complement(121560..122030) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389210.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene argR CDS 122494..123432 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369475.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene mdh CDS complement(123549..123821) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210175.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 124335..124691 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 124813..125175 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(126004..126975) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175409.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene ispB CDS 127323..127631 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210178.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene rplU CDS 127651..127908 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene rpmA CDS 128037..129212 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369510.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene cgtA CDS complement(129601..131049) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene dacB CDS 131319..131795 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148008.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene greA CDS complement(131915..132208) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210185.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene yhbY CDS 132344..132973 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175402.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene rlmE CDS 133022..135004 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369514.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene ftsH CDS 135076..135924 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764750.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene folP CDS 135917..137254 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210189.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene glmM CDS 137518..137856 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene secG tRNA 137954..138043 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 138103..138179 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 138384..138836 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300397.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene rimP CDS 138860..140368 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156278.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene nusA CDS 140392..143124 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223151.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene infB CDS 143265..143675 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209255.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene rbfA CDS 143675..144628 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209256.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene truB CDS 144746..145015 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene rpsO CDS 145281..147419 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001348313.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene pnp CDS 147501..148418 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156264.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene nlpI CDS 148589..150550 product DEAD/DEAH family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815447.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(150654..150983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(151141..151515) product YjaA family stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368803.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(151657..152373) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097930.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene btsR CDS complement(152437..154122) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272839.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 154362..155333 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091837.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 155345..156490 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098671.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 156490..157635 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113108.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 158020..159156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 159319..159726 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547734.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(159957..160832) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175357.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(160846..161841) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815453.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 162684..163208 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815454.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 163202..163705 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175351.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(163678..163989) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156248.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 164286..164537 product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816266.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 164848..165297 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080672.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(165294..165758) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695488.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene nrdG CDS complement(165763..167901) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209296.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene nrdD CDS 169467..169808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(169901..170287) product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298042.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene ridA CDS complement(170512..170976) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392342.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene pyrI CDS complement(170990..171925) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene pyrB CDS complement(172576..173601) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene argF CDS 173764..174180 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175286.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene rraB CDS complement(174233..174724) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815474.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(174960..177854) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815475.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(177868..178317) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209309.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 assembly_gap 178562..178997 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(179617..181128) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209310.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene pepA CDS 181532..182629 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166255.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene lptF CDS 182629..183705 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223173.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene lptG CDS complement(183789..184205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(184562..185797) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228026.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene ampH tRNA 186222..186306 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 186629..187246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 note possible pseudo, frameshifted CDS 187330..187878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 note possible pseudo, frameshifted CDS complement(187979..189952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943012.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(190024..191496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 191772..193379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(193492..194217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(194603..195049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(195682..196425) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(196478..197812) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972506.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(198102..198794) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(198814..200532) product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528172.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(201225..202112) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530571.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 202239..203162 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 204059..204583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 204639..205364 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706189.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 205321..207654 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706190.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 207645..208595 product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556779.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 208757..209341 product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207980.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(209415..210767) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469664.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene yegD CDS complement(211036..212427) product phosphoglycerate transporter PgtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955756.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene pgtP CDS 212988..214259 product phosphoglycerate transport regulator PgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467983.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene pgtC CDS 214256..216265 product two-component system sensor histidine kinase PgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678500.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene pgtB CDS 216255..217502 product two-component system response regulator PgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930841.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene pgtA CDS 218001..219200 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171600.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 219694..220662 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209581.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 220747..221628 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209582.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 221615..222598 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209583.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 222600..223355 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157194.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(223517..224008) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(224132..225553) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(227067..227714) product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085655.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 227865..229424 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804536.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 229520..230467 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969282.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 230464..232263 product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 232263..233057 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975339.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 233085..233855 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969279.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 233860..234912 product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389740.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(234994..236298) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206689.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 236686..236916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 236922..237290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(237541..238584) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108754.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(238601..239431) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981721.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(239428..240225) product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899623.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(240267..240740) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(240752..241183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(241379..242230) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549941.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 242905..245349 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850260.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene dmsA CDS 245361..245978 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209428.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene dmsB CDS 245980..246828 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097315.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 247050..247664 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209430.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene dmsD CDS complement(247868..247999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(248054..248362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 note possible pseudo, internal stop codon CDS 248367..248516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 249187..250458 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298440.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 250672..251421 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653653.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 251691..252707 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705178.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(253016..254005) product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304427.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 255204..255368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 255605..256174 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209597.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 256255..258750 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060676.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 258763..259488 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209596.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 259502..260053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 260069..261034 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209595.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(261312..262964) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174815.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 263853..264962 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531604.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene potA CDS 264949..265812 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene potB CDS 265809..266594 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580313.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene potC CDS 266854..267903 product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759329.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene potD CDS complement(267975..268532) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201269.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(269234..269497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 269873..270490 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209430.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene dmsD CDS complement(270551..270907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(270924..271748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095781.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(271770..272303) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167315.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(272300..272791) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167314.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(272803..273348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(273341..273922) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095779.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(273936..274688) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018304.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(274714..277401) product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(277422..277967) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095776.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(278050..278574) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163272.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 279245..279802 product tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(280814..281314) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(281442..282776) product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817224.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(282823..283908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817225.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(284035..285900) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298585.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(286511..287665) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528678.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(287658..288212) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104932.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(288256..289023) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(289020..289853) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(289850..290926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 291380..291964 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088483.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(292074..292814) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703700.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene ugpQ CDS complement(292811..293881) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703701.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(293885..294730) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099125.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene ugpE CDS complement(294727..295614) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099302.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene ugpA CDS complement(295723..297036) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624747.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene ugpB CDS 297888..298856 product multidrug transporter subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene mdtN CDS 298843..300711 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210377.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 300717..302186 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214220.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(302237..303256) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976508.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(303684..304985) product cytosine/isoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602187.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene codA CDS complement(304978..306225) product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076249.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene codB CDS 306956..309226 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817173.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene hypF CDS 309795..310913 product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145410.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene hybO CDS 310916..311905 product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene hybA CDS 311889..313076 product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017694.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene hybB CDS 313073..314776 product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706347.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene hybC CDS 314776..315273 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221953.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 315263..315754 product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134017.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene hybE CDS 315747..316088 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene hypA CDS 316210..317271 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817176.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene hypB CDS 317262..317558 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334896.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene hybG CDS 317542..318654 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817174.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene hypD CDS 318655..319680 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077175158.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene hypE CDS 319862..321448 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815714.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 321448..322416 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212223.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 322413..323225 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172993.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 323219..323995 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172992.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 323992..324600 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212226.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(324651..325385) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029304386.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 325494..326312 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045790855.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 326631..328778 product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300547.1 transl_table 11 codon_start 1 transl_except (pos:327048..327050,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_24210 gene fdhF CDS 329603..330952 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686687.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene tssK CDS 330949..331608 product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710992.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene tssL CDS 331658..334015 product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 334027..334485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 assembly_gap 335931..336296 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 336634..337398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 337395..338117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 338156..338530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 338725..339036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 339133..339462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 339475..340041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 assembly_gap 341484..341958 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 342032..343018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 343002..343457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 343655..344461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 344543..344854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 344941..345768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 345882..346160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS 346426..346824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 346837..347100 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226101.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 347102..348322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 348315..351698 product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211936.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 351771..353540 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342476.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene tssF CDS 353504..354586 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373315.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene tssG CDS 354633..355154 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484008.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene tssJ CDS 355159..357492 product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 357495..358322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 358322..358834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS 358991..359503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 359496..359630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 359743..360258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 360251..360385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 360510..361022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 361015..362931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 362987..363457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(363746..365338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 366009..366557 product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078791.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene hydN CDS 366567..366908 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173942.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene hypA CDS 366945..367217 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334887.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene hybG CDS complement(367303..367782) product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene hycI CDS complement(367779..368195) product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816734.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(368188..368970) product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298699.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(368967..369518) product hydrogenase 4 subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816732.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene hyfH CDS complement(369533..371266) product hydrogenase 4 catalytic subunit HyfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102329.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene hyfG CDS complement(371268..372863) product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122519.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene hyfF CDS complement(372868..373518) product hydrogenase 4 membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene hyfE CDS complement(373530..374972) product hydrogenase 4 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168281.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(374985..375935) product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168282.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(375947..377962) product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816729.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene hyfB CDS complement(377964..378581) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816728.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(379235..379978) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(379980..381302) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046695208.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(381311..383851) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032466356.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(383859..384581) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211998.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(384639..385193) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(386059..387252) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046052024.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(387318..388913) product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816293.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene malX CDS 389111..390139 product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169835.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene malI CDS complement(390210..391094) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705966.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 391196..392182 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261333.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 392481..393104 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175761.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene dsbA CDS complement(393747..394847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(394919..395452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(395452..395985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(395978..396409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(396440..397171) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071881865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(397200..399725) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034162516.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(399795..400373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(400599..401150) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172454863.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(401520..401741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(401851..402117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(403009..403668) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(403661..404677) product virulence-associated ABC transporter ATP-binding protein SfbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569655.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene sfbB CDS complement(404739..405575) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 406264..407838 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527970.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(407993..409162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(409159..409755) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084923.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 tRNA complement(410163..410238) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(410364..410942) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209117.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 411383..412969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 413002..419187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 419651..420769 product glycerate 3-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene glxK CDS complement(420859..422181) product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961957.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene dcuA CDS complement(422340..423764) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175569.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene aspA CDS 424297..424812 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368667.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene fxsA CDS 424972..425265 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209127.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 425317..426960 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene groL CDS 427510..427854 product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209129.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(427899..428927) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095264.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene epmB CDS 428972..429538 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene efp CDS complement(429648..429845) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097627.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(430681..432774) product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043134.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene cstA CDS complement(433119..433778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 note possible pseudo, frameshifted CDS 434287..434601 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228124.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene sugE CDS 434925..435422 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 435425..436372 product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390126.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 436509..439160 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209485.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(439542..439757) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815758.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 439952..440086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 440133..440720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 440775..441956 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674099.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 442097..443281 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674099.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 443361..444137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 444167..444943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 445144..446331 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186941.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 446552..447328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(447669..448733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(449390..449743) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209134.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene frdD CDS complement(449759..450154) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175556.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene frdC CDS complement(450169..450903) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175554.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(450896..452692) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815417.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene frdA CDS complement(452668..452865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 453494..454471 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209139.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene epmA CDS complement(454887..455963) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076852.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene glpQ CDS complement(456192..457547) product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365615.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene glpT CDS 457985..459640 product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene glpA CDS 459630..460925 product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176408.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene glpB CDS 460922..462115 product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050076855.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene glpC CDS 462369..462887 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106219.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(462937..463560) product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene dhaL CDS complement(463607..464677) product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050075779.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene dhaK CDS complement(465024..465692) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815353.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 465862..466116 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215973.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene tusA CDS complement(466504..466701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(466808..467716) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816232.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(467988..470381) product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211497.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(470521..471153) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176373.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 471488..471838 product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815355.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(471840..472127) product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369314.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(472117..472728) product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211502.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene rsmD assembly_gap 473400..474147 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 474277..475338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 475345..476010 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211504.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene ftsE CDS 476003..476980 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211505.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene ftsX CDS 477187..478062 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163942.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene rpoH CDS complement(478262..478648) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095668.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(478653..479057) product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211507.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene panM CDS 479560..480669 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163937.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 480883..481809 product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211509.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene livH CDS 481806..483089 product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176352.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 483086..483865 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369325.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene livG CDS 483865..484566 product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene livF CDS complement(484763..484972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(485545..485952) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833187.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene hiuH CDS 486694..488361 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462647.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 488510..489694 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 489691..490830 product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene acdA CDS 491231..492673 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114462.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 492932..493687 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 493703..494653 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 494665..496347 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(496484..497200) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169053.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene hutC CDS complement(497623..498909) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183081.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 499741..501144 product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167041.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene tnaA CDS complement(501698..501994) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210061.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene fis CDS complement(502019..502813) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369451.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene dusB CDS complement(503300..504184) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817286.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene prmA CDS complement(504297..505757) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene panF CDS complement(505747..505989) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210066.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(506487..506843) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703889.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(507105..508451) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817284.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene accC CDS complement(508464..508928) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene accB CDS complement(509157..509612) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174343.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene aroQ CDS complement(509844..510827) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210074.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 511553..512596 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228205.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene mreB CDS 512945..513913 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802540.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene mreC CDS 513954..514442 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163138.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene mreD CDS 514478..515065 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210078.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 515062..516531 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210079.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene rng CDS 516552..520346 product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817280.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene yhdP CDS 520346..521203 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817279.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 521209..522654 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174328.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene tldD CDS 522681..523163 product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050128.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 523175..523471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(523932..524927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(525002..525331) product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(525328..525561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(525763..526308) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166270.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene yjgA CDS 526527..527900 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene pmbA CDS 528207..528788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 note possible pseudo, internal stop codon CDS 528819..529163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 note possible pseudo, internal stop codon CDS complement(529260..529670) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210103.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene rnk CDS complement(530116..530388) product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162489.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene npr CDS complement(530388..531239) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369491.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene rapZ CDS complement(531537..532016) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098944.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene ptsN CDS complement(532189..532476) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004125711.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene hpf CDS complement(532499..533944) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174257.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene rpoN CDS complement(533989..534714) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392029.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene lptB CDS complement(534720..535268) product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162470.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene lptA CDS complement(535252..535845) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174254.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene lptC CDS complement(535861..536421) product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174251.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene kdsC CDS complement(536437..537417) product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817263.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene kdsD CDS 538117..538920 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032898349.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene mlaF CDS 538927..539709 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174247.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene mlaE CDS 539713..540210 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210123.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene mlaD CDS 540246..540872 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174244.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene mlaC CDS 540877..541167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 541305..541559 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162441.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene ibaG CDS 541609..542871 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098931.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene murA CDS 543488..544042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(544297..545334) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210128.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene degS CDS complement(545582..546976) product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 gene degQ CDS complement(547333..547737) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162428.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene zapG CDS 548113..549246 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817257.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene zapE CDS 549528..549956 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004710905.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene rplM CDS 549972..550364 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 gene rpsI CDS 551138..551779 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene sspA CDS 551782..552279 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216203.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene sspB CDS complement(552633..554048) product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210138.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(554059..558522) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077010.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene gltB CDS 559616..561961 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210142.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene arcB CDS 562195..562845 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210143.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene elbB CDS 562905..563579 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098946.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene mtgA CDS complement(563640..564215) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene dolP CDS complement(564225..564815) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene diaA CDS complement(564836..565219) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210147.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(565269..567023) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817253.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 567084..567944 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210149.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene rsmI CDS complement(568027..569154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(569151..569414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(569427..569795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 assembly_gap 569868..570614 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 571055..571903 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(572191..573978) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269337.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(573978..576707) product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061709398.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(577305..577544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 578658..579917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 580115..580408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 580411..580671 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212003.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 580754..580915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 580918..581181 product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768134.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(581524..582264) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095353.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(582266..583378) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174293.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(583362..584501) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095351.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(584527..585177) product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095350.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(585180..585971) product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392358.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(585999..586295) product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421477.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(586295..586660) product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368576.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(586679..587017) product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174305.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(587583..589520) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 589979..590755 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112421.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(591064..591765) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174207.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 592046..592942 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369566.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(593558..593953) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391987.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(594191..594490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(594477..594881) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174200.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(594887..595192) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098866.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(595469..596137) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210414.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 596753..597712 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817241.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 597985..599238 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174187.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene sstT CDS complement(599339..601360) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817236.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 601611..602207 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967669.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 tRNA 602381..602457 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 602796..604148 product P-loop NTPase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945911.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(605188..605688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 note possible pseudo, internal stop codon, frameshifted CDS 606526..606750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 607085..607384 product acid-activated periplasmic chaperone HdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032161.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene hdeB CDS complement(608023..608823) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216318.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 609018..610346 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082692.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 610351..610737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206343.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(610877..611791) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038489.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 611913..613406 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391926.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 613429..614034 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967273.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 614805..615236 product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 615267..615827 product sugar dehydrogenase complex small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 615820..617427 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815792.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 617424..619034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(619497..621350) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210359.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene rpoD CDS complement(621536..623281) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817223.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene dnaG CDS complement(623397..623612) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene rpsU CDS 623940..624974 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene tsaD CDS complement(625364..626896) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098826.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(627132..627788) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217581.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene plsY CDS 627900..628262 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene folB CDS complement(628309..629538) product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene cca CDS complement(629549..630166) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174130.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS 630428..631390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 631400..634249 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817220.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene glnE CDS 634362..635792 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817219.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene hldE CDS complement(635925..636410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 636927..637580 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817217.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene ribB CDS 637752..638537 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene ygiD CDS complement(638717..640162) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031772.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(640537..641697) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160795.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(641704..642408) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174105.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(643227..644609) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098744.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene tolC CDS 644964..645602 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369649.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene nudF CDS 645711..646550 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817215.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene cpdA CDS 646550..647131 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077091.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene yqiA CDS 647388..649283 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817213.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene parE CDS 649323..651581 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene parC CDS 651639..652373 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098722.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene plsC CDS 653184..654596 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098721.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene ftsP CDS complement(654663..655277) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166992.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 655451..655954 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368294.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene folA CDS complement(656126..656953) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210492.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene apaH CDS complement(656956..657333) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368292.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene apaG CDS complement(657355..658164) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704372.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene rsmA CDS complement(658161..659156) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167004.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene pdxA CDS complement(659137..660456) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167006.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene surA CDS complement(660604..662973) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815546.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene lptD CDS 663152..663967 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200595.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene djlA CDS complement(664174..664827) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095545.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene rluA CDS complement(665179..668085) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167013.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene rapA CDS complement(668467..670818) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815549.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(671027..671731) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051608.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene thiQ CDS complement(671724..673328) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214276.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene thiP CDS complement(673304..674308) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026017959.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene thiB CDS 674637..675170 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene rppH CDS 675175..677421 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816985.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene ptsP CDS 677496..678395 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816984.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene lgt CDS 678456..679307 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648113.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 679709..680194 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 680188..680793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 680790..681233 product YgdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211629.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 681230..681607 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816980.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 681585..684959 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211627.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene recC CDS 684979..687876 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816978.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene ptrA CDS 687873..691481 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816977.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene recB CDS 691484..693343 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215834.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene recD CDS 693396..693965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(694099..695442) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173274.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene argA CDS 695945..697195 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173271.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene amiC tRNA complement(697406..697482) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(697513..697589) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(697622..697698) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 697927..699033 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228046.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene mltA CDS 699048..699866 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098539.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene tcdA CDS complement(699891..700352) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212115.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene csdE CDS complement(700362..701570) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212116.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene csdA CDS 702178..703119 product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044409.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene gcvA CDS 703146..703541 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173250.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS 703534..704631 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816972.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene rlmM CDS complement(704810..705565) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420510.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene xni CDS complement(705597..706964) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene ppnN CDS complement(707022..707867) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173240.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene queF CDS 708221..708781 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212123.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene syd CDS complement(709194..710096) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695394.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 710476..719607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(719979..721166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478138.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 721731..722066 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173236.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 722035..722832 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212125.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene truC CDS 723024..723476 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807735.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(723545..723931) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212127.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(724322..725146) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene dapD CDS complement(725250..727769) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173232.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene glnD CDS complement(728330..729127) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266399.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene map CDS 729735..730460 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221800.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene rpsB CDS 730605..731456 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212132.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene tsf CDS 731755..732483 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164053.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene pyrH CDS 732592..733149 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212134.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene frr CDS 733397..734596 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene ispC CDS 734777..735529 product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173219.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene ispU CDS 735542..736405 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173216.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene cdsA CDS 736420..737772 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816967.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene rseP CDS 737813..740227 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212139.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene bamA CDS 740318..740812 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816966.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene skp CDS 740816..741853 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173181.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene lpxD CDS 741985..742437 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173178.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene fabZ CDS 742439..743236 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene lpxA CDS 743290..744444 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212144.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene lpxB CDS 744444..745043 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173174.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene rnhB CDS 745049..748531 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228634.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene dnaE CDS 748544..749503 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391685.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene accA CDS 749718..751070 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene tilS CDS complement(751142..751405) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene rof CDS 751797..752453 product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228043.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene nlpE CDS 752826..753146 product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412169.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene chbB CDS 753395..754753 product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097022.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene chbC CDS 754799..755140 product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366185.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene chbA CDS 755157..756020 product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097020.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene chbR CDS 756212..757564 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078722.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene celF CDS 757619..758383 product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442732.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene chbG CDS complement(758528..759646) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532874.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(759643..761022) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110692.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(761247..762749) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266562.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(762762..764093) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206845.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 764192..765088 product HTH-type transcriptional activator BauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083805.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene bauR CDS complement(765477..767204) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260683.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene proS CDS complement(767326..768045) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene tsaA CDS complement(768053..768457) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816957.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene rcsF CDS complement(768584..769405) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene metQ CDS complement(769465..770118) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(770111..771142) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173141.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene metN CDS 771314..771880 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173139.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene gmhB sequence3 source 1..454908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 575..2164 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210692.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene purH CDS 2181..3464 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175672.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene purD CDS complement(3973..4596) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355296.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(4686..4958) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445246.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene hupA CDS complement(5158..5745) product DUF416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166074.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(5820..6491) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217884.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene nfi CDS complement(6590..7654) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095015.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene hemE CDS complement(7753..8550) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166081.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 gene nudC CDS 9254..10306 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479781.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 10395..11162 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479833.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 11149..12054 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263895.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 12041..12859 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479788.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 12859..13875 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479814.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 13909..14571 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263898.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 15232..17181 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298956.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene thiC CDS 17165..17803 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849921.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene thiE CDS 17865..18623 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815387.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 18611..18811 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166243.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene thiS CDS 18814..19581 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815385.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 19581..20702 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210678.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene thiH CDS 20983..21519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(21651..22952) product uracil/xanthine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484506.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(23540..27760) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene rpoC CDS complement(27875..31903) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263103.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene rpoB CDS complement(32251..32616) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028878.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene rplL CDS complement(32677..33174) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095001.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene rplJ CDS complement(33509..34210) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene rplA CDS complement(34214..34642) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503452.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene rplK CDS complement(34800..35345) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287516.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene nusG CDS complement(35346..35732) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210670.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene secE assembly_gap 36168..37118 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(37265..39391) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124703.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene fusA CDS complement(39475..39945) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861706.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene rpsG CDS complement(40042..40416) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212323.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene rpsL CDS complement(40552..40839) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212322.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene tusB CDS complement(40860..41219) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817321.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene tusC CDS complement(41228..41629) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212320.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene tusD CDS complement(41626..42330) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212319.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(42737..43489) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369412.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene fkpA CDS 43835..44056 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212317.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(44121..44717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(44805..45008) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099038.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(45020..46825) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212314.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene kefB CDS complement(46825..47379) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081510.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene kefG CDS 47498..47674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 47716..49653 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174650.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(49719..51983) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978640.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene adiA CDS complement(52095..52955) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817227.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 53189..54100 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704387.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene murQ CDS 54212..55600 product PTS N-acetylmuramic acid transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703855.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene murP CDS complement(55646..56251) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174663.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 56348..57331 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174664.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 57328..57546 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 57607..58473 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212300.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(58547..58951) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391459.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 59257..59889 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene crp CDS complement(60321..61535) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174672.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(61666..62241) product aminodeoxychorismate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174674.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(62649..63809) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704755.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene nagA CDS complement(63875..64729) product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423588.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(64739..65173) product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098891.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene agaF CDS complement(65185..66078) product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369553.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene agaE CDS complement(66068..66850) product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369554.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene agaW CDS complement(66861..67343) product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336162.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 gene agaV CDS complement(67358..68512) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263815.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(68509..69804) product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 gene kbaZ CDS complement(70001..70774) product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene agaR CDS complement(71220..71792) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817336.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene ppiA CDS 72630..73937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 note possible pseudo, frameshifted CDS 73978..74325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 note possible pseudo, frameshifted CDS 74620..75237 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213160.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene yihA CDS complement(75781..76119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 note possible pseudo, frameshifted CDS complement(76256..76546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 note possible pseudo, frameshifted CDS 76817..77845 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094979.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(77930..78913) product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817452.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene ghrB CDS complement(78926..80206) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369218.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(80216..81208) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094977.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(81213..81962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703772.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(82351..82635) product YrhB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634159.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 assembly_gap 82787..82949 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(82983..85775) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene polA CDS complement(86163..86786) product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213168.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene dsbA CDS complement(86819..87814) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175762.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(87818..88090) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213170.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 88330..88911 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213171.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene mobA CDS 88914..89435 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175770.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene mobB CDS complement(90016..91440) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262043.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(91443..92309) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004121002.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(92302..92973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(92963..94084) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364967.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(94667..96019) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209534.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 gene gorA CDS complement(96384..97226) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703746.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 97600..98001 product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298591.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 98289..99284 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157374.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene yhjD CDS complement(99804..100865) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705345.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 101038..102027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(102072..103574) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209550.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(103743..104441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(104798..105802) product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161597821.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(105799..106779) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174903.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene dppD CDS complement(106792..107694) product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174904.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene dppC CDS complement(107706..108725) product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938843.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene dppB CDS complement(108903..110513) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817398.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(111060..112688) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206788.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 tRNA complement(113333..113409) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(113623..115692) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209623.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene glyS CDS complement(115702..116610) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209624.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 gene glyQ CDS 116812..117375 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438953.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene tag CDS 117638..118837 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228155.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(119046..120704) product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175115.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 121246..121494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(122080..123390) product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 123535..124149 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176012.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(124195..125913) product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215674.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene ligB CDS 126305..126928 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene gmk CDS 126986..127261 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene rpoZ CDS 127281..129398 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176016.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene spoT CDS 129416..130129 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165889.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene trmH CDS 130140..132221 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176019.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene recG CDS complement(132325..133539) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209005.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene gltS CDS 133774..135156 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815268.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 135423..137213 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766661.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(137287..138210) product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165039.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene fabY CDS complement(138233..138670) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560975.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 gene dtd CDS complement(138733..139347) product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175743.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene yihX CDS complement(139441..140361) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 140710..142035 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 142028..143476 product p-aminobenzoyl-glutamate hydrolase subunit AbgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156451.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene abgB CDS 143564..145093 product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062978.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene abgT CDS complement(145163..146986) product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572064.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene typA CDS 147407..148066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(148138..148611) product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298726.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene yiaA CDS 149043..150452 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213150.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene glnA CDS 150628..151677 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175750.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene glnL CDS 151687..153132 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175753.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene glnG CDS 153825..154349 product long polar fimbria major subunit LpfA-O113 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827814.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 154542..155210 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096968.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 155235..157733 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096967.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 157745..158719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 158729..159241 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369865.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 159252..159749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 159828..160091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 160160..160444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(160510..161394) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972737.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 161578..162720 product class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925876.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene ampC CDS complement(162765..164138) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815259.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 gene hemN CDS complement(164672..165196) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene yihI CDS complement(165399..166733) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161126.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(166947..167705) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817468.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(167706..168458) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817469.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(168625..169455) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175154.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(169847..170569) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817472.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene phoU CDS complement(170583..171359) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215562.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene pstB CDS complement(171397..172278) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215560.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene pstA CDS complement(172280..173092) product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215558.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene pstC CDS complement(173346..174389) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215557.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene pstS CDS complement(175093..175908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(176164..177420) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389558.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(177794..178786) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(178912..179673) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene fabG CDS complement(179697..181250) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529478.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(181504..182061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(182205..182999) product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869899.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(183918..184730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 184954..185556 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707037.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(185781..186338) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106176.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(186469..186675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(186697..187233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 note possible pseudo, internal stop codon CDS complement(187741..189075) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253696.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 gene envZ CDS complement(189072..189791) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene ompR CDS complement(189917..190402) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208915.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene greB CDS 190707..193037 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817360.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 193636..193878 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208918.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene feoA CDS 193933..196254 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174749.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene feoB CDS 196266..196499 product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(196540..197319) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817359.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene bioH CDS 197449..198036 product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817358.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene gntX CDS 198126..198704 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene nfuA CDS 198935..199258 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208928.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene glpE CDS 199275..200120 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174723.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene glpG CDS 200148..200906 product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 201233..202741 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174768.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene glpD CDS 203070..204641 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207054.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(204721..205236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(205310..205672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(205712..206266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 206552..207796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 207916..208977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 208979..209857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 209841..212354 product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(212440..213060) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096586.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(213391..214062) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798788.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(214047..214838) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705346.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(214835..215644) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366692.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(215665..216702) product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705347.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 216990..217889 product DNA-3-methyladenine glycosidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234926.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene alkA CDS complement(219802..221529) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211361.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene poxB CDS complement(221898..222332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 222862..224364 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817168.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene proP CDS 224390..225835 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816818.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene phrB CDS 225949..226260 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210368.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(226311..227072) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816922.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(227206..229266) product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096762.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene paaZ CDS 229590..230528 product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705613.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene paaA CDS 230551..230838 product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857353.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 gene paaB CDS 230849..231607 product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072837.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene paaC CDS 231624..232121 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004224495.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 gene paaJ CDS 232132..233190 product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206388.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene paaK CDS 233199..233972 product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292350.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 233974..234768 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528139.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene paaG CDS 234770..236308 product 3-hydroxyacyl-CoA dehydrogenase PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973360.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene paaC CDS 236305..236745 product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096754.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene paaI CDS 236742..237944 product bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206197.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene paaJ CDS 238173..239471 product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096752.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene paaF CDS 239633..240571 product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883661.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene paaX CDS 240703..241296 product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096750.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene paaY CDS complement(241596..243596) product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209560.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene hmsP CDS complement(244125..247637) product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099215.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene bcsC CDS complement(247637..248731) product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817393.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 gene bcsZ CDS complement(248744..250996) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018077.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene bcsB CDS complement(251215..253248) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099218.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene bcsA CDS complement(253819..254271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 note possible pseudo, frameshifted CDS complement(254229..254555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 note possible pseudo, frameshifted CDS complement(254561..254755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 254990..256525 product cellulose biosynthesis protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817396.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene bcsE CDS 256720..258255 product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174899.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene bcsG CDS 259272..260747 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883059.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(260835..262361) product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816951.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene emrB CDS complement(262378..263550) product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098428.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene emrA CDS 264321..266537 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174776.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene glgB CDS 266547..267986 product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197650.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene glgA CDS 268559..269056 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213014.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene tssB CDS 269083..270624 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214707.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene tssC CDS 270637..271974 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686687.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene tssK CDS 271971..272630 product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210015.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene tssL CDS 272630..274369 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120158270.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 274372..274863 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210014.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 275141..277840 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210013.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene tssH assembly_gap 278179..279142 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 279162..279938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 279954..282212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 282236..283147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 assembly_gap 283378..283780 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 283982..284194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 assembly_gap 284604..284867 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 284902..285699 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 285699..286547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 assembly_gap 287228..288476 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 288684..288896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 288918..289754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 289754..290608 product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262010.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 290898..291164 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001443095.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 291167..292303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 assembly_gap 293074..293425 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 293533..295785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 295806..297422 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211937.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene tssA CDS 297451..299214 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155110255.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene tssF CDS 299178..300272 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373315.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene tssG CDS 300289..300831 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074160625.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene tssJ CDS 300835..301263 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705635.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene tssE CDS 301303..302676 product type VI secretion system ImpA and VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211944.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 302840..303493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(303791..306100) product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(306100..307542) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene zwf CDS complement(307539..308591) product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene gnd CDS complement(308588..309298) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 309902..310204 product acid-activated periplasmic chaperone HdeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756550.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene hdeA CDS complement(310258..310521) product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680497.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 311049..313100 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973426.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 313225..314079 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098345.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 314480..314653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 314793..314987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(315392..316630) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112792.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(316627..317178) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(317175..319970) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(320743..321891) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705012.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene dgoD CDS complement(321892..322506) product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198722.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene dgoA CDS complement(322490..323392) product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094784.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(323389..324276) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228493.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(324291..325070) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 325500..326855 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(326880..328091) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200779.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 328130..329047 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158547.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 330311..330562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 330689..331246 product fimbrial protein BcfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743355.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 331316..331999 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703410.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 332020..334512 product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100159012.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 334526..335053 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023965.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 335046..335567 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703412.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 335560..336204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 336220..337305 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123654.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(337526..338458) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084391.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 339046..339651 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098408.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 339870..340709 product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001316891.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 340699..342249 product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098407.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene fdrA CDS 342249..343664 product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098406.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 343910..345472 product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098405.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 345550..346500 product carbamate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704652.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 346594..347982 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098403.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(348411..348893) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705072.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 349042..349278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(349490..350272) product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase WbbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262539.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene wbbL CDS complement(350280..351194) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837185.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(351195..352430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(352430..354394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(354440..355393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(355396..356613) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(356603..357382) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705991.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(357384..358265) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692740.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene rfbD CDS complement(358266..358799) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene rfbC CDS complement(359741..359920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(359883..360101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 note possible pseudo, frameshifted CDS 360299..360997 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168627.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(361024..361563) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211926.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(361736..364462) product TMAO reductase system sensor histidine kinase/response regulator TorS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054718.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene torS CDS 364576..365607 product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264948.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene torT CDS complement(365580..366281) product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120117.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene torR CDS 366409..367587 product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230242.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene torC CDS 367577..370117 product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790669.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene torA CDS 370118..370735 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209890.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene torD CDS complement(371118..371813) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169913.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene araD CDS complement(371928..373448) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816285.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene araA CDS complement(373500..375176) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210590.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 375495..376385 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210586.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene araC CDS complement(376467..377432) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157737.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(377435..378409) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157734.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(378402..379883) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081001.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(379975..380958) product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816705.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(381977..382543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037412146.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(382690..384306) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097895.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(384332..386827) product CS1-pili formation C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878114.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(386847..387533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024484739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(387623..388231) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878116.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(388378..388722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(389587..389847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(390600..390830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS complement(391083..391940) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 392912..393889 product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096709.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 393917..394951 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704695.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(395868..396545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037412146.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(396620..398209) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097895.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(398235..400730) product CS1-pili formation C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878114.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(400750..401433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024484739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(401533..402153) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878116.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(402265..402576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(403138..403383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(403492..403722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(403740..404123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(404532..405557) product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019212714.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 gene rhuM tRNA complement(406099..406193) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 407144..409186 product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298719.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene prlC CDS 409179..409943 product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174842.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene rsmJ CDS complement(410015..411346) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705776.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene gdhA CDS complement(411612..412046) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861223.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene uspA CDS complement(413104..414591) product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157393.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene pitA CDS 414970..416166 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439188.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 416599..417297 product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639821.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene yhhW CDS 417576..418049 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354621.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 418063..418329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 418424..418630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(419132..419572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(419918..420334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31490 note possible pseudo, internal stop codon CDS complement(420606..422225) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208912.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 gene pckA CDS complement(422431..423303) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208911.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 gene hslO CDS complement(423579..423977) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208910.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene hslR CDS complement(424032..425990) product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817351.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS 426430..426981 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045740.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene nudE CDS complement(427062..429521) product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301905.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene mrcA CDS 429710..430537 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208905.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene pilM CDS 430539..431078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 431071..431622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 431612..432649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 433155..433676 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208899.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene aroK CDS 433982..435076 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439863.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene aroB CDS 435394..436290 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817345.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 436372..437256 product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174698.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene dam CDS 437291..437965 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480446.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene rpe CDS 437962..438654 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208892.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS 438674..439711 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene trpS CDS complement(439891..440568) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367229.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 440837..441712 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816436.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(441772..442110) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704688.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(442199..443107) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097179.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 443450..445132 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536514.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 445129..446760 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551424.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(446768..447448) product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817439.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene yiiM CDS complement(447715..448341) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209614.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene sodA CDS 449028..450983 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175648.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene acs CDS 451176..451487 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156735.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 451484..453133 product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209029.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene actP CDS complement(453527..453955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 sequence4 source 1..378583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2711..3052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 3215..3766 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172454863.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 3829..4407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 4469..7033 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034162516.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 7071..7808 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071881865.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 7849..8268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 8261..8794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 8794..9327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 9342..10508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(10645..11112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(11099..11902) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639305.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(12572..13108) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 gene idi CDS complement(13344..14000) product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705094.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene narL CDS complement(14022..15800) product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816562.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene narX CDS 16296..17693 product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019827.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene narK CDS 17759..21520 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032955.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 21520..23061 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096257.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene narH CDS 23058..23780 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571671.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene narJ CDS 23777..24454 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367083.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene narI CDS complement(24513..25433) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 26085..27068 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703806.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(27131..28075) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113476.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 28413..29222 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123226.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 29406..30707 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704676.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 30756..31124 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704675.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 31153..32646 product NAD-dependent phenylacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286412.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 32943..33686 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703427.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(33733..34404) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367829.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 34799..36292 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704674.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 36267..36890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 37071..38651 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 38874..40310 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368025.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene phoA CDS 41006..42658 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173899.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 42914..43174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(43335..44063) product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687742.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(44060..44569) product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224162.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene fumE CDS complement(44855..45826) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987297.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 gene glpX CDS complement(45826..47100) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853233.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(47125..48507) product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428807.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene cmtA CDS complement(48529..48981) product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237038.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene cmtB tRNA complement(49496..49581) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS complement(49749..50762) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209206.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene rsmC CDS 50937..51356 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166902.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 51325..51792 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092432.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene rimI CDS complement(51919..54834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(54923..55843) product DNA-binding transcriptional regulator DmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061575.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene dmlR CDS 55962..57029 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085700.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 57259..58848 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095483.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene prfC CDS 59136..59546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 59796..60953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 60943..61725 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815517.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 62019..63305 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815518.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 63879..64658 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095489.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene deoC CDS 64873..66195 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815519.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene deoA CDS 66258..67481 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815520.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene deoB CDS 67644..68360 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166923.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene deoD CDS complement(68533..69036) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703697.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 gene yhhY CDS complement(69258..72056) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815400.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(72046..73752) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(73807..76578) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084281.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(76697..77683) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084282.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(77683..78249) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156585.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 78543..79325 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046052102.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(79493..80254) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209218.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 80554..81531 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166929.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene serB CDS 81915..83303 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029698.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene radA CDS 83317..84549 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209221.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene nadR CDS complement(84689..86335) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005180723.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene ettA CDS 86717..87076 product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706948.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(87569..88060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 88814..90727 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209227.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene sltY CDS 90799..91119 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815529.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene trpR CDS complement(91236..91772) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815530.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene yjjX CDS 91825..92472 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166949.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene gpmB CDS complement(92636..93532) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166950.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 gene robA CDS 93719..94195 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209232.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 gene creA CDS complement(94319..95035) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004706052.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene arcA CDS 95847..98306 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209237.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene thrA CDS 98310..99239 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166953.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene thrB CDS 99243..100538 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815533.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene thrC CDS complement(100729..101196) product copper resistance system metallochaperone PcoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087108.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene pcoE CDS complement(101342..102730) product Cu(+)/Ag(+) sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704248.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(102723..103406) product copper/silver response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096579.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 103566..104945 product Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001507116.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene silC CDS 104957..105304 product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246153.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene cusF CDS 105322..106584 product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157620.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene silB CDS 106594..109725 product Cu(+)/Ag(+) efflux RND transporter permease subunit SilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087115.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene silA CDS 109802..110224 product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436620.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(110332..111327) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878153.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene mgrA CDS complement(111699..112475) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209240.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene yaaA CDS 112843..113796 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130185.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene tal CDS complement(113968..115371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 115921..116499 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094685.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene mog CDS complement(116568..117134) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209246.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene satP CDS 117475..119388 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095521.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene dnaK CDS 119499..120644 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209249.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene dnaJ CDS complement(120903..121049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(121108..121854) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816194.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 121823..122017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 122349..123521 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166980.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene nhaA CDS 123839..124696 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157029.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene nhaR CDS complement(124749..125009) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157027.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene rpsT CDS 125608..126546 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166981.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene ribF CDS 126575..129385 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210509.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene ileS CDS 129382..129885 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210508.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene lspA CDS 130060..130530 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080552.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene fkpB CDS 130511..131464 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815541.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene ispH CDS 131553..132215 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099181.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(132341..133384) product tellurium resistance membrane protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255079.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene terC CDS complement(133393..133572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 133910..134731 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704365.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 gene dapB CDS 135179..136342 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597260.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene carA CDS 136357..139578 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368300.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene carB CDS complement(139699..140097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(140509..141180) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212173.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(141354..142541) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212172.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene metC CDS 142986..143939 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174068.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene exbB CDS 143945..144370 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212170.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene exbD CDS 146080..147294 product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209054.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene yedE CDS 147291..147530 product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096288.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene yedF CDS complement(147580..148089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(148320..149225) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208691.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene rdgC CDS 149422..150327 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208690.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 gene mak CDS 150491..152440 product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210160.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(152633..152938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(153624..154223) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113348.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(155092..156231) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210731.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene cydB CDS complement(156247..157794) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367666.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 gene cydA CDS complement(157893..158489) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020682.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(158494..159216) product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020679.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(159226..160044) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003039954.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(160032..160346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(160350..161300) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020668.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(161738..162598) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207147.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 162985..164019 product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705347.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 164066..165349 product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329028.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(165756..169433) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208688.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(169430..170650) product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208687.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene sbcD CDS 171179..171868 product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160580.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 gene phoB CDS 171890..173188 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208684.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene phoR CDS 174162..175487 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167571.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene brnQ CDS 175938..177656 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098265.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(177717..179483) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816913.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene ggt CDS complement(179728..180348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070541142.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(180798..181400) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707520.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(181410..181583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(181766..182341) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167576.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 assembly_gap 182657..183091 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 183348..184418 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266492.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene queA CDS 184508..185635 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208672.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene tgt CDS 185729..186061 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166605.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene yajC CDS 186122..187936 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208670.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 gene secD CDS 187947..188915 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208669.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 gene secF CDS 189085..189534 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208668.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene nrdR CDS 189539..190654 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167588.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene ribD CDS 190756..191226 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208666.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene ribE CDS 191256..191672 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367993.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene nusB CDS 191810..192799 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816909.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 gene thiL CDS complement(193413..195278) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367989.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 gene dxs CDS complement(195404..196321) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367988.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 gene ispA CDS complement(196325..196576) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208660.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 gene xseB CDS 196796..198247 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208658.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene thiI CDS complement(198494..199087) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208657.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene yajL CDS complement(199050..199961) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167606.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 gene panE CDS 200191..200715 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167608.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(200759..202123) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216717.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(202693..203580) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208653.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 gene cyoE CDS complement(203593..203925) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(203926..204540) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163525.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS complement(204530..206521) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163523.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 gene cyoB CDS complement(206526..207473) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208649.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 gene cyoA CDS complement(207900..208457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 note possible pseudo, internal stop codon CDS complement(208917..210419) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167629.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene ampG CDS complement(210531..210872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 211407..211745 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208644.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 gene bolA CDS 212103..213407 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208643.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 gene tig CDS 213846..214466 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167636.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene clpP CDS 214582..215859 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167638.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene clpX CDS 216068..218494 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067728.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene lon CDS 218726..219001 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392663.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 gene hupB CDS 219175..221043 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167642.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 gene ppiD CDS 221190..221561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 221774..222208 product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194543.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene fadM CDS complement(222280..222978) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817227.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene queC CDS 223188..223649 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208630.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 224031..225776 product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816892.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS 225773..227557 product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208628.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 227775..228113 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene glnK CDS 228124..229407 product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167660.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene amtB CDS complement(229546..230412) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167662.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene tesB CDS 230647..231099 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167665.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(231682..231885) product expression modulating protein YmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208622.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene ymoA CDS complement(231971..232339) product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218472.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene tomB CDS complement(232907..234049) product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018127.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene mltD CDS complement(234321..235076) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210697.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene gloB CDS 235110..235835 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210698.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(235852..236322) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095689.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene rnhA CDS 236377..237126 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077294168.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 gene dnaQ tRNA 237253..237329 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(237454..237792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS 238375..240369 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157073.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene tkt CDS 240782..241801 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209964.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene epd CDS 241886..243049 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157067.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene pgk CDS 243151..244227 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209962.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene fbaA CDS complement(244422..245309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 245600..246823 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105930.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene gltS CDS 246849..247814 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(247931..248800) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112482.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 248867..249553 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311533.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 249553..250020 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808993.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 250017..251237 product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206375.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 251332..252201 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551419.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 252372..253220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 253201..253467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 note possible pseudo, internal stop codon CDS 253474..253716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 note possible pseudo, internal stop codon CDS 253738..254031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 note possible pseudo, internal stop codon CDS complement(254194..254712) product 4-hydroxyphenylacetate 3-monooxygenase, reductase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211078.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene hpaC CDS complement(254732..256294) product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095447.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene hpaB CDS complement(256854..257534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(258991..259863) product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095448.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene hpaA CDS complement(260043..261413) product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285769.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene hpaX CDS complement(261757..262563) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431692.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene hpaI CDS complement(262574..263377) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887487.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene hpaH CDS complement(263481..264947) product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene gabD CDS complement(264944..266170) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159295.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(266180..266560) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368431.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(266570..267451) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095453.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene hpaD CDS complement(267616..269085) product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 gene hpaE CDS complement(269082..269849) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009485356.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(269849..270478) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704295.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 271128..271532 product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211070.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene hpaR CDS complement(271618..273624) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097075.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene betT CDS complement(274088..274354) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146332.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(274427..274864) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207602.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(275081..275539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 276079..276747 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262703.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(276796..278505) product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556318.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS 278706..278870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 279090..280265 product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164236.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene kch CDS 280289..280906 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene ccmA CDS 280906..281571 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815897.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene ccmB CDS 281854..282045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 282455..282793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 283096..283632 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163272.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 283725..284234 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051553.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 284329..286998 product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298457.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS 287056..287832 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018304.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 287884..288492 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095779.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS 288502..289041 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832400.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 289056..289553 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311011.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 289564..290061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 290058..290573 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824844.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 290595..291137 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167315.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 291282..292145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(292529..293179) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693164.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(293179..293835) product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693165.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene atoD CDS complement(293850..295031) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666204.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(295028..295861) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(295880..297142) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(297156..297932) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 298246..298926 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265528.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(299066..299962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34370 tRNA complement(300080..300155) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(300377..301489) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209995.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene mltC CDS complement(301621..301890) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105744.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(301883..302953) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228057.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene mutY CDS 303352..304023 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098672.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene trmB CDS 304023..304352 product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209990.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 304570..305496 product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209989.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene glsB CDS 305530..306255 product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817048.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 306627..307616 product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene yclQ CDS complement(307901..309040) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817047.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene hemW CDS complement(309033..309626) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173616.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(309642..310226) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209984.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(310245..311066) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209983.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene proC CDS complement(311077..311775) product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene yggS CDS complement(311898..312317) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209978.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene ruvX CDS complement(312317..312880) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817044.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(312981..313928) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703453.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene gshB CDS complement(313938..314669) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300912.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene rsmE CDS 315550..315924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(316035..316679) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816993.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(316891..317763) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209850.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 317888..318808 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209849.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(318782..319717) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173367.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS 319846..321105 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209846.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene lysA assembly_gap 321112..321452 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(321689..324166) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368121.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene fadE CDS 324518..325096 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284051.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene lpcA CDS 325401..326168 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208719.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(326139..326876) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208718.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene dpaA CDS 327291..328634 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816936.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 328639..329877 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208716.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 329870..330664 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208715.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 330657..331286 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160493.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 331291..331887 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392325.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene nqrE CDS 331903..333129 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208711.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene nqrF CDS 333197..334228 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227821.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 334245..334472 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214684.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 gene nqrM CDS complement(334547..335470) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208709.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 CDS complement(335491..336015) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524116.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(336092..338398) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815963.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 338599..339654 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167525.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene dinB CDS complement(339717..341177) product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene pepD CDS complement(341374..341622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS 341659..342123 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889733.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene gpt CDS 342309..343559 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816927.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene frsA CDS 343631..344032 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167534.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 gene crl CDS 344148..345251 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208701.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene proB CDS 345254..346507 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032901182.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene proA CDS 346779..347276 product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704546.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene aroL CDS 347389..349533 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816988.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene aas CDS 349538..350731 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene lplT CDS 350751..351266 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene pncC CDS 351361..352428 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166464.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene recA CDS 352754..355381 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815643.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene alaS CDS 355610..355795 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209449.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene csrA tRNA 356241..356333 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 356345..356421 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 assembly_gap 356518..357308 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 357416..357661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 note possible pseudo, internal stop codon CDS 357674..358630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 note possible pseudo, internal stop codon, frameshifted CDS 359402..359632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS 359758..361317 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848972.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene gshA CDS 361473..361988 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130208.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 gene luxS CDS complement(362067..363356) product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162197874.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(363410..364201) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167431.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 364600..365961 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167432.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene ffh CDS 366098..366346 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209458.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene rpsP CDS 366365..366913 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene rimM CDS 366951..367715 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393426.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene trmD CDS 367763..368116 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene rplS CDS 368567..369661 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167443.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 369676..370797 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167445.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene tyrA CDS complement(370918..372090) product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815647.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene pheA CDS complement(372379..372708) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209468.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene raiA CDS complement(373166..373900) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209469.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene bamD CDS 374037..375014 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166515.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene rluD CDS 375014..375748 product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815687.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene yfiH CDS 375876..378449 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167451.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene clpB sequence5 source 1..241727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..1059) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176045.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene murI CDS complement(1004..2911) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228170.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene btuB CDS 3401..4486 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209474.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene trmA CDS complement(4584..4979) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806411.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(4993..5649) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001537960.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 gene fabR CDS 6092..7489 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209477.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene sthA CDS complement(7537..8445) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176059.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene oxyR CDS complement(9027..10403) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099298.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene argH CDS complement(10486..11703) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049171.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(11781..12557) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302318.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene argB CDS complement(12596..13600) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209489.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 gene argC CDS 13703..14857 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298882.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene argE CDS 15201..16085 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099307.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 gene metF CDS 16834..18231 product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 18337..19905 product acid resistance gamma-aminobutyrate antiporter GadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246013.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene gadC CDS 20335..20508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(20720..23359) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209491.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 gene ppc CDS 23583..23786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 24309..24518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS 24457..25116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(25474..27915) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208934.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(27927..29087) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815294.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene metB CDS 29403..29720 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004107547.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene metJ CDS 30108..30854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715527.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(30977..31192) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216737.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene rpmE CDS 31675..33939 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208938.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 gene priA CDS 34322..35350 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815292.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 gene cytR CDS 35687..36514 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815291.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene ftsN CDS 36649..37179 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208242.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene hslV CDS 37191..38525 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175854.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene hslU CDS 38944..39864 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298879.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 39974..40492 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872918.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 gene rraA CDS complement(40829..41068) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392238.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 gene zapB CDS 41372..42232 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175868.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 42257..43783 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175870.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 gene glpK CDS 43986..48464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(48774..49013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(49496..51127) product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727769.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 gene mdlC CDS complement(51450..52634) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815288.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene emrD CDS 53015..53761 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369139.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 gene fpr CDS complement(54594..55016) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815287.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 55070..55684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 56149..56919 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208959.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 gene tpiA CDS complement(57273..58274) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208965.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 58698..60014 product type III secretion system effector YopM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229779.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 gene yopM CDS complement(60139..61116) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591793.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 gene pfkA CDS complement(61656..62600) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105554.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(62597..63238) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105553.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(63721..64473) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112931.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(65182..65724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 65878..66576 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 gene cpxR CDS 66573..67943 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208971.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene cpxA CDS 68800..70239 product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706057.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 70942..72465 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS 72469..73833 product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850092.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 73833..74954 product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 74956..75951 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107917.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 76175..76948 product lipooligosaccharide biosynthesis galactosyltransferase LsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694186.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 gene lsgD CDS 78054..79148 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202471.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 79290..80414 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703236.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 80651..81805 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706680.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 81811..82239 product protein tyrosine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112150398.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 82274..84352 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706678.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 84370..85395 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482282.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene galE CDS 85671..86174 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208973.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene trmL CDS complement(86328..87149) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815280.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene cysE CDS complement(87295..88329) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815279.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene gpsA CDS complement(88338..88802) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003382.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene secB CDS complement(89042..89479) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052206.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS 90178..91470 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815277.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene envC CDS 91790..92800 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483842.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS complement(92953..94044) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703864.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 94211..94498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(94750..95775) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646007.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene tdh CDS complement(95798..96994) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213794.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene kbl CDS 97225..98163 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815275.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene rfaD CDS 98500..99504 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815274.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene rfaF CDS 99504..100466 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094906.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 gene rfaC CDS complement(100782..102257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS complement(102562..103839) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172601538.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene waaA CDS 104055..104540 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208988.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene coaD CDS complement(104537..105352) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114543.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene mutM CDS complement(105375..106520) product lipopolysaccharide N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227811.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS complement(106525..107535) product lipopolysaccharide 1,2-glucosyltransferase RfaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376841.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene rfaJ CDS complement(107528..108763) product O-antigen ligase RfaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958453.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 gene rfaL CDS complement(108782..109789) product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272750.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene waaO CDS complement(109823..110623) product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229840.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene rfaP CDS complement(110616..111740) product lipopolysaccharide glucosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634283.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene rfaG CDS complement(111742..112752) product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268851.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene rfaQ CDS complement(113005..113172) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene rpmG CDS complement(113184..113420) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene rpmB CDS complement(113672..114349) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175951.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene radC CDS 114507..115739 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628128.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene coaBC CDS 115711..116166 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164750.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene dut CDS 116385..116984 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004714376.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene slmA CDS complement(117033..117674) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806169.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene pyrE CDS complement(117797..118510) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175960.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene rph CDS 118634..119497 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094887.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(119794..120318) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547661.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 121069..121854 product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052921.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(121888..122247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36110 note possible pseudo, frameshifted CDS complement(122210..122746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36120 note possible pseudo, internal stop codon, frameshifted CDS complement(122762..122890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 123151..123462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36140 note possible pseudo, internal stop codon CDS 123499..123942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(124035..125288) product xanthosine/proton symporter XapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020402.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene xapB CDS complement(125285..126214) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947043.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(126254..127072) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 127261..128463 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272496.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 128757..129533 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706079.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene thiM CDS complement(129615..130319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 130989..131546 product tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369873.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 assembly_gap 132105..132437 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 132521..132934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 133000..133563 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209720.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 133629..134174 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051553.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 134212..136755 product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298457.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS 136761..137510 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018304.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 137522..138130 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095779.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS 138174..138737 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167315.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS 138753..139754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(139861..141027) product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 gene ugd CDS complement(141102..142103) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706682.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 143817..144245 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001516948.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(144328..145986) product phosphoethanolamine transferase Lpt6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694030.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene lpt6 CDS complement(146192..148060) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817432.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 gene selB CDS complement(148057..149448) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209608.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene selA CDS complement(149471..150406) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209609.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene fdhE CDS 151291..152754 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990844.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene fumC CDS 152819..154612 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229258.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(154949..155098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 155172..155444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(155509..156168) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829025.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene fdoI CDS complement(156165..157109) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209611.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene fdxH CDS complement(157121..160168) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830448.1 transl_table 11 codon_start 1 transl_except (pos:159581..159583,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_36440 gene fdnG CDS 160489..161319 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848310.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 gene fdhD CDS complement(161455..162819) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175133.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene mnmE CDS complement(162919..164568) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817459.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene yidC CDS complement(164571..164831) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703903.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 gene yidD CDS complement(164795..165121) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703902.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 gene rnpA CDS complement(165176..165319) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369029.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene rpmH CDS 166164..167555 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220732.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 gene dnaA CDS 167561..168661 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209645.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 gene dnaN CDS 168671..169765 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817457.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 gene recF CDS 169784..172198 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175131.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene gyrB CDS 172697..174160 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602539.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(174265..174549) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(174774..175880) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209507.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene asd CDS complement(175937..176116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 assembly_gap 176234..176897 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(176948..177136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 177155..178342 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073742.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(178695..179873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(179876..181351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(182178..182438) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208617.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(182606..183166) product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996728.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(183433..184617) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079859.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(184699..185475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(185737..186510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 187135..188046 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170645.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene nagK CDS 188882..189520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 189641..191839 product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 192219..197159 product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 197189..197770 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245166.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 197951..198487 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385417.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 198776..199018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(199223..199885) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707347.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 199960..201369 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205544.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(201602..202372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(202420..203670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 204033..205367 product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095620.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 gene hutW CDS 205379..205873 product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020035.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene hutX CDS complement(205985..207469) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112356.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 207565..208107 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813206.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 208371..209150 product pyochelin biosynthesis transcriptional regulator PchR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106955.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene pchR CDS 209280..211442 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813609.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 211448..212347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 212344..213249 product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene yiuA note possible pseudo, internal stop codon CDS complement(213598..215430) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215552.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene glmS CDS complement(215650..217020) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175168.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene glmU CDS complement(217147..217572) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024912932.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS complement(217594..218976) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220753.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 gene atpD CDS complement(219011..219874) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817476.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene atpG CDS complement(219930..221471) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862367.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene atpA CDS complement(221486..222019) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175171.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene atpH CDS complement(222032..222502) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004107293.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene atpF CDS complement(222554..222796) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene atpE CDS complement(222843..223664) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161179.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene atpB CDS complement(223698..224075) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161181.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene atpI CDS complement(224678..225301) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161183.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene rsmG CDS complement(225304..227193) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212259.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene mnmG CDS complement(227571..227978) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212258.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene mioC CDS complement(228102..228563) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene asnC CDS 228725..229717 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212256.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene asnA CDS complement(229724..231181) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815251.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 gene viaA CDS complement(231184..232698) product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815252.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene ravA CDS 233241..233660 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368993.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene rbsD CDS 233668..235182 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175183.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene rbsA CDS 235179..236141 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368991.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene rbsC CDS 236225..237115 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175185.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene rbsB CDS 237329..238258 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212251.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene rbsK CDS 238262..239263 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175187.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene rbsR CDS complement(239260..240666) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212250.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene mdtD CDS complement(240716..241414) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215905.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 sequence6 source 1..187606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 680..1609 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174582.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene metA CDS 1973..3571 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212077.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene aceB CDS 3693..5000 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174580.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene aceA CDS 5111..6841 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212079.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene aceK CDS 7071..7976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 8460..9260 product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211028.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 9433..10311 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816210.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(10506..11336) product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174577.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene iclR CDS 11616..15299 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704023.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene metH CDS 15353..15940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 16148..17572 product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene lidL CDS complement(17722..19098) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136394.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene lysC CDS 19616..21262 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704033.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene pgi CDS 21674..22180 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209087.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene ubiC CDS 22202..23068 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209088.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 gene ubiA CDS complement(23155..25668) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214644.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene plsB CDS 25819..26193 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002907.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene dgkA CDS 26331..26948 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene lexA CDS complement(27141..27662) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174547.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene zur assembly_gap 27753..28350 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(28708..30717) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640133.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(30853..31707) product ModD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576816.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene modD CDS complement(31704..32522) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904011.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(32533..33300) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173325.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(33297..34301) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261267.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(34298..35335) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123164.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 35660..36655 product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730239.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 gene gntR CDS 36849..37391 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108342.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene gntK CDS 37388..38746 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833577.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene gntU CDS complement(38804..40036) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225180.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(40008..41174) product DUF459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225181.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(41161..42579) product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868907.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS complement(42852..43658) product protein bax inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077703.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(44358..44540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079839.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS 44952..46406 product DUF4026 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453709.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 46783..47238 product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068912.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 47806..49164 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162366.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 gene dcuC CDS 49571..50845 product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 51475..53124 product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169390.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 gene arnT CDS complement(53323..53505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(53502..56606) product multidrug efflux RND transporter permease MexI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114727.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 gene mexI CDS complement(56617..57726) product multidrug efflux RND transporter periplasmic adaptor MexH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104731.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene mexH CDS complement(57736..58167) product multidrug efflux RND transporter inhibitory subunit MexG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093607.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene mexG CDS 58321..58818 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206380.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene soxR CDS 58877..59347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 59780..60565 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206710.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 60612..61856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206711.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 61866..62426 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206712.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 62423..63205 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965976.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 63209..64822 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 64904..65797 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206215.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 66045..67469 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096165.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(67890..68897) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 69703..71901 product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 71912..73408 product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086194.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 73419..73841 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS 73870..76185 product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 76215..77342 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086196.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS 77403..78314 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS 78333..79364 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089142.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS 79361..80116 product maleate cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064689.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 80202..80660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 80934..82580 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391292.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 82810..83604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(83873..84493) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097603.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS complement(84765..85862) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096922.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(85920..86519) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419211.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(86752..87516) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704512.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 87749..88171 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(88255..88854) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208278.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(88939..89640) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704052.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(89803..90597) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130548.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(90607..91833) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(91838..92956) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592029.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 93518..95098 product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704028.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene rtcR CDS 95174..96088 product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001604679.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 gene rbn CDS complement(96155..96997) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049613991.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(97293..98072) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448638.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(98176..98844) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816010.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene deoC CDS 99075..99995 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350272.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene rbsK CDS 100124..101452 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998359.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 gene fucP CDS 101516..102532 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213216.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(102875..103270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 103463..104488 product low conductance mechanosensitive channel YnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559901.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene ynaI CDS complement(104541..104690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 104760..106919 product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817119.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene speF CDS 107025..107960 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 108122..108523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS 108650..109678 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182236.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene dusA CDS complement(109718..110701) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209094.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 110892..112322 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209095.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene dnaB CDS 112354..113436 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174405.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene alr CDS 113501..114697 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487001.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene tyrB CDS complement(114881..117715) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357740.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene uvrA CDS 117988..118527 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174387.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene ssb1 CDS 118821..119438 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 119654..119875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS 120171..121781 product yersiniabactin biosynthesis salycil-AMP ligase YbtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088818.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene ybtE CDS 121781..122512 product pyochelin biosynthesis editing thioesterase PchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114687.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene pchC CDS 122643..125516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38110 assembly_gap 125854..126335 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 126966..128075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 note possible pseudo, frameshifted CDS 128092..128445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38130 note possible pseudo, frameshifted CDS complement(128552..129832) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966040.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(129919..131061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS complement(131304..133769) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154223677.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene leuS CDS complement(133888..134301) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112890.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene gloA CDS complement(134328..134918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(134921..135673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(135755..136720) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613224.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(136791..137621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(137694..138761) product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922009.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(139193..140359) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477066.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 140933..142630 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298157.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene ilvB CDS 142633..142917 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181713.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 gene ilvN CDS 143147..143809 product alanyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098363.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(143853..144410) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098365.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 144636..145388 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817053.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS 145666..146856 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114355.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(146904..148586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196441.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 149276..150622 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080104.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 151030..152679 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174376.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 152696..153580 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176318.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(153480..154436) product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211525.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 gene metR CDS 154545..156824 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211526.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene metE CDS complement(157097..157486) product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369693.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 158070..159347 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208862.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 159340..159981 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170138703.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 159992..160771 product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704986.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS 160784..161560 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208861.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 161682..162641 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704985.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS 162652..164028 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202725.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(164108..164359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528682.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS 164457..165227 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235471423.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 165459..165875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 166121..166876 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211528.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene udp CDS 167199..167981 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815367.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 168189..168719 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211531.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS 168825..170180 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211532.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 gene rmuC CDS 170257..171012 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165601.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene ubiE CDS 171014..171667 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084314.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 171654..173288 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211535.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene ubiB CDS 173402..173692 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508972.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene tatA CDS 173696..174235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 174239..175000 product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815373.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene tatC CDS complement(175554..176048) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192407.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 gene rfaH CDS 176219..176944 product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707065.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene pepE CDS 177059..178531 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165587.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene ubiD CDS 178541..179242 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215918.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 gene fre CDS complement(179738..180904) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438702.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 gene fadA CDS complement(180909..183101) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815377.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene fadB CDS 183356..184690 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211547.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene pepQ CDS 184690..185304 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099228.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 185332..186783 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176271.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene trkH CDS 186800..187324 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416815.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene hemG sequence7 source 1..31314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 46..121 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 rRNA 150..259 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS complement(495..776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 note possible pseudo, internal stop codon CDS complement(804..1106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 note possible pseudo, internal stop codon CDS 1309..2343 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149790.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene murB CDS 2340..3317 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212289.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene birA CDS complement(3353..4303) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165813.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 gene coaA tRNA 4742..4817 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 4834..4918 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 4999..5073 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 5080..5155 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 assembly_gap 5344..6405 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 6566..6766 product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228136.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene bfd CDS 6895..7368 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675504.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene bfr CDS 7715..8026 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene rpsJ CDS 8059..8688 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709250.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 gene rplC CDS 8705..9310 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174626.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene rplD CDS 9307..9609 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617546.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene rplW CDS 9629..10453 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709246.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene rplB CDS 10468..10746 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027275662.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene rpsS CDS 10761..11093 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223844.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene rplV CDS 11111..11812 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene rpsC CDS 11825..12235 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919759.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene rplP CDS 12235..12426 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644742.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene rpmC CDS 12426..12680 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 gene rpsQ CDS 12854..13225 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 gene rplN CDS 13237..13551 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729187.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene rplX CDS 13567..14106 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096202.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene rplE CDS 14119..14424 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625879.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene rpsN CDS 14459..14851 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807048.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene rpsH CDS 14866..15399 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213334.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene rplF CDS 15409..15762 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358960.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene rplR CDS 15777..16277 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703641.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene rpsE CDS 16284..16463 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213339.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene rpmD CDS 16467..16901 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213341.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 gene rplO CDS 16909..18234 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213344.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene secY CDS 18543..18899 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004702348.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene rpsM CDS 18916..19305 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004388621.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 gene rpsK CDS 19340..19960 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 gene rpsD CDS 19986..20975 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209013.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 gene rpoA CDS 21013..21399 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391407.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene rplQ CDS 21527..21949 product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174611.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene zntR CDS 21994..22194 product alternative ribosome-rescue factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209016.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(22198..22608) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008119.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene mscL CDS complement(22713..24089) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209018.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene trkA CDS complement(24124..25410) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215705.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene rsmB CDS complement(25481..26428) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703637.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene fmt CDS complement(26454..26978) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114992.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene def CDS 27113..28192 product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817316.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene dprA CDS 28210..28749 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129723.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS 28762..29331 product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174593.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene tsaC CDS 29339..30157 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420960.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene aroE CDS 30154..30414 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS complement(30390..30935) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285635.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 sequence8 source 1..5750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 212..1748 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 assembly_gap 1774..2414 estimated_length known gap_type within scaffold linkage_evidence paired-ends rRNA 2594..5499 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030