>Feature sequence01 256 711 gene locus_tag LOCUS_00010 256 711 CDS product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985648.1 protein_id gnl|my_center|LOCUS_00010 831 2132 gene locus_tag LOCUS_00020 831 2132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098335.1 protein_id gnl|my_center|LOCUS_00020 2452 2129 gene locus_tag LOCUS_00030 2452 2129 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685902.1 protein_id gnl|my_center|LOCUS_00030 3855 2497 gene locus_tag LOCUS_00040 gene pssA 3855 2497 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949286.1 protein_id gnl|my_center|LOCUS_00040 6271 3962 gene locus_tag LOCUS_00050 gene pat 6271 3962 CDS product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098332.1 protein_id gnl|my_center|LOCUS_00050 7322 6657 gene locus_tag LOCUS_00060 gene tapT 7322 6657 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098331.1 protein_id gnl|my_center|LOCUS_00060 7849 7430 gene locus_tag LOCUS_00070 gene trxC 7849 7430 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 protein_id gnl|my_center|LOCUS_00070 8052 9125 gene locus_tag LOCUS_00080 8052 9125 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098329.1 protein_id gnl|my_center|LOCUS_00080 9868 9179 gene locus_tag LOCUS_00090 gene ung 9868 9179 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262720.1 protein_id gnl|my_center|LOCUS_00090 10186 10569 gene locus_tag LOCUS_00100 gene grcA 10186 10569 CDS product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914084.1 protein_id gnl|my_center|LOCUS_00100 10590 10942 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12400 13137 gene locus_tag LOCUS_00110 gene trmN 12400 13137 CDS product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297411.1 protein_id gnl|my_center|LOCUS_00110 14741 13122 gene locus_tag LOCUS_00120 gene nadB 14741 13122 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098324.1 protein_id gnl|my_center|LOCUS_00120 15164 15739 gene locus_tag LOCUS_00130 gene rpoE 15164 15739 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003307.1 protein_id gnl|my_center|LOCUS_00130 15771 16421 gene locus_tag LOCUS_00140 gene rseA 15771 16421 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098323.1 protein_id gnl|my_center|LOCUS_00140 16421 17374 gene locus_tag LOCUS_00150 gene rseB 16421 17374 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 protein_id gnl|my_center|LOCUS_00150 17371 17841 gene locus_tag LOCUS_00160 gene rseC 17371 17841 CDS product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703183.1 protein_id gnl|my_center|LOCUS_00160 18011 19810 gene locus_tag LOCUS_00170 gene lepA 18011 19810 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098320.1 protein_id gnl|my_center|LOCUS_00170 19826 20800 gene locus_tag LOCUS_00180 gene lepB 19826 20800 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098319.1 protein_id gnl|my_center|LOCUS_00180 21108 21722 gene locus_tag LOCUS_00190 gene rnc 21108 21722 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 protein_id gnl|my_center|LOCUS_00190 21719 22633 gene locus_tag LOCUS_00200 gene era 21719 22633 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102231.1 protein_id gnl|my_center|LOCUS_00200 22646 23353 gene locus_tag LOCUS_00210 gene recO 22646 23353 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098316.1 protein_id gnl|my_center|LOCUS_00210 23457 24188 gene locus_tag LOCUS_00220 gene pdxJ 23457 24188 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098315.1 protein_id gnl|my_center|LOCUS_00220 24188 24568 gene locus_tag LOCUS_00230 gene acpS 24188 24568 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370293.1 protein_id gnl|my_center|LOCUS_00230 24825 24565 gene locus_tag LOCUS_00240 24825 24565 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370294.1 protein_id gnl|my_center|LOCUS_00240 25806 24898 gene locus_tag LOCUS_00250 25806 24898 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001581956.1 protein_id gnl|my_center|LOCUS_00250 25933 27111 gene locus_tag LOCUS_00260 25933 27111 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276374.1 protein_id gnl|my_center|LOCUS_00260 27123 28040 gene locus_tag LOCUS_00270 27123 28040 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684023.1 protein_id gnl|my_center|LOCUS_00270 28918 28070 gene locus_tag LOCUS_00280 28918 28070 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098313.1 protein_id gnl|my_center|LOCUS_00280 29037 29930 gene locus_tag LOCUS_00290 gene murQ 29037 29930 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048539.1 protein_id gnl|my_center|LOCUS_00290 29940 31301 gene locus_tag LOCUS_00300 29940 31301 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098311.1 protein_id gnl|my_center|LOCUS_00300 31305 31940 gene locus_tag LOCUS_00310 gene yfhb 31305 31940 CDS product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 protein_id gnl|my_center|LOCUS_00310 32022 32519 gene locus_tag LOCUS_00320 gene tadA 32022 32519 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134566.1 protein_id gnl|my_center|LOCUS_00320 34065 32512 gene locus_tag LOCUS_00330 gene mltF 34065 32512 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098308.1 protein_id gnl|my_center|LOCUS_00330 34322 38209 gene locus_tag LOCUS_00340 gene purL 34322 38209 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970087.1 protein_id gnl|my_center|LOCUS_00340 38443 41454 gene locus_tag LOCUS_00350 38443 41454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41444 43066 gene locus_tag LOCUS_00360 41444 43066 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124765.1 protein_id gnl|my_center|LOCUS_00360 43385 44995 gene locus_tag LOCUS_00370 43385 44995 CDS product retron St85 family RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124764.1 protein_id gnl|my_center|LOCUS_00370 45064 45434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46040 47428 gene locus_tag LOCUS_00380 gene qseE 46040 47428 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420402.1 protein_id gnl|my_center|LOCUS_00380 47440 48153 gene locus_tag LOCUS_00390 gene qseG 47440 48153 CDS product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098305.1 protein_id gnl|my_center|LOCUS_00390 48150 49487 gene locus_tag LOCUS_00400 gene glrR 48150 49487 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098304.1 protein_id gnl|my_center|LOCUS_00400 49559 49897 gene locus_tag LOCUS_00410 gene glnB 49559 49897 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 protein_id gnl|my_center|LOCUS_00410 51070 49970 gene locus_tag LOCUS_00420 51070 49970 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703952.1 protein_id gnl|my_center|LOCUS_00420 51763 51098 gene locus_tag LOCUS_00430 gene fsa 51763 51098 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420897.1 protein_id gnl|my_center|LOCUS_00430 53138 51810 gene locus_tag LOCUS_00440 gene fucP 53138 51810 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_00440 54049 53141 gene locus_tag LOCUS_00450 54049 53141 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_00450 54542 54036 gene locus_tag LOCUS_00460 54542 54036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54900 55901 gene locus_tag LOCUS_00470 54900 55901 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_00470 57407 55953 gene locus_tag LOCUS_00480 gene dtpD 57407 55953 CDS product dipeptide permease DtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704649.1 protein_id gnl|my_center|LOCUS_00480 59606 57462 gene locus_tag LOCUS_00490 gene cadA 59606 57462 CDS product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100652.1 protein_id gnl|my_center|LOCUS_00490 61022 59688 gene locus_tag LOCUS_00500 gene cadB 61022 59688 CDS product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100004.1 protein_id gnl|my_center|LOCUS_00500 62918 61383 gene locus_tag LOCUS_00510 gene cadC 62918 61383 CDS product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187128.1 protein_id gnl|my_center|LOCUS_00510 64308 63118 gene locus_tag LOCUS_00520 gene hmpA 64308 63118 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098303.1 protein_id gnl|my_center|LOCUS_00520 64629 65882 gene locus_tag LOCUS_00530 64629 65882 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098302.1 protein_id gnl|my_center|LOCUS_00530 67271 66078 gene locus_tag LOCUS_00540 67271 66078 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299519.1 protein_id gnl|my_center|LOCUS_00540 67385 70141 gene locus_tag LOCUS_00550 67385 70141 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050717203.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00550 70249 70650 gene locus_tag LOCUS_00560 70249 70650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00560 70723 72162 gene locus_tag LOCUS_00570 70723 72162 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_00570 72159 73010 gene locus_tag LOCUS_00580 72159 73010 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266699.1 protein_id gnl|my_center|LOCUS_00580 73094 74233 gene locus_tag LOCUS_00590 73094 74233 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173729.1 protein_id gnl|my_center|LOCUS_00590 75507 74230 gene locus_tag LOCUS_00600 gene csiE 75507 74230 CDS product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098299.1 protein_id gnl|my_center|LOCUS_00600 75632 76270 gene locus_tag LOCUS_00610 75632 76270 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805721.1 protein_id gnl|my_center|LOCUS_00610 76261 77241 gene locus_tag LOCUS_00620 76261 77241 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 protein_id gnl|my_center|LOCUS_00620 77445 78173 gene locus_tag LOCUS_00630 77445 78173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 79043 78240 gene locus_tag LOCUS_00640 gene suhB 79043 78240 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553464.1 protein_id gnl|my_center|LOCUS_00640 79161 79892 gene locus_tag LOCUS_00650 gene trmJ 79161 79892 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370313.1 protein_id gnl|my_center|LOCUS_00650 80104 80595 gene locus_tag LOCUS_00660 gene iscR 80104 80595 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098294.1 protein_id gnl|my_center|LOCUS_00660 81557 81807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81839 82267 gene locus_tag LOCUS_00670 81839 82267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 82292 82678 gene locus_tag LOCUS_00680 gene iscU 82292 82678 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703172.1 protein_id gnl|my_center|LOCUS_00680 82693 83016 gene locus_tag LOCUS_00690 gene iscA 82693 83016 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540868.1 protein_id gnl|my_center|LOCUS_00690 83095 83610 gene locus_tag LOCUS_00700 gene hscB 83095 83610 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384414.1 protein_id gnl|my_center|LOCUS_00700 83626 85476 gene locus_tag LOCUS_00710 gene hscA 83626 85476 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 protein_id gnl|my_center|LOCUS_00710 85478 85813 gene locus_tag LOCUS_00720 gene fdx 85478 85813 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124471.1 protein_id gnl|my_center|LOCUS_00720 85815 86015 gene locus_tag LOCUS_00730 gene iscX 85815 86015 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002913954.1 protein_id gnl|my_center|LOCUS_00730 86076 87365 gene locus_tag LOCUS_00740 gene pepB 86076 87365 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370317.1 protein_id gnl|my_center|LOCUS_00740 87411 88208 gene locus_tag LOCUS_00750 gene sseB 87411 88208 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098290.1 protein_id gnl|my_center|LOCUS_00750 88993 88220 gene locus_tag LOCUS_00760 88993 88220 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098289.1 protein_id gnl|my_center|LOCUS_00760 89835 88993 gene locus_tag LOCUS_00770 gene sseA 89835 88993 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 protein_id gnl|my_center|LOCUS_00770 91296 89926 gene locus_tag LOCUS_00780 91296 89926 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 protein_id gnl|my_center|LOCUS_00780 92850 91306 gene locus_tag LOCUS_00790 92850 91306 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420384.1 protein_id gnl|my_center|LOCUS_00790 93129 98084 gene locus_tag LOCUS_00800 93129 98084 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098285.1 protein_id gnl|my_center|LOCUS_00800 98086 100407 gene locus_tag LOCUS_00810 gene pbpC 98086 100407 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137675.1 protein_id gnl|my_center|LOCUS_00810 100567 100998 gene locus_tag LOCUS_00820 gene ndk 100567 100998 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 protein_id gnl|my_center|LOCUS_00820 101191 102357 gene locus_tag LOCUS_00830 101191 102357 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003206.1 protein_id gnl|my_center|LOCUS_00830 102649 103635 gene locus_tag LOCUS_00840 gene rodZ 102649 103635 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098278.1 protein_id gnl|my_center|LOCUS_00840 103662 104780 gene locus_tag LOCUS_00850 gene ispG 103662 104780 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098277.1 protein_id gnl|my_center|LOCUS_00850 104874 106148 gene locus_tag LOCUS_00860 gene hisS 104874 106148 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703166.1 protein_id gnl|my_center|LOCUS_00860 106185 106805 gene locus_tag LOCUS_00870 106185 106805 CDS product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409190.1 protein_id gnl|my_center|LOCUS_00870 106816 107994 gene locus_tag LOCUS_00880 gene bamB 106816 107994 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177072.1 protein_id gnl|my_center|LOCUS_00880 108049 109578 gene locus_tag LOCUS_00890 gene der 108049 109578 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249413.1 protein_id gnl|my_center|LOCUS_00890 109624 109845 gene locus_tag LOCUS_00900 109624 109845 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703165.1 protein_id gnl|my_center|LOCUS_00900 110192 109842 gene locus_tag LOCUS_00910 110192 109842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098269.1 protein_id gnl|my_center|LOCUS_00910 111217 110192 gene locus_tag LOCUS_00920 111217 110192 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098268.1 protein_id gnl|my_center|LOCUS_00920 111815 112227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 112461 112874 gene locus_tag LOCUS_00930 112461 112874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 114175 112871 gene locus_tag LOCUS_00940 gene xseA 114175 112871 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098266.1 protein_id gnl|my_center|LOCUS_00940 114413 115879 gene locus_tag LOCUS_00950 gene guaB 114413 115879 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299507.1 protein_id gnl|my_center|LOCUS_00950 115941 117518 gene locus_tag LOCUS_00960 gene guaA 115941 117518 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 protein_id gnl|my_center|LOCUS_00960 117825 119015 gene locus_tag LOCUS_00970 117825 119015 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039727.1 protein_id gnl|my_center|LOCUS_00970 121316 120477 gene locus_tag LOCUS_00980 121316 120477 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226858412.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00980 121394 121624 gene locus_tag LOCUS_00990 121394 121624 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388106.1 protein_id gnl|my_center|LOCUS_00990 121630 122427 gene locus_tag LOCUS_01000 121630 122427 CDS product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880559.1 protein_id gnl|my_center|LOCUS_01000 122475 123236 gene locus_tag LOCUS_01010 122475 123236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 123925 124278 gene locus_tag LOCUS_01020 gene traJ 123925 124278 CDS product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205281.1 protein_id gnl|my_center|LOCUS_01020 124360 125154 gene locus_tag LOCUS_01030 gene trbJ 124360 125154 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938883.1 protein_id gnl|my_center|LOCUS_01030 125166 125357 gene locus_tag LOCUS_01040 125166 125357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 125341 125640 gene locus_tag LOCUS_01050 125341 125640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01050 125878 125630 gene locus_tag LOCUS_01060 125878 125630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 125919 126731 gene locus_tag LOCUS_01070 gene trbL 125919 126731 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269143.1 protein_id gnl|my_center|LOCUS_01070 126814 127251 gene locus_tag LOCUS_01080 126814 127251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 127446 129551 gene locus_tag LOCUS_01090 127446 129551 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538222.1 protein_id gnl|my_center|LOCUS_01090 129553 131391 gene locus_tag LOCUS_01100 129553 131391 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476430.1 protein_id gnl|my_center|LOCUS_01100 131616 132692 gene locus_tag LOCUS_01110 131616 132692 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096816.1 protein_id gnl|my_center|LOCUS_01110 134493 133321 gene locus_tag LOCUS_01120 134493 133321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 134730 135374 gene locus_tag LOCUS_01130 134730 135374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 135388 136662 gene locus_tag LOCUS_01140 135388 136662 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389727.1 protein_id gnl|my_center|LOCUS_01140 137356 137586 gene locus_tag LOCUS_01150 gene vapB 137356 137586 CDS product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450524.1 protein_id gnl|my_center|LOCUS_01150 137586 137990 gene locus_tag LOCUS_01160 gene vapC 137586 137990 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_01160 139003 138092 gene locus_tag LOCUS_01170 139003 138092 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_01170 139105 139542 gene locus_tag LOCUS_01180 139105 139542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 139945 140556 gene locus_tag LOCUS_01190 139945 140556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 140610 141152 gene locus_tag LOCUS_01200 140610 141152 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895531.1 protein_id gnl|my_center|LOCUS_01200 141196 141864 gene locus_tag LOCUS_01210 141196 141864 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041165625.1 protein_id gnl|my_center|LOCUS_01210 141895 144438 gene locus_tag LOCUS_01220 141895 144438 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704501.1 protein_id gnl|my_center|LOCUS_01220 144435 145466 gene locus_tag LOCUS_01230 144435 145466 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704500.1 protein_id gnl|my_center|LOCUS_01230 145561 147531 gene locus_tag LOCUS_01240 145561 147531 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266921.1 protein_id gnl|my_center|LOCUS_01240 148936 147614 gene locus_tag LOCUS_01250 148936 147614 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246197.1 protein_id gnl|my_center|LOCUS_01250 149663 148938 gene locus_tag LOCUS_01260 149663 148938 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704698.1 protein_id gnl|my_center|LOCUS_01260 151267 149750 gene locus_tag LOCUS_01270 151267 149750 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704701.1 protein_id gnl|my_center|LOCUS_01270 151760 153507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 154202 153591 gene locus_tag LOCUS_01280 gene yqaB 154202 153591 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703238.1 protein_id gnl|my_center|LOCUS_01280 155194 154253 gene locus_tag LOCUS_01290 155194 154253 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704703.1 protein_id gnl|my_center|LOCUS_01290 156017 155187 gene locus_tag LOCUS_01300 156017 155187 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704702.1 protein_id gnl|my_center|LOCUS_01300 156288 157088 gene locus_tag LOCUS_01310 156288 157088 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095437.1 protein_id gnl|my_center|LOCUS_01310 157137 157787 gene locus_tag LOCUS_01320 157137 157787 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 protein_id gnl|my_center|LOCUS_01320 157833 158045 gene locus_tag LOCUS_01330 157833 158045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 158357 160585 gene locus_tag LOCUS_01340 158357 160585 CDS product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773655.1 protein_id gnl|my_center|LOCUS_01340 162129 160588 gene locus_tag LOCUS_01350 gene ppx 162129 160588 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123330.1 protein_id gnl|my_center|LOCUS_01350 164199 162133 gene locus_tag LOCUS_01360 gene ppk1 164199 162133 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098243.1 protein_id gnl|my_center|LOCUS_01360 165120 164482 gene locus_tag LOCUS_01370 gene purN 165120 164482 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 protein_id gnl|my_center|LOCUS_01370 166154 165117 gene locus_tag LOCUS_01380 gene purM 166154 165117 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 protein_id gnl|my_center|LOCUS_01380 166432 167058 gene locus_tag LOCUS_01390 gene upp 166432 167058 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706208.1 protein_id gnl|my_center|LOCUS_01390 167207 168496 gene locus_tag LOCUS_01400 gene uraA 167207 168496 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703151.1 protein_id gnl|my_center|LOCUS_01400 168690 169292 gene locus_tag LOCUS_01410 168690 169292 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 protein_id gnl|my_center|LOCUS_01410 169677 169321 gene locus_tag LOCUS_01420 gene arsC 169677 169321 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098232.1 protein_id gnl|my_center|LOCUS_01420 170814 169690 gene locus_tag LOCUS_01430 gene bepA 170814 169690 CDS product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489667.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01430 171154 170777 gene locus_tag LOCUS_01440 171154 170777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01440 171377 172438 gene locus_tag LOCUS_01450 171377 172438 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098230.1 protein_id gnl|my_center|LOCUS_01450 173005 172535 gene locus_tag LOCUS_01460 gene bcp 173005 172535 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 protein_id gnl|my_center|LOCUS_01460 173577 173002 gene locus_tag LOCUS_01470 173577 173002 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001576288.1 protein_id gnl|my_center|LOCUS_01470 173723 174601 gene locus_tag LOCUS_01480 gene dapA 173723 174601 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098227.1 protein_id gnl|my_center|LOCUS_01480 174618 175652 gene locus_tag LOCUS_01490 gene bamC 174618 175652 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331881.1 protein_id gnl|my_center|LOCUS_01490 175760 176473 gene locus_tag LOCUS_01500 175760 176473 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501631.1 protein_id gnl|my_center|LOCUS_01500 176589 177461 gene locus_tag LOCUS_01510 176589 177461 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267503.1 protein_id gnl|my_center|LOCUS_01510 178148 178277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 178414 179601 gene locus_tag LOCUS_01520 178414 179601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 179674 180372 gene locus_tag LOCUS_01530 gene ypfH 179674 180372 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098223.1 protein_id gnl|my_center|LOCUS_01530 180611 180411 gene locus_tag LOCUS_01540 180611 180411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 181751 180624 gene locus_tag LOCUS_01550 gene dapE 181751 180624 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277830.1 protein_id gnl|my_center|LOCUS_01550 182111 181755 gene locus_tag LOCUS_01560 182111 181755 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703145.1 protein_id gnl|my_center|LOCUS_01560 185940 182827 gene locus_tag LOCUS_01570 gene acrD 185940 182827 CDS product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263083.1 protein_id gnl|my_center|LOCUS_01570 187836 186133 gene locus_tag LOCUS_01580 gene narQ 187836 186133 CDS product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296285.1 protein_id gnl|my_center|LOCUS_01580 188050 190029 gene locus_tag LOCUS_01590 gene aegA 188050 190029 CDS product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078843.1 protein_id gnl|my_center|LOCUS_01590 190096 190671 gene locus_tag LOCUS_01600 gene nudK 190096 190671 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084037.1 protein_id gnl|my_center|LOCUS_01600 190798 191838 gene locus_tag LOCUS_01610 190798 191838 CDS product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098215.1 protein_id gnl|my_center|LOCUS_01610 193822 191828 gene locus_tag LOCUS_01620 gene tkt 193822 191828 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098214.1 protein_id gnl|my_center|LOCUS_01620 194793 193843 gene locus_tag LOCUS_01630 gene tal 194793 193843 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098213.1 protein_id gnl|my_center|LOCUS_01630 195073 197352 gene locus_tag LOCUS_01640 gene maeB 195073 197352 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098212.1 protein_id gnl|my_center|LOCUS_01640 198413 197511 gene locus_tag LOCUS_01650 gene hemF 198413 197511 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801365.1 protein_id gnl|my_center|LOCUS_01650 199285 198413 gene locus_tag LOCUS_01660 gene amiA 199285 198413 CDS product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098210.1 protein_id gnl|my_center|LOCUS_01660 199497 199922 gene locus_tag LOCUS_01670 199497 199922 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098209.1 protein_id gnl|my_center|LOCUS_01670 200955 199960 gene locus_tag LOCUS_01680 200955 199960 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971188.1 protein_id gnl|my_center|LOCUS_01680 201069 201503 gene locus_tag LOCUS_01690 201069 201503 CDS product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098208.1 protein_id gnl|my_center|LOCUS_01690 201566 202138 gene locus_tag LOCUS_01700 201566 202138 CDS product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838971.1 protein_id gnl|my_center|LOCUS_01700 202231 203127 gene locus_tag LOCUS_01710 202231 203127 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098206.1 protein_id gnl|my_center|LOCUS_01710 203275 204291 gene locus_tag LOCUS_01720 gene cysP 203275 204291 CDS product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290222.1 protein_id gnl|my_center|LOCUS_01720 204291 205124 gene locus_tag LOCUS_01730 gene cysT 204291 205124 CDS product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458408.1 protein_id gnl|my_center|LOCUS_01730 205124 205999 gene locus_tag LOCUS_01740 gene cysW 205124 205999 CDS product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703135.1 protein_id gnl|my_center|LOCUS_01740 205989 207083 gene locus_tag LOCUS_01750 gene cysA 205989 207083 CDS product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021036.1 protein_id gnl|my_center|LOCUS_01750 207188 208099 gene locus_tag LOCUS_01760 gene cysM 207188 208099 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105467.1 protein_id gnl|my_center|LOCUS_01760 208867 208139 gene locus_tag LOCUS_01770 208867 208139 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263738.1 protein_id gnl|my_center|LOCUS_01770 210170 208878 gene locus_tag LOCUS_01780 gene ptsJ 210170 208878 CDS product transcriptional regulator PtsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565130.1 protein_id gnl|my_center|LOCUS_01780 210253 211119 gene locus_tag LOCUS_01790 gene pdxK 210253 211119 CDS product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529606.1 protein_id gnl|my_center|LOCUS_01790 211694 211185 gene locus_tag LOCUS_01800 gene crr 211694 211185 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522253.1 protein_id gnl|my_center|LOCUS_01800 213461 211704 gene locus_tag LOCUS_01810 gene ptsI 213461 211704 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703130.1 protein_id gnl|my_center|LOCUS_01810 213765 213508 gene locus_tag LOCUS_01820 gene ptsH 213765 213508 CDS product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 protein_id gnl|my_center|LOCUS_01820 215119 214148 gene locus_tag LOCUS_01830 gene cysK 215119 214148 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878168.1 protein_id gnl|my_center|LOCUS_01830 216019 215258 gene locus_tag LOCUS_01840 gene cysZ 216019 215258 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254835.1 protein_id gnl|my_center|LOCUS_01840 216250 217218 gene locus_tag LOCUS_01850 216250 217218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 217288 219303 gene locus_tag LOCUS_01860 gene ligA 217288 219303 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098195.1 protein_id gnl|my_center|LOCUS_01860 219408 219769 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 220871 219870 gene locus_tag LOCUS_01870 220871 219870 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098194.1 protein_id gnl|my_center|LOCUS_01870 220960 221883 gene locus_tag LOCUS_01880 220960 221883 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878162.1 protein_id gnl|my_center|LOCUS_01880 222215 221880 gene locus_tag LOCUS_01890 222215 221880 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098192.1 protein_id gnl|my_center|LOCUS_01890 222778 222703 gene locus_tag LOCUS_t00010 222778 222703 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 222858 222783 gene locus_tag LOCUS_t00020 222858 222783 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 222981 222906 gene locus_tag LOCUS_t00030 222981 222906 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 223102 223027 gene locus_tag LOCUS_t00040 223102 223027 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 223359 224774 gene locus_tag LOCUS_01900 gene gltX 223359 224774 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878160.1 protein_id gnl|my_center|LOCUS_01900 225199 224807 gene locus_tag LOCUS_01910 225199 224807 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826515.1 protein_id gnl|my_center|LOCUS_01910 225565 225203 gene locus_tag LOCUS_01920 225565 225203 CDS product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098189.1 protein_id gnl|my_center|LOCUS_01920 225786 225861 gene locus_tag LOCUS_t00050 225786 225861 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 225902 225977 gene locus_tag LOCUS_t00060 225902 225977 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 227295 226093 gene locus_tag LOCUS_01930 gene nupC 227295 226093 CDS product nucleoside permease NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376341.1 protein_id gnl|my_center|LOCUS_01930 227708 228883 gene locus_tag LOCUS_01940 227708 228883 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420300.1 protein_id gnl|my_center|LOCUS_01940 229249 228923 gene locus_tag LOCUS_01950 gene ypeC 229249 228923 CDS product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490091.1 protein_id gnl|my_center|LOCUS_01950 230356 229358 gene locus_tag LOCUS_01960 gene mgrA 230356 229358 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878153.1 protein_id gnl|my_center|LOCUS_01960 231693 230461 gene locus_tag LOCUS_01970 231693 230461 CDS product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098182.1 protein_id gnl|my_center|LOCUS_01970 231869 232834 gene locus_tag LOCUS_01980 gene glk 231869 232834 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098181.1 protein_id gnl|my_center|LOCUS_01980 233559 232831 gene locus_tag LOCUS_01990 233559 232831 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098180.1 protein_id gnl|my_center|LOCUS_01990 234372 233572 gene locus_tag LOCUS_02000 234372 233572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 234397 234891 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 234912 235238 gene locus_tag LOCUS_02010 234912 235238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 235186 235503 gene locus_tag LOCUS_02020 235186 235503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 235686 235820 gene locus_tag LOCUS_02030 235686 235820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 236191 237429 gene locus_tag LOCUS_02040 gene alaC 236191 237429 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878147.1 protein_id gnl|my_center|LOCUS_02040 238756 237977 gene locus_tag LOCUS_02050 238756 237977 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035567.1 protein_id gnl|my_center|LOCUS_02050 238826 239734 gene locus_tag LOCUS_02060 238826 239734 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974533.1 protein_id gnl|my_center|LOCUS_02060 241909 240968 gene locus_tag LOCUS_02070 241909 240968 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703651.1 protein_id gnl|my_center|LOCUS_02070 242217 241906 gene locus_tag LOCUS_02080 242217 241906 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915845.1 protein_id gnl|my_center|LOCUS_02080 242806 242585 gene locus_tag LOCUS_02090 242806 242585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 243747 243004 gene locus_tag LOCUS_02100 243747 243004 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105226.1 protein_id gnl|my_center|LOCUS_02100 243719 243874 gene locus_tag LOCUS_02110 243719 243874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 244059 244550 gene locus_tag LOCUS_02120 244059 244550 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808849.1 protein_id gnl|my_center|LOCUS_02120 244735 244661 gene locus_tag LOCUS_t00070 244735 244661 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 245768 244722 gene locus_tag LOCUS_02130 245768 244722 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098160.1 protein_id gnl|my_center|LOCUS_02130 246060 246812 gene locus_tag LOCUS_02140 gene mlaA 246060 246812 CDS product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776787.1 protein_id gnl|my_center|LOCUS_02140 248262 246904 gene locus_tag LOCUS_02150 gene fadL 248262 246904 CDS product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420287.1 protein_id gnl|my_center|LOCUS_02150 248633 248917 gene locus_tag LOCUS_02160 248633 248917 CDS product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030904.1 protein_id gnl|my_center|LOCUS_02160 249078 250388 gene locus_tag LOCUS_02170 gene fadI 249078 250388 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420286.1 protein_id gnl|my_center|LOCUS_02170 250388 252535 gene locus_tag LOCUS_02180 gene fadJ 250388 252535 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425010.1 protein_id gnl|my_center|LOCUS_02180 252731 253216 gene locus_tag LOCUS_02190 gene sixA 252731 253216 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832802.1 protein_id gnl|my_center|LOCUS_02190 254023 253472 gene locus_tag LOCUS_02200 gene smrB 254023 253472 CDS product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098153.1 protein_id gnl|my_center|LOCUS_02200 254187 255119 gene locus_tag LOCUS_02210 gene prmB 254187 255119 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098152.1 protein_id gnl|my_center|LOCUS_02210 255153 256238 gene locus_tag LOCUS_02220 gene aroC 255153 256238 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706181.1 protein_id gnl|my_center|LOCUS_02220 256242 257063 gene locus_tag LOCUS_02230 gene mepA 256242 257063 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098150.1 protein_id gnl|my_center|LOCUS_02230 257063 257875 gene locus_tag LOCUS_02240 257063 257875 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098149.1 protein_id gnl|my_center|LOCUS_02240 257872 258417 gene locus_tag LOCUS_02250 257872 258417 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098148.1 protein_id gnl|my_center|LOCUS_02250 258427 258705 gene locus_tag LOCUS_02260 258427 258705 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098147.1 protein_id gnl|my_center|LOCUS_02260 259023 259769 gene locus_tag LOCUS_02270 259023 259769 CDS product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463476.1 protein_id gnl|my_center|LOCUS_02270 259822 262245 gene locus_tag LOCUS_02280 259822 262245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02280 263599 264411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 264431 265111 gene locus_tag LOCUS_02290 264431 265111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 265120 265626 gene locus_tag LOCUS_02300 265120 265626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 265781 266302 gene locus_tag LOCUS_02310 265781 266302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 266299 266511 gene locus_tag LOCUS_02320 266299 266511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 266945 267436 gene locus_tag LOCUS_02330 266945 267436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 267433 267846 gene locus_tag LOCUS_02340 267433 267846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 267964 268377 gene locus_tag LOCUS_02350 267964 268377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 270462 268465 gene locus_tag LOCUS_02360 gene mnmC 270462 268465 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683799.1 protein_id gnl|my_center|LOCUS_02360 270622 271839 gene locus_tag LOCUS_02370 gene fabB 270622 271839 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098145.1 protein_id gnl|my_center|LOCUS_02370 272049 273224 gene locus_tag LOCUS_02380 272049 273224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098144.1 protein_id gnl|my_center|LOCUS_02380 273456 274886 gene locus_tag LOCUS_02390 273456 274886 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098239.1 protein_id gnl|my_center|LOCUS_02390 275971 274964 gene locus_tag LOCUS_02400 gene flk 275971 274964 CDS product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098143.1 protein_id gnl|my_center|LOCUS_02400 276109 277221 gene locus_tag LOCUS_02410 gene pdxB 276109 277221 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706175.1 protein_id gnl|my_center|LOCUS_02410 277283 278296 gene locus_tag LOCUS_02420 277283 278296 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098141.1 protein_id gnl|my_center|LOCUS_02420 278296 279108 gene locus_tag LOCUS_02430 gene truA 278296 279108 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098140.1 protein_id gnl|my_center|LOCUS_02430 279134 279793 gene locus_tag LOCUS_02440 279134 279793 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 protein_id gnl|my_center|LOCUS_02440 279897 280811 gene locus_tag LOCUS_02450 gene accD 279897 280811 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118383.1 protein_id gnl|my_center|LOCUS_02450 280880 281977 gene locus_tag LOCUS_02460 gene folC 280880 281977 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098137.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02460 281940 282149 gene locus_tag LOCUS_02470 281940 282149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02470 282166 282810 gene locus_tag LOCUS_02480 gene dedD 282166 282810 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832787.1 protein_id gnl|my_center|LOCUS_02480 283038 283526 gene locus_tag LOCUS_02490 gene cvpA 283038 283526 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 protein_id gnl|my_center|LOCUS_02490 283547 285064 gene locus_tag LOCUS_02500 gene purF 283547 285064 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334231.1 protein_id gnl|my_center|LOCUS_02500 285163 285735 gene locus_tag LOCUS_02510 285163 285735 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098133.1 protein_id gnl|my_center|LOCUS_02510 286010 286792 gene locus_tag LOCUS_02520 gene argT 286010 286792 CDS product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098132.1 protein_id gnl|my_center|LOCUS_02520 287045 287827 gene locus_tag LOCUS_02530 gene hisJ 287045 287827 CDS product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731871.1 protein_id gnl|my_center|LOCUS_02530 287912 288598 gene locus_tag LOCUS_02540 287912 288598 CDS product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098131.1 protein_id gnl|my_center|LOCUS_02540 288595 289308 gene locus_tag LOCUS_02550 288595 289308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502590.1 protein_id gnl|my_center|LOCUS_02550 289316 290089 gene locus_tag LOCUS_02560 gene hisP 289316 290089 CDS product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293601.1 protein_id gnl|my_center|LOCUS_02560 291069 290098 gene locus_tag LOCUS_02570 291069 290098 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211003.1 protein_id gnl|my_center|LOCUS_02570 291266 292666 gene locus_tag LOCUS_02580 291266 292666 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211002.1 protein_id gnl|my_center|LOCUS_02580 292676 294136 gene locus_tag LOCUS_02590 gene xylB 292676 294136 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706072.1 protein_id gnl|my_center|LOCUS_02590 294200 295474 gene locus_tag LOCUS_02600 294200 295474 CDS product RbtT/DalT/CsbX family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706077.1 protein_id gnl|my_center|LOCUS_02600 296002 295505 gene locus_tag LOCUS_02610 296002 295505 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446135.1 protein_id gnl|my_center|LOCUS_02610 296974 296081 gene locus_tag LOCUS_02620 296974 296081 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028341.1 protein_id gnl|my_center|LOCUS_02620 297355 296993 gene locus_tag LOCUS_02630 gene folX 297355 296993 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365570.1 protein_id gnl|my_center|LOCUS_02630 298044 297415 gene locus_tag LOCUS_02640 gene yfcG 298044 297415 CDS product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566559.1 protein_id gnl|my_center|LOCUS_02640 298168 298812 gene locus_tag LOCUS_02650 gene yfcF 298168 298812 CDS product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365572.1 protein_id gnl|my_center|LOCUS_02650 298868 299419 gene locus_tag LOCUS_02660 gene yfcE 298868 299419 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098124.1 protein_id gnl|my_center|LOCUS_02660 299472 300017 gene locus_tag LOCUS_02670 gene yfcD 299472 300017 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098123.1 protein_id gnl|my_center|LOCUS_02670 300070 300270 gene locus_tag LOCUS_02680 300070 300270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 300294 301211 gene locus_tag LOCUS_02690 300294 301211 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226829.1 protein_id gnl|my_center|LOCUS_02690 301215 302603 gene locus_tag LOCUS_02700 301215 302603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02700 302632 303021 gene locus_tag LOCUS_02710 302632 303021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02710 305266 303128 gene locus_tag LOCUS_02720 gene pta 305266 303128 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098116.1 protein_id gnl|my_center|LOCUS_02720 306532 305330 gene locus_tag LOCUS_02730 gene ackA 306532 305330 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095689.1 protein_id gnl|my_center|LOCUS_02730 306870 307325 gene locus_tag LOCUS_02740 gene yfbV 306870 307325 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098114.1 protein_id gnl|my_center|LOCUS_02740 307407 307904 gene locus_tag LOCUS_02750 307407 307904 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426135.1 protein_id gnl|my_center|LOCUS_02750 307915 308574 gene locus_tag LOCUS_02760 307915 308574 CDS product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013205.1 protein_id gnl|my_center|LOCUS_02760 308651 310483 gene locus_tag LOCUS_02770 308651 310483 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098111.1 protein_id gnl|my_center|LOCUS_02770 310551 310954 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 311562 310963 gene locus_tag LOCUS_02780 gene yfbR 311562 310963 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706162.1 protein_id gnl|my_center|LOCUS_02780 312856 311642 gene locus_tag LOCUS_02790 gene alaA 312856 311642 CDS product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098109.1 protein_id gnl|my_center|LOCUS_02790 313733 314671 gene locus_tag LOCUS_02800 gene lrhA 313733 314671 CDS product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 protein_id gnl|my_center|LOCUS_02800 315310 315113 gene locus_tag LOCUS_02810 315310 315113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 315295 315738 gene locus_tag LOCUS_02820 gene nuoA 315295 315738 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062993.1 protein_id gnl|my_center|LOCUS_02820 315754 316416 gene locus_tag LOCUS_02830 gene nuoB 315754 316416 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386728.1 protein_id gnl|my_center|LOCUS_02830 316506 318308 gene locus_tag LOCUS_02840 gene nuoC 316506 318308 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098106.1 protein_id gnl|my_center|LOCUS_02840 318311 318811 gene locus_tag LOCUS_02850 gene nuoE 318311 318811 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861486.1 protein_id gnl|my_center|LOCUS_02850 318808 320145 gene locus_tag LOCUS_02860 gene nuoF 318808 320145 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365587.1 protein_id gnl|my_center|LOCUS_02860 320292 323018 gene locus_tag LOCUS_02870 gene nuoG 320292 323018 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098105.1 protein_id gnl|my_center|LOCUS_02870 323015 323992 gene locus_tag LOCUS_02880 gene nuoH 323015 323992 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098104.1 protein_id gnl|my_center|LOCUS_02880 324007 324549 gene locus_tag LOCUS_02890 gene nuoI 324007 324549 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172747.1 protein_id gnl|my_center|LOCUS_02890 324561 325115 gene locus_tag LOCUS_02900 gene nuoJ 324561 325115 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393522.1 protein_id gnl|my_center|LOCUS_02900 325112 325414 gene locus_tag LOCUS_02910 gene nuoK 325112 325414 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612644.1 protein_id gnl|my_center|LOCUS_02910 325411 327252 gene locus_tag LOCUS_02920 gene nuoL 325411 327252 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 protein_id gnl|my_center|LOCUS_02920 327451 328980 gene locus_tag LOCUS_02930 gene nuoM 327451 328980 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098102.1 protein_id gnl|my_center|LOCUS_02930 328987 330444 gene locus_tag LOCUS_02940 gene nuoN 328987 330444 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098101.1 protein_id gnl|my_center|LOCUS_02940 330471 330827 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 331062 331793 gene locus_tag LOCUS_02950 331062 331793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 332893 331976 gene locus_tag LOCUS_02960 gene rnz 332893 331976 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098099.1 protein_id gnl|my_center|LOCUS_02960 332965 333426 gene locus_tag LOCUS_02970 332965 333426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420256.1 protein_id gnl|my_center|LOCUS_02970 333480 333782 gene locus_tag LOCUS_02980 gene elaB 333480 333782 CDS product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028061.1 protein_id gnl|my_center|LOCUS_02980 333990 335624 gene locus_tag LOCUS_02990 gene menD 333990 335624 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306466.1 protein_id gnl|my_center|LOCUS_02990 335624 336382 gene locus_tag LOCUS_03000 gene menH 335624 336382 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098094.1 protein_id gnl|my_center|LOCUS_03000 336393 337250 gene locus_tag LOCUS_03010 gene menB 336393 337250 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098093.1 protein_id gnl|my_center|LOCUS_03010 337250 338215 gene locus_tag LOCUS_03020 gene menC 337250 338215 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098092.1 protein_id gnl|my_center|LOCUS_03020 338212 339567 gene locus_tag LOCUS_03030 gene menE 338212 339567 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144672.1 protein_id gnl|my_center|LOCUS_03030 339663 340607 gene locus_tag LOCUS_03040 339663 340607 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703150.1 protein_id gnl|my_center|LOCUS_03040 340783 341322 gene locus_tag LOCUS_03050 340783 341322 CDS product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296251.1 protein_id gnl|my_center|LOCUS_03050 341423 342622 gene locus_tag LOCUS_03060 341423 342622 CDS product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935685.1 protein_id gnl|my_center|LOCUS_03060 343494 342619 gene locus_tag LOCUS_03070 343494 342619 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176736.1 protein_id gnl|my_center|LOCUS_03070 343676 344866 gene locus_tag LOCUS_03080 343676 344866 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660244.1 protein_id gnl|my_center|LOCUS_03080 345214 344960 gene locus_tag LOCUS_03090 gene yfaE 345214 344960 CDS product ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533921.1 protein_id gnl|my_center|LOCUS_03090 346344 345214 gene locus_tag LOCUS_03100 gene nrdB 346344 345214 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365618.1 protein_id gnl|my_center|LOCUS_03100 348744 346459 gene locus_tag LOCUS_03110 gene nrdA 348744 346459 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076502.1 protein_id gnl|my_center|LOCUS_03110 349820 349080 gene locus_tag LOCUS_03120 gene ubiG 349820 349080 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098010.1 protein_id gnl|my_center|LOCUS_03120 349979 352609 gene locus_tag LOCUS_03130 gene gyrA 349979 352609 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 protein_id gnl|my_center|LOCUS_03130 352724 355570 gene locus_tag LOCUS_03140 gene rcsC 352724 355570 CDS product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 protein_id gnl|my_center|LOCUS_03140 356254 355604 gene locus_tag LOCUS_03150 gene rcsB 356254 355604 CDS product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365624.1 protein_id gnl|my_center|LOCUS_03150 358940 356271 gene locus_tag LOCUS_03160 gene rcsD 358940 356271 CDS product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619743.1 protein_id gnl|my_center|LOCUS_03160 359780 360907 gene locus_tag LOCUS_03170 359780 360907 CDS product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865526.1 protein_id gnl|my_center|LOCUS_03170 361025 362059 gene locus_tag LOCUS_03180 gene apbE 361025 362059 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706140.1 protein_id gnl|my_center|LOCUS_03180 362132 363205 gene locus_tag LOCUS_03190 gene ada 362132 363205 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786370.1 protein_id gnl|my_center|LOCUS_03190 363205 363855 gene locus_tag LOCUS_03200 gene alkB 363205 363855 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884975.1 protein_id gnl|my_center|LOCUS_03200 363929 365572 gene locus_tag LOCUS_03210 363929 365572 CDS product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098002.1 protein_id gnl|my_center|LOCUS_03210 365885 365589 gene locus_tag LOCUS_03220 365885 365589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 365796 366959 gene locus_tag LOCUS_03230 gene mgtE 365796 366959 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098001.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03230 366908 367138 gene locus_tag LOCUS_03240 366908 367138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03240 368336 367101 gene locus_tag LOCUS_03250 368336 367101 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098000.1 protein_id gnl|my_center|LOCUS_03250 368612 370270 gene locus_tag LOCUS_03260 gene mqo 368612 370270 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097999.1 protein_id gnl|my_center|LOCUS_03260 370696 370352 gene locus_tag LOCUS_03270 370696 370352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 371087 371011 gene locus_tag LOCUS_t00080 371087 371011 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 372924 371164 gene locus_tag LOCUS_03280 gene yejM 372924 371164 CDS product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097996.1 protein_id gnl|my_center|LOCUS_03280 373169 372942 gene locus_tag LOCUS_03290 373169 372942 CDS product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135586.1 protein_id gnl|my_center|LOCUS_03290 373307 374314 gene locus_tag LOCUS_03300 gene yejK 373307 374314 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050806.1 protein_id gnl|my_center|LOCUS_03300 374378 374693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 375096 374812 gene locus_tag LOCUS_03310 gene rplY 375096 374812 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365674.1 protein_id gnl|my_center|LOCUS_03310 376995 375235 gene locus_tag LOCUS_03320 376995 375235 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706128.1 protein_id gnl|my_center|LOCUS_03320 377148 377855 gene locus_tag LOCUS_03330 gene rsuA 377148 377855 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097990.1 protein_id gnl|my_center|LOCUS_03330 377871 379064 gene locus_tag LOCUS_03340 gene bcr 377871 379064 CDS product multidrug efflux MFS transporter Bcr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213385.1 protein_id gnl|my_center|LOCUS_03340 379517 379858 gene locus_tag LOCUS_03350 379517 379858 CDS product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094639.1 protein_id gnl|my_center|LOCUS_03350 381451 379862 gene locus_tag LOCUS_03360 gene yejF 381451 379862 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097987.1 protein_id gnl|my_center|LOCUS_03360 382478 381453 gene locus_tag LOCUS_03370 382478 381453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088916.1 protein_id gnl|my_center|LOCUS_03370 383578 382478 gene locus_tag LOCUS_03380 383578 382478 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501623.1 protein_id gnl|my_center|LOCUS_03380 385396 383588 gene locus_tag LOCUS_03390 385396 383588 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602410.1 protein_id gnl|my_center|LOCUS_03390 387047 385491 gene locus_tag LOCUS_03400 387047 385491 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097983.1 protein_id gnl|my_center|LOCUS_03400 387698 387237 gene locus_tag LOCUS_03410 gene mepS 387698 387237 CDS product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241011.1 protein_id gnl|my_center|LOCUS_03410 388929 388234 gene locus_tag LOCUS_03420 388929 388234 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136374357.1 protein_id gnl|my_center|LOCUS_03420 389946 388969 gene locus_tag LOCUS_03430 gene yeiR 389946 388969 CDS product zinc-binding GTPase YeiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198816.1 protein_id gnl|my_center|LOCUS_03430 391526 390060 gene locus_tag LOCUS_03440 391526 390060 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091922.1 protein_id gnl|my_center|LOCUS_03440 391735 392925 gene locus_tag LOCUS_03450 gene uxuA 391735 392925 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097978.1 protein_id gnl|my_center|LOCUS_03450 393585 393013 gene locus_tag LOCUS_03460 393585 393013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03460 394972 393995 gene locus_tag LOCUS_03470 gene idnR 394972 393995 CDS product DNA-binding transcriptional regulator IdnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304655.1 protein_id gnl|my_center|LOCUS_03470 396311 395067 gene locus_tag LOCUS_03480 396311 395067 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094976.1 protein_id gnl|my_center|LOCUS_03480 397240 396476 gene locus_tag LOCUS_03490 gene idnO 397240 396476 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210264.1 protein_id gnl|my_center|LOCUS_03490 397650 398780 gene locus_tag LOCUS_03500 gene fruB 397650 398780 CDS product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487294.1 protein_id gnl|my_center|LOCUS_03500 398780 399718 gene locus_tag LOCUS_03510 gene fruK 398780 399718 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500936.1 protein_id gnl|my_center|LOCUS_03510 399735 401426 gene locus_tag LOCUS_03520 gene fruA 399735 401426 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854447.1 protein_id gnl|my_center|LOCUS_03520 402498 401641 gene locus_tag LOCUS_03530 gene nfo 402498 401641 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 protein_id gnl|my_center|LOCUS_03530 403654 402605 gene locus_tag LOCUS_03540 403654 402605 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137966.1 protein_id gnl|my_center|LOCUS_03540 404376 404712 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 405136 406605 gene locus_tag LOCUS_03550 405136 406605 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097961.1 protein_id gnl|my_center|LOCUS_03550 406855 408837 gene locus_tag LOCUS_03560 gene cirA 406855 408837 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488257.1 protein_id gnl|my_center|LOCUS_03560 409785 408949 gene locus_tag LOCUS_03570 gene yeiG 409785 408949 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425456.1 protein_id gnl|my_center|LOCUS_03570 409930 411057 gene locus_tag LOCUS_03580 409930 411057 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097958.1 protein_id gnl|my_center|LOCUS_03580 410997 411197 gene locus_tag LOCUS_03590 410997 411197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 411181 411849 gene locus_tag LOCUS_03600 gene folE 411181 411849 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097957.1 protein_id gnl|my_center|LOCUS_03600 411867 413027 gene locus_tag LOCUS_03610 gene yeiB 411867 413027 CDS product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706109.1 protein_id gnl|my_center|LOCUS_03610 413183 414208 gene locus_tag LOCUS_03620 gene galS 413183 414208 CDS product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097955.1 protein_id gnl|my_center|LOCUS_03620 414501 415499 gene locus_tag LOCUS_03630 gene mglB 414501 415499 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036964.1 protein_id gnl|my_center|LOCUS_03630 415579 417099 gene locus_tag LOCUS_03640 gene mglA 415579 417099 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883073.1 protein_id gnl|my_center|LOCUS_03640 417115 418125 gene locus_tag LOCUS_03650 gene mglC 417115 418125 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097952.1 protein_id gnl|my_center|LOCUS_03650 419977 418172 gene locus_tag LOCUS_03660 419977 418172 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036278.1 protein_id gnl|my_center|LOCUS_03660 421001 420117 gene locus_tag LOCUS_03670 421001 420117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 422314 421469 gene locus_tag LOCUS_03680 422314 421469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 423887 423003 gene locus_tag LOCUS_03690 423887 423003 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705352.1 protein_id gnl|my_center|LOCUS_03690 424202 424029 gene locus_tag LOCUS_03700 424202 424029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 424463 424690 gene locus_tag LOCUS_03710 424463 424690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 424898 425320 gene locus_tag LOCUS_03720 424898 425320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 426043 425327 gene locus_tag LOCUS_03730 gene sanA 426043 425327 CDS product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920064.1 protein_id gnl|my_center|LOCUS_03730 427042 426161 gene locus_tag LOCUS_03740 gene cdd 427042 426161 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097949.1 protein_id gnl|my_center|LOCUS_03740 427867 427172 gene locus_tag LOCUS_03750 427867 427172 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968198.1 protein_id gnl|my_center|LOCUS_03750 428262 427864 gene locus_tag LOCUS_03760 428262 427864 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 protein_id gnl|my_center|LOCUS_03760 429272 428370 gene locus_tag LOCUS_03770 429272 428370 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703160.1 protein_id gnl|my_center|LOCUS_03770 429368 429910 gene locus_tag LOCUS_03780 429368 429910 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095190.1 protein_id gnl|my_center|LOCUS_03780 429978 430916 gene locus_tag LOCUS_03790 gene dusC 429978 430916 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706102.1 protein_id gnl|my_center|LOCUS_03790 431253 432692 gene locus_tag LOCUS_03800 gene mdtQ 431253 432692 CDS product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081453.1 protein_id gnl|my_center|LOCUS_03800 432757 433524 gene locus_tag LOCUS_03810 432757 433524 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097944.1 protein_id gnl|my_center|LOCUS_03810 434106 433525 gene locus_tag LOCUS_03820 434106 433525 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706097.1 protein_id gnl|my_center|LOCUS_03820 434269 434553 gene locus_tag LOCUS_03830 434269 434553 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372584.1 protein_id gnl|my_center|LOCUS_03830 434544 435026 gene locus_tag LOCUS_03840 434544 435026 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405248.1 protein_id gnl|my_center|LOCUS_03840 435107 435694 gene locus_tag LOCUS_03850 435107 435694 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017057.1 protein_id gnl|my_center|LOCUS_03850 435864 436811 gene locus_tag LOCUS_03860 gene pbpG 435864 436811 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295432.1 protein_id gnl|my_center|LOCUS_03860 437404 436850 gene locus_tag LOCUS_03870 437404 436850 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097939.1 protein_id gnl|my_center|LOCUS_03870 439251 437545 gene locus_tag LOCUS_03880 gene dld 439251 437545 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095234.1 protein_id gnl|my_center|LOCUS_03880 439426 441723 gene locus_tag LOCUS_03890 gene bglX 439426 441723 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871504.1 protein_id gnl|my_center|LOCUS_03890 441915 442826 gene locus_tag LOCUS_03900 gene osmF 441915 442826 CDS product glycine betaine ABC transporter substrate-binding protein OsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131268.1 protein_id gnl|my_center|LOCUS_03900 442829 443983 gene locus_tag LOCUS_03910 442829 443983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097935.1 protein_id gnl|my_center|LOCUS_03910 443980 444927 gene locus_tag LOCUS_03920 gene yehX 443980 444927 CDS product glycine betaine ABC transporter ATP binding protein YehX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569315.1 protein_id gnl|my_center|LOCUS_03920 445307 445977 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 445986 446159 gene locus_tag LOCUS_03930 445986 446159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 446163 446399 gene locus_tag LOCUS_03940 446163 446399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 446651 448339 gene locus_tag LOCUS_03950 446651 448339 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097931.1 protein_id gnl|my_center|LOCUS_03950 448333 449052 gene locus_tag LOCUS_03960 gene btsR 448333 449052 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097930.1 protein_id gnl|my_center|LOCUS_03960 449101 449574 gene locus_tag LOCUS_03970 449101 449574 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706088.1 protein_id gnl|my_center|LOCUS_03970 450068 449610 gene locus_tag LOCUS_03980 450068 449610 CDS product YehR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703137.1 protein_id gnl|my_center|LOCUS_03980 452229 450223 gene locus_tag LOCUS_03990 gene metG 452229 450223 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301615.1 protein_id gnl|my_center|LOCUS_03990 452395 453504 gene locus_tag LOCUS_04000 gene apbC 452395 453504 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005448.1 protein_id gnl|my_center|LOCUS_04000 453947 453522 gene locus_tag LOCUS_04010 453947 453522 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017899343.1 protein_id gnl|my_center|LOCUS_04010 454276 453947 gene locus_tag LOCUS_04020 454276 453947 CDS product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365753.1 protein_id gnl|my_center|LOCUS_04020 455513 454506 gene locus_tag LOCUS_04030 455513 454506 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703848.1 protein_id gnl|my_center|LOCUS_04030 455802 456590 gene locus_tag LOCUS_04040 gene thiM 455802 456590 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195605.1 protein_id gnl|my_center|LOCUS_04040 456587 457387 gene locus_tag LOCUS_04050 gene thiD 456587 457387 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822268.1 protein_id gnl|my_center|LOCUS_04050 457594 458646 gene locus_tag LOCUS_04060 gene fbaB 457594 458646 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365768.1 protein_id gnl|my_center|LOCUS_04060 459413 458685 gene locus_tag LOCUS_04070 459413 458685 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267190.1 protein_id gnl|my_center|LOCUS_04070 460773 461287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 461550 462032 gene locus_tag LOCUS_04080 461550 462032 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259757.1 protein_id gnl|my_center|LOCUS_04080 462044 463351 gene locus_tag LOCUS_04090 462044 463351 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345269.1 protein_id gnl|my_center|LOCUS_04090 464344 463445 gene locus_tag LOCUS_04100 gene yegS 464344 463445 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273393.1 protein_id gnl|my_center|LOCUS_04100 465983 464622 gene locus_tag LOCUS_04110 gene yegQ 465983 464622 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476014.1 protein_id gnl|my_center|LOCUS_04110 466811 466098 gene locus_tag LOCUS_04120 466811 466098 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586683.1 protein_id gnl|my_center|LOCUS_04120 467656 466934 gene locus_tag LOCUS_04130 gene baeR 467656 466934 CDS product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097904.1 protein_id gnl|my_center|LOCUS_04130 469095 467653 gene locus_tag LOCUS_04140 gene baeS 469095 467653 CDS product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097903.1 protein_id gnl|my_center|LOCUS_04140 470201 469092 gene locus_tag LOCUS_04150 470201 469092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420156.1 protein_id gnl|my_center|LOCUS_04150 470223 470635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 473966 470889 gene locus_tag LOCUS_04160 gene mdtC 473966 470889 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706066.1 protein_id gnl|my_center|LOCUS_04160 477089 473967 gene locus_tag LOCUS_04170 gene mdtB 477089 473967 CDS product multidrug efflux RND transporter permease subunit MdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197910.1 protein_id gnl|my_center|LOCUS_04170 478168 477089 gene locus_tag LOCUS_04180 gene mdtA 478168 477089 CDS product multidrug efflux RND transporter subunit MdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678979.1 protein_id gnl|my_center|LOCUS_04180 479019 478465 gene locus_tag LOCUS_04190 479019 478465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 479549 479773 gene locus_tag LOCUS_04200 479549 479773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 481414 480062 gene locus_tag LOCUS_04210 gene yegD 481414 480062 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469706.1 protein_id gnl|my_center|LOCUS_04210 481549 482391 gene locus_tag LOCUS_04220 gene alkA 481549 482391 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288348.1 protein_id gnl|my_center|LOCUS_04220 485557 482384 gene locus_tag LOCUS_04230 485557 482384 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420943.1 protein_id gnl|my_center|LOCUS_04230 485656 486017 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 486280 487074 gene locus_tag LOCUS_04240 gene udk 486280 487074 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132082.1 protein_id gnl|my_center|LOCUS_04240 487156 487737 gene locus_tag LOCUS_04250 gene dcd 487156 487737 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234783.1 protein_id gnl|my_center|LOCUS_04250 487763 489616 gene locus_tag LOCUS_04260 gene asmA 487763 489616 CDS product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097885.1 protein_id gnl|my_center|LOCUS_04260 491330 489747 gene locus_tag LOCUS_04270 491330 489747 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454718.1 protein_id gnl|my_center|LOCUS_04270 492116 493162 gene locus_tag LOCUS_04280 492116 493162 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014170829.1 protein_id gnl|my_center|LOCUS_04280 493168 493611 gene locus_tag LOCUS_04290 gene wzb 493168 493611 CDS product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097882.1 protein_id gnl|my_center|LOCUS_04290 493614 495776 gene locus_tag LOCUS_04300 gene wzc 493614 495776 CDS product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097881.1 protein_id gnl|my_center|LOCUS_04300 495804 496685 gene locus_tag LOCUS_04310 gene wcaA 495804 496685 CDS product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 protein_id gnl|my_center|LOCUS_04310 496685 497176 gene locus_tag LOCUS_04320 gene wcaB 496685 497176 CDS product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888736.1 protein_id gnl|my_center|LOCUS_04320 497173 498390 gene locus_tag LOCUS_04330 gene wcaC 497173 498390 CDS product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097878.1 protein_id gnl|my_center|LOCUS_04330 498365 499582 gene locus_tag LOCUS_04340 gene wcaD 498365 499582 CDS product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097877.1 protein_id gnl|my_center|LOCUS_04340 499599 500345 gene locus_tag LOCUS_04350 gene wcaE 499599 500345 CDS product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927068.1 protein_id gnl|my_center|LOCUS_04350 500368 500922 gene locus_tag LOCUS_04360 gene wcaF 500368 500922 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_04360 500943 502064 gene locus_tag LOCUS_04370 gene gmd 500943 502064 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 protein_id gnl|my_center|LOCUS_04370 502067 503032 gene locus_tag LOCUS_04380 502067 503032 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 protein_id gnl|my_center|LOCUS_04380 503035 503508 gene locus_tag LOCUS_04390 gene gmm 503035 503508 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309580.1 protein_id gnl|my_center|LOCUS_04390 503505 504803 gene locus_tag LOCUS_04400 gene wcaI 503505 504803 CDS product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699717.1 protein_id gnl|my_center|LOCUS_04400 504800 506236 gene locus_tag LOCUS_04410 gene cpsB 504800 506236 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079256.1 protein_id gnl|my_center|LOCUS_04410 506309 507679 gene locus_tag LOCUS_04420 gene cpsG 506309 507679 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_04420 507781 509175 gene locus_tag LOCUS_04430 gene wcaJ 507781 509175 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183160.1 protein_id gnl|my_center|LOCUS_04430 509186 510664 gene locus_tag LOCUS_04440 gene wzxC 509186 510664 CDS product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097869.1 protein_id gnl|my_center|LOCUS_04440 510689 511966 gene locus_tag LOCUS_04450 gene wcaK 510689 511966 CDS product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097868.1 protein_id gnl|my_center|LOCUS_04450 511963 513183 gene locus_tag LOCUS_04460 gene wcaL 511963 513183 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862673.1 protein_id gnl|my_center|LOCUS_04460 513196 514596 gene locus_tag LOCUS_04470 gene wcaM 513196 514596 CDS product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097866.1 protein_id gnl|my_center|LOCUS_04470 514766 515608 gene locus_tag LOCUS_04480 gene galF 514766 515608 CDS product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981469.1 protein_id gnl|my_center|LOCUS_04480 516032 517132 gene locus_tag LOCUS_04490 gene rffG 516032 517132 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_04490 517145 518020 gene locus_tag LOCUS_04500 gene rfbA 517145 518020 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706043.1 protein_id gnl|my_center|LOCUS_04500 518041 518931 gene locus_tag LOCUS_04510 gene rfbD 518041 518931 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706042.1 protein_id gnl|my_center|LOCUS_04510 518948 519496 gene locus_tag LOCUS_04520 gene rfbC 518948 519496 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706041.1 protein_id gnl|my_center|LOCUS_04520 519501 520439 gene locus_tag LOCUS_04530 519501 520439 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103406.1 protein_id gnl|my_center|LOCUS_04530 520555 521307 gene locus_tag LOCUS_04540 520555 521307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244130.1 protein_id gnl|my_center|LOCUS_04540 521297 522643 gene locus_tag LOCUS_04550 521297 522643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 protein_id gnl|my_center|LOCUS_04550 522633 526643 gene locus_tag LOCUS_04560 522633 526643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 526742 528487 gene locus_tag LOCUS_04570 526742 528487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002398588.1 protein_id gnl|my_center|LOCUS_04570 528492 528869 gene locus_tag LOCUS_04580 528492 528869 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691708.1 protein_id gnl|my_center|LOCUS_04580 528875 529864 gene locus_tag LOCUS_04590 528875 529864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 529978 531384 gene locus_tag LOCUS_04600 gene gndA 529978 531384 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043484.1 protein_id gnl|my_center|LOCUS_04600 531648 532814 gene locus_tag LOCUS_04610 gene ugd 531648 532814 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 protein_id gnl|my_center|LOCUS_04610 533906 532902 gene locus_tag LOCUS_04620 533906 532902 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 protein_id gnl|my_center|LOCUS_04620 534659 534048 gene locus_tag LOCUS_04630 gene hisIE 534659 534048 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954830.1 protein_id gnl|my_center|LOCUS_04630 535429 534653 gene locus_tag LOCUS_04640 gene hisF 535429 534653 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097847.1 protein_id gnl|my_center|LOCUS_04640 536148 535411 gene locus_tag LOCUS_04650 gene hisA 536148 535411 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586451.1 protein_id gnl|my_center|LOCUS_04650 536738 536148 gene locus_tag LOCUS_04660 gene hisH 536738 536148 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103560.1 protein_id gnl|my_center|LOCUS_04660 537805 536738 gene locus_tag LOCUS_04670 gene hisB 537805 536738 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080040.1 protein_id gnl|my_center|LOCUS_04670 538863 537802 gene locus_tag LOCUS_04680 gene hisC 538863 537802 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108941.1 protein_id gnl|my_center|LOCUS_04680 540164 538860 gene locus_tag LOCUS_04690 gene hisD 540164 538860 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097843.1 protein_id gnl|my_center|LOCUS_04690 541069 540170 gene locus_tag LOCUS_04700 gene hisG 541069 540170 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886604.1 protein_id gnl|my_center|LOCUS_04700 541428 542252 gene locus_tag LOCUS_04710 541428 542252 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754758.1 protein_id gnl|my_center|LOCUS_04710 542651 544012 gene locus_tag LOCUS_04720 542651 544012 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097840.1 protein_id gnl|my_center|LOCUS_04720 545600 544176 gene locus_tag LOCUS_04730 gene sbcB 545600 544176 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980584.1 protein_id gnl|my_center|LOCUS_04730 545808 546971 gene locus_tag LOCUS_04740 gene dacD 545808 546971 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097838.1 protein_id gnl|my_center|LOCUS_04740 547088 547561 gene locus_tag LOCUS_04750 gene sbmC 547088 547561 CDS product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105393.1 protein_id gnl|my_center|LOCUS_04750 547699 548757 gene locus_tag LOCUS_04760 547699 548757 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706020.1 protein_id gnl|my_center|LOCUS_04760 548924 549259 gene locus_tag LOCUS_04770 548924 549259 CDS product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450405.1 protein_id gnl|my_center|LOCUS_04770 549481 549296 gene locus_tag LOCUS_04780 549481 549296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 550377 549511 gene locus_tag LOCUS_04790 550377 549511 CDS product L-threonine kinase PduX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201312.1 protein_id gnl|my_center|LOCUS_04790 551155 550421 gene locus_tag LOCUS_04800 gene cobA 551155 550421 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168410.1 protein_id gnl|my_center|LOCUS_04800 552360 551152 gene locus_tag LOCUS_04810 gene pduW 552360 551152 CDS product propanediol utilization propionate kinase PduW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120652.1 protein_id gnl|my_center|LOCUS_04810 552800 552345 gene locus_tag LOCUS_04820 gene pduV 552800 552345 CDS product propanediol utilization protein PduV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826280.1 protein_id gnl|my_center|LOCUS_04820 553150 552800 gene locus_tag LOCUS_04830 gene pduU 553150 552800 CDS product propanediol utilization microcompartment protein PduU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441103.1 protein_id gnl|my_center|LOCUS_04830 553704 553150 gene locus_tag LOCUS_04840 gene pduT 553704 553150 CDS product propanediol utilization microcompartment protein PduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075775.1 protein_id gnl|my_center|LOCUS_04840 555077 553707 gene locus_tag LOCUS_04850 gene pduS 555077 553707 CDS product cobalamin reductase PduS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058762.1 protein_id gnl|my_center|LOCUS_04850 556186 555074 gene locus_tag LOCUS_04860 gene pduQ 556186 555074 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091449.1 protein_id gnl|my_center|LOCUS_04860 557589 556198 gene locus_tag LOCUS_04870 gene pduP 557589 556198 CDS product CoA-acylating propionaldehyde dehydrogenase PduP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097666.1 protein_id gnl|my_center|LOCUS_04870 558593 557589 gene locus_tag LOCUS_04880 gene pduO 558593 557589 CDS product two-domain cob(I)yrinic acid a,c-diamide adenosyltransferase PduO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029486.1 protein_id gnl|my_center|LOCUS_04880 558878 558603 gene locus_tag LOCUS_04890 gene pduN 558878 558603 CDS product propanediol utilization microcompartment protein PduN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549827.1 protein_id gnl|my_center|LOCUS_04890 559373 558882 gene locus_tag LOCUS_04900 gene pduM 559373 558882 CDS product microcompartment protein PduM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061908.1 protein_id gnl|my_center|LOCUS_04900 560002 559370 gene locus_tag LOCUS_04910 560002 559370 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356724.1 protein_id gnl|my_center|LOCUS_04910 560505 560005 gene locus_tag LOCUS_04920 gene pduK 560505 560005 CDS product propanediol utilization microcompartment protein PduK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284376.1 protein_id gnl|my_center|LOCUS_04920 560803 560528 gene locus_tag LOCUS_04930 gene pduJ 560803 560528 CDS product propanediol utilization microcompartment protein PduJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057752.1 protein_id gnl|my_center|LOCUS_04930 561174 560836 gene locus_tag LOCUS_04940 gene pduH 561174 560836 CDS product propanediol dehydratase reactivase beta subunit PduH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377971.1 protein_id gnl|my_center|LOCUS_04940 562996 561164 gene locus_tag LOCUS_04950 gene pduG 562996 561164 CDS product propanediol dehydratase reactivase alpha subunit PduG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268875.1 protein_id gnl|my_center|LOCUS_04950 563538 563011 gene locus_tag LOCUS_04960 gene pduE 563538 563011 CDS product propanediol dehydratase small subunit PduE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090601.1 protein_id gnl|my_center|LOCUS_04960 564222 563551 gene locus_tag LOCUS_04970 gene pduD 564222 563551 CDS product propanediol dehydratase medium subunit PduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405054.1 protein_id gnl|my_center|LOCUS_04970 565897 564233 gene locus_tag LOCUS_04980 gene pduC 565897 564233 CDS product propanediol dehydratase large subunit PduC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256897.1 protein_id gnl|my_center|LOCUS_04980 566728 565916 gene locus_tag LOCUS_04990 gene pduB 566728 565916 CDS product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816690.1 protein_id gnl|my_center|LOCUS_04990 567009 566725 gene locus_tag LOCUS_05000 gene pduA 567009 566725 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 protein_id gnl|my_center|LOCUS_05000 567541 568350 gene locus_tag LOCUS_05010 gene pduF 567541 568350 CDS product propanediol diffusion facilitator PduF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699353.1 protein_id gnl|my_center|LOCUS_05010 568575 569486 gene locus_tag LOCUS_05020 gene pocR 568575 569486 CDS product regulatory protein PocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622328.1 protein_id gnl|my_center|LOCUS_05020 569838 569987 gene locus_tag LOCUS_05030 569838 569987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 569980 571359 gene locus_tag LOCUS_05040 569980 571359 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741259.1 protein_id gnl|my_center|LOCUS_05040 571356 572318 gene locus_tag LOCUS_05050 gene cbiB 571356 572318 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153666.1 protein_id gnl|my_center|LOCUS_05050 572318 572959 gene locus_tag LOCUS_05060 572318 572959 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816687.1 protein_id gnl|my_center|LOCUS_05060 572956 574095 gene locus_tag LOCUS_05070 gene cbiD 572956 574095 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292925.1 protein_id gnl|my_center|LOCUS_05070 574089 574694 gene locus_tag LOCUS_05080 574089 574694 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958833.1 protein_id gnl|my_center|LOCUS_05080 574684 575253 gene locus_tag LOCUS_05090 574684 575253 CDS product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650991.1 protein_id gnl|my_center|LOCUS_05090 575246 576019 gene locus_tag LOCUS_05100 575246 576019 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004870.1 protein_id gnl|my_center|LOCUS_05100 576000 577055 gene locus_tag LOCUS_05110 gene cbiG 576000 577055 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098913.1 protein_id gnl|my_center|LOCUS_05110 577055 577780 gene locus_tag LOCUS_05120 577055 577780 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953643.1 protein_id gnl|my_center|LOCUS_05120 577777 578568 gene locus_tag LOCUS_05130 577777 578568 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816684.1 protein_id gnl|my_center|LOCUS_05130 578573 579367 gene locus_tag LOCUS_05140 578573 579367 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 protein_id gnl|my_center|LOCUS_05140 579364 580071 gene locus_tag LOCUS_05150 579364 580071 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013551.1 protein_id gnl|my_center|LOCUS_05150 580068 580805 gene locus_tag LOCUS_05160 gene cbiM 580068 580805 CDS product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816682.1 protein_id gnl|my_center|LOCUS_05160 580807 581088 gene locus_tag LOCUS_05170 580807 581088 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753216.1 protein_id gnl|my_center|LOCUS_05170 581069 581752 gene locus_tag LOCUS_05180 581069 581752 CDS product energy-coupling factor ABC transporter transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147138.1 protein_id gnl|my_center|LOCUS_05180 581761 582576 gene locus_tag LOCUS_05190 581761 582576 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881535.1 protein_id gnl|my_center|LOCUS_05190 582573 584096 gene locus_tag LOCUS_05200 582573 584096 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189676.1 protein_id gnl|my_center|LOCUS_05200 584090 584635 gene locus_tag LOCUS_05210 gene cobU 584090 584635 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973185.1 protein_id gnl|my_center|LOCUS_05210 584632 585372 gene locus_tag LOCUS_05220 gene cobS 584632 585372 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039987.1 protein_id gnl|my_center|LOCUS_05220 585400 586452 gene locus_tag LOCUS_05230 gene cobT 585400 586452 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193966.1 protein_id gnl|my_center|LOCUS_05230 586722 587750 gene locus_tag LOCUS_05240 586722 587750 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096845.1 protein_id gnl|my_center|LOCUS_05240 587870 588118 gene locus_tag LOCUS_05250 587870 588118 CDS product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368794.1 protein_id gnl|my_center|LOCUS_05250 588063 588266 gene locus_tag LOCUS_05260 588063 588266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 588390 588896 gene locus_tag LOCUS_05270 588390 588896 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168624.1 protein_id gnl|my_center|LOCUS_05270 589008 589484 gene locus_tag LOCUS_05280 589008 589484 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705072.1 protein_id gnl|my_center|LOCUS_05280 589757 591748 gene locus_tag LOCUS_05290 gene betT 589757 591748 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097075.1 protein_id gnl|my_center|LOCUS_05290 593135 591789 gene locus_tag LOCUS_05300 593135 591789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089309.1 protein_id gnl|my_center|LOCUS_05300 594667 593156 gene locus_tag LOCUS_05310 594667 593156 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_05310 594820 595740 gene locus_tag LOCUS_05320 594820 595740 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_05320 596058 595768 gene locus_tag LOCUS_05330 596058 595768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 596920 596114 gene locus_tag LOCUS_05340 gene fabG 596920 596114 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016121.1 protein_id gnl|my_center|LOCUS_05340 598045 597098 gene locus_tag LOCUS_05350 598045 597098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 598194 598994 gene locus_tag LOCUS_05360 598194 598994 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703203.1 protein_id gnl|my_center|LOCUS_05360 599471 599067 gene locus_tag LOCUS_05370 599471 599067 CDS product DUF4126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275228.1 protein_id gnl|my_center|LOCUS_05370 600466 600122 gene locus_tag LOCUS_05380 600466 600122 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044173324.1 protein_id gnl|my_center|LOCUS_05380 600937 600862 gene locus_tag LOCUS_t00090 600937 600862 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 601128 602558 gene locus_tag LOCUS_05390 gene emmdR 601128 602558 CDS product multidrug efflux MATE transporter EmmdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120727113.1 protein_id gnl|my_center|LOCUS_05390 602670 602745 gene locus_tag LOCUS_t00100 602670 602745 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 603600 602869 gene locus_tag LOCUS_05400 603600 602869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 603809 603618 gene locus_tag LOCUS_05410 603809 603618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 604237 603773 gene locus_tag LOCUS_05420 604237 603773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 606025 604571 gene locus_tag LOCUS_05430 606025 604571 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097832.1 protein_id gnl|my_center|LOCUS_05430 607121 606144 gene locus_tag LOCUS_05440 607121 606144 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148478.1 protein_id gnl|my_center|LOCUS_05440 607822 607118 gene locus_tag LOCUS_05450 607822 607118 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145474.1 protein_id gnl|my_center|LOCUS_05450 607961 608899 gene locus_tag LOCUS_05460 gene ldtA 607961 608899 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365885.1 protein_id gnl|my_center|LOCUS_05460 609111 609368 gene locus_tag LOCUS_05470 609111 609368 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288812.1 protein_id gnl|my_center|LOCUS_05470 609369 609701 gene locus_tag LOCUS_05480 609369 609701 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373724.1 protein_id gnl|my_center|LOCUS_05480 610099 609782 gene locus_tag LOCUS_05490 610099 609782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 610862 610149 gene locus_tag LOCUS_05500 610862 610149 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054659530.1 protein_id gnl|my_center|LOCUS_05500 611165 611587 gene locus_tag LOCUS_05510 611165 611587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683475.1 protein_id gnl|my_center|LOCUS_05510 612610 613797 gene locus_tag LOCUS_05520 612610 613797 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355468.1 protein_id gnl|my_center|LOCUS_05520 613815 614978 gene locus_tag LOCUS_05530 613815 614978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150292.1 protein_id gnl|my_center|LOCUS_05530 616766 615102 gene locus_tag LOCUS_05540 616766 615102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 618127 616778 gene locus_tag LOCUS_05550 618127 616778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 618551 618129 gene locus_tag LOCUS_05560 618551 618129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 618979 619923 gene locus_tag LOCUS_05570 618979 619923 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155898.1 protein_id gnl|my_center|LOCUS_05570 620696 620118 gene locus_tag LOCUS_05580 gene mobC 620696 620118 CDS product MobC family replication-relaxation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909124.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 622732 620873 gene locus_tag LOCUS_05590 622732 620873 CDS product TraM recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602685.1 protein_id gnl|my_center|LOCUS_05590 623158 623400 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 623883 623677 gene locus_tag LOCUS_05600 623883 623677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 625059 624040 gene locus_tag LOCUS_05610 gene virB11 625059 624040 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125557.1 protein_id gnl|my_center|LOCUS_05610 626347 625049 gene locus_tag LOCUS_05620 gene virB10 626347 625049 CDS product VirB10/TraB/TrbI family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039326147.1 protein_id gnl|my_center|LOCUS_05620 627231 626344 gene locus_tag LOCUS_05630 gene virB9 627231 626344 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976329.1 protein_id gnl|my_center|LOCUS_05630 627791 627231 gene locus_tag LOCUS_05640 627791 627231 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005327.1 protein_id gnl|my_center|LOCUS_05640 627891 628178 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 628359 628219 gene locus_tag LOCUS_05650 628359 628219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 629480 628449 gene locus_tag LOCUS_05660 629480 628449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 629827 629552 gene locus_tag LOCUS_05670 629827 629552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 630567 629839 gene locus_tag LOCUS_05680 630567 629839 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848059.1 protein_id gnl|my_center|LOCUS_05680 633337 630590 gene locus_tag LOCUS_05690 633337 630590 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096399.1 protein_id gnl|my_center|LOCUS_05690 633627 633349 gene locus_tag LOCUS_05700 633627 633349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 634268 633627 gene locus_tag LOCUS_05710 634268 633627 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446637.1 protein_id gnl|my_center|LOCUS_05710 634562 634341 gene locus_tag LOCUS_05720 634562 634341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 635166 634957 gene locus_tag LOCUS_05730 635166 634957 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112403.1 protein_id gnl|my_center|LOCUS_05730 635743 635156 gene locus_tag LOCUS_05740 635743 635156 CDS product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937857.1 protein_id gnl|my_center|LOCUS_05740 635954 635769 gene locus_tag LOCUS_05750 635954 635769 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 protein_id gnl|my_center|LOCUS_05750 637026 636814 gene locus_tag LOCUS_05760 637026 636814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05760 637803 638519 gene locus_tag LOCUS_05770 637803 638519 CDS product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174866.1 protein_id gnl|my_center|LOCUS_05770 638579 640207 gene locus_tag LOCUS_05780 638579 640207 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_05780 640277 641215 gene locus_tag LOCUS_05790 640277 641215 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 protein_id gnl|my_center|LOCUS_05790 641379 642053 gene locus_tag LOCUS_05800 641379 642053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 642050 642904 gene locus_tag LOCUS_05810 642050 642904 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030933.1 protein_id gnl|my_center|LOCUS_05810 642892 643527 gene locus_tag LOCUS_05820 642892 643527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05820 643784 645133 gene locus_tag LOCUS_05830 643784 645133 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140537.1 protein_id gnl|my_center|LOCUS_05830 645121 646158 gene locus_tag LOCUS_05840 645121 646158 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_05840 646350 647177 gene locus_tag LOCUS_05850 646350 647177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040904057.1 protein_id gnl|my_center|LOCUS_05850 647199 648155 gene locus_tag LOCUS_05860 647199 648155 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705828.1 protein_id gnl|my_center|LOCUS_05860 648155 649174 gene locus_tag LOCUS_05870 648155 649174 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033652390.1 protein_id gnl|my_center|LOCUS_05870 649862 649380 gene locus_tag LOCUS_05880 gene zur 649862 649380 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245564.1 protein_id gnl|my_center|LOCUS_05880 650013 650414 gene locus_tag LOCUS_05890 gene hisI 650013 650414 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_05890 650451 651068 gene locus_tag LOCUS_05900 650451 651068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05900 651068 651673 gene locus_tag LOCUS_05910 651068 651673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05910 651937 651731 gene locus_tag LOCUS_05920 651937 651731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 652365 651940 gene locus_tag LOCUS_05930 652365 651940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 653223 654107 gene locus_tag LOCUS_05940 653223 654107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 654332 655189 gene locus_tag LOCUS_05950 gene hemB 654332 655189 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211541.1 protein_id gnl|my_center|LOCUS_05950 655342 655677 gene locus_tag LOCUS_05960 655342 655677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 655719 656279 gene locus_tag LOCUS_05970 655719 656279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 657267 657521 gene locus_tag LOCUS_05980 657267 657521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602757.1 protein_id gnl|my_center|LOCUS_05980 658998 657745 gene locus_tag LOCUS_05990 gene aztD 658998 657745 CDS product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969726.1 protein_id gnl|my_center|LOCUS_05990 659867 659037 gene locus_tag LOCUS_06000 gene aztC 659867 659037 CDS product zinc ABC transporter substrate-binding protein AztC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383482.1 protein_id gnl|my_center|LOCUS_06000 661616 660870 gene locus_tag LOCUS_06010 gene aztA 661616 660870 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532307.1 protein_id gnl|my_center|LOCUS_06010 663859 661886 gene locus_tag LOCUS_06020 663859 661886 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_06020 664244 664044 gene locus_tag LOCUS_06030 664244 664044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 664166 664651 gene locus_tag LOCUS_06040 664166 664651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 664744 664932 gene locus_tag LOCUS_06050 664744 664932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 665634 665260 gene locus_tag LOCUS_06060 665634 665260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 665746 666165 gene locus_tag LOCUS_06070 665746 666165 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970751.1 protein_id gnl|my_center|LOCUS_06070 669411 666220 gene locus_tag LOCUS_06080 gene ceoB 669411 666220 CDS product multidrug efflux RND transporter permease subunit CeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188522.1 protein_id gnl|my_center|LOCUS_06080 670577 669408 gene locus_tag LOCUS_06090 670577 669408 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203095.1 protein_id gnl|my_center|LOCUS_06090 672470 671220 gene locus_tag LOCUS_06100 672470 671220 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212753.1 protein_id gnl|my_center|LOCUS_06100 672707 672632 gene locus_tag LOCUS_t00110 672707 672632 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 673042 673959 gene locus_tag LOCUS_06110 gene nac 673042 673959 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 protein_id gnl|my_center|LOCUS_06110 674061 675011 gene locus_tag LOCUS_06120 gene cbl 674061 675011 CDS product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705998.1 protein_id gnl|my_center|LOCUS_06120 675125 675050 gene locus_tag LOCUS_t00120 675125 675050 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 676023 675226 gene locus_tag LOCUS_06130 gene mtfA 676023 675226 CDS product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881844.1 protein_id gnl|my_center|LOCUS_06130 676117 676206 gene locus_tag LOCUS_t00130 676117 676206 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 676949 677503 gene locus_tag LOCUS_06140 676949 677503 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493084.1 protein_id gnl|my_center|LOCUS_06140 677663 678373 gene locus_tag LOCUS_06150 677663 678373 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019839.1 protein_id gnl|my_center|LOCUS_06150 678820 680034 gene locus_tag LOCUS_06160 678820 680034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06160 680031 680915 gene locus_tag LOCUS_06170 680031 680915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06170 680953 682293 gene locus_tag LOCUS_06180 680953 682293 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302256.1 protein_id gnl|my_center|LOCUS_06180 682290 683015 gene locus_tag LOCUS_06190 682290 683015 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843907.1 protein_id gnl|my_center|LOCUS_06190 684291 683074 gene locus_tag LOCUS_06200 gene ompC 684291 683074 CDS product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097752.1 protein_id gnl|my_center|LOCUS_06200 684879 685583 gene locus_tag LOCUS_06210 684879 685583 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365890.1 protein_id gnl|my_center|LOCUS_06210 685595 686089 gene locus_tag LOCUS_06220 gene vsr 685595 686089 CDS product VSPR family DNA mismatch endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785988.1 protein_id gnl|my_center|LOCUS_06220 686975 686058 gene locus_tag LOCUS_06230 gene yedA 686975 686058 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097747.1 protein_id gnl|my_center|LOCUS_06230 687164 688075 gene locus_tag LOCUS_06240 687164 688075 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 protein_id gnl|my_center|LOCUS_06240 688154 688336 gene locus_tag LOCUS_06250 688154 688336 CDS product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097745.1 protein_id gnl|my_center|LOCUS_06250 688431 690128 gene locus_tag LOCUS_06260 gene dgcQ 688431 690128 CDS product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097744.1 protein_id gnl|my_center|LOCUS_06260 690922 690086 gene locus_tag LOCUS_06270 690922 690086 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948794.1 protein_id gnl|my_center|LOCUS_06270 691452 691216 gene locus_tag LOCUS_06280 gene yodD 691452 691216 CDS product YodD family peroxide/acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844798.1 protein_id gnl|my_center|LOCUS_06280 691576 691764 gene locus_tag LOCUS_06290 gene dsrB 691576 691764 CDS product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097741.1 protein_id gnl|my_center|LOCUS_06290 692425 691802 gene locus_tag LOCUS_06300 gene rcsA 692425 691802 CDS product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097740.1 protein_id gnl|my_center|LOCUS_06300 693494 692709 gene locus_tag LOCUS_06310 gene fliR 693494 692709 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097739.1 protein_id gnl|my_center|LOCUS_06310 693769 693500 gene locus_tag LOCUS_06320 gene fliQ 693769 693500 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187358.1 protein_id gnl|my_center|LOCUS_06320 694516 693779 gene locus_tag LOCUS_06330 gene fliP 694516 693779 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253450.1 protein_id gnl|my_center|LOCUS_06330 694890 694516 gene locus_tag LOCUS_06340 gene fliO 694890 694516 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097737.1 protein_id gnl|my_center|LOCUS_06340 695312 694899 gene locus_tag LOCUS_06350 gene fliN 695312 694899 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500318.1 protein_id gnl|my_center|LOCUS_06350 696313 695309 gene locus_tag LOCUS_06360 gene fliM 696313 695309 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502815.1 protein_id gnl|my_center|LOCUS_06360 696794 696318 gene locus_tag LOCUS_06370 gene fliL 696794 696318 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832480.1 protein_id gnl|my_center|LOCUS_06370 698077 696899 gene locus_tag LOCUS_06380 gene fliK 698077 696899 CDS product flagellar hook length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097734.1 protein_id gnl|my_center|LOCUS_06380 698548 698105 gene locus_tag LOCUS_06390 gene fliJ 698548 698105 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097733.1 protein_id gnl|my_center|LOCUS_06390 699939 698569 gene locus_tag LOCUS_06400 gene fliI 699939 698569 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 protein_id gnl|my_center|LOCUS_06400 700649 699939 gene locus_tag LOCUS_06410 gene fliH 700649 699939 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097731.1 protein_id gnl|my_center|LOCUS_06410 701646 700642 gene locus_tag LOCUS_06420 gene fliG 701646 700642 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500327.1 protein_id gnl|my_center|LOCUS_06420 703324 701636 gene locus_tag LOCUS_06430 gene fliF 703324 701636 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097730.1 protein_id gnl|my_center|LOCUS_06430 703553 703864 gene locus_tag LOCUS_06440 gene fliE 703553 703864 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 protein_id gnl|my_center|LOCUS_06440 704000 704416 gene locus_tag LOCUS_06450 gene yedD 704000 704416 CDS product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096004.1 protein_id gnl|my_center|LOCUS_06450 705937 704450 gene locus_tag LOCUS_06460 gene amyA 705937 704450 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245695.1 protein_id gnl|my_center|LOCUS_06460 706365 706003 gene locus_tag LOCUS_06470 gene fliT 706365 706003 CDS product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096006.1 protein_id gnl|my_center|LOCUS_06470 706775 706365 gene locus_tag LOCUS_06480 gene fliS 706775 706365 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096007.1 protein_id gnl|my_center|LOCUS_06480 708221 706785 gene locus_tag LOCUS_06490 gene fliD 708221 706785 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096008.1 protein_id gnl|my_center|LOCUS_06490 708555 709415 gene locus_tag LOCUS_06500 708555 709415 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 protein_id gnl|my_center|LOCUS_06500 709693 713055 gene locus_tag LOCUS_06510 709693 713055 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096011.1 protein_id gnl|my_center|LOCUS_06510 713122 714261 gene locus_tag LOCUS_06520 713122 714261 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096012.1 protein_id gnl|my_center|LOCUS_06520 714285 714977 gene locus_tag LOCUS_06530 714285 714977 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_06530 714985 715962 gene locus_tag LOCUS_06540 714985 715962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 715976 717253 gene locus_tag LOCUS_06550 715976 717253 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202935.1 protein_id gnl|my_center|LOCUS_06550 717266 718327 gene locus_tag LOCUS_06560 717266 718327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 718707 719396 gene locus_tag LOCUS_06570 718707 719396 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096018.1 protein_id gnl|my_center|LOCUS_06570 719455 720006 gene locus_tag LOCUS_06580 gene fliZ 719455 720006 CDS product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096019.1 protein_id gnl|my_center|LOCUS_06580 720035 720892 gene locus_tag LOCUS_06590 gene tcyJ 720035 720892 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096020.1 protein_id gnl|my_center|LOCUS_06590 720989 721975 gene locus_tag LOCUS_06600 gene dcyD 720989 721975 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128215.1 protein_id gnl|my_center|LOCUS_06600 721993 722661 gene locus_tag LOCUS_06610 gene tcyL 721993 722661 CDS product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096022.1 protein_id gnl|my_center|LOCUS_06610 722658 723410 gene locus_tag LOCUS_06620 gene yecC 722658 723410 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096023.1 protein_id gnl|my_center|LOCUS_06620 723739 724425 gene locus_tag LOCUS_06630 gene sdiA 723739 724425 CDS product transcriptional regulator SdiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096024.1 protein_id gnl|my_center|LOCUS_06630 724722 724498 gene locus_tag LOCUS_06640 724722 724498 CDS product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365908.1 protein_id gnl|my_center|LOCUS_06640 725183 725839 gene locus_tag LOCUS_06650 gene uvrY 725183 725839 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096026.1 protein_id gnl|my_center|LOCUS_06650 725836 727668 gene locus_tag LOCUS_06660 gene uvrC 725836 727668 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096027.1 protein_id gnl|my_center|LOCUS_06660 727726 728274 gene locus_tag LOCUS_06670 gene pgsA 727726 728274 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096028.1 protein_id gnl|my_center|LOCUS_06670 728424 728499 gene locus_tag LOCUS_t00140 728424 728499 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 728547 728620 gene locus_tag LOCUS_t00150 728547 728620 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 728633 728719 gene locus_tag LOCUS_t00160 728633 728719 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 728845 729513 gene locus_tag LOCUS_06680 728845 729513 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096035.1 protein_id gnl|my_center|LOCUS_06680 730752 729541 gene locus_tag LOCUS_06690 gene tyrP 730752 729541 CDS product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797555.1 protein_id gnl|my_center|LOCUS_06690 731264 730926 gene locus_tag LOCUS_06700 gene yecR 731264 730926 CDS product YecR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096039.1 protein_id gnl|my_center|LOCUS_06700 731518 732156 gene locus_tag LOCUS_06710 731518 732156 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096040.1 protein_id gnl|my_center|LOCUS_06710 732698 733255 gene locus_tag LOCUS_06720 732698 733255 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754799.1 protein_id gnl|my_center|LOCUS_06720 733572 734561 gene locus_tag LOCUS_06730 733572 734561 CDS product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705967.1 protein_id gnl|my_center|LOCUS_06730 734566 736146 gene locus_tag LOCUS_06740 gene araG 734566 736146 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096045.1 protein_id gnl|my_center|LOCUS_06740 736162 737148 gene locus_tag LOCUS_06750 gene araH 736162 737148 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096046.1 protein_id gnl|my_center|LOCUS_06750 737398 738201 gene locus_tag LOCUS_06760 gene otsB 737398 738201 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840119.1 protein_id gnl|my_center|LOCUS_06760 738176 739600 gene locus_tag LOCUS_06770 gene otsA 738176 739600 CDS product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096048.1 protein_id gnl|my_center|LOCUS_06770 740057 739632 gene locus_tag LOCUS_06780 gene uspC 740057 739632 CDS product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419943.1 protein_id gnl|my_center|LOCUS_06780 740834 741178 gene locus_tag LOCUS_06790 gene flhD 740834 741178 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096050.1 protein_id gnl|my_center|LOCUS_06790 741181 741759 gene locus_tag LOCUS_06800 gene flhC 741181 741759 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096051.1 protein_id gnl|my_center|LOCUS_06800 741881 742768 gene locus_tag LOCUS_06810 gene motA 741881 742768 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500417.1 protein_id gnl|my_center|LOCUS_06810 742765 743724 gene locus_tag LOCUS_06820 gene motB 742765 743724 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795656.1 protein_id gnl|my_center|LOCUS_06820 743735 745765 gene locus_tag LOCUS_06830 gene cheA 743735 745765 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096053.1 protein_id gnl|my_center|LOCUS_06830 745786 746289 gene locus_tag LOCUS_06840 gene cheW 745786 746289 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096054.1 protein_id gnl|my_center|LOCUS_06840 746508 746888 gene locus_tag LOCUS_06850 746508 746888 CDS product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096056.1 protein_id gnl|my_center|LOCUS_06850 747318 747890 gene locus_tag LOCUS_06860 747318 747890 CDS product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096056.1 protein_id gnl|my_center|LOCUS_06860 747901 748461 gene locus_tag LOCUS_06870 747901 748461 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027938.1 protein_id gnl|my_center|LOCUS_06870 748477 749241 gene locus_tag LOCUS_06880 748477 749241 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096058.1 protein_id gnl|my_center|LOCUS_06880 749220 751616 gene locus_tag LOCUS_06890 749220 751616 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096059.1 protein_id gnl|my_center|LOCUS_06890 751616 752596 gene locus_tag LOCUS_06900 751616 752596 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096060.1 protein_id gnl|my_center|LOCUS_06900 752723 754387 gene locus_tag LOCUS_06910 gene tar 752723 754387 CDS product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096061.1 protein_id gnl|my_center|LOCUS_06910 754430 756028 gene locus_tag LOCUS_06920 gene tap 754430 756028 CDS product methyl-accepting chemotaxis protein IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096062.1 protein_id gnl|my_center|LOCUS_06920 756047 756916 gene locus_tag LOCUS_06930 gene cheR 756047 756916 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204368.1 protein_id gnl|my_center|LOCUS_06930 756913 757962 gene locus_tag LOCUS_06940 756913 757962 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_06940 757979 758368 gene locus_tag LOCUS_06950 gene cheY 757979 758368 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763867.1 protein_id gnl|my_center|LOCUS_06950 758379 759023 gene locus_tag LOCUS_06960 gene cheZ 758379 759023 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096065.1 protein_id gnl|my_center|LOCUS_06960 759272 760420 gene locus_tag LOCUS_06970 gene flhB 759272 760420 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096066.1 protein_id gnl|my_center|LOCUS_06970 760413 762491 gene locus_tag LOCUS_06980 gene flhA 760413 762491 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002392.1 protein_id gnl|my_center|LOCUS_06980 762491 762883 gene locus_tag LOCUS_06990 gene flhe 762491 762883 CDS product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233619.1 protein_id gnl|my_center|LOCUS_06990 763157 764734 gene locus_tag LOCUS_07000 763157 764734 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096070.1 protein_id gnl|my_center|LOCUS_07000 764745 765404 gene locus_tag LOCUS_07010 764745 765404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07010 765457 765885 gene locus_tag LOCUS_07020 765457 765885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07020 767774 766041 gene locus_tag LOCUS_07030 gene argS 767774 766041 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705961.1 protein_id gnl|my_center|LOCUS_07030 767963 768523 gene locus_tag LOCUS_07040 767963 768523 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365978.1 protein_id gnl|my_center|LOCUS_07040 768546 769286 gene locus_tag LOCUS_07050 gene cutC 768546 769286 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419924.1 protein_id gnl|my_center|LOCUS_07050 770364 769393 gene locus_tag LOCUS_07060 gene cmoB 770364 769393 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569029.1 protein_id gnl|my_center|LOCUS_07060 771104 770361 gene locus_tag LOCUS_07070 gene cmoA 771104 770361 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019609.1 protein_id gnl|my_center|LOCUS_07070 771539 771144 gene locus_tag LOCUS_07080 771539 771144 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096077.1 protein_id gnl|my_center|LOCUS_07080 772406 771588 gene locus_tag LOCUS_07090 772406 771588 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705960.1 protein_id gnl|my_center|LOCUS_07090 772969 772403 gene locus_tag LOCUS_07100 772969 772403 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096079.1 protein_id gnl|my_center|LOCUS_07100 773236 775005 gene locus_tag LOCUS_07110 gene aspS 773236 775005 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096080.1 protein_id gnl|my_center|LOCUS_07110 775007 775450 gene locus_tag LOCUS_07120 gene nudB 775007 775450 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323632.1 protein_id gnl|my_center|LOCUS_07120 775479 776219 gene locus_tag LOCUS_07130 775479 776219 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365987.1 protein_id gnl|my_center|LOCUS_07130 776257 776778 gene locus_tag LOCUS_07140 gene ruvC 776257 776778 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295503.1 protein_id gnl|my_center|LOCUS_07140 776859 777470 gene locus_tag LOCUS_07150 gene ruvA 776859 777470 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365989.1 protein_id gnl|my_center|LOCUS_07150 777479 778489 gene locus_tag LOCUS_07160 gene ruvB 777479 778489 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705957.1 protein_id gnl|my_center|LOCUS_07160 778624 778493 gene locus_tag LOCUS_07170 778624 778493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 779580 778795 gene locus_tag LOCUS_07180 gene znuB 779580 778795 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571518.1 protein_id gnl|my_center|LOCUS_07180 780332 779577 gene locus_tag LOCUS_07190 gene znuC 780332 779577 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832401.1 protein_id gnl|my_center|LOCUS_07190 780411 781355 gene locus_tag LOCUS_07200 gene znuA 780411 781355 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625584.1 protein_id gnl|my_center|LOCUS_07200 781371 782699 gene locus_tag LOCUS_07210 gene mepM 781371 782699 CDS product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096090.1 protein_id gnl|my_center|LOCUS_07210 782814 783785 gene locus_tag LOCUS_07220 gene lpxM 782814 783785 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419920.1 protein_id gnl|my_center|LOCUS_07220 785283 783841 gene locus_tag LOCUS_07230 gene pyk 785283 783841 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096092.1 protein_id gnl|my_center|LOCUS_07230 786260 785397 gene locus_tag LOCUS_07240 786260 785397 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882312.1 protein_id gnl|my_center|LOCUS_07240 786609 788084 gene locus_tag LOCUS_07250 gene zwf 786609 788084 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301712.1 protein_id gnl|my_center|LOCUS_07250 788319 790130 gene locus_tag LOCUS_07260 gene edd 788319 790130 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069450.1 protein_id gnl|my_center|LOCUS_07260 790168 790809 gene locus_tag LOCUS_07270 790168 790809 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 protein_id gnl|my_center|LOCUS_07270 792079 790901 gene locus_tag LOCUS_07280 gene purT 792079 790901 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173461.1 protein_id gnl|my_center|LOCUS_07280 792210 792545 gene locus_tag LOCUS_07290 792210 792545 CDS product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705951.1 protein_id gnl|my_center|LOCUS_07290 792610 792966 gene locus_tag LOCUS_07300 gene yebF 792610 792966 CDS product protein YebF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042123.1 protein_id gnl|my_center|LOCUS_07300 793061 793720 gene locus_tag LOCUS_07310 793061 793720 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024713.1 protein_id gnl|my_center|LOCUS_07310 793798 795858 gene locus_tag LOCUS_07320 gene ptrB 793798 795858 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936997.1 protein_id gnl|my_center|LOCUS_07320 796532 795855 gene locus_tag LOCUS_07330 gene exoX 796532 795855 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944256.1 protein_id gnl|my_center|LOCUS_07330 796759 796529 gene locus_tag LOCUS_07340 796759 796529 CDS product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856224.1 protein_id gnl|my_center|LOCUS_07340 796894 797268 gene locus_tag LOCUS_07350 gene yobA 796894 797268 CDS product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168393.1 protein_id gnl|my_center|LOCUS_07350 797405 798127 gene locus_tag LOCUS_07360 gene copD 797405 798127 CDS product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096104.1 protein_id gnl|my_center|LOCUS_07360 798196 798486 gene locus_tag LOCUS_07370 798196 798486 CDS product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976483.1 protein_id gnl|my_center|LOCUS_07370 798996 799214 gene locus_tag LOCUS_07380 798996 799214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 799815 800459 gene locus_tag LOCUS_07390 gene pphA 799815 800459 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096112.1 protein_id gnl|my_center|LOCUS_07390 800651 800460 gene locus_tag LOCUS_07400 800651 800460 CDS product YebW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296140.1 protein_id gnl|my_center|LOCUS_07400 800995 800756 gene locus_tag LOCUS_07410 800995 800756 CDS product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096113.1 protein_id gnl|my_center|LOCUS_07410 802501 801110 gene locus_tag LOCUS_07420 gene rsmF 802501 801110 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602287.1 protein_id gnl|my_center|LOCUS_07420 805258 802625 gene locus_tag LOCUS_07430 805258 802625 CDS product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419908.1 protein_id gnl|my_center|LOCUS_07430 806471 805227 gene locus_tag LOCUS_07440 gene yebS 806471 805227 CDS product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419906.1 protein_id gnl|my_center|LOCUS_07440 806644 807141 gene locus_tag LOCUS_07450 806644 807141 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096117.1 protein_id gnl|my_center|LOCUS_07450 807239 807922 gene locus_tag LOCUS_07460 gene proQ 807239 807922 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096118.1 protein_id gnl|my_center|LOCUS_07460 807942 809990 gene locus_tag LOCUS_07470 gene prc 807942 809990 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096119.1 protein_id gnl|my_center|LOCUS_07470 810184 811065 gene locus_tag LOCUS_07480 gene htpX 810184 811065 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096120.1 protein_id gnl|my_center|LOCUS_07480 812481 811111 gene locus_tag LOCUS_07490 812481 811111 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705935.1 protein_id gnl|my_center|LOCUS_07490 812657 813448 gene locus_tag LOCUS_07500 gene kdgR 812657 813448 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096122.1 protein_id gnl|my_center|LOCUS_07500 813717 813478 gene locus_tag LOCUS_07510 813717 813478 CDS product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705933.1 protein_id gnl|my_center|LOCUS_07510 813874 814017 gene locus_tag LOCUS_07520 gene mgrB 813874 814017 CDS product PhoP/PhoQ regulator MgrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366032.1 protein_id gnl|my_center|LOCUS_07520 814093 814377 gene locus_tag LOCUS_07530 814093 814377 CDS product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000660.1 protein_id gnl|my_center|LOCUS_07530 814386 815390 gene locus_tag LOCUS_07540 814386 815390 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_07540 815887 816057 gene locus_tag LOCUS_07550 815887 816057 CDS product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071845891.1 protein_id gnl|my_center|LOCUS_07550 816044 816253 gene locus_tag LOCUS_07560 gene cspE 816044 816253 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 protein_id gnl|my_center|LOCUS_07560 816405 817217 gene locus_tag LOCUS_07570 gene rlmA 816405 817217 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_07570 817789 817223 gene locus_tag LOCUS_07580 gene mntP 817789 817223 CDS product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366036.1 protein_id gnl|my_center|LOCUS_07580 818623 818165 gene locus_tag LOCUS_07590 818623 818165 CDS product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096131.1 protein_id gnl|my_center|LOCUS_07590 819529 818678 gene locus_tag LOCUS_07600 819529 818678 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 protein_id gnl|my_center|LOCUS_07600 820339 819542 gene locus_tag LOCUS_07610 gene manY 820339 819542 CDS product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859914.1 protein_id gnl|my_center|LOCUS_07610 821362 820400 gene locus_tag LOCUS_07620 gene manX 821362 820400 CDS product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150523.1 protein_id gnl|my_center|LOCUS_07620 821801 823357 gene locus_tag LOCUS_07630 gene yoaE 821801 823357 CDS product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394983.1 protein_id gnl|my_center|LOCUS_07630 824939 823380 gene locus_tag LOCUS_07640 824939 823380 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192512.1 protein_id gnl|my_center|LOCUS_07640 826436 825072 gene locus_tag LOCUS_07650 gene sdaA 826436 825072 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705929.1 protein_id gnl|my_center|LOCUS_07650 827187 826609 gene locus_tag LOCUS_07660 827187 826609 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705928.1 protein_id gnl|my_center|LOCUS_07660 828548 827190 gene locus_tag LOCUS_07670 gene pabB 828548 827190 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705927.1 protein_id gnl|my_center|LOCUS_07670 828632 828811 gene locus_tag LOCUS_07680 828632 828811 CDS product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457334.1 protein_id gnl|my_center|LOCUS_07680 829211 828867 gene locus_tag LOCUS_07690 829211 828867 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295493.1 protein_id gnl|my_center|LOCUS_07690 830488 830689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 830763 831521 gene locus_tag LOCUS_07700 830763 831521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 831581 832276 gene locus_tag LOCUS_07710 gene tsaB 831581 832276 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705925.1 protein_id gnl|my_center|LOCUS_07710 832314 832898 gene locus_tag LOCUS_07720 832314 832898 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290594.1 protein_id gnl|my_center|LOCUS_07720 833103 834788 gene locus_tag LOCUS_07730 gene fadD 833103 834788 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705923.1 protein_id gnl|my_center|LOCUS_07730 834858 835988 gene locus_tag LOCUS_07740 gene rnd 834858 835988 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109156.1 protein_id gnl|my_center|LOCUS_07740 836350 836084 gene locus_tag LOCUS_07750 gene minE 836350 836084 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366053.1 protein_id gnl|my_center|LOCUS_07750 837166 836354 gene locus_tag LOCUS_07760 gene minD 837166 836354 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096144.1 protein_id gnl|my_center|LOCUS_07760 837881 837189 gene locus_tag LOCUS_07770 gene minC 837881 837189 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096145.1 protein_id gnl|my_center|LOCUS_07770 838004 838270 gene locus_tag LOCUS_07780 838004 838270 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125720.1 protein_id gnl|my_center|LOCUS_07780 838420 839079 gene locus_tag LOCUS_07790 838420 839079 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366057.1 protein_id gnl|my_center|LOCUS_07790 839171 839617 gene locus_tag LOCUS_07800 839171 839617 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306825.1 protein_id gnl|my_center|LOCUS_07800 840233 839697 gene locus_tag LOCUS_07810 gene dsbB 840233 839697 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943452.1 protein_id gnl|my_center|LOCUS_07810 841916 840372 gene locus_tag LOCUS_07820 gene nhaB 841916 840372 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406446.1 protein_id gnl|my_center|LOCUS_07820 842139 842858 gene locus_tag LOCUS_07830 gene fadR 842139 842858 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096152.1 protein_id gnl|my_center|LOCUS_07830 844492 842960 gene locus_tag LOCUS_07840 844492 842960 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096153.1 protein_id gnl|my_center|LOCUS_07840 844811 846109 gene locus_tag LOCUS_07850 844811 846109 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705841.1 protein_id gnl|my_center|LOCUS_07850 846121 847191 gene locus_tag LOCUS_07860 gene dadX 846121 847191 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096156.1 protein_id gnl|my_center|LOCUS_07860 848958 847225 gene locus_tag LOCUS_07870 848958 847225 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096157.1 protein_id gnl|my_center|LOCUS_07870 850012 849101 gene locus_tag LOCUS_07880 gene ldcA 850012 849101 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096158.1 protein_id gnl|my_center|LOCUS_07880 850042 850722 gene locus_tag LOCUS_07890 gene emtA 850042 850722 CDS product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096159.1 protein_id gnl|my_center|LOCUS_07890 851739 851059 gene locus_tag LOCUS_07900 851739 851059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07900 851859 852113 gene locus_tag LOCUS_07910 851859 852113 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096161.1 protein_id gnl|my_center|LOCUS_07910 853847 852162 gene locus_tag LOCUS_07920 853847 852162 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705837.1 protein_id gnl|my_center|LOCUS_07920 854676 855185 gene locus_tag LOCUS_07930 854676 855185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096174.1 protein_id gnl|my_center|LOCUS_07930 855701 855959 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 856011 857354 gene locus_tag LOCUS_07940 gene tssK 856011 857354 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096176.1 protein_id gnl|my_center|LOCUS_07940 857369 858607 gene locus_tag LOCUS_07950 857369 858607 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096177.1 protein_id gnl|my_center|LOCUS_07950 858610 862224 gene locus_tag LOCUS_07960 gene tssM 858610 862224 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096178.1 protein_id gnl|my_center|LOCUS_07960 862241 862948 gene locus_tag LOCUS_07970 gene tagF 862241 862948 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366557.1 protein_id gnl|my_center|LOCUS_07970 862961 863962 gene locus_tag LOCUS_07980 gene tssA 862961 863962 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705460.1 protein_id gnl|my_center|LOCUS_07980 864027 864551 gene locus_tag LOCUS_07990 gene tssB 864027 864551 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502644.1 protein_id gnl|my_center|LOCUS_07990 865223 865579 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 865664 866443 gene locus_tag LOCUS_08000 865664 866443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 866521 866949 gene locus_tag LOCUS_08010 866521 866949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 867172 867654 gene locus_tag LOCUS_08020 867172 867654 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366565.1 protein_id gnl|my_center|LOCUS_08020 868267 868984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 870349 871143 gene locus_tag LOCUS_08030 870349 871143 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705455.1 protein_id gnl|my_center|LOCUS_08030 871165 872142 gene locus_tag LOCUS_08040 871165 872142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096186.1 protein_id gnl|my_center|LOCUS_08040 872741 873093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 873359 873925 gene locus_tag LOCUS_08050 gene tssE 873359 873925 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705452.1 protein_id gnl|my_center|LOCUS_08050 873922 875793 gene locus_tag LOCUS_08060 gene tssF 873922 875793 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420938.1 protein_id gnl|my_center|LOCUS_08060 875790 876833 gene locus_tag LOCUS_08070 gene tssG 875790 876833 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705450.1 protein_id gnl|my_center|LOCUS_08070 876882 878429 gene locus_tag LOCUS_08080 876882 878429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 878198 878317 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 878399 879652 gene locus_tag LOCUS_08090 878399 879652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 879679 881139 gene locus_tag LOCUS_08100 879679 881139 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096192.1 protein_id gnl|my_center|LOCUS_08100 881198 881584 gene locus_tag LOCUS_08110 881198 881584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 881674 882877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 882939 883511 gene locus_tag LOCUS_08120 882939 883511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 883523 884314 gene locus_tag LOCUS_08130 883523 884314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 884326 885468 gene locus_tag LOCUS_08140 884326 885468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 885471 885698 gene locus_tag LOCUS_08150 885471 885698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 885922 886729 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 886937 888295 gene locus_tag LOCUS_08160 886937 888295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08160 888308 888694 gene locus_tag LOCUS_08170 888308 888694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705447.1 protein_id gnl|my_center|LOCUS_08170 888998 891433 gene locus_tag LOCUS_08180 888998 891433 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705435.1 protein_id gnl|my_center|LOCUS_08180 891430 892116 gene locus_tag LOCUS_08190 891430 892116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08190 892200 892499 gene locus_tag LOCUS_08200 892200 892499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 892510 893115 gene locus_tag LOCUS_08210 892510 893115 CDS product DUF3540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705433.1 protein_id gnl|my_center|LOCUS_08210 893125 893517 gene locus_tag LOCUS_08220 893125 893517 CDS product DUF4150 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366584.1 protein_id gnl|my_center|LOCUS_08220 893678 894169 gene locus_tag LOCUS_08230 893678 894169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 895947 894202 gene locus_tag LOCUS_08240 895947 894202 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703227.1 protein_id gnl|my_center|LOCUS_08240 896227 897747 gene locus_tag LOCUS_08250 896227 897747 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118247.1 protein_id gnl|my_center|LOCUS_08250 898117 898299 gene locus_tag LOCUS_08260 898117 898299 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004150795.1 protein_id gnl|my_center|LOCUS_08260 898779 899147 gene locus_tag LOCUS_08270 898779 899147 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280524.1 protein_id gnl|my_center|LOCUS_08270 899144 899782 gene locus_tag LOCUS_08280 899144 899782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 899787 900749 gene locus_tag LOCUS_08290 899787 900749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 900824 901150 gene locus_tag LOCUS_08300 900824 901150 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_08300 903582 901189 gene locus_tag LOCUS_08310 903582 901189 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 protein_id gnl|my_center|LOCUS_08310 904061 904771 gene locus_tag LOCUS_08320 904061 904771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 906998 904824 gene locus_tag LOCUS_08330 gene katG 906998 904824 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705487.1 protein_id gnl|my_center|LOCUS_08330 907333 907776 gene locus_tag LOCUS_08340 gene marR 907333 907776 CDS product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799375.1 protein_id gnl|my_center|LOCUS_08340 907803 908987 gene locus_tag LOCUS_08350 907803 908987 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 protein_id gnl|my_center|LOCUS_08350 908999 910537 gene locus_tag LOCUS_08360 908999 910537 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112615.1 protein_id gnl|my_center|LOCUS_08360 910571 911803 gene locus_tag LOCUS_08370 910571 911803 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_08370 912584 913275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 914064 913495 gene locus_tag LOCUS_08380 914064 913495 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 protein_id gnl|my_center|LOCUS_08380 914942 914064 gene locus_tag LOCUS_08390 gene paoD 914942 914064 CDS product molybdenum cofactor insertion chaperone PaoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122401.1 protein_id gnl|my_center|LOCUS_08390 917247 915049 gene locus_tag LOCUS_08400 gene paoC 917247 915049 CDS product aldehyde oxidoreductase molybdenum-binding subunit PaoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667026.1 protein_id gnl|my_center|LOCUS_08400 918200 917250 gene locus_tag LOCUS_08410 gene paoB 918200 917250 CDS product aldehyde oxidoreductase FAD-binding subunit PaoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643333.1 protein_id gnl|my_center|LOCUS_08410 918769 918197 gene locus_tag LOCUS_08420 gene paoA 918769 918197 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070685.1 protein_id gnl|my_center|LOCUS_08420 919672 918941 gene locus_tag LOCUS_08430 919672 918941 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704784.1 protein_id gnl|my_center|LOCUS_08430 921077 919857 gene locus_tag LOCUS_08440 921077 919857 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704783.1 protein_id gnl|my_center|LOCUS_08440 921458 921697 gene locus_tag LOCUS_08450 gene ycgZ 921458 921697 CDS product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367637.1 protein_id gnl|my_center|LOCUS_08450 921844 922155 gene locus_tag LOCUS_08460 921844 922155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 922198 922464 gene locus_tag LOCUS_08470 922198 922464 CDS product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096961.1 protein_id gnl|my_center|LOCUS_08470 922657 923403 gene locus_tag LOCUS_08480 922657 923403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 924165 923410 gene locus_tag LOCUS_08490 924165 923410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096723.1 protein_id gnl|my_center|LOCUS_08490 924363 924166 gene locus_tag LOCUS_08500 924363 924166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 925023 924439 gene locus_tag LOCUS_08510 925023 924439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 925052 925469 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 925544 925747 gene locus_tag LOCUS_08520 925544 925747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 926411 927193 gene locus_tag LOCUS_08530 926411 927193 CDS product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992238.1 protein_id gnl|my_center|LOCUS_08530 927674 927195 gene locus_tag LOCUS_08540 927674 927195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 929129 927810 gene locus_tag LOCUS_08550 929129 927810 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477481.1 protein_id gnl|my_center|LOCUS_08550 929261 930163 gene locus_tag LOCUS_08560 929261 930163 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477420.1 protein_id gnl|my_center|LOCUS_08560 930254 930559 gene locus_tag LOCUS_08570 930254 930559 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137290.1 protein_id gnl|my_center|LOCUS_08570 930561 931094 gene locus_tag LOCUS_08580 930561 931094 CDS product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098411.1 protein_id gnl|my_center|LOCUS_08580 932385 931477 gene locus_tag LOCUS_08590 932385 931477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 933793 932702 gene locus_tag LOCUS_08600 gene ychF 933793 932702 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505850.1 protein_id gnl|my_center|LOCUS_08600 934504 933920 gene locus_tag LOCUS_08610 gene pth 934504 933920 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705080.1 protein_id gnl|my_center|LOCUS_08610 934754 935029 gene locus_tag LOCUS_08620 gene ychH 934754 935029 CDS product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367115.1 protein_id gnl|my_center|LOCUS_08620 935144 935375 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 937071 935392 gene locus_tag LOCUS_08630 gene dauA 937071 935392 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705081.1 protein_id gnl|my_center|LOCUS_08630 938140 937193 gene locus_tag LOCUS_08640 gene prs 938140 937193 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367113.1 protein_id gnl|my_center|LOCUS_08640 939134 938268 gene locus_tag LOCUS_08650 gene ispE 939134 938268 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367112.1 protein_id gnl|my_center|LOCUS_08650 939754 939131 gene locus_tag LOCUS_08660 gene lolB 939754 939131 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130692.1 protein_id gnl|my_center|LOCUS_08660 939956 941212 gene locus_tag LOCUS_08670 gene hemA 939956 941212 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367110.1 protein_id gnl|my_center|LOCUS_08670 941250 942332 gene locus_tag LOCUS_08680 gene prfA 941250 942332 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804726.1 protein_id gnl|my_center|LOCUS_08680 942332 943177 gene locus_tag LOCUS_08690 gene prmC 942332 943177 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096234.1 protein_id gnl|my_center|LOCUS_08690 943420 944190 gene locus_tag LOCUS_08700 gene sirB1 943420 944190 CDS product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096236.1 protein_id gnl|my_center|LOCUS_08700 944228 945082 gene locus_tag LOCUS_08710 gene kdsA 944228 945082 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811065.1 protein_id gnl|my_center|LOCUS_08710 946258 945158 gene locus_tag LOCUS_08720 gene chaA 946258 945158 CDS product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 protein_id gnl|my_center|LOCUS_08720 946516 946746 gene locus_tag LOCUS_08730 gene chaB 946516 946746 CDS product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146442.1 protein_id gnl|my_center|LOCUS_08730 946924 947619 gene locus_tag LOCUS_08740 946924 947619 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096242.1 protein_id gnl|my_center|LOCUS_08740 947878 947633 gene locus_tag LOCUS_08750 947878 947633 CDS product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705086.1 protein_id gnl|my_center|LOCUS_08750 949881 948091 gene locus_tag LOCUS_08760 949881 948091 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096244.1 protein_id gnl|my_center|LOCUS_08760 950334 949981 gene locus_tag LOCUS_08770 950334 949981 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705087.1 protein_id gnl|my_center|LOCUS_08770 950989 950438 gene locus_tag LOCUS_08780 950989 950438 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_08780 951196 952572 gene locus_tag LOCUS_08790 951196 952572 CDS product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419841.1 protein_id gnl|my_center|LOCUS_08790 953226 952576 gene locus_tag LOCUS_08800 gene narL 953226 952576 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070491.1 protein_id gnl|my_center|LOCUS_08800 955015 953219 gene locus_tag LOCUS_08810 gene narX 955015 953219 CDS product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476239.1 protein_id gnl|my_center|LOCUS_08810 955323 956717 gene locus_tag LOCUS_08820 gene narK 955323 956717 CDS product nitrate transporter NarK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019848.1 protein_id gnl|my_center|LOCUS_08820 957106 960849 gene locus_tag LOCUS_08830 957106 960849 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032878.1 protein_id gnl|my_center|LOCUS_08830 960846 962381 gene locus_tag LOCUS_08840 gene narH 960846 962381 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702629.1 protein_id gnl|my_center|LOCUS_08840 962378 963088 gene locus_tag LOCUS_08850 gene narJ 962378 963088 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705098.1 protein_id gnl|my_center|LOCUS_08850 963088 963765 gene locus_tag LOCUS_08860 gene narI 963088 963765 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367083.1 protein_id gnl|my_center|LOCUS_08860 964095 964011 gene locus_tag LOCUS_t00170 964095 964011 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 964389 964305 gene locus_tag LOCUS_t00180 964389 964305 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 965568 964726 gene locus_tag LOCUS_08870 gene purU 965568 964726 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191159.1 protein_id gnl|my_center|LOCUS_08870 966070 965612 gene locus_tag LOCUS_08880 966070 965612 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883447.1 protein_id gnl|my_center|LOCUS_08880 966246 967091 gene locus_tag LOCUS_08890 gene rssA 966246 967091 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096264.1 protein_id gnl|my_center|LOCUS_08890 967185 968198 gene locus_tag LOCUS_08900 gene rssB 967185 968198 CDS product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193451.1 protein_id gnl|my_center|LOCUS_08900 968396 969307 gene locus_tag LOCUS_08910 gene galU 968396 969307 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718995.1 protein_id gnl|my_center|LOCUS_08910 969919 969506 gene locus_tag LOCUS_08920 gene hns 969919 969506 CDS product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502781.1 protein_id gnl|my_center|LOCUS_08920 970471 971085 gene locus_tag LOCUS_08930 gene tdk 970471 971085 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705104.1 protein_id gnl|my_center|LOCUS_08930 973863 971182 gene locus_tag LOCUS_08940 gene adhE 973863 971182 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096268.1 protein_id gnl|my_center|LOCUS_08940 974337 974984 gene locus_tag LOCUS_08950 974337 974984 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615840.1 protein_id gnl|my_center|LOCUS_08950 975826 976239 gene locus_tag LOCUS_08960 975826 976239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08960 976266 977384 gene locus_tag LOCUS_08970 976266 977384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08970 977469 978389 gene locus_tag LOCUS_08980 gene oppB 977469 978389 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367069.1 protein_id gnl|my_center|LOCUS_08980 978404 979312 gene locus_tag LOCUS_08990 gene oppC 978404 979312 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 protein_id gnl|my_center|LOCUS_08990 979324 980337 gene locus_tag LOCUS_09000 979324 980337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096273.1 protein_id gnl|my_center|LOCUS_09000 980334 981338 gene locus_tag LOCUS_09010 gene oppF 980334 981338 CDS product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367066.1 protein_id gnl|my_center|LOCUS_09010 981718 981389 gene locus_tag LOCUS_09020 981718 981389 CDS product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367064.1 protein_id gnl|my_center|LOCUS_09020 983213 981753 gene locus_tag LOCUS_09030 gene cls 983213 981753 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206886.1 protein_id gnl|my_center|LOCUS_09030 983351 983524 gene locus_tag LOCUS_09040 983351 983524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09040 983579 983917 gene locus_tag LOCUS_09050 983579 983917 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159242.1 protein_id gnl|my_center|LOCUS_09050 984255 983959 gene locus_tag LOCUS_09060 984255 983959 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367051.1 protein_id gnl|my_center|LOCUS_09060 984476 985213 gene locus_tag LOCUS_09070 gene tonB 984476 985213 CDS product TonB system transport protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171276.1 protein_id gnl|my_center|LOCUS_09070 985645 985244 gene locus_tag LOCUS_09080 gene yciA 985645 985244 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096281.1 protein_id gnl|my_center|LOCUS_09080 986257 985718 gene locus_tag LOCUS_09090 986257 985718 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366196.1 protein_id gnl|my_center|LOCUS_09090 987039 986284 gene locus_tag LOCUS_09100 987039 986284 CDS product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096283.1 protein_id gnl|my_center|LOCUS_09100 987745 988380 gene locus_tag LOCUS_09110 gene ompW 987745 988380 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096285.1 protein_id gnl|my_center|LOCUS_09110 989269 988460 gene locus_tag LOCUS_09120 gene trpA 989269 988460 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096355.1 protein_id gnl|my_center|LOCUS_09120 990462 989269 gene locus_tag LOCUS_09130 gene trpB 990462 989269 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096356.1 protein_id gnl|my_center|LOCUS_09130 991832 990474 gene locus_tag LOCUS_09140 gene trpCF 991832 990474 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096357.1 protein_id gnl|my_center|LOCUS_09140 993431 991836 gene locus_tag LOCUS_09150 gene trpD 993431 991836 CDS product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763524.1 protein_id gnl|my_center|LOCUS_09150 994993 993431 gene locus_tag LOCUS_09160 994993 993431 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366210.1 protein_id gnl|my_center|LOCUS_09160 995537 995890 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 996460 997080 gene locus_tag LOCUS_09170 996460 997080 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366212.1 protein_id gnl|my_center|LOCUS_09170 997164 998036 gene locus_tag LOCUS_09180 gene rluB 997164 998036 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291217.1 protein_id gnl|my_center|LOCUS_09180 998648 998058 gene locus_tag LOCUS_09190 gene cobO 998648 998058 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278906.1 protein_id gnl|my_center|LOCUS_09190 999403 998645 gene locus_tag LOCUS_09200 999403 998645 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559262.1 protein_id gnl|my_center|LOCUS_09200 999605 1000651 gene locus_tag LOCUS_09210 gene sohB 999605 1000651 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422082.1 protein_id gnl|my_center|LOCUS_09210 1000937 1000686 gene locus_tag LOCUS_09220 1000937 1000686 CDS product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366222.1 protein_id gnl|my_center|LOCUS_09220 1001337 1003934 gene locus_tag LOCUS_09230 gene topA 1001337 1003934 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513593.1 protein_id gnl|my_center|LOCUS_09230 1004116 1005090 gene locus_tag LOCUS_09240 gene cysB 1004116 1005090 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705738.1 protein_id gnl|my_center|LOCUS_09240 1006148 1008385 gene locus_tag LOCUS_09250 gene acnA 1006148 1008385 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099459.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 1008360 1008824 gene locus_tag LOCUS_09260 1008360 1008824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 1009457 1008867 gene locus_tag LOCUS_09270 gene ribA 1009457 1008867 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096372.1 protein_id gnl|my_center|LOCUS_09270 1009643 1010407 gene locus_tag LOCUS_09280 gene pgpB 1009643 1010407 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948651.1 protein_id gnl|my_center|LOCUS_09280 1010549 1010857 gene locus_tag LOCUS_09290 gene lapA 1010549 1010857 CDS product lipopolysaccharide assembly protein LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876284.1 protein_id gnl|my_center|LOCUS_09290 1010864 1012033 gene locus_tag LOCUS_09300 gene lapB 1010864 1012033 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096375.1 protein_id gnl|my_center|LOCUS_09300 1012222 1012956 gene locus_tag LOCUS_09310 gene pyrF 1012222 1012956 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176265.1 protein_id gnl|my_center|LOCUS_09310 1012956 1013282 gene locus_tag LOCUS_09320 gene yciH 1012956 1013282 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285199.1 protein_id gnl|my_center|LOCUS_09320 1013614 1013393 gene locus_tag LOCUS_09330 gene osmB 1013614 1013393 CDS product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498253.1 protein_id gnl|my_center|LOCUS_09330 1014629 1013871 gene locus_tag LOCUS_09340 1014629 1013871 CDS product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096378.1 protein_id gnl|my_center|LOCUS_09340 1014871 1014689 gene locus_tag LOCUS_09350 1014871 1014689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366235.1 protein_id gnl|my_center|LOCUS_09350 1015063 1015929 gene locus_tag LOCUS_09360 1015063 1015929 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 protein_id gnl|my_center|LOCUS_09360 1017917 1015926 gene locus_tag LOCUS_09370 gene pdeR 1017917 1015926 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096381.1 protein_id gnl|my_center|LOCUS_09370 1018640 1018218 gene locus_tag LOCUS_09380 1018640 1018218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 1020151 1018637 gene locus_tag LOCUS_09390 1020151 1018637 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705733.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09390 1021407 1020259 gene locus_tag LOCUS_09400 1021407 1020259 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705732.1 protein_id gnl|my_center|LOCUS_09400 1022370 1021582 gene locus_tag LOCUS_09410 gene fabI 1022370 1021582 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 protein_id gnl|my_center|LOCUS_09410 1023090 1024025 gene locus_tag LOCUS_09420 1023090 1024025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1024900 1024094 gene locus_tag LOCUS_09430 gene sapF 1024900 1024094 CDS product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573407.1 protein_id gnl|my_center|LOCUS_09430 1025894 1024902 gene locus_tag LOCUS_09440 gene sapD 1025894 1024902 CDS product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096394.1 protein_id gnl|my_center|LOCUS_09440 1026784 1025894 gene locus_tag LOCUS_09450 gene sapC 1026784 1025894 CDS product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146150.1 protein_id gnl|my_center|LOCUS_09450 1027736 1026771 gene locus_tag LOCUS_09460 gene sapB 1027736 1026771 CDS product peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583298.1 protein_id gnl|my_center|LOCUS_09460 1029436 1027733 gene locus_tag LOCUS_09470 gene sapA 1029436 1027733 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096397.1 protein_id gnl|my_center|LOCUS_09470 1030455 1029472 gene locus_tag LOCUS_09480 gene pspF 1030455 1029472 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852835.1 protein_id gnl|my_center|LOCUS_09480 1030624 1031292 gene locus_tag LOCUS_09490 gene pspA 1030624 1031292 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511000.1 protein_id gnl|my_center|LOCUS_09490 1031348 1031572 gene locus_tag LOCUS_09500 gene pspB 1031348 1031572 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274963.1 protein_id gnl|my_center|LOCUS_09500 1031572 1031928 gene locus_tag LOCUS_09510 gene pspC 1031572 1031928 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014347.1 protein_id gnl|my_center|LOCUS_09510 1031946 1032164 gene locus_tag LOCUS_09520 gene pspD 1031946 1032164 CDS product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295585.1 protein_id gnl|my_center|LOCUS_09520 1032248 1032562 gene locus_tag LOCUS_09530 gene pspE 1032248 1032562 CDS product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473128.1 protein_id gnl|my_center|LOCUS_09530 1032667 1033533 gene locus_tag LOCUS_09540 1032667 1033533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09540 1033503 1034072 gene locus_tag LOCUS_09550 1033503 1034072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09550 1034069 1035133 gene locus_tag LOCUS_09560 1034069 1035133 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138717.1 protein_id gnl|my_center|LOCUS_09560 1035276 1036817 gene locus_tag LOCUS_09570 gene tyrR 1035276 1036817 CDS product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235493.1 protein_id gnl|my_center|LOCUS_09570 1037361 1036855 gene locus_tag LOCUS_09580 gene tpx 1037361 1036855 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096423.1 protein_id gnl|my_center|LOCUS_09580 1037674 1038648 gene locus_tag LOCUS_09590 gene ycjG 1037674 1038648 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258077.1 protein_id gnl|my_center|LOCUS_09590 1039343 1038630 gene locus_tag LOCUS_09600 gene mpaA 1039343 1038630 CDS product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219125.1 protein_id gnl|my_center|LOCUS_09600 1039527 1041143 gene locus_tag LOCUS_09610 1039527 1041143 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096426.1 protein_id gnl|my_center|LOCUS_09610 1042877 1041198 gene locus_tag LOCUS_09620 1042877 1041198 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705650.1 protein_id gnl|my_center|LOCUS_09620 1044389 1042935 gene locus_tag LOCUS_09630 1044389 1042935 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184131.1 protein_id gnl|my_center|LOCUS_09630 1045211 1045399 gene locus_tag LOCUS_09640 1045211 1045399 CDS product YdiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638607.1 protein_id gnl|my_center|LOCUS_09640 1045715 1045548 gene locus_tag LOCUS_09650 1045715 1045548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1045794 1046975 gene locus_tag LOCUS_09660 1045794 1046975 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062729484.1 protein_id gnl|my_center|LOCUS_09660 1047218 1046994 gene locus_tag LOCUS_09670 1047218 1046994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1047102 1048085 gene locus_tag LOCUS_09680 gene zntB 1047102 1048085 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387372.1 protein_id gnl|my_center|LOCUS_09680 1048357 1048506 gene locus_tag LOCUS_09690 1048357 1048506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1049496 1048561 gene locus_tag LOCUS_09700 gene ttcA 1049496 1048561 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 protein_id gnl|my_center|LOCUS_09700 1049645 1050088 gene locus_tag LOCUS_09710 1049645 1050088 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096599.1 protein_id gnl|my_center|LOCUS_09710 1053855 1050331 gene locus_tag LOCUS_09720 gene nifJ 1053855 1050331 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096463.1 protein_id gnl|my_center|LOCUS_09720 1054824 1054396 gene locus_tag LOCUS_09730 gene hslJ 1054824 1054396 CDS product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296048.1 protein_id gnl|my_center|LOCUS_09730 1055920 1054931 gene locus_tag LOCUS_09740 1055920 1054931 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096773.1 protein_id gnl|my_center|LOCUS_09740 1056129 1058768 gene locus_tag LOCUS_09750 1056129 1058768 CDS product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096772.1 protein_id gnl|my_center|LOCUS_09750 1058765 1058953 gene locus_tag LOCUS_09760 1058765 1058953 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698145.1 protein_id gnl|my_center|LOCUS_09760 1059030 1059635 gene locus_tag LOCUS_09770 1059030 1059635 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177537.1 protein_id gnl|my_center|LOCUS_09770 1059632 1060549 gene locus_tag LOCUS_09780 1059632 1060549 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209769.1 protein_id gnl|my_center|LOCUS_09780 1060797 1060603 gene locus_tag LOCUS_09790 1060797 1060603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1060756 1062342 gene locus_tag LOCUS_09800 1060756 1062342 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431870.1 protein_id gnl|my_center|LOCUS_09800 1062977 1062375 gene locus_tag LOCUS_09810 gene azoR 1062977 1062375 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048924.1 protein_id gnl|my_center|LOCUS_09810 1063173 1067078 gene locus_tag LOCUS_09820 gene hrpA 1063173 1067078 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139499.1 protein_id gnl|my_center|LOCUS_09820 1068599 1067214 gene locus_tag LOCUS_09830 1068599 1067214 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096703.1 protein_id gnl|my_center|LOCUS_09830 1069678 1068596 gene locus_tag LOCUS_09840 1069678 1068596 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096702.1 protein_id gnl|my_center|LOCUS_09840 1071359 1069704 gene locus_tag LOCUS_09850 1071359 1069704 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096701.1 protein_id gnl|my_center|LOCUS_09850 1072418 1072922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1073095 1074534 gene locus_tag LOCUS_09860 gene aldA 1073095 1074534 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115947.1 protein_id gnl|my_center|LOCUS_09860 1074874 1074659 gene locus_tag LOCUS_09870 1074874 1074659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1076064 1075138 gene locus_tag LOCUS_09880 1076064 1075138 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_09880 1076398 1076937 gene locus_tag LOCUS_09890 gene cybB 1076398 1076937 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096695.1 protein_id gnl|my_center|LOCUS_09890 1077124 1078410 gene locus_tag LOCUS_09900 gene proP 1077124 1078410 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_09900 1078752 1079027 gene locus_tag LOCUS_09910 1078752 1079027 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 protein_id gnl|my_center|LOCUS_09910 1079059 1080177 gene locus_tag LOCUS_09920 1079059 1080177 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366371.1 protein_id gnl|my_center|LOCUS_09920 1080327 1082024 gene locus_tag LOCUS_09930 1080327 1082024 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419375.1 protein_id gnl|my_center|LOCUS_09930 1083280 1082225 gene locus_tag LOCUS_09940 1083280 1082225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09940 1083375 1083585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1085813 1084890 gene locus_tag LOCUS_09950 1085813 1084890 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096674.1 protein_id gnl|my_center|LOCUS_09950 1086102 1087445 gene locus_tag LOCUS_09960 1086102 1087445 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705582.1 protein_id gnl|my_center|LOCUS_09960 1087488 1088996 gene locus_tag LOCUS_09970 1087488 1088996 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366380.1 protein_id gnl|my_center|LOCUS_09970 1089864 1089181 gene locus_tag LOCUS_09980 gene ompL 1089864 1089181 CDS product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099374.1 protein_id gnl|my_center|LOCUS_09980 1091095 1089938 gene locus_tag LOCUS_09990 1091095 1089938 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703474.1 protein_id gnl|my_center|LOCUS_09990 1092357 1091107 gene locus_tag LOCUS_10000 1092357 1091107 CDS product oligosaccharide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098731.1 protein_id gnl|my_center|LOCUS_10000 1093965 1092382 gene locus_tag LOCUS_10010 1093965 1092382 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703475.1 protein_id gnl|my_center|LOCUS_10010 1094414 1095268 gene locus_tag LOCUS_10020 1094414 1095268 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369696.1 protein_id gnl|my_center|LOCUS_10020 1096808 1097305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1097647 1098207 gene locus_tag LOCUS_10030 gene rimL 1097647 1098207 CDS product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366387.1 protein_id gnl|my_center|LOCUS_10030 1099170 1098190 gene locus_tag LOCUS_10040 gene ydcK 1099170 1098190 CDS product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096652.1 protein_id gnl|my_center|LOCUS_10040 1099307 1099900 gene locus_tag LOCUS_10050 gene tehB 1099307 1099900 CDS product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218282.1 protein_id gnl|my_center|LOCUS_10050 1101126 1099897 gene locus_tag LOCUS_10060 gene pepT 1101126 1099897 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096649.1 protein_id gnl|my_center|LOCUS_10060 1101244 1102839 gene locus_tag LOCUS_10070 1101244 1102839 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419397.1 protein_id gnl|my_center|LOCUS_10070 1103486 1103935 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1103989 1104111 gene locus_tag LOCUS_10080 1103989 1104111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1105058 1104162 gene locus_tag LOCUS_10090 1105058 1104162 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705569.1 protein_id gnl|my_center|LOCUS_10090 1105207 1106097 gene locus_tag LOCUS_10100 1105207 1106097 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096645.1 protein_id gnl|my_center|LOCUS_10100 1107243 1106077 gene locus_tag LOCUS_10110 1107243 1106077 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096644.1 protein_id gnl|my_center|LOCUS_10110 1107378 1107932 gene locus_tag LOCUS_10120 1107378 1107932 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705566.1 protein_id gnl|my_center|LOCUS_10120 1108012 1109976 gene locus_tag LOCUS_10130 gene rlhA 1108012 1109976 CDS product 23S rRNA 5-hydroxycytidine C2501 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313806.1 protein_id gnl|my_center|LOCUS_10130 1110120 1111529 gene locus_tag LOCUS_10140 1110120 1111529 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096471.1 protein_id gnl|my_center|LOCUS_10140 1111867 1113009 gene locus_tag LOCUS_10150 1111867 1113009 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047447.1 protein_id gnl|my_center|LOCUS_10150 1113027 1114040 gene locus_tag LOCUS_10160 1113027 1114040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220396.1 protein_id gnl|my_center|LOCUS_10160 1114040 1114972 gene locus_tag LOCUS_10170 1114040 1114972 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251315.1 protein_id gnl|my_center|LOCUS_10170 1114962 1115753 gene locus_tag LOCUS_10180 1114962 1115753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096476.1 protein_id gnl|my_center|LOCUS_10180 1116138 1116506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1118253 1117633 gene locus_tag LOCUS_10190 1118253 1117633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1118509 1119735 gene locus_tag LOCUS_10200 1118509 1119735 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618922.1 protein_id gnl|my_center|LOCUS_10200 1121574 1119778 gene locus_tag LOCUS_10210 1121574 1119778 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530887.1 protein_id gnl|my_center|LOCUS_10210 1122135 1121692 gene locus_tag LOCUS_10220 1122135 1121692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1122606 1122779 gene locus_tag LOCUS_10230 1122606 1122779 CDS product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 protein_id gnl|my_center|LOCUS_10230 1122960 1123985 gene locus_tag LOCUS_10240 gene yiaK 1122960 1123985 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869006.1 protein_id gnl|my_center|LOCUS_10240 1126209 1124035 gene locus_tag LOCUS_10250 1126209 1124035 CDS product virulence factor SrfC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419532.1 protein_id gnl|my_center|LOCUS_10250 1128899 1126206 gene locus_tag LOCUS_10260 1128899 1126206 CDS product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096481.1 protein_id gnl|my_center|LOCUS_10260 1128982 1129362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1130906 1129578 gene locus_tag LOCUS_10270 1130906 1129578 CDS product SrfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096482.1 protein_id gnl|my_center|LOCUS_10270 1131161 1132759 gene locus_tag LOCUS_10280 1131161 1132759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705554.1 protein_id gnl|my_center|LOCUS_10280 1132770 1133003 gene locus_tag LOCUS_10290 gene ydcY 1132770 1133003 CDS product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 protein_id gnl|my_center|LOCUS_10290 1133456 1133007 gene locus_tag LOCUS_10300 1133456 1133007 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096484.1 protein_id gnl|my_center|LOCUS_10300 1133971 1133453 gene locus_tag LOCUS_10310 1133971 1133453 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096485.1 protein_id gnl|my_center|LOCUS_10310 1134049 1134316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1134582 1134785 gene locus_tag LOCUS_10320 1134582 1134785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10320 1134849 1135886 gene locus_tag LOCUS_10330 gene curA 1134849 1135886 CDS product NADPH-dependent curcumin/dihydrocurcumin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531462.1 protein_id gnl|my_center|LOCUS_10330 1136141 1136797 gene locus_tag LOCUS_10340 1136141 1136797 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096488.1 protein_id gnl|my_center|LOCUS_10340 1138991 1136973 gene locus_tag LOCUS_10350 gene pqqU 1138991 1136973 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_10350 1139341 1140402 gene locus_tag LOCUS_10360 1139341 1140402 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550675.1 protein_id gnl|my_center|LOCUS_10360 1141942 1140458 gene locus_tag LOCUS_10370 gene ansP 1141942 1140458 CDS product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366426.1 protein_id gnl|my_center|LOCUS_10370 1143515 1142205 gene locus_tag LOCUS_10380 1143515 1142205 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703312.1 protein_id gnl|my_center|LOCUS_10380 1144914 1143718 gene locus_tag LOCUS_10390 1144914 1143718 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_10390 1145195 1146208 gene locus_tag LOCUS_10400 1145195 1146208 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981551.1 protein_id gnl|my_center|LOCUS_10400 1146211 1146738 gene locus_tag LOCUS_10410 1146211 1146738 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684771.1 protein_id gnl|my_center|LOCUS_10410 1147085 1147311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1147703 1147936 gene locus_tag LOCUS_10420 gene pptA 1147703 1147936 CDS product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096502.1 protein_id gnl|my_center|LOCUS_10420 1148574 1148002 gene locus_tag LOCUS_10430 1148574 1148002 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096509.1 protein_id gnl|my_center|LOCUS_10430 1150396 1148609 gene locus_tag LOCUS_10440 1150396 1148609 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095767.1 protein_id gnl|my_center|LOCUS_10440 1150639 1151340 gene locus_tag LOCUS_10450 1150639 1151340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1151370 1152296 gene locus_tag LOCUS_10460 1151370 1152296 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385516.1 protein_id gnl|my_center|LOCUS_10460 1152417 1154042 gene locus_tag LOCUS_10470 1152417 1154042 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 protein_id gnl|my_center|LOCUS_10470 1154119 1154940 gene locus_tag LOCUS_10480 gene nhoA 1154119 1154940 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 protein_id gnl|my_center|LOCUS_10480 1155424 1154948 gene locus_tag LOCUS_10490 1155424 1154948 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_10490 1155870 1155424 gene locus_tag LOCUS_10500 1155870 1155424 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266691.1 protein_id gnl|my_center|LOCUS_10500 1156818 1155937 gene locus_tag LOCUS_10510 gene yddG 1156818 1155937 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 protein_id gnl|my_center|LOCUS_10510 1157822 1156917 gene locus_tag LOCUS_10520 1157822 1156917 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530571.1 protein_id gnl|my_center|LOCUS_10520 1157923 1158729 gene locus_tag LOCUS_10530 1157923 1158729 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172659.1 protein_id gnl|my_center|LOCUS_10530 1158900 1160339 gene locus_tag LOCUS_10540 gene katA 1158900 1160339 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175627974.1 protein_id gnl|my_center|LOCUS_10540 1160499 1161680 gene locus_tag LOCUS_10550 gene araJ 1160499 1161680 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096529.1 protein_id gnl|my_center|LOCUS_10550 1162008 1161724 gene locus_tag LOCUS_10560 1162008 1161724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1163817 1162102 gene locus_tag LOCUS_10570 1163817 1162102 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096531.1 protein_id gnl|my_center|LOCUS_10570 1165809 1164112 gene locus_tag LOCUS_10580 1165809 1164112 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096532.1 protein_id gnl|my_center|LOCUS_10580 1166113 1165979 gene locus_tag LOCUS_10590 gene sra 1166113 1165979 CDS product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096533.1 protein_id gnl|my_center|LOCUS_10590 1167814 1166276 gene locus_tag LOCUS_10600 1167814 1166276 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189772.1 protein_id gnl|my_center|LOCUS_10600 1168388 1169605 gene locus_tag LOCUS_10610 1168388 1169605 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 protein_id gnl|my_center|LOCUS_10610 1169645 1171198 gene locus_tag LOCUS_10620 1169645 1171198 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038812.1 protein_id gnl|my_center|LOCUS_10620 1171351 1174323 gene locus_tag LOCUS_10630 gene fdhF 1171351 1174323 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037794.1 protein_id gnl|my_center|LOCUS_10630 1174323 1174805 gene locus_tag LOCUS_10640 1174323 1174805 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037793.1 protein_id gnl|my_center|LOCUS_10640 1174798 1176150 gene locus_tag LOCUS_10650 1174798 1176150 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037792.1 protein_id gnl|my_center|LOCUS_10650 1176751 1177159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1177687 1178862 gene locus_tag LOCUS_10660 1177687 1178862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1180240 1178900 gene locus_tag LOCUS_10670 1180240 1178900 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096576.1 protein_id gnl|my_center|LOCUS_10670 1180421 1181341 gene locus_tag LOCUS_10680 1180421 1181341 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705406.1 protein_id gnl|my_center|LOCUS_10680 1181668 1181345 gene locus_tag LOCUS_10690 1181668 1181345 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628051.1 protein_id gnl|my_center|LOCUS_10690 1182408 1181668 gene locus_tag LOCUS_10700 1182408 1181668 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029975.1 protein_id gnl|my_center|LOCUS_10700 1182741 1182950 gene locus_tag LOCUS_10710 1182741 1182950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1183205 1183798 gene locus_tag LOCUS_10720 1183205 1183798 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039271.1 protein_id gnl|my_center|LOCUS_10720 1183964 1184584 gene locus_tag LOCUS_10730 1183964 1184584 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096586.1 protein_id gnl|my_center|LOCUS_10730 1184616 1185440 gene locus_tag LOCUS_10740 1184616 1185440 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073885237.1 protein_id gnl|my_center|LOCUS_10740 1185517 1185879 gene locus_tag LOCUS_10750 1185517 1185879 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370120.1 protein_id gnl|my_center|LOCUS_10750 1186154 1187491 gene locus_tag LOCUS_10760 1186154 1187491 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061782.1 protein_id gnl|my_center|LOCUS_10760 1187524 1188261 gene locus_tag LOCUS_10770 1187524 1188261 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_10770 1188273 1189301 gene locus_tag LOCUS_10780 1188273 1189301 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_10780 1189472 1190650 gene locus_tag LOCUS_10790 1189472 1190650 CDS product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051352.1 protein_id gnl|my_center|LOCUS_10790 1191886 1191332 gene locus_tag LOCUS_10800 1191886 1191332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1192647 1192180 gene locus_tag LOCUS_10810 1192647 1192180 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702452.1 protein_id gnl|my_center|LOCUS_10810 1193169 1192768 gene locus_tag LOCUS_10820 1193169 1192768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10820 1193557 1193159 gene locus_tag LOCUS_10830 1193557 1193159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10830 1193840 1194214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1194791 1194231 gene locus_tag LOCUS_10840 1194791 1194231 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534996.1 protein_id gnl|my_center|LOCUS_10840 1194877 1195620 gene locus_tag LOCUS_10850 1194877 1195620 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 protein_id gnl|my_center|LOCUS_10850 1196586 1195663 gene locus_tag LOCUS_10860 1196586 1195663 CDS product aromatic alcohol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814344.1 protein_id gnl|my_center|LOCUS_10860 1196716 1197612 gene locus_tag LOCUS_10870 1196716 1197612 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359197.1 protein_id gnl|my_center|LOCUS_10870 1197747 1198013 gene locus_tag LOCUS_10880 1197747 1198013 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083182810.1 protein_id gnl|my_center|LOCUS_10880 1198015 1199280 gene locus_tag LOCUS_10890 1198015 1199280 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_10890 1199470 1199865 gene locus_tag LOCUS_10900 1199470 1199865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10900 1199859 1200800 gene locus_tag LOCUS_10910 1199859 1200800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10910 1201040 1201711 gene locus_tag LOCUS_10920 1201040 1201711 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_10920 1201727 1202806 gene locus_tag LOCUS_10930 1201727 1202806 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_10930 1202825 1203985 gene locus_tag LOCUS_10940 1202825 1203985 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_10940 1204003 1204464 gene locus_tag LOCUS_10950 1204003 1204464 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033059696.1 protein_id gnl|my_center|LOCUS_10950 1204675 1205958 gene locus_tag LOCUS_10960 1204675 1205958 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410140.1 protein_id gnl|my_center|LOCUS_10960 1206528 1205995 gene locus_tag LOCUS_10970 1206528 1205995 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094859.1 protein_id gnl|my_center|LOCUS_10970 1206663 1207397 gene locus_tag LOCUS_10980 1206663 1207397 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418306.1 protein_id gnl|my_center|LOCUS_10980 1207500 1208459 gene locus_tag LOCUS_10990 1207500 1208459 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418304.1 protein_id gnl|my_center|LOCUS_10990 1209216 1208461 gene locus_tag LOCUS_11000 1209216 1208461 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_11000 1209298 1209882 gene locus_tag LOCUS_11010 1209298 1209882 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096593.1 protein_id gnl|my_center|LOCUS_11010 1210106 1211893 gene locus_tag LOCUS_11020 gene treZ 1210106 1211893 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095550.1 protein_id gnl|my_center|LOCUS_11020 1214097 1214611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1214633 1214971 gene locus_tag LOCUS_11030 1214633 1214971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1215212 1217086 gene locus_tag LOCUS_11040 gene glgX 1215212 1217086 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096571.1 protein_id gnl|my_center|LOCUS_11040 1217192 1218160 gene locus_tag LOCUS_11050 gene tehA 1217192 1218160 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096651.1 protein_id gnl|my_center|LOCUS_11050 1218356 1219315 gene locus_tag LOCUS_11060 1218356 1219315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705429.1 protein_id gnl|my_center|LOCUS_11060 1219358 1219891 gene locus_tag LOCUS_11070 1219358 1219891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096584.1 protein_id gnl|my_center|LOCUS_11070 1220082 1221320 gene locus_tag LOCUS_11080 1220082 1221320 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097093.1 protein_id gnl|my_center|LOCUS_11080 1221569 1223146 gene locus_tag LOCUS_11090 1221569 1223146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1225027 1223576 gene locus_tag LOCUS_11100 gene uxaB 1225027 1223576 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854618.1 protein_id gnl|my_center|LOCUS_11100 1225680 1225150 gene locus_tag LOCUS_11110 1225680 1225150 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096605.1 protein_id gnl|my_center|LOCUS_11110 1226725 1225760 gene locus_tag LOCUS_11120 1226725 1225760 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096606.1 protein_id gnl|my_center|LOCUS_11120 1227873 1226818 gene locus_tag LOCUS_11130 1227873 1226818 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096607.1 protein_id gnl|my_center|LOCUS_11130 1229373 1227991 gene locus_tag LOCUS_11140 1229373 1227991 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096608.1 protein_id gnl|my_center|LOCUS_11140 1229893 1229501 gene locus_tag LOCUS_11150 1229893 1229501 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191033.1 protein_id gnl|my_center|LOCUS_11150 1231525 1229936 gene locus_tag LOCUS_11160 1231525 1229936 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096611.1 protein_id gnl|my_center|LOCUS_11160 1233029 1231641 gene locus_tag LOCUS_11170 gene sad 1233029 1231641 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096612.1 protein_id gnl|my_center|LOCUS_11170 1233128 1233985 gene locus_tag LOCUS_11180 1233128 1233985 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705323.1 protein_id gnl|my_center|LOCUS_11180 1234106 1235050 gene locus_tag LOCUS_11190 1234106 1235050 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732587.1 protein_id gnl|my_center|LOCUS_11190 1235823 1235062 gene locus_tag LOCUS_11200 1235823 1235062 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096615.1 protein_id gnl|my_center|LOCUS_11200 1236811 1235825 gene locus_tag LOCUS_11210 1236811 1235825 CDS product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705322.1 protein_id gnl|my_center|LOCUS_11210 1238039 1236804 gene locus_tag LOCUS_11220 1238039 1236804 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096617.1 protein_id gnl|my_center|LOCUS_11220 1238211 1239356 gene locus_tag LOCUS_11230 1238211 1239356 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096618.1 protein_id gnl|my_center|LOCUS_11230 1239369 1240253 gene locus_tag LOCUS_11240 1239369 1240253 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705319.1 protein_id gnl|my_center|LOCUS_11240 1240298 1241248 gene locus_tag LOCUS_11250 1240298 1241248 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814047.1 protein_id gnl|my_center|LOCUS_11250 1241310 1242626 gene locus_tag LOCUS_11260 1241310 1242626 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267368.1 protein_id gnl|my_center|LOCUS_11260 1243558 1242686 gene locus_tag LOCUS_11270 1243558 1242686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1245189 1244398 gene locus_tag LOCUS_11280 1245189 1244398 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 protein_id gnl|my_center|LOCUS_11280 1245370 1246566 gene locus_tag LOCUS_11290 1245370 1246566 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154617.1 protein_id gnl|my_center|LOCUS_11290 1247275 1246601 gene locus_tag LOCUS_11300 1247275 1246601 CDS product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968968.1 protein_id gnl|my_center|LOCUS_11300 1247592 1247921 gene locus_tag LOCUS_11310 gene marR 1247592 1247921 CDS product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069377.1 protein_id gnl|my_center|LOCUS_11310 1247939 1248322 gene locus_tag LOCUS_11320 gene marA 1247939 1248322 CDS product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502237.1 protein_id gnl|my_center|LOCUS_11320 1248354 1248566 gene locus_tag LOCUS_11330 gene marB 1248354 1248566 CDS product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096628.1 protein_id gnl|my_center|LOCUS_11330 1249493 1248597 gene locus_tag LOCUS_11340 gene eamA 1249493 1248597 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096629.1 protein_id gnl|my_center|LOCUS_11340 1249680 1250867 gene locus_tag LOCUS_11350 gene ydeE 1249680 1250867 CDS product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705311.1 protein_id gnl|my_center|LOCUS_11350 1252118 1250874 gene locus_tag LOCUS_11360 1252118 1250874 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_11360 1253363 1252260 gene locus_tag LOCUS_11370 1253363 1252260 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705310.1 protein_id gnl|my_center|LOCUS_11370 1253910 1253515 gene locus_tag LOCUS_11380 1253910 1253515 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096638.1 protein_id gnl|my_center|LOCUS_11380 1253999 1254982 gene locus_tag LOCUS_11390 gene ftrA 1253999 1254982 CDS product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420910.1 protein_id gnl|my_center|LOCUS_11390 1255735 1255268 gene locus_tag LOCUS_11400 1255735 1255268 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518864.1 protein_id gnl|my_center|LOCUS_11400 1256004 1256243 gene locus_tag LOCUS_11410 1256004 1256243 CDS product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096351.1 protein_id gnl|my_center|LOCUS_11410 1256741 1256451 gene locus_tag LOCUS_11420 1256741 1256451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1257029 1256838 gene locus_tag LOCUS_11430 1257029 1256838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1257636 1257334 gene locus_tag LOCUS_11440 1257636 1257334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1258219 1257848 gene locus_tag LOCUS_11450 1258219 1257848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1258515 1258219 gene locus_tag LOCUS_11460 1258515 1258219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1258630 1259028 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1261599 1261288 gene locus_tag LOCUS_11470 1261599 1261288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1261862 1261674 gene locus_tag LOCUS_11480 1261862 1261674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1262670 1261981 gene locus_tag LOCUS_11490 1262670 1261981 CDS product DUF6246 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705868.1 protein_id gnl|my_center|LOCUS_11490 1263233 1263009 gene locus_tag LOCUS_11500 1263233 1263009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1263565 1263419 gene locus_tag LOCUS_11510 1263565 1263419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1264842 1264372 gene locus_tag LOCUS_11520 1264842 1264372 CDS product lysis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098056.1 protein_id gnl|my_center|LOCUS_11520 1265465 1264839 gene locus_tag LOCUS_11530 1265465 1264839 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403797.1 protein_id gnl|my_center|LOCUS_11530 1265746 1265462 gene locus_tag LOCUS_11540 1265746 1265462 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705707.1 protein_id gnl|my_center|LOCUS_11540 1266113 1265733 gene locus_tag LOCUS_11550 1266113 1265733 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294876.1 protein_id gnl|my_center|LOCUS_11550 1266317 1266241 gene locus_tag LOCUS_t00190 1266317 1266241 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1268293 1267487 gene locus_tag LOCUS_11560 1268293 1267487 CDS product bacteriophage antitermination protein Q inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020843838.1 protein_id gnl|my_center|LOCUS_11560 1268669 1268286 gene locus_tag LOCUS_11570 1268669 1268286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761433.1 protein_id gnl|my_center|LOCUS_11570 1269184 1268666 gene locus_tag LOCUS_11580 1269184 1268666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1269683 1269159 gene locus_tag LOCUS_11590 1269683 1269159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1270429 1269683 gene locus_tag LOCUS_11600 1270429 1269683 CDS product replication protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705904.1 protein_id gnl|my_center|LOCUS_11600 1271402 1270413 gene locus_tag LOCUS_11610 1271402 1270413 CDS product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705718.1 protein_id gnl|my_center|LOCUS_11610 1271821 1271576 gene locus_tag LOCUS_11620 1271821 1271576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1272286 1271837 gene locus_tag LOCUS_11630 1272286 1271837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1272222 1272806 gene locus_tag LOCUS_11640 1272222 1272806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1272846 1273028 gene locus_tag LOCUS_11650 1272846 1273028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1273003 1273245 gene locus_tag LOCUS_11660 1273003 1273245 CDS product DUF4060 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237031.1 protein_id gnl|my_center|LOCUS_11660 1273305 1273562 gene locus_tag LOCUS_11670 1273305 1273562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1273543 1274682 gene locus_tag LOCUS_11680 1273543 1274682 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741344.1 protein_id gnl|my_center|LOCUS_11680 1276878 1274833 gene locus_tag LOCUS_11690 gene dcp 1276878 1274833 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096778.1 protein_id gnl|my_center|LOCUS_11690 1277029 1277778 gene locus_tag LOCUS_11700 gene ydfG 1277029 1277778 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366753.1 protein_id gnl|my_center|LOCUS_11700 1277994 1278554 gene locus_tag LOCUS_11710 1277994 1278554 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096780.1 protein_id gnl|my_center|LOCUS_11710 1278726 1278929 gene locus_tag LOCUS_11720 gene ydfZ 1278726 1278929 CDS product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096785.1 protein_id gnl|my_center|LOCUS_11720 1280481 1279018 gene locus_tag LOCUS_11730 1280481 1279018 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096786.1 protein_id gnl|my_center|LOCUS_11730 1282006 1280630 gene locus_tag LOCUS_11740 1282006 1280630 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192118.1 protein_id gnl|my_center|LOCUS_11740 1283073 1282057 gene locus_tag LOCUS_11750 1283073 1282057 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 protein_id gnl|my_center|LOCUS_11750 1283512 1283186 gene locus_tag LOCUS_11760 1283512 1283186 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096792.1 protein_id gnl|my_center|LOCUS_11760 1283652 1283993 gene locus_tag LOCUS_11770 1283652 1283993 CDS product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366763.1 protein_id gnl|my_center|LOCUS_11770 1284314 1284030 gene locus_tag LOCUS_11780 1284314 1284030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11780 1284717 1284316 gene locus_tag LOCUS_11790 1284717 1284316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11790 1284942 1285223 gene locus_tag LOCUS_11800 1284942 1285223 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096796.1 protein_id gnl|my_center|LOCUS_11800 1285463 1287805 gene locus_tag LOCUS_11810 1285463 1287805 CDS product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096797.1 protein_id gnl|my_center|LOCUS_11810 1287816 1288433 gene locus_tag LOCUS_11820 gene dmsB 1287816 1288433 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213098.1 protein_id gnl|my_center|LOCUS_11820 1288435 1289292 gene locus_tag LOCUS_11830 1288435 1289292 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534718.1 protein_id gnl|my_center|LOCUS_11830 1289308 1289922 gene locus_tag LOCUS_11840 gene dmsD 1289308 1289922 CDS product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206559.1 protein_id gnl|my_center|LOCUS_11840 1290173 1290883 gene locus_tag LOCUS_11850 gene osmY 1290173 1290883 CDS product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096821.1 protein_id gnl|my_center|LOCUS_11850 1290896 1291798 gene locus_tag LOCUS_11860 gene osmX 1290896 1291798 CDS product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096822.1 protein_id gnl|my_center|LOCUS_11860 1291808 1292455 gene locus_tag LOCUS_11870 gene osmW 1291808 1292455 CDS product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808875.1 protein_id gnl|my_center|LOCUS_11870 1292455 1293603 gene locus_tag LOCUS_11880 gene osmV 1292455 1293603 CDS product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096823.1 protein_id gnl|my_center|LOCUS_11880 1294339 1293698 gene locus_tag LOCUS_11890 gene bioD 1294339 1293698 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919226.1 protein_id gnl|my_center|LOCUS_11890 1295743 1294520 gene locus_tag LOCUS_11900 1295743 1294520 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096827.1 protein_id gnl|my_center|LOCUS_11900 1296767 1295871 gene locus_tag LOCUS_11910 1296767 1295871 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705289.1 protein_id gnl|my_center|LOCUS_11910 1296873 1298123 gene locus_tag LOCUS_11920 1296873 1298123 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091834.1 protein_id gnl|my_center|LOCUS_11920 1298419 1299903 gene locus_tag LOCUS_11930 1298419 1299903 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096839.1 protein_id gnl|my_center|LOCUS_11930 1300088 1300420 gene locus_tag LOCUS_11940 1300088 1300420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1300687 1301493 gene locus_tag LOCUS_11950 1300687 1301493 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096841.1 protein_id gnl|my_center|LOCUS_11950 1301853 1301524 gene locus_tag LOCUS_11960 gene mdtI 1301853 1301524 CDS product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096842.1 protein_id gnl|my_center|LOCUS_11960 1302202 1301840 gene locus_tag LOCUS_11970 gene mdtJ 1302202 1301840 CDS product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705282.1 protein_id gnl|my_center|LOCUS_11970 1303646 1302588 gene locus_tag LOCUS_11980 1303646 1302588 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365665.1 protein_id gnl|my_center|LOCUS_11980 1304094 1304471 gene locus_tag LOCUS_11990 1304094 1304471 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897372.1 protein_id gnl|my_center|LOCUS_11990 1305256 1304501 gene locus_tag LOCUS_12000 1305256 1304501 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195081.1 protein_id gnl|my_center|LOCUS_12000 1306409 1305348 gene locus_tag LOCUS_12010 gene ugpC 1306409 1305348 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396370.1 protein_id gnl|my_center|LOCUS_12010 1307278 1306412 gene locus_tag LOCUS_12020 1307278 1306412 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213186.1 protein_id gnl|my_center|LOCUS_12020 1307627 1307259 gene locus_tag LOCUS_12030 1307627 1307259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1307693 1308008 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1309830 1308502 gene locus_tag LOCUS_12040 1309830 1308502 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049832539.1 protein_id gnl|my_center|LOCUS_12040 1310785 1309817 gene locus_tag LOCUS_12050 1310785 1309817 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 protein_id gnl|my_center|LOCUS_12050 1312175 1311045 gene locus_tag LOCUS_12060 1312175 1311045 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_12060 1313118 1312192 gene locus_tag LOCUS_12070 1313118 1312192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1313129 1313535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1313614 1313805 gene locus_tag LOCUS_12080 1313614 1313805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1313923 1314207 gene locus_tag LOCUS_12090 1313923 1314207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1315141 1314404 gene locus_tag LOCUS_12100 1315141 1314404 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_12100 1316375 1315164 gene locus_tag LOCUS_12110 gene gudP 1316375 1315164 CDS product glucarate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234818.1 protein_id gnl|my_center|LOCUS_12110 1316377 1316781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1317912 1317439 gene locus_tag LOCUS_12120 1317912 1317439 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115857.1 protein_id gnl|my_center|LOCUS_12120 1318044 1318424 gene locus_tag LOCUS_12130 1318044 1318424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1318436 1319119 gene locus_tag LOCUS_12140 1318436 1319119 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140539.1 protein_id gnl|my_center|LOCUS_12140 1319387 1319145 gene locus_tag LOCUS_12150 1319387 1319145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12150 1320028 1319384 gene locus_tag LOCUS_12160 1320028 1319384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12160 1320279 1321337 gene locus_tag LOCUS_12170 1320279 1321337 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303808.1 protein_id gnl|my_center|LOCUS_12170 1321419 1322603 gene locus_tag LOCUS_12180 1321419 1322603 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171064.1 protein_id gnl|my_center|LOCUS_12180 1322732 1323985 gene locus_tag LOCUS_12190 gene umuC 1322732 1323985 CDS product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457628.1 protein_id gnl|my_center|LOCUS_12190 1324555 1323992 gene locus_tag LOCUS_12200 gene smrA 1324555 1323992 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046824.1 protein_id gnl|my_center|LOCUS_12200 1325076 1325591 gene locus_tag LOCUS_12210 gene ogt 1325076 1325591 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096864.1 protein_id gnl|my_center|LOCUS_12210 1325803 1326555 gene locus_tag LOCUS_12220 gene fnr 1325803 1326555 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 protein_id gnl|my_center|LOCUS_12220 1326699 1327649 gene locus_tag LOCUS_12230 gene uspE 1326699 1327649 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096866.1 protein_id gnl|my_center|LOCUS_12230 1328627 1327758 gene locus_tag LOCUS_12240 1328627 1327758 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270764.1 protein_id gnl|my_center|LOCUS_12240 1328727 1329179 gene locus_tag LOCUS_12250 1328727 1329179 CDS product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597495.1 protein_id gnl|my_center|LOCUS_12250 1330306 1329185 gene locus_tag LOCUS_12260 1330306 1329185 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096867.1 protein_id gnl|my_center|LOCUS_12260 1331794 1330406 gene locus_tag LOCUS_12270 gene pntB 1331794 1330406 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096868.1 protein_id gnl|my_center|LOCUS_12270 1333334 1331805 gene locus_tag LOCUS_12280 gene pntA 1333334 1331805 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 protein_id gnl|my_center|LOCUS_12280 1333966 1334910 gene locus_tag LOCUS_12290 gene ydgH 1333966 1334910 CDS product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769298.1 protein_id gnl|my_center|LOCUS_12290 1335096 1336478 gene locus_tag LOCUS_12300 1335096 1336478 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096871.1 protein_id gnl|my_center|LOCUS_12300 1336514 1337236 gene locus_tag LOCUS_12310 gene folM 1336514 1337236 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096872.1 protein_id gnl|my_center|LOCUS_12310 1337568 1337233 gene locus_tag LOCUS_12320 1337568 1337233 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366825.1 protein_id gnl|my_center|LOCUS_12320 1337695 1338411 gene locus_tag LOCUS_12330 gene rstA 1337695 1338411 CDS product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705255.1 protein_id gnl|my_center|LOCUS_12330 1338438 1339727 gene locus_tag LOCUS_12340 gene rstB 1338438 1339727 CDS product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096876.1 protein_id gnl|my_center|LOCUS_12340 1340640 1341101 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1342611 1341211 gene locus_tag LOCUS_12350 gene fumC 1342611 1341211 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096878.1 protein_id gnl|my_center|LOCUS_12350 1344569 1342923 gene locus_tag LOCUS_12360 gene fumA 1344569 1342923 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 protein_id gnl|my_center|LOCUS_12360 1344834 1345146 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1346384 1347940 gene locus_tag LOCUS_12370 1346384 1347940 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753325.1 protein_id gnl|my_center|LOCUS_12370 1349033 1347969 gene locus_tag LOCUS_12380 1349033 1347969 CDS product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705245.1 protein_id gnl|my_center|LOCUS_12380 1349501 1350010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1351287 1352459 gene locus_tag LOCUS_12390 1351287 1352459 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705243.1 protein_id gnl|my_center|LOCUS_12390 1352561 1353562 gene locus_tag LOCUS_12400 gene add 1352561 1353562 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565566.1 protein_id gnl|my_center|LOCUS_12400 1354045 1353647 gene locus_tag LOCUS_12410 1354045 1353647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1354164 1354631 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1355139 1354666 gene locus_tag LOCUS_12420 1355139 1354666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1355883 1356098 gene locus_tag LOCUS_12430 gene ydgT 1355883 1356098 CDS product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217950.1 protein_id gnl|my_center|LOCUS_12430 1356171 1356608 gene locus_tag LOCUS_12440 1356171 1356608 CDS product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306099.1 protein_id gnl|my_center|LOCUS_12440 1356686 1357267 gene locus_tag LOCUS_12450 gene rsxA 1356686 1357267 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133179.1 protein_id gnl|my_center|LOCUS_12450 1357267 1357845 gene locus_tag LOCUS_12460 gene rsxB 1357267 1357845 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096899.1 protein_id gnl|my_center|LOCUS_12460 1357838 1360090 gene locus_tag LOCUS_12470 gene rsxC 1357838 1360090 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915818.1 protein_id gnl|my_center|LOCUS_12470 1360091 1361143 gene locus_tag LOCUS_12480 gene rsxD 1360091 1361143 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419218.1 protein_id gnl|my_center|LOCUS_12480 1361153 1361779 gene locus_tag LOCUS_12490 gene rsxG 1361153 1361779 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920784.1 protein_id gnl|my_center|LOCUS_12490 1361776 1362468 gene locus_tag LOCUS_12500 1361776 1362468 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096903.1 protein_id gnl|my_center|LOCUS_12500 1362468 1363103 gene locus_tag LOCUS_12510 gene nth 1362468 1363103 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705230.1 protein_id gnl|my_center|LOCUS_12510 1363531 1363100 gene locus_tag LOCUS_12520 1363531 1363100 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974551.1 protein_id gnl|my_center|LOCUS_12520 1364165 1365667 gene locus_tag LOCUS_12530 gene dtpA 1364165 1365667 CDS product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100913.1 protein_id gnl|my_center|LOCUS_12530 1365769 1366371 gene locus_tag LOCUS_12540 gene gstA 1365769 1366371 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765742.1 protein_id gnl|my_center|LOCUS_12540 1366653 1366456 gene locus_tag LOCUS_12550 1366653 1366456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1366665 1366991 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1367142 1367912 gene locus_tag LOCUS_12560 1367142 1367912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1368872 1368216 gene locus_tag LOCUS_12570 gene pdxH 1368872 1368216 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282834.1 protein_id gnl|my_center|LOCUS_12570 1369253 1368930 gene locus_tag LOCUS_12580 gene mliC 1369253 1368930 CDS product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061974.1 protein_id gnl|my_center|LOCUS_12580 1370468 1369344 gene locus_tag LOCUS_12590 gene anmK 1370468 1369344 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096911.1 protein_id gnl|my_center|LOCUS_12590 1370751 1371218 gene locus_tag LOCUS_12600 gene slyB 1370751 1371218 CDS product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597179.1 protein_id gnl|my_center|LOCUS_12600 1371733 1371299 gene locus_tag LOCUS_12610 gene slyA 1371733 1371299 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688303.1 protein_id gnl|my_center|LOCUS_12610 1371917 1372153 gene locus_tag LOCUS_12620 1371917 1372153 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096914.1 protein_id gnl|my_center|LOCUS_12620 1372156 1373019 gene locus_tag LOCUS_12630 1372156 1373019 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 protein_id gnl|my_center|LOCUS_12630 1373016 1375025 gene locus_tag LOCUS_12640 1373016 1375025 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096916.1 protein_id gnl|my_center|LOCUS_12640 1375539 1375018 gene locus_tag LOCUS_12650 gene sodC 1375539 1375018 CDS product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296937.1 protein_id gnl|my_center|LOCUS_12650 1376513 1375617 gene locus_tag LOCUS_12660 1376513 1375617 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250656.1 protein_id gnl|my_center|LOCUS_12660 1376801 1376562 gene locus_tag LOCUS_12670 1376801 1376562 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001538148.1 protein_id gnl|my_center|LOCUS_12670 1376923 1377519 gene locus_tag LOCUS_12680 1376923 1377519 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419211.1 protein_id gnl|my_center|LOCUS_12680 1377574 1378668 gene locus_tag LOCUS_12690 gene nemA 1377574 1378668 CDS product N-ethylmaleimide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093589.1 protein_id gnl|my_center|LOCUS_12690 1378752 1379159 gene locus_tag LOCUS_12700 gene gloA 1378752 1379159 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096923.1 protein_id gnl|my_center|LOCUS_12700 1379251 1379898 gene locus_tag LOCUS_12710 gene rnt 1379251 1379898 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282267.1 protein_id gnl|my_center|LOCUS_12710 1380286 1379939 gene locus_tag LOCUS_12720 gene grxD 1380286 1379939 CDS product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108172.1 protein_id gnl|my_center|LOCUS_12720 1380947 1381453 gene locus_tag LOCUS_12730 1380947 1381453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 1381573 1382154 gene locus_tag LOCUS_12740 gene sodB 1381573 1382154 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096926.1 protein_id gnl|my_center|LOCUS_12740 1382481 1382182 gene locus_tag LOCUS_12750 1382481 1382182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1382523 1382831 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1383029 1383403 gene locus_tag LOCUS_12760 1383029 1383403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1383735 1383896 gene locus_tag LOCUS_12770 1383735 1383896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1384233 1385258 gene locus_tag LOCUS_12780 gene purR 1384233 1385258 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190992.1 protein_id gnl|my_center|LOCUS_12780 1386184 1385273 gene locus_tag LOCUS_12790 gene punR 1386184 1385273 CDS product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269528.1 protein_id gnl|my_center|LOCUS_12790 1386296 1387483 gene locus_tag LOCUS_12800 gene punC 1386296 1387483 CDS product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096931.1 protein_id gnl|my_center|LOCUS_12800 1387786 1388934 gene locus_tag LOCUS_12810 gene cfa 1387786 1388934 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098879.1 protein_id gnl|my_center|LOCUS_12810 1389608 1388970 gene locus_tag LOCUS_12820 1389608 1388970 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096933.1 protein_id gnl|my_center|LOCUS_12820 1389834 1391207 gene locus_tag LOCUS_12830 1389834 1391207 CDS product multidrug efflux MATE transporter MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175077.1 protein_id gnl|my_center|LOCUS_12830 1391397 1391473 gene locus_tag LOCUS_t00200 1391397 1391473 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1391484 1391560 gene locus_tag LOCUS_t00210 1391484 1391560 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1391639 1392538 gene locus_tag LOCUS_12840 1391639 1392538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1392538 1392855 gene locus_tag LOCUS_12850 1392538 1392855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1393038 1393829 gene locus_tag LOCUS_12860 gene hisN 1393038 1393829 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606663.1 protein_id gnl|my_center|LOCUS_12860 1394270 1395682 gene locus_tag LOCUS_12870 gene pykF 1394270 1395682 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751448.1 protein_id gnl|my_center|LOCUS_12870 1395990 1396226 gene locus_tag LOCUS_12880 1395990 1396226 CDS product major outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908860.1 protein_id gnl|my_center|LOCUS_12880 1397291 1396278 gene locus_tag LOCUS_12890 gene ldtE 1397291 1396278 CDS product L,D-transpeptidase LdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817109.1 protein_id gnl|my_center|LOCUS_12890 1397804 1397388 gene locus_tag LOCUS_12900 gene sufE 1397804 1397388 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096952.1 protein_id gnl|my_center|LOCUS_12900 1399038 1397818 gene locus_tag LOCUS_12910 gene sufS 1399038 1397818 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096953.1 protein_id gnl|my_center|LOCUS_12910 1400303 1399035 gene locus_tag LOCUS_12920 gene sufD 1400303 1399035 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 protein_id gnl|my_center|LOCUS_12920 1401024 1400278 gene locus_tag LOCUS_12930 gene sufC 1401024 1400278 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367012.1 protein_id gnl|my_center|LOCUS_12930 1402537 1401053 gene locus_tag LOCUS_12940 gene sufB 1402537 1401053 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304330.1 protein_id gnl|my_center|LOCUS_12940 1402914 1402546 gene locus_tag LOCUS_12950 gene sufA 1402914 1402546 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367169.1 protein_id gnl|my_center|LOCUS_12950 1403926 1403276 gene locus_tag LOCUS_12960 gene zinT 1403926 1403276 CDS product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234684.1 protein_id gnl|my_center|LOCUS_12960 1404956 1404039 gene locus_tag LOCUS_12970 gene lpxP 1404956 1404039 CDS product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484431.1 protein_id gnl|my_center|LOCUS_12970 1405572 1405162 gene locus_tag LOCUS_12980 gene menI 1405572 1405162 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096973.1 protein_id gnl|my_center|LOCUS_12980 1408625 1405569 gene locus_tag LOCUS_12990 1408625 1405569 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419180.1 protein_id gnl|my_center|LOCUS_12990 1408819 1409931 gene locus_tag LOCUS_13000 gene ydiK 1408819 1409931 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096976.1 protein_id gnl|my_center|LOCUS_13000 1410542 1411159 gene locus_tag LOCUS_13010 1410542 1411159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1413338 1411218 gene locus_tag LOCUS_13020 1413338 1411218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1414130 1413762 gene locus_tag LOCUS_13030 1414130 1413762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1414533 1414219 gene locus_tag LOCUS_13040 1414533 1414219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1414752 1414588 gene locus_tag LOCUS_13050 1414752 1414588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1414860 1415213 gene locus_tag LOCUS_13060 1414860 1415213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1415306 1415788 gene locus_tag LOCUS_13070 1415306 1415788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1416247 1416459 gene locus_tag LOCUS_13080 1416247 1416459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1416961 1416560 gene locus_tag LOCUS_13090 1416961 1416560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1417581 1417330 gene locus_tag LOCUS_13100 1417581 1417330 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210175.1 protein_id gnl|my_center|LOCUS_13100 1418542 1418664 gene locus_tag LOCUS_13110 1418542 1418664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1419468 1419704 gene locus_tag LOCUS_13120 1419468 1419704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1420557 1420144 gene locus_tag LOCUS_13130 1420557 1420144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1423235 1420857 gene locus_tag LOCUS_13140 gene ppsA 1423235 1420857 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096979.1 protein_id gnl|my_center|LOCUS_13140 1423569 1424363 gene locus_tag LOCUS_13150 gene ppsR 1423569 1424363 CDS product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620693.1 protein_id gnl|my_center|LOCUS_13150 1424502 1425602 gene locus_tag LOCUS_13160 gene aroH 1424502 1425602 CDS product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 protein_id gnl|my_center|LOCUS_13160 1425695 1425925 gene locus_tag LOCUS_13170 gene hemP 1425695 1425925 CDS product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096982.1 protein_id gnl|my_center|LOCUS_13170 1427369 1425927 gene locus_tag LOCUS_13180 gene selO 1427369 1425927 CDS product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175703.1 protein_id gnl|my_center|LOCUS_13180 1428132 1427422 gene locus_tag LOCUS_13190 1428132 1427422 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096995.1 protein_id gnl|my_center|LOCUS_13190 1428900 1428436 gene locus_tag LOCUS_13200 1428900 1428436 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213259.1 protein_id gnl|my_center|LOCUS_13200 1429719 1428973 gene locus_tag LOCUS_13210 gene btuD 1429719 1428973 CDS product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029466.1 protein_id gnl|my_center|LOCUS_13210 1430270 1429719 gene locus_tag LOCUS_13220 1430270 1429719 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096998.1 protein_id gnl|my_center|LOCUS_13220 1431290 1430304 gene locus_tag LOCUS_13230 gene btuC 1431290 1430304 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956518.1 protein_id gnl|my_center|LOCUS_13230 1431691 1431392 gene locus_tag LOCUS_13240 gene ihfA 1431691 1431392 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229266.1 protein_id gnl|my_center|LOCUS_13240 1434083 1431696 gene locus_tag LOCUS_13250 gene pheT 1434083 1431696 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705112.1 protein_id gnl|my_center|LOCUS_13250 1435081 1434098 gene locus_tag LOCUS_13260 gene pheS 1435081 1434098 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018588.1 protein_id gnl|my_center|LOCUS_13260 1435732 1435376 gene locus_tag LOCUS_13270 gene rplT 1435732 1435376 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 protein_id gnl|my_center|LOCUS_13270 1436558 1436124 gene locus_tag LOCUS_13280 gene infC 1436558 1436124 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058403.1 protein_id gnl|my_center|LOCUS_13280 1438598 1436670 gene locus_tag LOCUS_13290 gene thrS 1438598 1436670 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097005.1 protein_id gnl|my_center|LOCUS_13290 1439045 1438830 gene locus_tag LOCUS_13300 gene fumD 1439045 1438830 CDS product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367006.1 protein_id gnl|my_center|LOCUS_13300 1439147 1440592 gene locus_tag LOCUS_13310 1439147 1440592 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_13310 1441401 1440643 gene locus_tag LOCUS_13320 1441401 1440643 CDS product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097007.1 protein_id gnl|my_center|LOCUS_13320 1442020 1443882 gene locus_tag LOCUS_13330 1442020 1443882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1443911 1444318 gene locus_tag LOCUS_13340 1443911 1444318 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816206.1 protein_id gnl|my_center|LOCUS_13340 1444377 1444652 gene locus_tag LOCUS_13350 1444377 1444652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1444902 1445693 gene locus_tag LOCUS_13360 1444902 1445693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1445856 1446788 gene locus_tag LOCUS_13370 gene pfkB 1445856 1446788 CDS product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251728.1 protein_id gnl|my_center|LOCUS_13370 1446894 1447184 gene locus_tag LOCUS_13380 gene ghoS 1446894 1447184 CDS product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146133.1 protein_id gnl|my_center|LOCUS_13380 1447290 1448288 gene locus_tag LOCUS_13390 1447290 1448288 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097010.1 protein_id gnl|my_center|LOCUS_13390 1448819 1448283 gene locus_tag LOCUS_13400 1448819 1448283 CDS product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097011.1 protein_id gnl|my_center|LOCUS_13400 1449146 1449459 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1449460 1449963 gene locus_tag LOCUS_13410 1449460 1449963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1450090 1450851 gene locus_tag LOCUS_13420 gene kduD 1450090 1450851 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_13420 1450947 1451537 gene locus_tag LOCUS_13430 1450947 1451537 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097014.1 protein_id gnl|my_center|LOCUS_13430 1451669 1453060 gene locus_tag LOCUS_13440 gene tcyP 1451669 1453060 CDS product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097015.1 protein_id gnl|my_center|LOCUS_13440 1453388 1453113 gene locus_tag LOCUS_13450 gene cedA 1453388 1453113 CDS product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097016.1 protein_id gnl|my_center|LOCUS_13450 1453575 1455833 gene locus_tag LOCUS_13460 gene katE 1453575 1455833 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077872.1 protein_id gnl|my_center|LOCUS_13460 1456307 1455966 gene locus_tag LOCUS_13470 gene osmE 1456307 1455966 CDS product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039301.1 protein_id gnl|my_center|LOCUS_13470 1456561 1457391 gene locus_tag LOCUS_13480 gene nadE 1456561 1457391 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175035.1 protein_id gnl|my_center|LOCUS_13480 1457474 1458340 gene locus_tag LOCUS_13490 gene cho 1457474 1458340 CDS product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097025.1 protein_id gnl|my_center|LOCUS_13490 1458891 1458334 gene locus_tag LOCUS_13500 gene ves 1458891 1458334 CDS product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 protein_id gnl|my_center|LOCUS_13500 1459684 1459199 gene locus_tag LOCUS_13510 gene spy 1459684 1459199 CDS product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228972.1 protein_id gnl|my_center|LOCUS_13510 1459838 1459987 gene locus_tag LOCUS_13520 1459838 1459987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1461041 1460076 gene locus_tag LOCUS_13530 gene astE 1461041 1460076 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705766.1 protein_id gnl|my_center|LOCUS_13530 1462378 1461053 gene locus_tag LOCUS_13540 gene astB 1462378 1461053 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994973.1 protein_id gnl|my_center|LOCUS_13540 1463853 1462375 gene locus_tag LOCUS_13550 gene astD 1463853 1462375 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097030.1 protein_id gnl|my_center|LOCUS_13550 1464884 1463850 gene locus_tag LOCUS_13560 gene astA 1464884 1463850 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097031.1 protein_id gnl|my_center|LOCUS_13560 1466101 1464881 gene locus_tag LOCUS_13570 1466101 1464881 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097032.1 protein_id gnl|my_center|LOCUS_13570 1466591 1467400 gene locus_tag LOCUS_13580 gene xthA 1466591 1467400 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366172.1 protein_id gnl|my_center|LOCUS_13580 1467405 1467815 gene locus_tag LOCUS_13590 1467405 1467815 CDS product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097041.1 protein_id gnl|my_center|LOCUS_13590 1468065 1467781 gene locus_tag LOCUS_13600 1468065 1467781 CDS product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085240.1 protein_id gnl|my_center|LOCUS_13600 1468297 1469640 gene locus_tag LOCUS_13610 gene gdhA 1468297 1469640 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705776.1 protein_id gnl|my_center|LOCUS_13610 1469885 1469712 gene locus_tag LOCUS_13620 1469885 1469712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1472020 1470095 gene locus_tag LOCUS_13630 gene topB 1472020 1470095 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235800.1 protein_id gnl|my_center|LOCUS_13630 1473068 1472025 gene locus_tag LOCUS_13640 gene selD 1473068 1472025 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097045.1 protein_id gnl|my_center|LOCUS_13640 1473736 1473185 gene locus_tag LOCUS_13650 1473736 1473185 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097046.1 protein_id gnl|my_center|LOCUS_13650 1473899 1475752 gene locus_tag LOCUS_13660 gene sppA 1473899 1475752 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705783.1 protein_id gnl|my_center|LOCUS_13660 1475861 1476877 gene locus_tag LOCUS_13670 gene ansA 1475861 1476877 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 protein_id gnl|my_center|LOCUS_13670 1476888 1477529 gene locus_tag LOCUS_13680 gene pncA 1476888 1477529 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097049.1 protein_id gnl|my_center|LOCUS_13680 1477865 1477587 gene locus_tag LOCUS_13690 1477865 1477587 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046864.1 protein_id gnl|my_center|LOCUS_13690 1478320 1477907 gene locus_tag LOCUS_13700 gene msrB 1478320 1477907 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705785.1 protein_id gnl|my_center|LOCUS_13700 1478653 1479657 gene locus_tag LOCUS_13710 gene gapA 1478653 1479657 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097053.1 protein_id gnl|my_center|LOCUS_13710 1479732 1480616 gene locus_tag LOCUS_13720 1479732 1480616 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366147.1 protein_id gnl|my_center|LOCUS_13720 1481581 1480724 gene locus_tag LOCUS_13730 gene yeaE 1481581 1480724 CDS product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186359.1 protein_id gnl|my_center|LOCUS_13730 1482419 1481673 gene locus_tag LOCUS_13740 1482419 1481673 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163762.1 protein_id gnl|my_center|LOCUS_13740 1482851 1484785 gene locus_tag LOCUS_13750 gene yeaG 1482851 1484785 CDS product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097060.1 protein_id gnl|my_center|LOCUS_13750 1484905 1485462 gene locus_tag LOCUS_13760 1484905 1485462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13760 1485459 1486205 gene locus_tag LOCUS_13770 1485459 1486205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13770 1487012 1488202 gene locus_tag LOCUS_13780 1487012 1488202 CDS product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834259.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13780 1488218 1490257 gene locus_tag LOCUS_13790 1488218 1490257 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_13790 1490358 1490804 gene locus_tag LOCUS_13800 1490358 1490804 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460698.1 protein_id gnl|my_center|LOCUS_13800 1491479 1490787 gene locus_tag LOCUS_13810 1491479 1490787 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704525.1 protein_id gnl|my_center|LOCUS_13810 1491536 1491793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1492073 1492357 gene locus_tag LOCUS_13820 1492073 1492357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1493307 1492486 gene locus_tag LOCUS_13830 1493307 1492486 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 protein_id gnl|my_center|LOCUS_13830 1494130 1493309 gene locus_tag LOCUS_13840 1494130 1493309 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 protein_id gnl|my_center|LOCUS_13840 1495120 1494335 gene locus_tag LOCUS_13850 1495120 1494335 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366139.1 protein_id gnl|my_center|LOCUS_13850 1495800 1496090 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1496170 1496700 gene locus_tag LOCUS_13860 1496170 1496700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1497418 1496711 gene locus_tag LOCUS_13870 1497418 1496711 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097066.1 protein_id gnl|my_center|LOCUS_13870 1497573 1498070 gene locus_tag LOCUS_13880 1497573 1498070 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096732.1 protein_id gnl|my_center|LOCUS_13880 1498067 1498423 gene locus_tag LOCUS_13890 1498067 1498423 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705791.1 protein_id gnl|my_center|LOCUS_13890 1498718 1498413 gene locus_tag LOCUS_13900 1498718 1498413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097068.1 protein_id gnl|my_center|LOCUS_13900 1499030 1498788 gene locus_tag LOCUS_13910 1499030 1498788 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063447014.1 protein_id gnl|my_center|LOCUS_13910 1499345 1500373 gene locus_tag LOCUS_13920 1499345 1500373 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097070.1 protein_id gnl|my_center|LOCUS_13920 1500643 1502466 gene locus_tag LOCUS_13930 1500643 1502466 CDS product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113344.1 protein_id gnl|my_center|LOCUS_13930 1503225 1503407 gene locus_tag LOCUS_13940 1503225 1503407 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103638.1 protein_id gnl|my_center|LOCUS_13940 1503431 1503859 gene locus_tag LOCUS_13950 1503431 1503859 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074368.1 protein_id gnl|my_center|LOCUS_13950 1504481 1504071 gene locus_tag LOCUS_13960 gene hiuH 1504481 1504071 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833187.1 protein_id gnl|my_center|LOCUS_13960 1504617 1505297 gene locus_tag LOCUS_13970 gene hprR 1504617 1505297 CDS product response regulator transcription factor HprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343829.1 protein_id gnl|my_center|LOCUS_13970 1505290 1506645 gene locus_tag LOCUS_13980 1505290 1506645 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240036.1 protein_id gnl|my_center|LOCUS_13980 1506744 1507169 gene locus_tag LOCUS_13990 gene nudI 1506744 1507169 CDS product nucleoside triphosphatase NudI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365608.1 protein_id gnl|my_center|LOCUS_13990 1508559 1507309 gene locus_tag LOCUS_14000 gene icd 1508559 1507309 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097077.1 protein_id gnl|my_center|LOCUS_14000 1508803 1509327 gene locus_tag LOCUS_14010 gene rluE 1508803 1509327 CDS product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 protein_id gnl|my_center|LOCUS_14010 1509370 1510290 gene locus_tag LOCUS_14020 1509370 1510290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1510302 1510751 gene locus_tag LOCUS_14030 gene nudJ 1510302 1510751 CDS product phosphatase NudJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476089.1 protein_id gnl|my_center|LOCUS_14030 1511049 1512998 gene locus_tag LOCUS_14040 1511049 1512998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1513102 1514208 gene locus_tag LOCUS_14050 gene mnmA 1513102 1514208 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004540.1 protein_id gnl|my_center|LOCUS_14050 1514242 1514871 gene locus_tag LOCUS_14060 gene hflD 1514242 1514871 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297479.1 protein_id gnl|my_center|LOCUS_14060 1514891 1516261 gene locus_tag LOCUS_14070 gene purB 1514891 1516261 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423737.1 protein_id gnl|my_center|LOCUS_14070 1516520 1517642 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1517706 1518707 gene locus_tag LOCUS_14080 1517706 1518707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1518736 1519920 gene locus_tag LOCUS_14090 1518736 1519920 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097085.1 protein_id gnl|my_center|LOCUS_14090 1520275 1519961 gene locus_tag LOCUS_14100 1520275 1519961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14100 1521503 1520220 gene locus_tag LOCUS_14110 gene vceB 1521503 1520220 CDS product multidrug efflux MFS transporter permease subunit VceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019055.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14110 1522462 1521515 gene locus_tag LOCUS_14120 gene vceA 1522462 1521515 CDS product multidrug efflux MFS transporter adaptor subunit VceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625982.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14120 1524100 1522619 gene locus_tag LOCUS_14130 gene vceC 1524100 1522619 CDS product multidrug efflux MFS transporter outer membrane subunit VceC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798631.1 protein_id gnl|my_center|LOCUS_14130 1524205 1524822 gene locus_tag LOCUS_14140 1524205 1524822 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403787.1 protein_id gnl|my_center|LOCUS_14140 1525278 1524874 gene locus_tag LOCUS_14150 1525278 1524874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1525407 1525675 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1525843 1526247 gene locus_tag LOCUS_14160 1525843 1526247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1526660 1527796 gene locus_tag LOCUS_14170 gene potA 1526660 1527796 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705060.1 protein_id gnl|my_center|LOCUS_14170 1527780 1528637 gene locus_tag LOCUS_14180 gene potB 1527780 1528637 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705059.1 protein_id gnl|my_center|LOCUS_14180 1528634 1529425 gene locus_tag LOCUS_14190 gene potC 1528634 1529425 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012968557.1 protein_id gnl|my_center|LOCUS_14190 1529466 1530512 gene locus_tag LOCUS_14200 gene potD 1529466 1530512 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759329.1 protein_id gnl|my_center|LOCUS_14200 1530576 1531037 gene locus_tag LOCUS_14210 1530576 1531037 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309411.1 protein_id gnl|my_center|LOCUS_14210 1531034 1531825 gene locus_tag LOCUS_14220 1531034 1531825 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723290.1 protein_id gnl|my_center|LOCUS_14220 1532806 1531985 gene locus_tag LOCUS_14230 gene cobB 1532806 1531985 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097094.1 protein_id gnl|my_center|LOCUS_14230 1533733 1532822 gene locus_tag LOCUS_14240 gene nagK 1533733 1532822 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291303.1 protein_id gnl|my_center|LOCUS_14240 1534997 1533753 gene locus_tag LOCUS_14250 gene lolE 1534997 1533753 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097096.1 protein_id gnl|my_center|LOCUS_14250 1535698 1534997 gene locus_tag LOCUS_14260 gene lolD 1535698 1534997 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033714.1 protein_id gnl|my_center|LOCUS_14260 1536890 1535691 gene locus_tag LOCUS_14270 gene lolC 1536890 1535691 CDS product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097098.1 protein_id gnl|my_center|LOCUS_14270 1537178 1537384 gene locus_tag LOCUS_14280 1537178 1537384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14280 1537647 1537937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1537968 1538531 gene locus_tag LOCUS_14290 1537968 1538531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1538632 1542078 gene locus_tag LOCUS_14300 gene mfd 1538632 1542078 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114340.1 protein_id gnl|my_center|LOCUS_14300 1542229 1543164 gene locus_tag LOCUS_14310 1542229 1543164 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482967.1 protein_id gnl|my_center|LOCUS_14310 1543461 1543204 gene locus_tag LOCUS_14320 gene bhsA 1543461 1543204 CDS product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097102.1 protein_id gnl|my_center|LOCUS_14320 1543705 1544340 gene locus_tag LOCUS_14330 1543705 1544340 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705049.1 protein_id gnl|my_center|LOCUS_14330 1544558 1544713 gene locus_tag LOCUS_14340 1544558 1544713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1545338 1544799 gene locus_tag LOCUS_14350 1545338 1544799 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043449.1 protein_id gnl|my_center|LOCUS_14350 1546835 1545531 gene locus_tag LOCUS_14360 1546835 1545531 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097105.1 protein_id gnl|my_center|LOCUS_14360 1547681 1547139 gene locus_tag LOCUS_14370 gene ycfP 1547681 1547139 CDS product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587933.1 protein_id gnl|my_center|LOCUS_14370 1548750 1547719 gene locus_tag LOCUS_14380 gene nagZ 1548750 1547719 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529284.1 protein_id gnl|my_center|LOCUS_14380 1549571 1548747 gene locus_tag LOCUS_14390 gene thiK 1549571 1548747 CDS product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705044.1 protein_id gnl|my_center|LOCUS_14390 1550214 1549552 gene locus_tag LOCUS_14400 gene lpoB 1550214 1549552 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164360.1 protein_id gnl|my_center|LOCUS_14400 1550599 1550225 gene locus_tag LOCUS_14410 1550599 1550225 CDS product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097110.1 protein_id gnl|my_center|LOCUS_14410 1550961 1550605 gene locus_tag LOCUS_14420 gene hinT 1550961 1550605 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705043.1 protein_id gnl|my_center|LOCUS_14420 1551292 1553502 gene locus_tag LOCUS_14430 gene fhuE 1551292 1553502 CDS product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097112.1 protein_id gnl|my_center|LOCUS_14430 1555140 1553707 gene locus_tag LOCUS_14440 gene ptsG 1555140 1553707 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097113.1 protein_id gnl|my_center|LOCUS_14440 1556232 1555438 gene locus_tag LOCUS_14450 1556232 1555438 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705042.1 protein_id gnl|my_center|LOCUS_14450 1557248 1556244 gene locus_tag LOCUS_14460 gene holB 1557248 1556244 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872450.1 protein_id gnl|my_center|LOCUS_14460 1557886 1557245 gene locus_tag LOCUS_14470 gene tmk 1557886 1557245 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535399.1 protein_id gnl|my_center|LOCUS_14470 1558889 1557876 gene locus_tag LOCUS_14480 gene yceG 1558889 1557876 CDS product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756827.1 protein_id gnl|my_center|LOCUS_14480 1559710 1558895 gene locus_tag LOCUS_14490 gene pabC 1559710 1558895 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705038.1 protein_id gnl|my_center|LOCUS_14490 1561071 1559830 gene locus_tag LOCUS_14500 gene fabF 1561071 1559830 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705037.1 protein_id gnl|my_center|LOCUS_14500 1561397 1561161 gene locus_tag LOCUS_14510 gene acpP 1561397 1561161 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103754.1 protein_id gnl|my_center|LOCUS_14510 1562286 1561552 gene locus_tag LOCUS_14520 gene fabG 1562286 1561552 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 protein_id gnl|my_center|LOCUS_14520 1563228 1562299 gene locus_tag LOCUS_14530 gene fabD 1563228 1562299 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367191.1 protein_id gnl|my_center|LOCUS_14530 1564039 1563245 gene locus_tag LOCUS_14540 1564039 1563245 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097122.1 protein_id gnl|my_center|LOCUS_14540 1565238 1563973 gene locus_tag LOCUS_14550 gene plsX 1565238 1563973 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063411321.1 protein_id gnl|my_center|LOCUS_14550 1565512 1565339 gene locus_tag LOCUS_14560 gene rpmF 1565512 1565339 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857964.1 protein_id gnl|my_center|LOCUS_14560 1566084 1565563 gene locus_tag LOCUS_14570 gene yceD 1566084 1565563 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174492.1 protein_id gnl|my_center|LOCUS_14570 1566226 1566810 gene locus_tag LOCUS_14580 1566226 1566810 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 protein_id gnl|my_center|LOCUS_14580 1567796 1566843 gene locus_tag LOCUS_14590 gene rluC 1567796 1566843 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705035.1 protein_id gnl|my_center|LOCUS_14590 1568364 1571576 gene locus_tag LOCUS_14600 gene rne 1568364 1571576 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827370.1 protein_id gnl|my_center|LOCUS_14600 1572553 1571615 gene locus_tag LOCUS_14610 1572553 1571615 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165457189.1 protein_id gnl|my_center|LOCUS_14610 1572672 1573886 gene locus_tag LOCUS_14620 1572672 1573886 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097130.1 protein_id gnl|my_center|LOCUS_14620 1574915 1573962 gene locus_tag LOCUS_14630 gene flgL 1574915 1573962 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223025.1 protein_id gnl|my_center|LOCUS_14630 1576570 1574930 gene locus_tag LOCUS_14640 gene flgK 1576570 1574930 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096524.1 protein_id gnl|my_center|LOCUS_14640 1577603 1576647 gene locus_tag LOCUS_14650 gene flgJ 1577603 1576647 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097133.1 protein_id gnl|my_center|LOCUS_14650 1578697 1577603 gene locus_tag LOCUS_14660 1578697 1577603 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097134.1 protein_id gnl|my_center|LOCUS_14660 1579408 1578710 gene locus_tag LOCUS_14670 gene flgH 1579408 1578710 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857987.1 protein_id gnl|my_center|LOCUS_14670 1580247 1579465 gene locus_tag LOCUS_14680 gene flgG 1580247 1579465 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 protein_id gnl|my_center|LOCUS_14680 1581018 1580263 gene locus_tag LOCUS_14690 1581018 1580263 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097135.1 protein_id gnl|my_center|LOCUS_14690 1582307 1581039 gene locus_tag LOCUS_14700 gene flgE 1582307 1581039 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885878.1 protein_id gnl|my_center|LOCUS_14700 1583017 1582334 gene locus_tag LOCUS_14710 gene flgD 1583017 1582334 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097137.1 protein_id gnl|my_center|LOCUS_14710 1583432 1583028 gene locus_tag LOCUS_14720 gene flgC 1583432 1583028 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196448.1 protein_id gnl|my_center|LOCUS_14720 1583851 1583435 gene locus_tag LOCUS_14730 gene flgB 1583851 1583435 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_14730 1584017 1584676 gene locus_tag LOCUS_14740 gene flgA 1584017 1584676 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194076.1 protein_id gnl|my_center|LOCUS_14740 1584771 1585064 gene locus_tag LOCUS_14750 gene flgM 1584771 1585064 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020892.1 protein_id gnl|my_center|LOCUS_14750 1585068 1585490 gene locus_tag LOCUS_14760 gene flgN 1585068 1585490 CDS product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197547.1 protein_id gnl|my_center|LOCUS_14760 1587009 1585552 gene locus_tag LOCUS_14770 gene murJ 1587009 1585552 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419099.1 protein_id gnl|my_center|LOCUS_14770 1588116 1587193 gene locus_tag LOCUS_14780 1588116 1587193 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097144.1 protein_id gnl|my_center|LOCUS_14780 1588766 1588119 gene locus_tag LOCUS_14790 1588766 1588119 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877137.1 protein_id gnl|my_center|LOCUS_14790 1589360 1588776 gene locus_tag LOCUS_14800 gene rimJ 1589360 1588776 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097146.1 protein_id gnl|my_center|LOCUS_14800 1589927 1590350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1590357 1591289 gene locus_tag LOCUS_14810 gene mdtH 1590357 1591289 CDS product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092170.1 protein_id gnl|my_center|LOCUS_14810 1591353 1592000 gene locus_tag LOCUS_14820 gene grxB 1591353 1592000 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780893.1 protein_id gnl|my_center|LOCUS_14820 1592114 1592674 gene locus_tag LOCUS_14830 1592114 1592674 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713057.1 protein_id gnl|my_center|LOCUS_14830 1592834 1593307 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1593316 1594236 gene locus_tag LOCUS_14840 gene pyrC 1593316 1594236 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126534.1 protein_id gnl|my_center|LOCUS_14840 1594312 1594557 gene locus_tag LOCUS_14850 gene dinI 1594312 1594557 CDS product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097151.1 protein_id gnl|my_center|LOCUS_14850 1594824 1595078 gene locus_tag LOCUS_14860 gene bssS 1594824 1595078 CDS product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414441.1 protein_id gnl|my_center|LOCUS_14860 1595468 1596332 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1596334 1596834 gene locus_tag LOCUS_14870 1596334 1596834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14870 1596783 1597181 gene locus_tag LOCUS_14880 1596783 1597181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14880 1597234 1597404 gene locus_tag LOCUS_14890 1597234 1597404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1597409 1597669 gene locus_tag LOCUS_14900 1597409 1597669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1597674 1598240 gene locus_tag LOCUS_14910 1597674 1598240 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419093.1 protein_id gnl|my_center|LOCUS_14910 1598243 1598818 gene locus_tag LOCUS_14920 1598243 1598818 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739886.1 protein_id gnl|my_center|LOCUS_14920 1599923 1598856 gene locus_tag LOCUS_14930 1599923 1598856 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097157.1 protein_id gnl|my_center|LOCUS_14930 1600123 1601043 gene locus_tag LOCUS_14940 gene lpxL 1600123 1601043 CDS product kdo(2)-lipid IV(A) lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183364.1 protein_id gnl|my_center|LOCUS_14940 1601279 1602529 gene locus_tag LOCUS_14950 gene mdtG 1601279 1602529 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027946.1 protein_id gnl|my_center|LOCUS_14950 1602611 1602985 gene locus_tag LOCUS_14960 1602611 1602985 CDS product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180056.1 protein_id gnl|my_center|LOCUS_14960 1603216 1602986 gene locus_tag LOCUS_14970 1603216 1602986 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237205.1 protein_id gnl|my_center|LOCUS_14970 1605813 1603285 gene locus_tag LOCUS_14980 gene mdoH 1605813 1603285 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097163.1 protein_id gnl|my_center|LOCUS_14980 1607332 1605806 gene locus_tag LOCUS_14990 gene mdoG 1607332 1605806 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 protein_id gnl|my_center|LOCUS_14990 1607616 1608764 gene locus_tag LOCUS_15000 gene mdoC 1607616 1608764 CDS product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705023.1 protein_id gnl|my_center|LOCUS_15000 1610249 1608777 gene locus_tag LOCUS_15010 1610249 1608777 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976323.1 protein_id gnl|my_center|LOCUS_15010 1610919 1610377 gene locus_tag LOCUS_15020 gene ymdB 1610919 1610377 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097166.1 protein_id gnl|my_center|LOCUS_15020 1611329 1611021 gene locus_tag LOCUS_15030 1611329 1611021 CDS product fimbrial assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223575861.1 protein_id gnl|my_center|LOCUS_15030 1611821 1611492 gene locus_tag LOCUS_15040 gene csgC 1611821 1611492 CDS product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992821.1 protein_id gnl|my_center|LOCUS_15040 1612327 1611878 gene locus_tag LOCUS_15050 gene csgA 1612327 1611878 CDS product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771416.1 protein_id gnl|my_center|LOCUS_15050 1612823 1612368 gene locus_tag LOCUS_15060 gene csgB 1612823 1612368 CDS product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360656.1 protein_id gnl|my_center|LOCUS_15060 1613094 1612828 gene locus_tag LOCUS_15070 1613094 1612828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1613585 1614235 gene locus_tag LOCUS_15080 gene csgD 1613585 1614235 CDS product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097171.1 protein_id gnl|my_center|LOCUS_15080 1614239 1614628 gene locus_tag LOCUS_15090 gene csgE 1614239 1614628 CDS product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833288.1 protein_id gnl|my_center|LOCUS_15090 1614654 1615070 gene locus_tag LOCUS_15100 gene csgF 1614654 1615070 CDS product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264096.1 protein_id gnl|my_center|LOCUS_15100 1615097 1615930 gene locus_tag LOCUS_15110 gene csgG 1615097 1615930 CDS product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137620.1 protein_id gnl|my_center|LOCUS_15110 1616581 1616111 gene locus_tag LOCUS_15120 1616581 1616111 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300785.1 protein_id gnl|my_center|LOCUS_15120 1617237 1616683 gene locus_tag LOCUS_15130 1617237 1616683 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001883.1 protein_id gnl|my_center|LOCUS_15130 1617633 1617259 gene locus_tag LOCUS_15140 1617633 1617259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1618382 1617654 gene locus_tag LOCUS_15150 1618382 1617654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1618428 1618676 gene locus_tag LOCUS_15160 1618428 1618676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1618717 1618926 gene locus_tag LOCUS_15170 1618717 1618926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1619215 1618949 gene locus_tag LOCUS_15180 1619215 1618949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1619561 1619268 gene locus_tag LOCUS_15190 1619561 1619268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1619716 1619558 gene locus_tag LOCUS_15200 1619716 1619558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1620431 1619868 gene locus_tag LOCUS_15210 1620431 1619868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1620875 1620447 gene locus_tag LOCUS_15220 1620875 1620447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1620917 1621369 gene locus_tag LOCUS_15230 1620917 1621369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1621654 1621379 gene locus_tag LOCUS_15240 1621654 1621379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1622334 1621687 gene locus_tag LOCUS_15250 1622334 1621687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1622643 1622344 gene locus_tag LOCUS_15260 1622643 1622344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1626281 1622691 gene locus_tag LOCUS_15270 1626281 1622691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1626670 1626266 gene locus_tag LOCUS_15280 1626670 1626266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1627296 1626670 gene locus_tag LOCUS_15290 1627296 1626670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1627853 1627296 gene locus_tag LOCUS_15300 1627853 1627296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1628603 1627911 gene locus_tag LOCUS_15310 1628603 1627911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1630300 1628609 gene locus_tag LOCUS_15320 1630300 1628609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1630643 1630290 gene locus_tag LOCUS_15330 1630643 1630290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1630977 1630636 gene locus_tag LOCUS_15340 1630977 1630636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1631483 1631025 gene locus_tag LOCUS_15350 1631483 1631025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1635084 1631536 gene locus_tag LOCUS_15360 1635084 1631536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1635484 1635086 gene locus_tag LOCUS_15370 1635484 1635086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1635804 1635484 gene locus_tag LOCUS_15380 1635804 1635484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1637774 1635810 gene locus_tag LOCUS_15390 1637774 1635810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1639239 1637716 gene locus_tag LOCUS_15400 1639239 1637716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1639787 1639239 gene locus_tag LOCUS_15410 1639787 1639239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1641462 1639798 gene locus_tag LOCUS_15420 1641462 1639798 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027298.1 protein_id gnl|my_center|LOCUS_15420 1641707 1641501 gene locus_tag LOCUS_15430 1641707 1641501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1642179 1641628 gene locus_tag LOCUS_15440 1642179 1641628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1642848 1642471 gene locus_tag LOCUS_15450 1642848 1642471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1643399 1642902 gene locus_tag LOCUS_15460 1643399 1642902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1644365 1643796 gene locus_tag LOCUS_15470 1644365 1643796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1644528 1644842 gene locus_tag LOCUS_15480 1644528 1644842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1645617 1645159 gene locus_tag LOCUS_15490 1645617 1645159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1645897 1645634 gene locus_tag LOCUS_15500 1645897 1645634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1646115 1645939 gene locus_tag LOCUS_15510 1646115 1645939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1646279 1647010 gene locus_tag LOCUS_15520 1646279 1647010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1647282 1647052 gene locus_tag LOCUS_15530 1647282 1647052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1647641 1647312 gene locus_tag LOCUS_15540 1647641 1647312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1648082 1647690 gene locus_tag LOCUS_15550 1648082 1647690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1650307 1648247 gene locus_tag LOCUS_15560 1650307 1648247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1650563 1650378 gene locus_tag LOCUS_15570 1650563 1650378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1651281 1650922 gene locus_tag LOCUS_15580 1651281 1650922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1653629 1651827 gene locus_tag LOCUS_15590 1653629 1651827 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047369517.1 protein_id gnl|my_center|LOCUS_15590 1654089 1653664 gene locus_tag LOCUS_15600 1654089 1653664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1655110 1654172 gene locus_tag LOCUS_15610 gene ghrA 1655110 1654172 CDS product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097178.1 protein_id gnl|my_center|LOCUS_15610 1655363 1656016 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1656800 1656198 gene locus_tag LOCUS_15620 1656800 1656198 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705217.1 protein_id gnl|my_center|LOCUS_15620 1656988 1657539 gene locus_tag LOCUS_15630 1656988 1657539 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366894.1 protein_id gnl|my_center|LOCUS_15630 1657637 1657843 gene locus_tag LOCUS_15640 1657637 1657843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1657886 1658695 gene locus_tag LOCUS_15650 1657886 1658695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1658923 1659177 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1659185 1659272 gene locus_tag LOCUS_t00220 1659185 1659272 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1660954 1660166 gene locus_tag LOCUS_15660 gene phoH 1660954 1660166 CDS product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367231.1 protein_id gnl|my_center|LOCUS_15660 1662777 1661494 gene locus_tag LOCUS_15670 gene efeB 1662777 1661494 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097184.1 protein_id gnl|my_center|LOCUS_15670 1663909 1662782 gene locus_tag LOCUS_15680 gene efeO 1663909 1662782 CDS product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154391.1 protein_id gnl|my_center|LOCUS_15680 1664788 1663955 gene locus_tag LOCUS_15690 1664788 1663955 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097186.1 protein_id gnl|my_center|LOCUS_15690 1666479 1664971 gene locus_tag LOCUS_15700 gene putP 1666479 1664971 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018503.1 protein_id gnl|my_center|LOCUS_15700 1666884 1670846 gene locus_tag LOCUS_15710 gene putA 1666884 1670846 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097190.1 protein_id gnl|my_center|LOCUS_15710 1670942 1671340 gene locus_tag LOCUS_15720 1670942 1671340 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821059.1 protein_id gnl|my_center|LOCUS_15720 1671603 1671430 gene locus_tag LOCUS_15730 1671603 1671430 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097201.1 protein_id gnl|my_center|LOCUS_15730 1671988 1672584 gene locus_tag LOCUS_15740 gene wrbA 1671988 1672584 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062894.1 protein_id gnl|my_center|LOCUS_15740 1672602 1672829 gene locus_tag LOCUS_15750 1672602 1672829 CDS product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499832.1 protein_id gnl|my_center|LOCUS_15750 1674103 1672865 gene locus_tag LOCUS_15760 gene agp 1674103 1672865 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132910.1 protein_id gnl|my_center|LOCUS_15760 1675192 1674218 gene locus_tag LOCUS_15770 gene wcaA 1675192 1674218 CDS product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654485.1 protein_id gnl|my_center|LOCUS_15770 1676781 1675609 gene locus_tag LOCUS_15780 1676781 1675609 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529186.1 protein_id gnl|my_center|LOCUS_15780 1677348 1678676 gene locus_tag LOCUS_15790 1677348 1678676 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194588.1 protein_id gnl|my_center|LOCUS_15790 1678869 1679231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1679499 1680482 gene locus_tag LOCUS_15800 1679499 1680482 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298359.1 protein_id gnl|my_center|LOCUS_15800 1680528 1681283 gene locus_tag LOCUS_15810 1680528 1681283 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_15810 1681477 1681390 gene locus_tag LOCUS_t00230 1681477 1681390 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1683246 1681618 gene locus_tag LOCUS_15820 1683246 1681618 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097243.1 protein_id gnl|my_center|LOCUS_15820 1683518 1684171 gene locus_tag LOCUS_15830 gene yccA 1683518 1684171 CDS product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704916.1 protein_id gnl|my_center|LOCUS_15830 1684260 1684586 gene locus_tag LOCUS_15840 gene tusE 1684260 1684586 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 protein_id gnl|my_center|LOCUS_15840 1684876 1684583 gene locus_tag LOCUS_15850 gene yccX 1684876 1684583 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097246.1 protein_id gnl|my_center|LOCUS_15850 1685099 1685881 gene locus_tag LOCUS_15860 1685099 1685881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1685988 1687178 gene locus_tag LOCUS_15870 gene rlmI 1685988 1687178 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 protein_id gnl|my_center|LOCUS_15870 1687253 1687570 gene locus_tag LOCUS_15880 gene hspQ 1687253 1687570 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561983.1 protein_id gnl|my_center|LOCUS_15880 1688009 1687596 gene locus_tag LOCUS_15890 1688009 1687596 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975203.1 protein_id gnl|my_center|LOCUS_15890 1688159 1688821 gene locus_tag LOCUS_15900 1688159 1688821 CDS product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097250.1 protein_id gnl|my_center|LOCUS_15900 1688934 1689392 gene locus_tag LOCUS_15910 gene mgsA 1688934 1689392 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424187.1 protein_id gnl|my_center|LOCUS_15910 1691475 1689421 gene locus_tag LOCUS_15920 gene helD 1691475 1689421 CDS product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305911.1 protein_id gnl|my_center|LOCUS_15920 1691600 1692046 gene locus_tag LOCUS_15930 1691600 1692046 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097253.1 protein_id gnl|my_center|LOCUS_15930 1692063 1693073 gene locus_tag LOCUS_15940 1692063 1693073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15940 1693183 1694190 gene locus_tag LOCUS_15950 1693183 1694190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15950 1694807 1694187 gene locus_tag LOCUS_15960 1694807 1694187 CDS product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097255.1 protein_id gnl|my_center|LOCUS_15960 1694968 1695525 gene locus_tag LOCUS_15970 gene sulA 1694968 1695525 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288710.1 protein_id gnl|my_center|LOCUS_15970 1695891 1696949 gene locus_tag LOCUS_15980 gene ompA 1695891 1696949 CDS product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989142.1 protein_id gnl|my_center|LOCUS_15980 1697476 1697024 gene locus_tag LOCUS_15990 gene matP 1697476 1697024 CDS product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367432.1 protein_id gnl|my_center|LOCUS_15990 1698177 1698608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1698726 1699832 gene locus_tag LOCUS_16000 1698726 1699832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1699902 1700420 gene locus_tag LOCUS_16010 gene fabA 1699902 1700420 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227927.1 protein_id gnl|my_center|LOCUS_16010 1701487 1700921 gene locus_tag LOCUS_16020 gene pqiC 1701487 1700921 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367436.1 protein_id gnl|my_center|LOCUS_16020 1703124 1701484 gene locus_tag LOCUS_16030 gene pqiB 1703124 1701484 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097263.1 protein_id gnl|my_center|LOCUS_16030 1704382 1703129 gene locus_tag LOCUS_16040 gene pqiA 1704382 1703129 CDS product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333164.1 protein_id gnl|my_center|LOCUS_16040 1706304 1704397 gene locus_tag LOCUS_16050 1706304 1704397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097265.1 protein_id gnl|my_center|LOCUS_16050 1708674 1706317 gene locus_tag LOCUS_16060 1708674 1706317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1707014 1707228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1708774 1709883 gene locus_tag LOCUS_16070 1708774 1709883 CDS product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224084.1 protein_id gnl|my_center|LOCUS_16070 1710419 1709880 gene locus_tag LOCUS_16080 gene zapC 1710419 1709880 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097268.1 protein_id gnl|my_center|LOCUS_16080 1711598 1710588 gene locus_tag LOCUS_16090 gene pyrD 1711598 1710588 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305914.1 protein_id gnl|my_center|LOCUS_16090 1714420 1711808 gene locus_tag LOCUS_16100 gene pepN 1714420 1711808 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704896.1 protein_id gnl|my_center|LOCUS_16100 1714682 1715884 gene locus_tag LOCUS_16110 gene pncB 1714682 1715884 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097285.1 protein_id gnl|my_center|LOCUS_16110 1716111 1717511 gene locus_tag LOCUS_16120 gene asnS 1716111 1717511 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117867.1 protein_id gnl|my_center|LOCUS_16120 1718112 1719212 gene locus_tag LOCUS_16130 gene ompF 1718112 1719212 CDS product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977709.1 protein_id gnl|my_center|LOCUS_16130 1719398 1720588 gene locus_tag LOCUS_16140 gene aspC 1719398 1720588 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462680.1 protein_id gnl|my_center|LOCUS_16140 1721345 1720698 gene locus_tag LOCUS_16150 gene gloC 1721345 1720698 CDS product hydroxyacylglutathione hydrolase GloC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109455.1 protein_id gnl|my_center|LOCUS_16150 1721921 1721373 gene locus_tag LOCUS_16160 1721921 1721373 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357053.1 protein_id gnl|my_center|LOCUS_16160 1723968 1722106 gene locus_tag LOCUS_16170 gene ldtD 1723968 1722106 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097291.1 protein_id gnl|my_center|LOCUS_16170 1728584 1724136 gene locus_tag LOCUS_16180 gene mukB 1728584 1724136 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704893.1 protein_id gnl|my_center|LOCUS_16180 1729282 1728581 gene locus_tag LOCUS_16190 gene mukE 1729282 1728581 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295347.1 protein_id gnl|my_center|LOCUS_16190 1730591 1729269 gene locus_tag LOCUS_16200 gene mukF 1730591 1729269 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288845.1 protein_id gnl|my_center|LOCUS_16200 1731378 1730584 gene locus_tag LOCUS_16210 gene cmoM 1731378 1730584 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154025.1 protein_id gnl|my_center|LOCUS_16210 1731497 1732276 gene locus_tag LOCUS_16220 gene elyC 1731497 1732276 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899546.1 protein_id gnl|my_center|LOCUS_16220 1732642 1732253 gene locus_tag LOCUS_16230 1732642 1732253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1732661 1733218 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1734588 1733842 gene locus_tag LOCUS_16240 gene kdsB 1734588 1733842 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097299.1 protein_id gnl|my_center|LOCUS_16240 1734767 1734585 gene locus_tag LOCUS_16250 gene ycaR 1734767 1734585 CDS product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367465.1 protein_id gnl|my_center|LOCUS_16250 1736039 1734822 gene locus_tag LOCUS_16260 1736039 1734822 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097301.1 protein_id gnl|my_center|LOCUS_16260 1737052 1736075 gene locus_tag LOCUS_16270 gene lpxK 1737052 1736075 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097302.1 protein_id gnl|my_center|LOCUS_16270 1738797 1737049 gene locus_tag LOCUS_16280 gene msbA 1738797 1737049 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 protein_id gnl|my_center|LOCUS_16280 1741098 1738834 gene locus_tag LOCUS_16290 1741098 1738834 CDS product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705794.1 protein_id gnl|my_center|LOCUS_16290 1741592 1741308 gene locus_tag LOCUS_16300 gene ihfB 1741592 1741308 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004100704.1 protein_id gnl|my_center|LOCUS_16300 1743483 1741810 gene locus_tag LOCUS_16310 gene rpsA 1743483 1741810 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140327.1 protein_id gnl|my_center|LOCUS_16310 1744280 1743597 gene locus_tag LOCUS_16320 gene cmk 1744280 1743597 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125007.1 protein_id gnl|my_center|LOCUS_16320 1745219 1744452 gene locus_tag LOCUS_16330 1745219 1744452 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792300.1 protein_id gnl|my_center|LOCUS_16330 1746644 1745361 gene locus_tag LOCUS_16340 gene aroA 1746644 1745361 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 protein_id gnl|my_center|LOCUS_16340 1747802 1746714 gene locus_tag LOCUS_16350 gene serC 1747802 1746714 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882989.1 protein_id gnl|my_center|LOCUS_16350 1748657 1747965 gene locus_tag LOCUS_16360 1748657 1747965 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642849.1 protein_id gnl|my_center|LOCUS_16360 1748796 1750556 gene locus_tag LOCUS_16370 gene ycaO 1748796 1750556 CDS product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420898.1 protein_id gnl|my_center|LOCUS_16370 1750962 1751819 gene locus_tag LOCUS_16380 gene focA 1750962 1751819 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097310.1 protein_id gnl|my_center|LOCUS_16380 1751871 1754153 gene locus_tag LOCUS_16390 gene pflB 1751871 1754153 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097311.1 protein_id gnl|my_center|LOCUS_16390 1754349 1755089 gene locus_tag LOCUS_16400 gene pflA 1754349 1755089 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367479.1 protein_id gnl|my_center|LOCUS_16400 1755724 1756137 gene locus_tag LOCUS_16410 1755724 1756137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1756149 1756709 gene locus_tag LOCUS_16420 1756149 1756709 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_16420 1756690 1757076 gene locus_tag LOCUS_16430 1756690 1757076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1758311 1757163 gene locus_tag LOCUS_16440 1758311 1757163 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097314.1 protein_id gnl|my_center|LOCUS_16440 1759883 1758591 gene locus_tag LOCUS_16450 gene serS 1759883 1758591 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499983.1 protein_id gnl|my_center|LOCUS_16450 1761320 1759977 gene locus_tag LOCUS_16460 gene rarA 1761320 1759977 CDS product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 protein_id gnl|my_center|LOCUS_16460 1761941 1761330 gene locus_tag LOCUS_16470 gene lolA 1761941 1761330 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976047.1 protein_id gnl|my_center|LOCUS_16470 1765887 1762060 gene locus_tag LOCUS_16480 1765887 1762060 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097320.1 protein_id gnl|my_center|LOCUS_16480 1766492 1765998 gene locus_tag LOCUS_16490 gene lrp 1766492 1765998 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 protein_id gnl|my_center|LOCUS_16490 1767041 1768009 gene locus_tag LOCUS_16500 gene trxB 1767041 1768009 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097321.1 protein_id gnl|my_center|LOCUS_16500 1768124 1769890 gene locus_tag LOCUS_16510 gene cydD 1768124 1769890 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044527.1 protein_id gnl|my_center|LOCUS_16510 1769891 1771612 gene locus_tag LOCUS_16520 gene cydC 1769891 1771612 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704874.1 protein_id gnl|my_center|LOCUS_16520 1771724 1772425 gene locus_tag LOCUS_16530 gene aat 1771724 1772425 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241667.1 protein_id gnl|my_center|LOCUS_16530 1772572 1772953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1773105 1773323 gene locus_tag LOCUS_16540 gene infA 1773105 1773323 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_16540 1773723 1773454 gene locus_tag LOCUS_16550 1773723 1773454 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621026.1 protein_id gnl|my_center|LOCUS_16550 1774593 1773733 gene locus_tag LOCUS_16560 1774593 1773733 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131789.1 protein_id gnl|my_center|LOCUS_16560 1776126 1774639 gene locus_tag LOCUS_16570 1776126 1774639 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113563.1 protein_id gnl|my_center|LOCUS_16570 1777477 1776119 gene locus_tag LOCUS_16580 1777477 1776119 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997823.1 protein_id gnl|my_center|LOCUS_16580 1777841 1777554 gene locus_tag LOCUS_16590 1777841 1777554 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041396.1 protein_id gnl|my_center|LOCUS_16590 1778311 1777838 gene locus_tag LOCUS_16600 1778311 1777838 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161554.1 protein_id gnl|my_center|LOCUS_16600 1779072 1778329 gene locus_tag LOCUS_16610 1779072 1778329 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854956.1 protein_id gnl|my_center|LOCUS_16610 1779537 1779818 gene locus_tag LOCUS_16620 1779537 1779818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 1782327 1780048 gene locus_tag LOCUS_16630 gene clpA 1782327 1780048 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934058.1 protein_id gnl|my_center|LOCUS_16630 1782678 1782358 gene locus_tag LOCUS_16640 gene clpS 1782678 1782358 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174393.1 protein_id gnl|my_center|LOCUS_16640 1783002 1783223 gene locus_tag LOCUS_16650 gene cspD 1783002 1783223 CDS product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447499.1 protein_id gnl|my_center|LOCUS_16650 1785232 1783289 gene locus_tag LOCUS_16660 gene macB 1785232 1783289 CDS product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097326.1 protein_id gnl|my_center|LOCUS_16660 1786344 1785229 gene locus_tag LOCUS_16670 gene macA 1786344 1785229 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097327.1 protein_id gnl|my_center|LOCUS_16670 1786516 1787472 gene locus_tag LOCUS_16680 1786516 1787472 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 protein_id gnl|my_center|LOCUS_16680 1789127 1787469 gene locus_tag LOCUS_16690 1789127 1787469 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704871.1 protein_id gnl|my_center|LOCUS_16690 1789484 1790179 gene locus_tag LOCUS_16700 gene aqpZ 1789484 1790179 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704870.1 protein_id gnl|my_center|LOCUS_16700 1790311 1791210 gene locus_tag LOCUS_16710 gene lysO 1790311 1791210 CDS product L-lysine exporter LysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309383.1 protein_id gnl|my_center|LOCUS_16710 1791356 1793008 gene locus_tag LOCUS_16720 gene hcp 1791356 1793008 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097332.1 protein_id gnl|my_center|LOCUS_16720 1793019 1793987 gene locus_tag LOCUS_16730 gene hcr 1793019 1793987 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704868.1 protein_id gnl|my_center|LOCUS_16730 1794553 1794125 gene locus_tag LOCUS_16740 1794553 1794125 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704866.1 protein_id gnl|my_center|LOCUS_16740 1794705 1796423 gene locus_tag LOCUS_16750 gene poxB 1794705 1796423 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815366.1 protein_id gnl|my_center|LOCUS_16750 1796471 1797496 gene locus_tag LOCUS_16760 gene ltaE 1796471 1797496 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097336.1 protein_id gnl|my_center|LOCUS_16760 1797664 1798677 gene locus_tag LOCUS_16770 1797664 1798677 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097338.1 protein_id gnl|my_center|LOCUS_16770 1799261 1798686 gene locus_tag LOCUS_16780 1799261 1798686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1800074 1799265 gene locus_tag LOCUS_16790 gene amiD 1800074 1799265 CDS product N-acetylmuramoyl-L-alanine amidase AmiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255157.1 protein_id gnl|my_center|LOCUS_16790 1800412 1800089 gene locus_tag LOCUS_16800 1800412 1800089 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174327.1 protein_id gnl|my_center|LOCUS_16800 1800508 1801023 gene locus_tag LOCUS_16810 1800508 1801023 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097359.1 protein_id gnl|my_center|LOCUS_16810 1801167 1801955 gene locus_tag LOCUS_16820 gene artP 1801167 1801955 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367515.1 protein_id gnl|my_center|LOCUS_16820 1801957 1802706 gene locus_tag LOCUS_16830 gene artJ 1801957 1802706 CDS product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756586.1 protein_id gnl|my_center|LOCUS_16830 1802712 1803428 gene locus_tag LOCUS_16840 gene artQ 1802712 1803428 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001687.1 protein_id gnl|my_center|LOCUS_16840 1803428 1804096 gene locus_tag LOCUS_16850 gene artM 1803428 1804096 CDS product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097363.1 protein_id gnl|my_center|LOCUS_16850 1804271 1805002 gene locus_tag LOCUS_16860 gene artJ 1804271 1805002 CDS product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367519.1 protein_id gnl|my_center|LOCUS_16860 1806241 1805114 gene locus_tag LOCUS_16870 gene rlmC 1806241 1805114 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149709.1 protein_id gnl|my_center|LOCUS_16870 1806756 1806283 gene locus_tag LOCUS_16880 1806756 1806283 CDS product DUF2593 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763976.1 protein_id gnl|my_center|LOCUS_16880 1807676 1806831 gene locus_tag LOCUS_16890 gene potI 1807676 1806831 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367524.1 protein_id gnl|my_center|LOCUS_16890 1808626 1807673 gene locus_tag LOCUS_16900 gene potH 1808626 1807673 CDS product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367525.1 protein_id gnl|my_center|LOCUS_16900 1809787 1808636 gene locus_tag LOCUS_16910 gene potG 1809787 1808636 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097371.1 protein_id gnl|my_center|LOCUS_16910 1811016 1809907 gene locus_tag LOCUS_16920 gene potF 1811016 1809907 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 protein_id gnl|my_center|LOCUS_16920 1811856 1811377 gene locus_tag LOCUS_16930 1811856 1811377 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367528.1 protein_id gnl|my_center|LOCUS_16930 1812081 1812383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1812604 1813146 gene locus_tag LOCUS_16940 1812604 1813146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1813436 1813699 gene locus_tag LOCUS_16950 1813436 1813699 CDS product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 protein_id gnl|my_center|LOCUS_16950 1814073 1813705 gene locus_tag LOCUS_16960 1814073 1813705 CDS product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680848.1 protein_id gnl|my_center|LOCUS_16960 1814351 1816036 gene locus_tag LOCUS_16970 1814351 1816036 CDS product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024851.1 protein_id gnl|my_center|LOCUS_16970 1816735 1816193 gene locus_tag LOCUS_16980 1816735 1816193 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097419.1 protein_id gnl|my_center|LOCUS_16980 1816816 1818009 gene locus_tag LOCUS_16990 1816816 1818009 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217879.1 protein_id gnl|my_center|LOCUS_16990 1819272 1818040 gene locus_tag LOCUS_17000 gene mdfA 1819272 1818040 CDS product multidrug efflux MFS transporter MdfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180089.1 protein_id gnl|my_center|LOCUS_17000 1819554 1820162 gene locus_tag LOCUS_17010 gene ybjG 1819554 1820162 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520197.1 protein_id gnl|my_center|LOCUS_17010 1820227 1820496 gene locus_tag LOCUS_17020 1820227 1820496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 1820451 1820984 gene locus_tag LOCUS_17030 1820451 1820984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17030 1822238 1821015 gene locus_tag LOCUS_17040 gene dacC 1822238 1821015 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386670.1 protein_id gnl|my_center|LOCUS_17040 1822442 1823068 gene locus_tag LOCUS_17050 1822442 1823068 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631908.1 protein_id gnl|my_center|LOCUS_17050 1824201 1823086 gene locus_tag LOCUS_17060 1824201 1823086 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097429.1 protein_id gnl|my_center|LOCUS_17060 1824693 1824310 gene locus_tag LOCUS_17070 gene bssR 1824693 1824310 CDS product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367550.1 protein_id gnl|my_center|LOCUS_17070 1826615 1824816 gene locus_tag LOCUS_17080 gene atzF 1826615 1824816 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096801.1 protein_id gnl|my_center|LOCUS_17080 1830214 1826615 gene locus_tag LOCUS_17090 gene uca 1830214 1826615 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096802.1 protein_id gnl|my_center|LOCUS_17090 1830996 1830370 gene locus_tag LOCUS_17100 1830996 1830370 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_17100 1831735 1831007 gene locus_tag LOCUS_17110 1831735 1831007 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_17110 1832514 1831732 gene locus_tag LOCUS_17120 1832514 1831732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096805.1 protein_id gnl|my_center|LOCUS_17120 1833326 1832511 gene locus_tag LOCUS_17130 1833326 1832511 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096806.1 protein_id gnl|my_center|LOCUS_17130 1834404 1833346 gene locus_tag LOCUS_17140 1834404 1833346 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096807.1 protein_id gnl|my_center|LOCUS_17140 1835007 1836332 gene locus_tag LOCUS_17150 gene rimO 1835007 1836332 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049367.1 protein_id gnl|my_center|LOCUS_17150 1837706 1836369 gene locus_tag LOCUS_17160 1837706 1836369 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038346.1 protein_id gnl|my_center|LOCUS_17160 1838702 1837746 gene locus_tag LOCUS_17170 1838702 1837746 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210257.1 protein_id gnl|my_center|LOCUS_17170 1838797 1839684 gene locus_tag LOCUS_17180 1838797 1839684 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088611.1 protein_id gnl|my_center|LOCUS_17180 1840585 1839674 gene locus_tag LOCUS_17190 gene gsiD 1840585 1839674 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704838.1 protein_id gnl|my_center|LOCUS_17190 1841508 1840588 gene locus_tag LOCUS_17200 gene gsiC 1841508 1840588 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367554.1 protein_id gnl|my_center|LOCUS_17200 1843095 1841557 gene locus_tag LOCUS_17210 gene gsiB 1843095 1841557 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 protein_id gnl|my_center|LOCUS_17210 1844995 1843124 gene locus_tag LOCUS_17220 gene gsiA 1844995 1843124 CDS product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097436.1 protein_id gnl|my_center|LOCUS_17220 1845947 1845006 gene locus_tag LOCUS_17230 gene iaaA 1845947 1845006 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513761.1 protein_id gnl|my_center|LOCUS_17230 1846149 1847381 gene locus_tag LOCUS_17240 gene moeA 1846149 1847381 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704836.1 protein_id gnl|my_center|LOCUS_17240 1847383 1848150 gene locus_tag LOCUS_17250 gene moeB 1847383 1848150 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097439.1 protein_id gnl|my_center|LOCUS_17250 1849116 1848166 gene locus_tag LOCUS_17260 1849116 1848166 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235943.1 protein_id gnl|my_center|LOCUS_17260 1849386 1850285 gene locus_tag LOCUS_17270 1849386 1850285 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576948.1 protein_id gnl|my_center|LOCUS_17270 1850290 1852722 gene locus_tag LOCUS_17280 1850290 1852722 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192654.1 protein_id gnl|my_center|LOCUS_17280 1852895 1853707 gene locus_tag LOCUS_17290 1852895 1853707 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367562.1 protein_id gnl|my_center|LOCUS_17290 1853832 1855109 gene locus_tag LOCUS_17300 1853832 1855109 CDS product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097444.1 protein_id gnl|my_center|LOCUS_17300 1856992 1855160 gene locus_tag LOCUS_17310 1856992 1855160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1859157 1857178 gene locus_tag LOCUS_17320 1859157 1857178 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269327.1 protein_id gnl|my_center|LOCUS_17320 1860891 1859299 gene locus_tag LOCUS_17330 1860891 1859299 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097447.1 protein_id gnl|my_center|LOCUS_17330 1861548 1862015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1862059 1862511 gene locus_tag LOCUS_17340 1862059 1862511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1863630 1862575 gene locus_tag LOCUS_17350 1863630 1862575 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097452.1 protein_id gnl|my_center|LOCUS_17350 1865253 1863730 gene locus_tag LOCUS_17360 1865253 1863730 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149366214.1 protein_id gnl|my_center|LOCUS_17360 1866826 1865255 gene locus_tag LOCUS_17370 1866826 1865255 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097454.1 protein_id gnl|my_center|LOCUS_17370 1867929 1866823 gene locus_tag LOCUS_17380 1867929 1866823 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 protein_id gnl|my_center|LOCUS_17380 1869139 1868030 gene locus_tag LOCUS_17390 1869139 1868030 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056477.1 protein_id gnl|my_center|LOCUS_17390 1869603 1869136 gene locus_tag LOCUS_17400 gene mntR 1869603 1869136 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097457.1 protein_id gnl|my_center|LOCUS_17400 1869795 1869923 gene locus_tag LOCUS_17410 gene mntS 1869795 1869923 CDS product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097458.1 protein_id gnl|my_center|LOCUS_17410 1870201 1871784 gene locus_tag LOCUS_17420 1870201 1871784 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097459.1 protein_id gnl|my_center|LOCUS_17420 1872358 1871846 gene locus_tag LOCUS_17430 gene ompX 1872358 1871846 CDS product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097460.1 protein_id gnl|my_center|LOCUS_17430 1872721 1873599 gene locus_tag LOCUS_17440 gene rhtA 1872721 1873599 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001446792.1 protein_id gnl|my_center|LOCUS_17440 1873894 1874397 gene locus_tag LOCUS_17450 gene dps 1873894 1874397 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097463.1 protein_id gnl|my_center|LOCUS_17450 1874752 1875495 gene locus_tag LOCUS_17460 gene glnH 1874752 1875495 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843866.1 protein_id gnl|my_center|LOCUS_17460 1875652 1876311 gene locus_tag LOCUS_17470 gene glnP 1875652 1876311 CDS product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159076.1 protein_id gnl|my_center|LOCUS_17470 1876308 1877030 gene locus_tag LOCUS_17480 gene glnQ 1876308 1877030 CDS product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569093.1 protein_id gnl|my_center|LOCUS_17480 1877148 1879355 gene locus_tag LOCUS_17490 gene ybiO 1877148 1879355 CDS product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097466.1 protein_id gnl|my_center|LOCUS_17490 1880280 1879345 gene locus_tag LOCUS_17500 gene rlmF 1880280 1879345 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704819.1 protein_id gnl|my_center|LOCUS_17500 1880375 1880989 gene locus_tag LOCUS_17510 1880375 1880989 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704818.1 protein_id gnl|my_center|LOCUS_17510 1881116 1881382 gene locus_tag LOCUS_17520 1881116 1881382 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367587.1 protein_id gnl|my_center|LOCUS_17520 1881668 1881928 gene locus_tag LOCUS_17530 gene ybiJ 1881668 1881928 CDS product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367588.1 protein_id gnl|my_center|LOCUS_17530 1882996 1882034 gene locus_tag LOCUS_17540 gene ybiB 1882996 1882034 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386551.1 protein_id gnl|my_center|LOCUS_17540 1885162 1883021 gene locus_tag LOCUS_17550 gene dinG 1885162 1883021 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218658.1 protein_id gnl|my_center|LOCUS_17550 1886347 1885310 gene locus_tag LOCUS_17560 1886347 1885310 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038001995.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17560 1886637 1886344 gene locus_tag LOCUS_17570 1886637 1886344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17570 1888255 1886651 gene locus_tag LOCUS_17580 1888255 1886651 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861179.1 protein_id gnl|my_center|LOCUS_17580 1889111 1888377 gene locus_tag LOCUS_17590 1889111 1888377 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_17590 1890662 1889325 gene locus_tag LOCUS_17600 gene rhlE 1890662 1889325 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097479.1 protein_id gnl|my_center|LOCUS_17600 1890961 1891620 gene locus_tag LOCUS_17610 gene cecR 1890961 1891620 CDS product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097480.1 protein_id gnl|my_center|LOCUS_17610 1891624 1892619 gene locus_tag LOCUS_17620 gene hlyD 1891624 1892619 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097481.1 protein_id gnl|my_center|LOCUS_17620 1892612 1894351 gene locus_tag LOCUS_17630 1892612 1894351 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287626.1 protein_id gnl|my_center|LOCUS_17630 1894341 1895474 gene locus_tag LOCUS_17640 1894341 1895474 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045765.1 protein_id gnl|my_center|LOCUS_17640 1895484 1896590 gene locus_tag LOCUS_17650 1895484 1896590 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469048.1 protein_id gnl|my_center|LOCUS_17650 1896962 1896552 gene locus_tag LOCUS_17660 1896962 1896552 CDS product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871970.1 protein_id gnl|my_center|LOCUS_17660 1897095 1897856 gene locus_tag LOCUS_17670 1897095 1897856 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 protein_id gnl|my_center|LOCUS_17670 1897853 1899097 gene locus_tag LOCUS_17680 gene clsB 1897853 1899097 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650337.1 protein_id gnl|my_center|LOCUS_17680 1899097 1900062 gene locus_tag LOCUS_17690 1899097 1900062 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129824.1 protein_id gnl|my_center|LOCUS_17690 1900764 1900063 gene locus_tag LOCUS_17700 1900764 1900063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1901595 1900888 gene locus_tag LOCUS_17710 1901595 1900888 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428846.1 protein_id gnl|my_center|LOCUS_17710 1902107 1901655 gene locus_tag LOCUS_17720 gene moaE 1902107 1901655 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545202.1 protein_id gnl|my_center|LOCUS_17720 1902354 1902109 gene locus_tag LOCUS_17730 gene moaD 1902354 1902109 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598612.1 protein_id gnl|my_center|LOCUS_17730 1902832 1902347 gene locus_tag LOCUS_17740 gene moaC 1902832 1902347 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097492.1 protein_id gnl|my_center|LOCUS_17740 1903347 1902835 gene locus_tag LOCUS_17750 gene moaB 1903347 1902835 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084604.1 protein_id gnl|my_center|LOCUS_17750 1904357 1903368 gene locus_tag LOCUS_17760 gene moaA 1904357 1903368 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704804.1 protein_id gnl|my_center|LOCUS_17760 1904696 1905604 gene locus_tag LOCUS_17770 gene yvcK 1904696 1905604 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301716.1 protein_id gnl|my_center|LOCUS_17770 1905729 1907372 gene locus_tag LOCUS_17780 gene eptA 1905729 1907372 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704802.1 protein_id gnl|my_center|LOCUS_17780 1907369 1908040 gene locus_tag LOCUS_17790 gene pmrA 1907369 1908040 CDS product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704801.1 protein_id gnl|my_center|LOCUS_17790 1908043 1909122 gene locus_tag LOCUS_17800 gene pmrB 1908043 1909122 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704800.1 protein_id gnl|my_center|LOCUS_17800 1911449 1909428 gene locus_tag LOCUS_17810 gene uvrB 1911449 1909428 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097496.1 protein_id gnl|my_center|LOCUS_17810 1912164 1912886 gene locus_tag LOCUS_17820 1912164 1912886 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097498.1 protein_id gnl|my_center|LOCUS_17820 1913550 1912828 gene locus_tag LOCUS_17830 gene bioD 1913550 1912828 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167219.1 protein_id gnl|my_center|LOCUS_17830 1914298 1913543 gene locus_tag LOCUS_17840 gene bioC 1914298 1913543 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246788.1 protein_id gnl|my_center|LOCUS_17840 1915439 1914282 gene locus_tag LOCUS_17850 gene bioF 1915439 1914282 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118943.1 protein_id gnl|my_center|LOCUS_17850 1916476 1915436 gene locus_tag LOCUS_17860 gene bioB 1916476 1915436 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951213.1 protein_id gnl|my_center|LOCUS_17860 1916553 1917842 gene locus_tag LOCUS_17870 gene bioA 1916553 1917842 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205503.1 protein_id gnl|my_center|LOCUS_17870 1917910 1918590 gene locus_tag LOCUS_17880 1917910 1918590 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054996466.1 protein_id gnl|my_center|LOCUS_17880 1918602 1919078 gene locus_tag LOCUS_17890 1918602 1919078 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767403.1 protein_id gnl|my_center|LOCUS_17890 1919191 1920474 gene locus_tag LOCUS_17900 1919191 1920474 CDS product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097510.1 protein_id gnl|my_center|LOCUS_17900 1921511 1920516 gene locus_tag LOCUS_17910 gene pgl 1921511 1920516 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815470.1 protein_id gnl|my_center|LOCUS_17910 1921661 1921873 gene locus_tag LOCUS_17920 1921661 1921873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1921990 1922826 gene locus_tag LOCUS_17930 1921990 1922826 CDS product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989132.1 protein_id gnl|my_center|LOCUS_17930 1923210 1922884 gene locus_tag LOCUS_17940 1923210 1922884 CDS product DUF1493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211097.1 protein_id gnl|my_center|LOCUS_17940 1923668 1923204 gene locus_tag LOCUS_17950 1923668 1923204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133086100.1 protein_id gnl|my_center|LOCUS_17950 1925102 1924044 gene locus_tag LOCUS_17960 gene modC 1925102 1924044 CDS product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891721.1 protein_id gnl|my_center|LOCUS_17960 1925795 1925106 gene locus_tag LOCUS_17970 gene modB 1925795 1925106 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604034.1 protein_id gnl|my_center|LOCUS_17970 1926568 1925795 gene locus_tag LOCUS_17980 gene modA 1926568 1925795 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704779.1 protein_id gnl|my_center|LOCUS_17980 1926888 1926736 gene locus_tag LOCUS_17990 gene acrZ 1926888 1926736 CDS product multidrug efflux pump accessory protein AcrZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891515.1 protein_id gnl|my_center|LOCUS_17990 1927019 1927807 gene locus_tag LOCUS_18000 gene modE 1927019 1927807 CDS product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097517.1 protein_id gnl|my_center|LOCUS_18000 1927874 1928662 gene locus_tag LOCUS_18010 1927874 1928662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18010 1928610 1929335 gene locus_tag LOCUS_18020 1928610 1929335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18020 1929554 1930570 gene locus_tag LOCUS_18030 gene galE 1929554 1930570 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622345.1 protein_id gnl|my_center|LOCUS_18030 1930581 1931627 gene locus_tag LOCUS_18040 gene galT 1930581 1931627 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191531.1 protein_id gnl|my_center|LOCUS_18040 1931630 1932778 gene locus_tag LOCUS_18050 gene galK 1931630 1932778 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 protein_id gnl|my_center|LOCUS_18050 1932772 1933812 gene locus_tag LOCUS_18060 gene galM 1932772 1933812 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097522.1 protein_id gnl|my_center|LOCUS_18060 1934020 1934772 gene locus_tag LOCUS_18070 gene gpmA 1934020 1934772 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367652.1 protein_id gnl|my_center|LOCUS_18070 1935886 1934834 gene locus_tag LOCUS_18080 gene aroG 1935886 1934834 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097523.1 protein_id gnl|my_center|LOCUS_18080 1936205 1936648 gene locus_tag LOCUS_18090 1936205 1936648 CDS product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784348.1 protein_id gnl|my_center|LOCUS_18090 1936862 1937710 gene locus_tag LOCUS_18100 gene zitB 1936862 1937710 CDS product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 protein_id gnl|my_center|LOCUS_18100 1938426 1937707 gene locus_tag LOCUS_18110 gene pnuC 1938426 1937707 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367656.1 protein_id gnl|my_center|LOCUS_18110 1939506 1938463 gene locus_tag LOCUS_18120 gene nadA 1939506 1938463 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097527.1 protein_id gnl|my_center|LOCUS_18120 1939578 1939730 gene locus_tag LOCUS_18130 1939578 1939730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1939941 1939866 gene locus_tag LOCUS_t00240 1939941 1939866 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1940049 1939974 gene locus_tag LOCUS_t00250 1940049 1939974 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1940268 1940193 gene locus_tag LOCUS_t00260 1940268 1940193 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1940331 1940712 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1940814 1940739 gene locus_tag LOCUS_t00270 1940814 1940739 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1941015 1940940 gene locus_tag LOCUS_t00280 1941015 1940940 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1941967 1941179 gene locus_tag LOCUS_18140 gene cpoB 1941967 1941179 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097569.1 protein_id gnl|my_center|LOCUS_18140 1942498 1941977 gene locus_tag LOCUS_18150 gene pal 1942498 1941977 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006177214.1 protein_id gnl|my_center|LOCUS_18150 1943828 1942533 gene locus_tag LOCUS_18160 gene tolB 1943828 1942533 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989131.1 protein_id gnl|my_center|LOCUS_18160 1945192 1943948 gene locus_tag LOCUS_18170 1945192 1943948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1945725 1945288 gene locus_tag LOCUS_18180 gene tolR 1945725 1945288 CDS product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858589.1 protein_id gnl|my_center|LOCUS_18180 1946412 1945729 gene locus_tag LOCUS_18190 gene tolQ 1946412 1945729 CDS product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 protein_id gnl|my_center|LOCUS_18190 1946822 1946418 gene locus_tag LOCUS_18200 gene ybgC 1946822 1946418 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859689.1 protein_id gnl|my_center|LOCUS_18200 1947261 1946971 gene locus_tag LOCUS_18210 gene ybgE 1947261 1946971 CDS product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097534.1 protein_id gnl|my_center|LOCUS_18210 1948528 1947389 gene locus_tag LOCUS_18220 gene cydB 1948528 1947389 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568258.1 protein_id gnl|my_center|LOCUS_18220 1950142 1948544 gene locus_tag LOCUS_18230 gene cydA 1950142 1948544 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 protein_id gnl|my_center|LOCUS_18230 1951778 1950909 gene locus_tag LOCUS_18240 gene sucD 1951778 1950909 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501094.1 protein_id gnl|my_center|LOCUS_18240 1952944 1951778 gene locus_tag LOCUS_18250 gene sucC 1952944 1951778 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367670.1 protein_id gnl|my_center|LOCUS_18250 1954256 1953036 gene locus_tag LOCUS_18260 gene odhB 1954256 1953036 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099823.1 protein_id gnl|my_center|LOCUS_18260 1957429 1954271 gene locus_tag LOCUS_18270 1957429 1954271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1955440 1955734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1958515 1957799 gene locus_tag LOCUS_18280 gene sdhB 1958515 1957799 CDS product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976880.1 protein_id gnl|my_center|LOCUS_18280 1960240 1958531 gene locus_tag LOCUS_18290 gene sdhA 1960240 1958531 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775540.1 protein_id gnl|my_center|LOCUS_18290 1960644 1960297 gene locus_tag LOCUS_18300 gene sdhD 1960644 1960297 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254356.1 protein_id gnl|my_center|LOCUS_18300 1961042 1960638 gene locus_tag LOCUS_18310 gene sdhC 1961042 1960638 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263355.1 protein_id gnl|my_center|LOCUS_18310 1961680 1962966 gene locus_tag LOCUS_18320 gene gltA 1961680 1962966 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367676.1 protein_id gnl|my_center|LOCUS_18320 1963820 1963089 gene locus_tag LOCUS_18330 gene nei 1963820 1963089 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097546.1 protein_id gnl|my_center|LOCUS_18330 1964573 1963836 gene locus_tag LOCUS_18340 gene pxpA 1964573 1963836 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017910.1 protein_id gnl|my_center|LOCUS_18340 1965495 1964563 gene locus_tag LOCUS_18350 gene pxpC 1965495 1964563 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912719.1 protein_id gnl|my_center|LOCUS_18350 1966145 1965489 gene locus_tag LOCUS_18360 gene pxpB 1966145 1965489 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097549.1 protein_id gnl|my_center|LOCUS_18360 1967390 1966266 gene locus_tag LOCUS_18370 1967390 1966266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1968701 1967559 gene locus_tag LOCUS_18380 1968701 1967559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1968906 1968721 gene locus_tag LOCUS_18390 1968906 1968721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1969421 1968852 gene locus_tag LOCUS_18400 1969421 1968852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18400 1970418 1969669 gene locus_tag LOCUS_18410 1970418 1969669 CDS product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621132.1 protein_id gnl|my_center|LOCUS_18410 1971846 1970428 gene locus_tag LOCUS_18420 gene phrB 1971846 1970428 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097551.1 protein_id gnl|my_center|LOCUS_18420 1972209 1972003 gene locus_tag LOCUS_18430 1972209 1972003 CDS product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097552.1 protein_id gnl|my_center|LOCUS_18430 1972640 1974319 gene locus_tag LOCUS_18440 gene kdpA 1972640 1974319 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097553.1 protein_id gnl|my_center|LOCUS_18440 1974338 1976386 gene locus_tag LOCUS_18450 gene kdpB 1974338 1976386 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883015.1 protein_id gnl|my_center|LOCUS_18450 1976399 1976974 gene locus_tag LOCUS_18460 gene kdpC 1976399 1976974 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602229.1 protein_id gnl|my_center|LOCUS_18460 1976978 1979665 gene locus_tag LOCUS_18470 gene kdpD 1976978 1979665 CDS product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704755.1 protein_id gnl|my_center|LOCUS_18470 1979662 1980339 gene locus_tag LOCUS_18480 gene kdpE 1979662 1980339 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097557.1 protein_id gnl|my_center|LOCUS_18480 1981355 1980345 gene locus_tag LOCUS_18490 1981355 1980345 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388137.1 protein_id gnl|my_center|LOCUS_18490 1981441 1981986 gene locus_tag LOCUS_18500 1981441 1981986 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_18500 1982505 1982230 gene locus_tag LOCUS_18510 1982505 1982230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171592.1 protein_id gnl|my_center|LOCUS_18510 1982670 1984868 gene locus_tag LOCUS_18520 gene speF 1982670 1984868 CDS product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082898.1 protein_id gnl|my_center|LOCUS_18520 1984865 1986184 gene locus_tag LOCUS_18530 gene potE 1984865 1986184 CDS product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075831.1 protein_id gnl|my_center|LOCUS_18530 1988042 1986402 gene locus_tag LOCUS_18540 gene pgm 1988042 1986402 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367693.1 protein_id gnl|my_center|LOCUS_18540 1988615 1988067 gene locus_tag LOCUS_18550 gene seqA 1988615 1988067 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367694.1 protein_id gnl|my_center|LOCUS_18550 1988797 1989570 gene locus_tag LOCUS_18560 gene ybfF 1988797 1989570 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773280.1 protein_id gnl|my_center|LOCUS_18560 1989702 1989995 gene locus_tag LOCUS_18570 gene ybfE 1989702 1989995 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602226.1 protein_id gnl|my_center|LOCUS_18570 1990145 1990675 gene locus_tag LOCUS_18580 gene fldA 1990145 1990675 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 protein_id gnl|my_center|LOCUS_18580 1990966 1991418 gene locus_tag LOCUS_18590 gene fur 1990966 1991418 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428651.1 protein_id gnl|my_center|LOCUS_18590 1993206 1991539 gene locus_tag LOCUS_18600 gene glnS 1993206 1991539 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097566.1 protein_id gnl|my_center|LOCUS_18600 1993962 1993387 gene locus_tag LOCUS_18610 1993962 1993387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1993974 1994967 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1995311 1996186 gene locus_tag LOCUS_18620 gene nagB 1995311 1996186 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367707.1 protein_id gnl|my_center|LOCUS_18620 1996174 1997322 gene locus_tag LOCUS_18630 gene nagA 1996174 1997322 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097569.1 protein_id gnl|my_center|LOCUS_18630 1997332 1998552 gene locus_tag LOCUS_18640 1997332 1998552 CDS product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 protein_id gnl|my_center|LOCUS_18640 1998596 1999348 gene locus_tag LOCUS_18650 1998596 1999348 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367710.1 protein_id gnl|my_center|LOCUS_18650 1999628 2001292 gene locus_tag LOCUS_18660 gene asnB 1999628 2001292 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704746.1 protein_id gnl|my_center|LOCUS_18660 2001520 2001596 gene locus_tag LOCUS_t00290 2001520 2001596 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2001605 2001689 gene locus_tag LOCUS_t00300 2001605 2001689 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2001712 2001786 gene locus_tag LOCUS_t00310 2001712 2001786 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2001820 2001894 gene locus_tag LOCUS_t00320 2001820 2001894 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2001911 2001987 gene locus_tag LOCUS_t00330 2001911 2001987 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2002035 2002109 gene locus_tag LOCUS_t00340 2002035 2002109 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2002143 2002217 gene locus_tag LOCUS_t00350 2002143 2002217 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2003484 2002309 gene locus_tag LOCUS_18670 gene ubiF 2003484 2002309 CDS product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097573.1 protein_id gnl|my_center|LOCUS_18670 2003642 2003869 gene locus_tag LOCUS_18680 2003642 2003869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18680 2003890 2005065 gene locus_tag LOCUS_18690 gene miaB 2003890 2005065 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162740.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18690 2005227 2006279 gene locus_tag LOCUS_18700 2005227 2006279 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018040.1 protein_id gnl|my_center|LOCUS_18700 2006276 2006743 gene locus_tag LOCUS_18710 gene ybeY 2006276 2006743 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858677.1 protein_id gnl|my_center|LOCUS_18710 2006846 2007724 gene locus_tag LOCUS_18720 gene corC 2006846 2007724 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278615.1 protein_id gnl|my_center|LOCUS_18720 2007730 2009268 gene locus_tag LOCUS_18730 gene lnt 2007730 2009268 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097577.1 protein_id gnl|my_center|LOCUS_18730 2009612 2010520 gene locus_tag LOCUS_18740 2009612 2010520 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883004.1 protein_id gnl|my_center|LOCUS_18740 2010677 2011417 gene locus_tag LOCUS_18750 gene gltJ 2010677 2011417 CDS product glutamate/aspartate ABC transporter permease GltJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020930.1 protein_id gnl|my_center|LOCUS_18750 2011417 2012091 gene locus_tag LOCUS_18760 gene gltK 2011417 2012091 CDS product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272799.1 protein_id gnl|my_center|LOCUS_18760 2012091 2012816 gene locus_tag LOCUS_18770 2012091 2012816 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097581.1 protein_id gnl|my_center|LOCUS_18770 2013349 2012867 gene locus_tag LOCUS_18780 2013349 2012867 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 protein_id gnl|my_center|LOCUS_18780 2013575 2016157 gene locus_tag LOCUS_18790 gene leuS 2013575 2016157 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157907.1 protein_id gnl|my_center|LOCUS_18790 2016172 2016720 gene locus_tag LOCUS_18800 gene lptE 2016172 2016720 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704738.1 protein_id gnl|my_center|LOCUS_18800 2016720 2017751 gene locus_tag LOCUS_18810 gene holA 2016720 2017751 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620491.1 protein_id gnl|my_center|LOCUS_18810 2017753 2018394 gene locus_tag LOCUS_18820 gene nadD 2017753 2018394 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989126.1 protein_id gnl|my_center|LOCUS_18820 2019460 2018369 gene locus_tag LOCUS_18830 gene cobD 2019460 2018369 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_18830 2019559 2020170 gene locus_tag LOCUS_18840 2019559 2020170 CDS product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241920.1 protein_id gnl|my_center|LOCUS_18840 2020411 2020728 gene locus_tag LOCUS_18850 gene rsfS 2020411 2020728 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894623.1 protein_id gnl|my_center|LOCUS_18850 2020732 2021199 gene locus_tag LOCUS_18860 gene rlmH 2020732 2021199 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858701.1 protein_id gnl|my_center|LOCUS_18860 2021226 2023127 gene locus_tag LOCUS_18870 gene mrdA 2021226 2023127 CDS product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097589.1 protein_id gnl|my_center|LOCUS_18870 2023129 2024241 gene locus_tag LOCUS_18880 gene mrdB 2023129 2024241 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097590.1 protein_id gnl|my_center|LOCUS_18880 2024333 2025430 gene locus_tag LOCUS_18890 gene rlpA 2024333 2025430 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549517.1 protein_id gnl|my_center|LOCUS_18890 2025568 2026779 gene locus_tag LOCUS_18900 gene dacA 2025568 2026779 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097592.1 protein_id gnl|my_center|LOCUS_18900 2026883 2027146 gene locus_tag LOCUS_18910 gene ybeD 2026883 2027146 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858718.1 protein_id gnl|my_center|LOCUS_18910 2027233 2027874 gene locus_tag LOCUS_18920 gene lipB 2027233 2027874 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284027.1 protein_id gnl|my_center|LOCUS_18920 2028175 2029128 gene locus_tag LOCUS_18930 2028175 2029128 CDS product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282817.1 protein_id gnl|my_center|LOCUS_18930 2029338 2030303 gene locus_tag LOCUS_18940 gene lipA 2029338 2030303 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042632.1 protein_id gnl|my_center|LOCUS_18940 2030585 2030382 gene locus_tag LOCUS_18950 gene tatE 2030585 2030382 CDS product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503931.1 protein_id gnl|my_center|LOCUS_18950 2031501 2030713 gene locus_tag LOCUS_18960 2031501 2030713 CDS product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959109.1 protein_id gnl|my_center|LOCUS_18960 2031591 2031974 gene locus_tag LOCUS_18970 gene crcB 2031591 2031974 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939753.1 protein_id gnl|my_center|LOCUS_18970 2032239 2032030 gene locus_tag LOCUS_18980 gene cspE 2032239 2032030 CDS product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542460.1 protein_id gnl|my_center|LOCUS_18980 2035565 2032446 gene locus_tag LOCUS_18990 2035565 2032446 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817193.1 protein_id gnl|my_center|LOCUS_18990 2036998 2035562 gene locus_tag LOCUS_19000 2036998 2035562 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 protein_id gnl|my_center|LOCUS_19000 2038251 2036995 gene locus_tag LOCUS_19010 2038251 2036995 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817191.1 protein_id gnl|my_center|LOCUS_19010 2038597 2038262 gene locus_tag LOCUS_19020 2038597 2038262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2039005 2038652 gene locus_tag LOCUS_19030 2039005 2038652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817189.1 protein_id gnl|my_center|LOCUS_19030 2039375 2040748 gene locus_tag LOCUS_19040 gene dcuC 2039375 2040748 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958619.1 protein_id gnl|my_center|LOCUS_19040 2040844 2041903 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2043227 2041962 gene locus_tag LOCUS_19050 2043227 2041962 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646123.1 protein_id gnl|my_center|LOCUS_19050 2043460 2043894 gene locus_tag LOCUS_19060 gene uspG 2043460 2043894 CDS product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278509.1 protein_id gnl|my_center|LOCUS_19060 2045565 2044000 gene locus_tag LOCUS_19070 gene ahpF 2045565 2044000 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979839.1 protein_id gnl|my_center|LOCUS_19070 2046377 2045814 gene locus_tag LOCUS_19080 gene ahpC 2046377 2045814 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052802.1 protein_id gnl|my_center|LOCUS_19080 2046767 2047510 gene locus_tag LOCUS_19090 gene dsbG 2046767 2047510 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301891.1 protein_id gnl|my_center|LOCUS_19090 2047907 2049130 gene locus_tag LOCUS_19100 2047907 2049130 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118148.1 protein_id gnl|my_center|LOCUS_19100 2049115 2049741 gene locus_tag LOCUS_19110 2049115 2049741 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097610.1 protein_id gnl|my_center|LOCUS_19110 2049864 2049742 gene locus_tag LOCUS_19120 2049864 2049742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2049975 2050299 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2050452 2051195 gene locus_tag LOCUS_19130 2050452 2051195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2051359 2051973 gene locus_tag LOCUS_19140 2051359 2051973 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704721.1 protein_id gnl|my_center|LOCUS_19140 2051970 2052659 gene locus_tag LOCUS_19150 gene mtnC 2051970 2052659 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097613.1 protein_id gnl|my_center|LOCUS_19150 2052656 2053198 gene locus_tag LOCUS_19160 2052656 2053198 CDS product 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097614.1 protein_id gnl|my_center|LOCUS_19160 2053492 2053809 gene locus_tag LOCUS_19170 2053492 2053809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19170 2055113 2053839 gene locus_tag LOCUS_19180 2055113 2053839 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532883.1 protein_id gnl|my_center|LOCUS_19180 2056534 2055110 gene locus_tag LOCUS_19190 2056534 2055110 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762889.1 protein_id gnl|my_center|LOCUS_19190 2056703 2057626 gene locus_tag LOCUS_19200 2056703 2057626 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532831.1 protein_id gnl|my_center|LOCUS_19200 2058645 2057623 gene locus_tag LOCUS_19210 gene mtnA 2058645 2057623 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097616.1 protein_id gnl|my_center|LOCUS_19210 2058751 2059950 gene locus_tag LOCUS_19220 gene mtnK 2058751 2059950 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097617.1 protein_id gnl|my_center|LOCUS_19220 2061319 2060075 gene locus_tag LOCUS_19230 2061319 2060075 CDS product LVIVD repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097619.1 protein_id gnl|my_center|LOCUS_19230 2062432 2061368 gene locus_tag LOCUS_19240 2062432 2061368 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097620.1 protein_id gnl|my_center|LOCUS_19240 2063446 2062451 gene locus_tag LOCUS_19250 2063446 2062451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097621.1 protein_id gnl|my_center|LOCUS_19250 2064393 2063443 gene locus_tag LOCUS_19260 2064393 2063443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19260 2064944 2064450 gene locus_tag LOCUS_19270 2064944 2064450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19270 2065107 2066195 gene locus_tag LOCUS_19280 2065107 2066195 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097623.1 protein_id gnl|my_center|LOCUS_19280 2066520 2066672 gene locus_tag LOCUS_19290 2066520 2066672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2066946 2066749 gene locus_tag LOCUS_19300 2066946 2066749 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893903.1 protein_id gnl|my_center|LOCUS_19300 2069100 2066995 gene locus_tag LOCUS_19310 gene cstA 2069100 2066995 CDS product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043134.1 protein_id gnl|my_center|LOCUS_19310 2069838 2069425 gene locus_tag LOCUS_19320 gene entH 2069838 2069425 CDS product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637966.1 protein_id gnl|my_center|LOCUS_19320 2070585 2069839 gene locus_tag LOCUS_19330 gene entA 2070585 2069839 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097631.1 protein_id gnl|my_center|LOCUS_19330 2071445 2070585 gene locus_tag LOCUS_19340 gene entB 2071445 2070585 CDS product enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007142.1 protein_id gnl|my_center|LOCUS_19340 2071610 2071458 gene locus_tag LOCUS_19350 2071610 2071458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 2071625 2071975 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2074636 2073461 gene locus_tag LOCUS_19360 gene entC 2074636 2073461 CDS product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097634.1 protein_id gnl|my_center|LOCUS_19360 2074856 2075776 gene locus_tag LOCUS_19370 gene fepB 2074856 2075776 CDS product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234314.1 protein_id gnl|my_center|LOCUS_19370 2077092 2075866 gene locus_tag LOCUS_19380 gene entS 2077092 2075866 CDS product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041788.1 protein_id gnl|my_center|LOCUS_19380 2077203 2078207 gene locus_tag LOCUS_19390 gene fepD 2077203 2078207 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704708.1 protein_id gnl|my_center|LOCUS_19390 2078204 2079196 gene locus_tag LOCUS_19400 gene fepG 2078204 2079196 CDS product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640959.1 protein_id gnl|my_center|LOCUS_19400 2079193 2079993 gene locus_tag LOCUS_19410 gene fepC 2079193 2079993 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367776.1 protein_id gnl|my_center|LOCUS_19410 2080631 2080068 gene locus_tag LOCUS_19420 2080631 2080068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2080732 2081054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2083956 2083204 gene locus_tag LOCUS_19430 2083956 2083204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19430 2084255 2083956 gene locus_tag LOCUS_19440 2084255 2083956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19440 2084469 2084266 gene locus_tag LOCUS_19450 2084469 2084266 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396011.1 protein_id gnl|my_center|LOCUS_19450 2085830 2084493 gene locus_tag LOCUS_19460 gene fes 2085830 2084493 CDS product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097642.1 protein_id gnl|my_center|LOCUS_19460 2087094 2087445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2088628 2089290 gene locus_tag LOCUS_19470 gene entD 2088628 2089290 CDS product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681620.1 protein_id gnl|my_center|LOCUS_19470 2089408 2090349 gene locus_tag LOCUS_19480 2089408 2090349 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209434.1 protein_id gnl|my_center|LOCUS_19480 2090363 2090971 gene locus_tag LOCUS_19490 2090363 2090971 CDS product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209435.1 protein_id gnl|my_center|LOCUS_19490 2090971 2092497 gene locus_tag LOCUS_19500 2090971 2092497 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167401.1 protein_id gnl|my_center|LOCUS_19500 2092499 2093587 gene locus_tag LOCUS_19510 2092499 2093587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815639.1 protein_id gnl|my_center|LOCUS_19510 2094642 2093626 gene locus_tag LOCUS_19520 2094642 2093626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2096037 2094703 gene locus_tag LOCUS_19530 2096037 2094703 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_19530 2097403 2096018 gene locus_tag LOCUS_19540 2097403 2096018 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357550.1 protein_id gnl|my_center|LOCUS_19540 2098517 2097567 gene locus_tag LOCUS_19550 2098517 2097567 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367784.1 protein_id gnl|my_center|LOCUS_19550 2098831 2099661 gene locus_tag LOCUS_19560 2098831 2099661 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209438.1 protein_id gnl|my_center|LOCUS_19560 2099654 2100601 gene locus_tag LOCUS_19570 2099654 2100601 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704703.1 protein_id gnl|my_center|LOCUS_19570 2100637 2102055 gene locus_tag LOCUS_19580 2100637 2102055 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167413.1 protein_id gnl|my_center|LOCUS_19580 2102088 2103596 gene locus_tag LOCUS_19590 2102088 2103596 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704701.1 protein_id gnl|my_center|LOCUS_19590 2104204 2105772 gene locus_tag LOCUS_19600 2104204 2105772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592279.1 protein_id gnl|my_center|LOCUS_19600 2105871 2106893 gene locus_tag LOCUS_19610 2105871 2106893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640254.1 protein_id gnl|my_center|LOCUS_19610 2106893 2107726 gene locus_tag LOCUS_19620 2106893 2107726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131974.1 protein_id gnl|my_center|LOCUS_19620 2107719 2108555 gene locus_tag LOCUS_19630 2107719 2108555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132443.1 protein_id gnl|my_center|LOCUS_19630 2108542 2109246 gene locus_tag LOCUS_19640 2108542 2109246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156927.1 protein_id gnl|my_center|LOCUS_19640 2109256 2109606 gene locus_tag LOCUS_19650 2109256 2109606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2109626 2109904 gene locus_tag LOCUS_19660 2109626 2109904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2110047 2110625 gene locus_tag LOCUS_19670 2110047 2110625 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972227.1 protein_id gnl|my_center|LOCUS_19670 2110703 2111575 gene locus_tag LOCUS_19680 2110703 2111575 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729398.1 protein_id gnl|my_center|LOCUS_19680 2111770 2112216 gene locus_tag LOCUS_19690 2111770 2112216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2113013 2112429 gene locus_tag LOCUS_19700 2113013 2112429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2113248 2114018 gene locus_tag LOCUS_19710 2113248 2114018 CDS product DUF4225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703217.1 protein_id gnl|my_center|LOCUS_19710 2114363 2114022 gene locus_tag LOCUS_19720 2114363 2114022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052332699.1 protein_id gnl|my_center|LOCUS_19720 2114760 2114488 gene locus_tag LOCUS_19730 2114760 2114488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2114893 2115210 gene locus_tag LOCUS_19740 2114893 2115210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence02 845 87 gene locus_tag LOCUS_19750 845 87 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099005.1 protein_id gnl|my_center|LOCUS_19750 1956 853 gene locus_tag LOCUS_19760 1956 853 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298587.1 protein_id gnl|my_center|LOCUS_19760 3147 1966 gene locus_tag LOCUS_19770 3147 1966 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019655.1 protein_id gnl|my_center|LOCUS_19770 4244 3219 gene locus_tag LOCUS_19780 4244 3219 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 protein_id gnl|my_center|LOCUS_19780 4936 4715 gene locus_tag LOCUS_19790 4936 4715 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 protein_id gnl|my_center|LOCUS_19790 7288 5213 gene locus_tag LOCUS_19800 7288 5213 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098998.1 protein_id gnl|my_center|LOCUS_19800 7593 7429 gene locus_tag LOCUS_19810 7593 7429 CDS product DUF2556 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098997.1 protein_id gnl|my_center|LOCUS_19810 7948 9171 gene locus_tag LOCUS_19820 7948 9171 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085257.1 protein_id gnl|my_center|LOCUS_19820 9168 9965 gene locus_tag LOCUS_19830 9168 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 10066 10275 gene locus_tag LOCUS_19840 10066 10275 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953272.1 protein_id gnl|my_center|LOCUS_19840 10890 10705 gene locus_tag LOCUS_19850 10890 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 11084 11284 gene locus_tag LOCUS_19860 11084 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 11281 11478 gene locus_tag LOCUS_19870 11281 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 11471 11782 gene locus_tag LOCUS_19880 11471 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 11779 12147 gene locus_tag LOCUS_19890 11779 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 12144 13511 gene locus_tag LOCUS_19900 12144 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 13726 13965 gene locus_tag LOCUS_19910 13726 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 14398 14003 gene locus_tag LOCUS_19920 14398 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 14833 14531 gene locus_tag LOCUS_19930 14833 14531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 15243 14839 gene locus_tag LOCUS_19940 15243 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 15474 16640 gene locus_tag LOCUS_19950 15474 16640 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137336.1 protein_id gnl|my_center|LOCUS_19950 16693 17253 gene locus_tag LOCUS_19960 16693 17253 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504050.1 protein_id gnl|my_center|LOCUS_19960 17255 18481 gene locus_tag LOCUS_19970 17255 18481 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267612.1 protein_id gnl|my_center|LOCUS_19970 18478 18816 gene locus_tag LOCUS_19980 18478 18816 CDS product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201245.1 protein_id gnl|my_center|LOCUS_19980 18813 19106 gene locus_tag LOCUS_19990 18813 19106 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123184.1 protein_id gnl|my_center|LOCUS_19990 19106 19549 gene locus_tag LOCUS_20000 19106 19549 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145903.1 protein_id gnl|my_center|LOCUS_20000 19542 19694 gene locus_tag LOCUS_20010 19542 19694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 19676 19840 gene locus_tag LOCUS_20020 19676 19840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 19824 20180 gene locus_tag LOCUS_20030 19824 20180 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113645.1 protein_id gnl|my_center|LOCUS_20030 20164 21825 gene locus_tag LOCUS_20040 20164 21825 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127900.1 protein_id gnl|my_center|LOCUS_20040 22863 21913 gene locus_tag LOCUS_20050 22863 21913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 23228 22914 gene locus_tag LOCUS_20060 23228 22914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 23716 23420 gene locus_tag LOCUS_20070 gene fis 23716 23420 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 protein_id gnl|my_center|LOCUS_20070 24658 23741 gene locus_tag LOCUS_20080 gene dusB 24658 23741 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369451.1 protein_id gnl|my_center|LOCUS_20080 25947 25066 gene locus_tag LOCUS_20090 gene prmA 25947 25066 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145812.1 protein_id gnl|my_center|LOCUS_20090 27407 25962 gene locus_tag LOCUS_20100 gene panF 27407 25962 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175714.1 protein_id gnl|my_center|LOCUS_20100 27639 27397 gene locus_tag LOCUS_20110 27639 27397 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 protein_id gnl|my_center|LOCUS_20110 29097 27748 gene locus_tag LOCUS_20120 gene accC 29097 27748 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369455.1 protein_id gnl|my_center|LOCUS_20120 29578 29108 gene locus_tag LOCUS_20130 gene accB 29578 29108 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354626.1 protein_id gnl|my_center|LOCUS_20130 30680 30081 gene locus_tag LOCUS_20140 gene msrQ 30680 30081 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703627.1 protein_id gnl|my_center|LOCUS_20140 31676 30681 gene locus_tag LOCUS_20150 gene msrP 31676 30681 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098989.1 protein_id gnl|my_center|LOCUS_20150 31959 33899 gene locus_tag LOCUS_20160 gene csrD 31959 33899 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098987.1 protein_id gnl|my_center|LOCUS_20160 34206 35249 gene locus_tag LOCUS_20170 gene mreB 34206 35249 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 protein_id gnl|my_center|LOCUS_20170 35314 36312 gene locus_tag LOCUS_20180 gene mreC 35314 36312 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098986.1 protein_id gnl|my_center|LOCUS_20180 36312 36800 gene locus_tag LOCUS_20190 gene mreD 36312 36800 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098985.1 protein_id gnl|my_center|LOCUS_20190 36808 37401 gene locus_tag LOCUS_20200 gene yhdE 36808 37401 CDS product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203096.1 protein_id gnl|my_center|LOCUS_20200 37391 38860 gene locus_tag LOCUS_20210 gene rng 37391 38860 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123188.1 protein_id gnl|my_center|LOCUS_20210 38897 42706 gene locus_tag LOCUS_20220 gene yhdP 38897 42706 CDS product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098981.1 protein_id gnl|my_center|LOCUS_20220 42791 44236 gene locus_tag LOCUS_20230 gene tldD 42791 44236 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098980.1 protein_id gnl|my_center|LOCUS_20230 45245 44322 gene locus_tag LOCUS_20240 gene aaeR 45245 44322 CDS product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098979.1 protein_id gnl|my_center|LOCUS_20240 45426 45629 gene locus_tag LOCUS_20250 45426 45629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 45637 46569 gene locus_tag LOCUS_20260 gene aaeA 45637 46569 CDS product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098978.1 protein_id gnl|my_center|LOCUS_20260 46575 48545 gene locus_tag LOCUS_20270 gene aaeB 46575 48545 CDS product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098977.1 protein_id gnl|my_center|LOCUS_20270 48627 50081 gene locus_tag LOCUS_20280 48627 50081 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098976.1 protein_id gnl|my_center|LOCUS_20280 50127 50393 gene locus_tag LOCUS_20290 50127 50393 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098975.1 protein_id gnl|my_center|LOCUS_20290 50718 50455 gene locus_tag LOCUS_20300 gene yhcN 50718 50455 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098974.1 protein_id gnl|my_center|LOCUS_20300 51079 50816 gene locus_tag LOCUS_20310 gene yhcN 51079 50816 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369473.1 protein_id gnl|my_center|LOCUS_20310 51899 51429 gene locus_tag LOCUS_20320 gene argR 51899 51429 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257847.1 protein_id gnl|my_center|LOCUS_20320 52307 53245 gene locus_tag LOCUS_20330 gene mdh 52307 53245 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295272.1 protein_id gnl|my_center|LOCUS_20330 54415 53348 gene locus_tag LOCUS_20340 gene degS 54415 53348 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497724.1 protein_id gnl|my_center|LOCUS_20340 55890 54520 gene locus_tag LOCUS_20350 gene degQ 55890 54520 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098969.1 protein_id gnl|my_center|LOCUS_20350 56454 56056 gene locus_tag LOCUS_20360 gene zapG 56454 56056 CDS product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481183.1 protein_id gnl|my_center|LOCUS_20360 56644 57768 gene locus_tag LOCUS_20370 gene zapE 56644 57768 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192323.1 protein_id gnl|my_center|LOCUS_20370 58033 58461 gene locus_tag LOCUS_20380 gene rplM 58033 58461 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_20380 58477 58869 gene locus_tag LOCUS_20390 gene rpsI 58477 58869 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 protein_id gnl|my_center|LOCUS_20390 59184 59822 gene locus_tag LOCUS_20400 gene sspA 59184 59822 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257300.1 protein_id gnl|my_center|LOCUS_20400 59827 60324 gene locus_tag LOCUS_20410 gene sspB 59827 60324 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369484.1 protein_id gnl|my_center|LOCUS_20410 61009 60359 gene locus_tag LOCUS_20420 61009 60359 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967752.1 protein_id gnl|my_center|LOCUS_20420 61175 61963 gene locus_tag LOCUS_20430 61175 61963 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843394.1 protein_id gnl|my_center|LOCUS_20430 61979 63130 gene locus_tag LOCUS_20440 61979 63130 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257480.1 protein_id gnl|my_center|LOCUS_20440 63140 63970 gene locus_tag LOCUS_20450 63140 63970 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085626.1 protein_id gnl|my_center|LOCUS_20450 64027 65250 gene locus_tag LOCUS_20460 64027 65250 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113027.1 protein_id gnl|my_center|LOCUS_20460 65262 67334 gene locus_tag LOCUS_20470 65262 67334 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080381.1 protein_id gnl|my_center|LOCUS_20470 68625 67372 gene locus_tag LOCUS_20480 68625 67372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 69530 68805 gene locus_tag LOCUS_20490 69530 68805 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095625.1 protein_id gnl|my_center|LOCUS_20490 72089 69561 gene locus_tag LOCUS_20500 gene lpfC 72089 69561 CDS product outer membrane usher protein LpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558680.1 protein_id gnl|my_center|LOCUS_20500 72854 72285 gene locus_tag LOCUS_20510 72854 72285 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521426.1 protein_id gnl|my_center|LOCUS_20510 73568 73017 gene locus_tag LOCUS_20520 73568 73017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 75673 74255 gene locus_tag LOCUS_20530 gene gltD 75673 74255 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081705.1 protein_id gnl|my_center|LOCUS_20530 80143 75683 gene locus_tag LOCUS_20540 gene gltB 80143 75683 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098958.1 protein_id gnl|my_center|LOCUS_20540 80776 81747 gene locus_tag LOCUS_20550 80776 81747 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299745.1 protein_id gnl|my_center|LOCUS_20550 82844 81783 gene locus_tag LOCUS_20560 82844 81783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824230.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20560 83068 82844 gene locus_tag LOCUS_20570 83068 82844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20570 84171 83155 gene locus_tag LOCUS_20580 84171 83155 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 protein_id gnl|my_center|LOCUS_20580 84430 86763 gene locus_tag LOCUS_20590 gene arcB 84430 86763 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809818.1 protein_id gnl|my_center|LOCUS_20590 86997 87650 gene locus_tag LOCUS_20600 gene elbB 86997 87650 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719819.1 protein_id gnl|my_center|LOCUS_20600 87647 88363 gene locus_tag LOCUS_20610 gene mtgA 87647 88363 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047087.1 protein_id gnl|my_center|LOCUS_20610 88505 89134 gene locus_tag LOCUS_20620 88505 89134 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703622.1 protein_id gnl|my_center|LOCUS_20620 89121 89786 gene locus_tag LOCUS_20630 89121 89786 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171579.1 protein_id gnl|my_center|LOCUS_20630 89976 91244 gene locus_tag LOCUS_20640 89976 91244 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 protein_id gnl|my_center|LOCUS_20640 91277 92176 gene locus_tag LOCUS_20650 gene ttdA 91277 92176 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 protein_id gnl|my_center|LOCUS_20650 92176 92793 gene locus_tag LOCUS_20660 gene ttdB 92176 92793 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703618.1 protein_id gnl|my_center|LOCUS_20660 92945 94216 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 94387 95085 gene locus_tag LOCUS_20670 94387 95085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703615.1 protein_id gnl|my_center|LOCUS_20670 95085 95933 gene locus_tag LOCUS_20680 95085 95933 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098684.1 protein_id gnl|my_center|LOCUS_20680 96244 95972 gene locus_tag LOCUS_20690 gene npr 96244 95972 CDS product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861872.1 protein_id gnl|my_center|LOCUS_20690 97095 96241 gene locus_tag LOCUS_20700 gene rapZ 97095 96241 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098945.1 protein_id gnl|my_center|LOCUS_20700 97629 97138 gene locus_tag LOCUS_20710 gene ptsN 97629 97138 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098944.1 protein_id gnl|my_center|LOCUS_20710 97997 97710 gene locus_tag LOCUS_20720 gene hpf 97997 97710 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176588.1 protein_id gnl|my_center|LOCUS_20720 99441 98020 gene locus_tag LOCUS_20730 gene rpoN 99441 98020 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809051.1 protein_id gnl|my_center|LOCUS_20730 100227 99502 gene locus_tag LOCUS_20740 gene lptB 100227 99502 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206203.1 protein_id gnl|my_center|LOCUS_20740 100791 100234 gene locus_tag LOCUS_20750 gene lptA 100791 100234 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 protein_id gnl|my_center|LOCUS_20750 101335 100760 gene locus_tag LOCUS_20760 gene lptC 101335 100760 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098939.1 protein_id gnl|my_center|LOCUS_20760 101898 101332 gene locus_tag LOCUS_20770 gene kdsC 101898 101332 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098938.1 protein_id gnl|my_center|LOCUS_20770 102899 101913 gene locus_tag LOCUS_20780 gene kdsD 102899 101913 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098937.1 protein_id gnl|my_center|LOCUS_20780 103890 102913 gene locus_tag LOCUS_20790 103890 102913 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922739.1 protein_id gnl|my_center|LOCUS_20790 104121 104933 gene locus_tag LOCUS_20800 gene mlaF 104121 104933 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098935.1 protein_id gnl|my_center|LOCUS_20800 104941 105723 gene locus_tag LOCUS_20810 gene mlaE 104941 105723 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925786.1 protein_id gnl|my_center|LOCUS_20810 105728 106279 gene locus_tag LOCUS_20820 gene mlaD 105728 106279 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193591.1 protein_id gnl|my_center|LOCUS_20820 106296 106931 gene locus_tag LOCUS_20830 gene mlaC 106296 106931 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476475.1 protein_id gnl|my_center|LOCUS_20830 106931 107224 gene locus_tag LOCUS_20840 gene mlaB 106931 107224 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098932.1 protein_id gnl|my_center|LOCUS_20840 107351 107605 gene locus_tag LOCUS_20850 gene ibaG 107351 107605 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501458.1 protein_id gnl|my_center|LOCUS_20850 107659 108918 gene locus_tag LOCUS_20860 gene murA 107659 108918 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369505.1 protein_id gnl|my_center|LOCUS_20860 109345 109073 gene locus_tag LOCUS_20870 gene sfsB 109345 109073 CDS product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098930.1 protein_id gnl|my_center|LOCUS_20870 110527 109556 gene locus_tag LOCUS_20880 gene ispB 110527 109556 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 protein_id gnl|my_center|LOCUS_20880 110786 111097 gene locus_tag LOCUS_20890 gene rplU 110786 111097 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271401.1 protein_id gnl|my_center|LOCUS_20890 111118 111375 gene locus_tag LOCUS_20900 gene rpmA 111118 111375 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 protein_id gnl|my_center|LOCUS_20900 111471 112436 gene locus_tag LOCUS_20910 111471 112436 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369509.1 protein_id gnl|my_center|LOCUS_20910 112452 113618 gene locus_tag LOCUS_20920 gene cgtA 112452 113618 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369510.1 protein_id gnl|my_center|LOCUS_20920 115085 113679 gene locus_tag LOCUS_20930 gene dacB 115085 113679 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212651.1 protein_id gnl|my_center|LOCUS_20930 115361 115837 gene locus_tag LOCUS_20940 gene greA 115361 115837 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369513.1 protein_id gnl|my_center|LOCUS_20940 116283 115990 gene locus_tag LOCUS_20950 gene yhbY 116283 115990 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 protein_id gnl|my_center|LOCUS_20950 116405 117031 gene locus_tag LOCUS_20960 gene rlmE 116405 117031 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861812.1 protein_id gnl|my_center|LOCUS_20960 117125 119065 gene locus_tag LOCUS_20970 gene ftsH 117125 119065 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369514.1 protein_id gnl|my_center|LOCUS_20970 119175 120023 gene locus_tag LOCUS_20980 gene folP 119175 120023 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764731.1 protein_id gnl|my_center|LOCUS_20980 120016 121353 gene locus_tag LOCUS_20990 gene glmM 120016 121353 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071134.1 protein_id gnl|my_center|LOCUS_20990 121574 121906 gene locus_tag LOCUS_21000 gene secG 121574 121906 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 protein_id gnl|my_center|LOCUS_21000 121918 122004 gene locus_tag LOCUS_t00360 121918 122004 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 123599 122256 gene locus_tag LOCUS_21010 gene argG 123599 122256 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207645.1 protein_id gnl|my_center|LOCUS_21010 123953 124029 gene locus_tag LOCUS_t00370 123953 124029 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 124267 124689 gene locus_tag LOCUS_21020 gene rimP 124267 124689 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833432.1 protein_id gnl|my_center|LOCUS_21020 124717 126204 gene locus_tag LOCUS_21030 gene nusA 124717 126204 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369524.1 protein_id gnl|my_center|LOCUS_21030 126229 128934 gene locus_tag LOCUS_21040 gene infB 126229 128934 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131175.1 protein_id gnl|my_center|LOCUS_21040 129089 129490 gene locus_tag LOCUS_21050 gene rbfA 129089 129490 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 protein_id gnl|my_center|LOCUS_21050 129490 130437 gene locus_tag LOCUS_21060 gene truB 129490 130437 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 protein_id gnl|my_center|LOCUS_21060 130582 130851 gene locus_tag LOCUS_21070 gene rpsO 130582 130851 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 protein_id gnl|my_center|LOCUS_21070 131094 133226 gene locus_tag LOCUS_21080 gene pnp 131094 133226 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098913.1 protein_id gnl|my_center|LOCUS_21080 133335 134219 gene locus_tag LOCUS_21090 gene nlpI 133335 134219 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 protein_id gnl|my_center|LOCUS_21090 134292 134790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 134870 136771 gene locus_tag LOCUS_21100 134870 136771 CDS product DEAD/DEAH family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815447.1 protein_id gnl|my_center|LOCUS_21100 136909 138153 gene locus_tag LOCUS_21110 gene mtr 136909 138153 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224390.1 protein_id gnl|my_center|LOCUS_21110 138252 139193 gene locus_tag LOCUS_21120 138252 139193 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099042.1 protein_id gnl|my_center|LOCUS_21120 139587 139156 gene locus_tag LOCUS_21130 139587 139156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 140402 139632 gene locus_tag LOCUS_21140 gene madM 140402 139632 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389085.1 protein_id gnl|my_center|LOCUS_21140 140802 140422 gene locus_tag LOCUS_21150 gene madL 140802 140422 CDS product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389084.1 protein_id gnl|my_center|LOCUS_21150 141341 141123 gene locus_tag LOCUS_21160 141341 141123 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389083.1 protein_id gnl|my_center|LOCUS_21160 142047 141361 gene locus_tag LOCUS_21170 142047 141361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 143147 142044 gene locus_tag LOCUS_21180 143147 142044 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389081.1 protein_id gnl|my_center|LOCUS_21180 144045 143164 gene locus_tag LOCUS_21190 gene mdcE 144045 143164 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389080.1 protein_id gnl|my_center|LOCUS_21190 144974 144045 gene locus_tag LOCUS_21200 144974 144045 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389079.1 protein_id gnl|my_center|LOCUS_21200 145299 144967 gene locus_tag LOCUS_21210 gene mdcC 145299 144967 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389078.1 protein_id gnl|my_center|LOCUS_21210 146978 145311 gene locus_tag LOCUS_21220 gene mdcA 146978 145311 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389077.1 protein_id gnl|my_center|LOCUS_21220 148199 146991 gene locus_tag LOCUS_21230 gene madB 148199 146991 CDS product Na+-transporting malonate decarboxylase, carboxybiotin decarboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389075.1 protein_id gnl|my_center|LOCUS_21230 148457 148236 gene locus_tag LOCUS_21240 148457 148236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 149245 148355 gene locus_tag LOCUS_21250 gene mdcB 149245 148355 CDS product triphosphoribosyl-dephospho-CoA synthase MdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389074.1 protein_id gnl|my_center|LOCUS_21250 150456 149449 gene locus_tag LOCUS_21260 150456 149449 CDS product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130380.1 protein_id gnl|my_center|LOCUS_21260 151415 150537 gene locus_tag LOCUS_21270 151415 150537 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098908.1 protein_id gnl|my_center|LOCUS_21270 152419 151424 gene locus_tag LOCUS_21280 152419 151424 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421305.1 protein_id gnl|my_center|LOCUS_21280 152660 153184 gene locus_tag LOCUS_21290 152660 153184 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884720.1 protein_id gnl|my_center|LOCUS_21290 153178 153681 gene locus_tag LOCUS_21300 153178 153681 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098905.1 protein_id gnl|my_center|LOCUS_21300 153970 153668 gene locus_tag LOCUS_21310 153970 153668 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369538.1 protein_id gnl|my_center|LOCUS_21310 154025 154462 gene locus_tag LOCUS_21320 154025 154462 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449041.1 protein_id gnl|my_center|LOCUS_21320 154966 154448 gene locus_tag LOCUS_21330 gene yhbO 154966 154448 CDS product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037608.1 protein_id gnl|my_center|LOCUS_21330 155086 155724 gene locus_tag LOCUS_21340 155086 155724 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084526.1 protein_id gnl|my_center|LOCUS_21340 155816 156865 gene locus_tag LOCUS_21350 155816 156865 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147632.1 protein_id gnl|my_center|LOCUS_21350 157488 156913 gene locus_tag LOCUS_21360 gene dolP 157488 156913 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643280.1 protein_id gnl|my_center|LOCUS_21360 158112 157498 gene locus_tag LOCUS_21370 gene diaA 158112 157498 CDS product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 protein_id gnl|my_center|LOCUS_21370 158504 158109 gene locus_tag LOCUS_21380 158504 158109 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246847.1 protein_id gnl|my_center|LOCUS_21380 160525 158462 gene locus_tag LOCUS_21390 160525 158462 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098897.1 protein_id gnl|my_center|LOCUS_21390 160619 161479 gene locus_tag LOCUS_21400 gene rsmI 160619 161479 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809258.1 protein_id gnl|my_center|LOCUS_21400 162248 161532 gene locus_tag LOCUS_21410 162248 161532 CDS product galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001377079.1 protein_id gnl|my_center|LOCUS_21410 163040 162249 gene locus_tag LOCUS_21420 gene agaD 163040 162249 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534351.1 protein_id gnl|my_center|LOCUS_21420 163833 163030 gene locus_tag LOCUS_21430 gene agaC 163833 163030 CDS product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544489.1 protein_id gnl|my_center|LOCUS_21430 164394 163879 gene locus_tag LOCUS_21440 gene agaB 164394 163879 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098022.1 protein_id gnl|my_center|LOCUS_21440 165314 164439 gene locus_tag LOCUS_21450 gene kbaY 165314 164439 CDS product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022773.1 protein_id gnl|my_center|LOCUS_21450 166476 165316 gene locus_tag LOCUS_21460 166476 165316 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098893.1 protein_id gnl|my_center|LOCUS_21460 167238 166804 gene locus_tag LOCUS_21470 gene agaF 167238 166804 CDS product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948824.1 protein_id gnl|my_center|LOCUS_21470 168596 167283 gene locus_tag LOCUS_21480 gene kbaZ 168596 167283 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024130977.1 protein_id gnl|my_center|LOCUS_21480 168812 169621 gene locus_tag LOCUS_21490 gene agaR 168812 169621 CDS product aga operon transcriptional regulator AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072187.1 protein_id gnl|my_center|LOCUS_21490 171263 169692 gene locus_tag LOCUS_21500 gene garD 171263 169692 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273776.1 protein_id gnl|my_center|LOCUS_21500 171683 173014 gene locus_tag LOCUS_21510 gene garP 171683 173014 CDS product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599651.1 protein_id gnl|my_center|LOCUS_21510 173044 173814 gene locus_tag LOCUS_21520 gene garL 173044 173814 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058209.1 protein_id gnl|my_center|LOCUS_21520 173847 174737 gene locus_tag LOCUS_21530 gene garR 173847 174737 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 protein_id gnl|my_center|LOCUS_21530 174848 175993 gene locus_tag LOCUS_21540 gene garK 174848 175993 CDS product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703577.1 protein_id gnl|my_center|LOCUS_21540 176827 176666 gene locus_tag LOCUS_21550 176827 176666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 177504 176854 gene locus_tag LOCUS_21560 177504 176854 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098873.1 protein_id gnl|my_center|LOCUS_21560 177662 178558 gene locus_tag LOCUS_21570 gene yhaJ 177662 178558 CDS product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041028.1 protein_id gnl|my_center|LOCUS_21570 178933 178568 gene locus_tag LOCUS_21580 178933 178568 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369567.1 protein_id gnl|my_center|LOCUS_21580 180034 179048 gene locus_tag LOCUS_21590 gene yqjG 180034 179048 CDS product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531205.1 protein_id gnl|my_center|LOCUS_21590 180491 180099 gene locus_tag LOCUS_21600 180491 180099 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732237.1 protein_id gnl|my_center|LOCUS_21600 181033 180734 gene locus_tag LOCUS_21610 181033 180734 CDS product YqjK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095496.1 protein_id gnl|my_center|LOCUS_21610 181367 181026 gene locus_tag LOCUS_21620 181367 181026 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785626.1 protein_id gnl|my_center|LOCUS_21620 181783 181427 gene locus_tag LOCUS_21630 181783 181427 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031219.1 protein_id gnl|my_center|LOCUS_21630 182204 181773 gene locus_tag LOCUS_21640 182204 181773 CDS product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877297.1 protein_id gnl|my_center|LOCUS_21640 182671 182288 gene locus_tag LOCUS_21650 gene mzrA 182671 182288 CDS product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098864.1 protein_id gnl|my_center|LOCUS_21650 183337 182675 gene locus_tag LOCUS_21660 gene yqjA 183337 182675 CDS product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 protein_id gnl|my_center|LOCUS_21660 184451 183675 gene locus_tag LOCUS_21670 gene exuR 184451 183675 CDS product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369577.1 protein_id gnl|my_center|LOCUS_21670 185889 184588 gene locus_tag LOCUS_21680 185889 184588 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098861.1 protein_id gnl|my_center|LOCUS_21680 186346 187758 gene locus_tag LOCUS_21690 gene uxaC 186346 187758 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_21690 187776 189263 gene locus_tag LOCUS_21700 187776 189263 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098859.1 protein_id gnl|my_center|LOCUS_21700 189390 189944 gene locus_tag LOCUS_21710 189390 189944 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128138.1 protein_id gnl|my_center|LOCUS_21710 191203 189959 gene locus_tag LOCUS_21720 gene sstT 191203 189959 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703565.1 protein_id gnl|my_center|LOCUS_21720 191351 191605 gene locus_tag LOCUS_21730 191351 191605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 192536 191568 gene locus_tag LOCUS_21740 192536 191568 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703564.1 protein_id gnl|my_center|LOCUS_21740 193822 192824 gene locus_tag LOCUS_21750 193822 192824 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 protein_id gnl|my_center|LOCUS_21750 194622 194008 gene locus_tag LOCUS_21760 194622 194008 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464880.1 protein_id gnl|my_center|LOCUS_21760 195429 194872 gene locus_tag LOCUS_21770 195429 194872 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967454.1 protein_id gnl|my_center|LOCUS_21770 195569 196750 gene locus_tag LOCUS_21780 195569 196750 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098395.1 protein_id gnl|my_center|LOCUS_21780 197469 196972 gene locus_tag LOCUS_21790 197469 196972 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295542.1 protein_id gnl|my_center|LOCUS_21790 197538 198668 gene locus_tag LOCUS_21800 gene rlmG 197538 198668 CDS product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703562.1 protein_id gnl|my_center|LOCUS_21800 198831 199315 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 199557 201131 gene locus_tag LOCUS_21810 199557 201131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 202548 201502 gene locus_tag LOCUS_21820 202548 201502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 202611 202801 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 202897 203319 gene locus_tag LOCUS_21830 202897 203319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 204349 203381 gene locus_tag LOCUS_21840 gene lsrR 204349 203381 CDS product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098851.1 protein_id gnl|my_center|LOCUS_21840 204566 206056 gene locus_tag LOCUS_21850 gene lsrA 204566 206056 CDS product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098850.1 protein_id gnl|my_center|LOCUS_21850 206053 207087 gene locus_tag LOCUS_21860 gene lsrC 206053 207087 CDS product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369589.1 protein_id gnl|my_center|LOCUS_21860 207088 208080 gene locus_tag LOCUS_21870 gene lsrD 207088 208080 CDS product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703557.1 protein_id gnl|my_center|LOCUS_21870 208083 209096 gene locus_tag LOCUS_21880 gene lsrB 208083 209096 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098847.1 protein_id gnl|my_center|LOCUS_21880 209108 209995 gene locus_tag LOCUS_21890 gene lsrF 209108 209995 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098846.1 protein_id gnl|my_center|LOCUS_21890 209992 210288 gene locus_tag LOCUS_21900 gene lsrG 209992 210288 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004181386.1 protein_id gnl|my_center|LOCUS_21900 210290 210981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 212295 211006 gene locus_tag LOCUS_21910 gene ygjG 212295 211006 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098827.1 protein_id gnl|my_center|LOCUS_21910 212817 214337 gene locus_tag LOCUS_21920 212817 214337 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098826.1 protein_id gnl|my_center|LOCUS_21920 214775 216337 gene locus_tag LOCUS_21930 214775 216337 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098825.1 protein_id gnl|my_center|LOCUS_21930 216849 216334 gene locus_tag LOCUS_21940 216849 216334 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983441.1 protein_id gnl|my_center|LOCUS_21940 217077 217847 gene locus_tag LOCUS_21950 217077 217847 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098823.1 protein_id gnl|my_center|LOCUS_21950 217941 218276 gene locus_tag LOCUS_21960 217941 218276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 219338 218169 gene locus_tag LOCUS_21970 219338 218169 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098822.1 protein_id gnl|my_center|LOCUS_21970 219803 220828 gene locus_tag LOCUS_21980 219803 220828 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_21980 222190 220910 gene locus_tag LOCUS_21990 222190 220910 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391962.1 protein_id gnl|my_center|LOCUS_21990 222657 222187 gene locus_tag LOCUS_22000 222657 222187 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229215.1 protein_id gnl|my_center|LOCUS_22000 223692 222715 gene locus_tag LOCUS_22010 223692 222715 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975940.1 protein_id gnl|my_center|LOCUS_22010 224937 223723 gene locus_tag LOCUS_22020 gene rspA 224937 223723 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298659.1 protein_id gnl|my_center|LOCUS_22020 225765 225418 gene locus_tag LOCUS_22030 225765 225418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 226350 226275 gene locus_tag LOCUS_t00380 226350 226275 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 226476 226982 gene locus_tag LOCUS_22040 gene mug 226476 226982 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098778.1 protein_id gnl|my_center|LOCUS_22040 227530 228306 gene locus_tag LOCUS_22050 227530 228306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124279.1 protein_id gnl|my_center|LOCUS_22050 228303 228962 gene locus_tag LOCUS_22060 228303 228962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169038807.1 protein_id gnl|my_center|LOCUS_22060 228987 229244 gene locus_tag LOCUS_22070 228987 229244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 229310 229960 gene locus_tag LOCUS_22080 229310 229960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 230040 232352 gene locus_tag LOCUS_22090 230040 232352 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857891.1 protein_id gnl|my_center|LOCUS_22090 232339 233190 gene locus_tag LOCUS_22100 232339 233190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 233250 233846 gene locus_tag LOCUS_22110 233250 233846 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064620.1 protein_id gnl|my_center|LOCUS_22110 234840 233878 gene locus_tag LOCUS_22120 234840 233878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22120 237175 235142 gene locus_tag LOCUS_22130 237175 235142 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579517.1 protein_id gnl|my_center|LOCUS_22130 238947 237271 gene locus_tag LOCUS_22140 238947 237271 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010348153.1 protein_id gnl|my_center|LOCUS_22140 240110 238980 gene locus_tag LOCUS_22150 240110 238980 CDS product capsule polysaccharide export inner-membrane protein KpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905920.1 protein_id gnl|my_center|LOCUS_22150 241171 240203 gene locus_tag LOCUS_22160 241171 240203 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298261.1 protein_id gnl|my_center|LOCUS_22160 243508 241661 gene locus_tag LOCUS_22170 gene rpoD 243508 241661 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098777.1 protein_id gnl|my_center|LOCUS_22170 245538 243796 gene locus_tag LOCUS_22180 gene dnaG 245538 243796 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703524.1 protein_id gnl|my_center|LOCUS_22180 245868 245653 gene locus_tag LOCUS_22190 gene rpsU 245868 245653 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_22190 246028 247008 gene locus_tag LOCUS_22200 gene tsaD 246028 247008 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264352.1 protein_id gnl|my_center|LOCUS_22200 246980 247120 gene locus_tag LOCUS_22210 246980 247120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22210 247864 248232 gene locus_tag LOCUS_22220 gene folB 247864 248232 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001540933.1 protein_id gnl|my_center|LOCUS_22220 248340 249158 gene locus_tag LOCUS_22230 gene bacA 248340 249158 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640212.1 protein_id gnl|my_center|LOCUS_22230 250411 249170 gene locus_tag LOCUS_22240 gene cca 250411 249170 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708496.1 protein_id gnl|my_center|LOCUS_22240 251097 250477 gene locus_tag LOCUS_22250 251097 250477 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098761.1 protein_id gnl|my_center|LOCUS_22250 251985 252280 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 252298 252870 gene locus_tag LOCUS_22260 252298 252870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 252889 255741 gene locus_tag LOCUS_22270 gene glnE 252889 255741 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098759.1 protein_id gnl|my_center|LOCUS_22270 255788 257218 gene locus_tag LOCUS_22280 gene hldE 255788 257218 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098758.1 protein_id gnl|my_center|LOCUS_22280 258963 257266 gene locus_tag LOCUS_22290 258963 257266 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342894.1 protein_id gnl|my_center|LOCUS_22290 259610 258981 gene locus_tag LOCUS_22300 259610 258981 CDS product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599947.1 protein_id gnl|my_center|LOCUS_22300 260044 259748 gene locus_tag LOCUS_22310 gene ubiK 260044 259748 CDS product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 protein_id gnl|my_center|LOCUS_22310 260411 261064 gene locus_tag LOCUS_22320 gene ribB 260411 261064 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703517.1 protein_id gnl|my_center|LOCUS_22320 261242 261466 gene locus_tag LOCUS_22330 261242 261466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 262222 261449 gene locus_tag LOCUS_22340 gene zupT 262222 261449 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115874.1 protein_id gnl|my_center|LOCUS_22340 262419 263210 gene locus_tag LOCUS_22350 gene ygiD 262419 263210 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098747.1 protein_id gnl|my_center|LOCUS_22350 264533 263373 gene locus_tag LOCUS_22360 264533 263373 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098746.1 protein_id gnl|my_center|LOCUS_22360 265213 264539 gene locus_tag LOCUS_22370 265213 264539 CDS product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831528.1 protein_id gnl|my_center|LOCUS_22370 266822 265377 gene locus_tag LOCUS_22380 gene tolC 266822 265377 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 protein_id gnl|my_center|LOCUS_22380 267027 267659 gene locus_tag LOCUS_22390 gene nudF 267027 267659 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 protein_id gnl|my_center|LOCUS_22390 267656 268078 gene locus_tag LOCUS_22400 267656 268078 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 protein_id gnl|my_center|LOCUS_22400 268103 268930 gene locus_tag LOCUS_22410 gene cpdA 268103 268930 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098742.1 protein_id gnl|my_center|LOCUS_22410 268930 269505 gene locus_tag LOCUS_22420 gene yqiA 268930 269505 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098741.1 protein_id gnl|my_center|LOCUS_22420 269545 271437 gene locus_tag LOCUS_22430 gene parE 269545 271437 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195296.1 protein_id gnl|my_center|LOCUS_22430 273013 271487 gene locus_tag LOCUS_22440 273013 271487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096787.1 protein_id gnl|my_center|LOCUS_22440 274439 273033 gene locus_tag LOCUS_22450 gene uxaC 274439 273033 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096788.1 protein_id gnl|my_center|LOCUS_22450 274860 275930 gene locus_tag LOCUS_22460 gene uxuA 274860 275930 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705361.1 protein_id gnl|my_center|LOCUS_22460 276137 276469 gene locus_tag LOCUS_22470 276137 276469 CDS product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706013.1 protein_id gnl|my_center|LOCUS_22470 276479 276817 gene locus_tag LOCUS_22480 276479 276817 CDS product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706012.1 protein_id gnl|my_center|LOCUS_22480 278040 276868 gene locus_tag LOCUS_22490 278040 276868 CDS product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 protein_id gnl|my_center|LOCUS_22490 279759 280314 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 281500 280646 gene locus_tag LOCUS_22500 281500 280646 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098733.1 protein_id gnl|my_center|LOCUS_22500 281664 283493 gene locus_tag LOCUS_22510 281664 283493 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098732.1 protein_id gnl|my_center|LOCUS_22510 283565 284833 gene locus_tag LOCUS_22520 283565 284833 CDS product oligosaccharide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098731.1 protein_id gnl|my_center|LOCUS_22520 284872 286062 gene locus_tag LOCUS_22530 284872 286062 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098730.1 protein_id gnl|my_center|LOCUS_22530 286653 286126 gene locus_tag LOCUS_22540 286653 286126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963497.1 protein_id gnl|my_center|LOCUS_22540 287100 286660 gene locus_tag LOCUS_22550 gene lysM 287100 286660 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098729.1 protein_id gnl|my_center|LOCUS_22550 287541 287227 gene locus_tag LOCUS_22560 287541 287227 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369654.1 protein_id gnl|my_center|LOCUS_22560 288152 287571 gene locus_tag LOCUS_22570 288152 287571 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703509.1 protein_id gnl|my_center|LOCUS_22570 289602 288256 gene locus_tag LOCUS_22580 gene qseC 289602 288256 CDS product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673390.1 protein_id gnl|my_center|LOCUS_22580 290258 289599 gene locus_tag LOCUS_22590 gene qseB 290258 289599 CDS product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221574.1 protein_id gnl|my_center|LOCUS_22590 290403 290777 gene locus_tag LOCUS_22600 gene ygiW 290403 290777 CDS product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 protein_id gnl|my_center|LOCUS_22600 290897 293155 gene locus_tag LOCUS_22610 gene parC 290897 293155 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098723.1 protein_id gnl|my_center|LOCUS_22610 293328 294065 gene locus_tag LOCUS_22620 gene plsC 293328 294065 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965722.1 protein_id gnl|my_center|LOCUS_22620 294132 295544 gene locus_tag LOCUS_22630 gene ftsP 294132 295544 CDS product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098721.1 protein_id gnl|my_center|LOCUS_22630 295617 296564 gene locus_tag LOCUS_22640 295617 296564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 296566 298014 gene locus_tag LOCUS_22650 296566 298014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384560.1 protein_id gnl|my_center|LOCUS_22650 298091 300244 gene locus_tag LOCUS_22660 298091 300244 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274469.1 protein_id gnl|my_center|LOCUS_22660 300312 300752 gene locus_tag LOCUS_22670 300312 300752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 301617 300790 gene locus_tag LOCUS_22680 gene dkgA 301617 300790 CDS product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098717.1 protein_id gnl|my_center|LOCUS_22680 302883 301720 gene locus_tag LOCUS_22690 gene yqhD 302883 301720 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 protein_id gnl|my_center|LOCUS_22690 303074 303973 gene locus_tag LOCUS_22700 303074 303973 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703501.1 protein_id gnl|my_center|LOCUS_22700 304686 304027 gene locus_tag LOCUS_22710 gene yghB 304686 304027 CDS product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098714.1 protein_id gnl|my_center|LOCUS_22710 306001 304814 gene locus_tag LOCUS_22720 gene metC 306001 304814 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098713.1 protein_id gnl|my_center|LOCUS_22720 306155 306985 gene locus_tag LOCUS_22730 gene exbB 306155 306985 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527859.1 protein_id gnl|my_center|LOCUS_22730 306992 307417 gene locus_tag LOCUS_22740 gene exbD 306992 307417 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 protein_id gnl|my_center|LOCUS_22740 308340 307456 gene locus_tag LOCUS_22750 308340 307456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019040.1 protein_id gnl|my_center|LOCUS_22750 308620 310044 gene locus_tag LOCUS_22760 308620 310044 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_22760 310056 311585 gene locus_tag LOCUS_22770 310056 311585 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_22770 312030 311569 gene locus_tag LOCUS_22780 312030 311569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 protein_id gnl|my_center|LOCUS_22780 312436 312032 gene locus_tag LOCUS_22790 312436 312032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098709.1 protein_id gnl|my_center|LOCUS_22790 312540 313046 gene locus_tag LOCUS_22800 312540 313046 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098708.1 protein_id gnl|my_center|LOCUS_22800 313129 313623 gene locus_tag LOCUS_22810 313129 313623 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 protein_id gnl|my_center|LOCUS_22810 314761 313721 gene locus_tag LOCUS_22820 314761 313721 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622102.1 protein_id gnl|my_center|LOCUS_22820 315771 317420 gene locus_tag LOCUS_22830 315771 317420 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098705.1 protein_id gnl|my_center|LOCUS_22830 318316 317597 gene locus_tag LOCUS_22840 gene fucR 318316 317597 CDS product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642330.1 protein_id gnl|my_center|LOCUS_22840 319345 318479 gene locus_tag LOCUS_22850 gene yghU 319345 318479 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 protein_id gnl|my_center|LOCUS_22850 320221 319472 gene locus_tag LOCUS_22860 320221 319472 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086142.1 protein_id gnl|my_center|LOCUS_22860 321293 320352 gene locus_tag LOCUS_22870 321293 320352 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347707.1 protein_id gnl|my_center|LOCUS_22870 321404 322243 gene locus_tag LOCUS_22880 321404 322243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 322771 322289 gene locus_tag LOCUS_22890 322771 322289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 323106 323351 gene locus_tag LOCUS_22900 323106 323351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 325866 323497 gene locus_tag LOCUS_22910 325866 323497 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096967.1 protein_id gnl|my_center|LOCUS_22910 326625 326056 gene locus_tag LOCUS_22920 326625 326056 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 protein_id gnl|my_center|LOCUS_22920 327318 326800 gene locus_tag LOCUS_22930 327318 326800 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773772.1 protein_id gnl|my_center|LOCUS_22930 328194 328370 gene locus_tag LOCUS_22940 328194 328370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 328676 329440 gene locus_tag LOCUS_22950 328676 329440 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098484.1 protein_id gnl|my_center|LOCUS_22950 329576 329905 gene locus_tag LOCUS_22960 329576 329905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 331638 330802 gene locus_tag LOCUS_22970 331638 330802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 332291 331671 gene locus_tag LOCUS_22980 332291 331671 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085691.1 protein_id gnl|my_center|LOCUS_22980 333002 333451 gene locus_tag LOCUS_22990 333002 333451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 333499 334041 gene locus_tag LOCUS_23000 333499 334041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 334239 334164 gene locus_tag LOCUS_t00390 334239 334164 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 335064 334345 gene locus_tag LOCUS_23010 335064 334345 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 protein_id gnl|my_center|LOCUS_23010 337637 337928 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 339341 338088 gene locus_tag LOCUS_23020 339341 338088 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703460.1 protein_id gnl|my_center|LOCUS_23020 340674 339589 gene locus_tag LOCUS_23030 gene mltC 340674 339589 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098675.1 protein_id gnl|my_center|LOCUS_23030 341026 340751 gene locus_tag LOCUS_23040 341026 340751 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 protein_id gnl|my_center|LOCUS_23040 342106 341054 gene locus_tag LOCUS_23050 gene mutY 342106 341054 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703459.1 protein_id gnl|my_center|LOCUS_23050 342248 342967 gene locus_tag LOCUS_23060 gene trmB 342248 342967 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098672.1 protein_id gnl|my_center|LOCUS_23060 342967 343293 gene locus_tag LOCUS_23070 342967 343293 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107565.1 protein_id gnl|my_center|LOCUS_23070 343345 344064 gene locus_tag LOCUS_23080 343345 344064 CDS product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984827.1 protein_id gnl|my_center|LOCUS_23080 344523 344161 gene locus_tag LOCUS_23090 344523 344161 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968855.1 protein_id gnl|my_center|LOCUS_23090 344647 345651 gene locus_tag LOCUS_23100 344647 345651 CDS product DUF1202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252198.1 protein_id gnl|my_center|LOCUS_23100 346816 345680 gene locus_tag LOCUS_23110 gene hemW 346816 345680 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098670.1 protein_id gnl|my_center|LOCUS_23110 347402 346809 gene locus_tag LOCUS_23120 347402 346809 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 protein_id gnl|my_center|LOCUS_23120 347701 347405 gene locus_tag LOCUS_23130 gene yggU 347701 347405 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369728.1 protein_id gnl|my_center|LOCUS_23130 348261 347698 gene locus_tag LOCUS_23140 348261 347698 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369729.1 protein_id gnl|my_center|LOCUS_23140 348983 348270 gene locus_tag LOCUS_23150 gene yggS 348983 348270 CDS product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 protein_id gnl|my_center|LOCUS_23150 349001 349978 gene locus_tag LOCUS_23160 349001 349978 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883139.1 protein_id gnl|my_center|LOCUS_23160 352233 349975 gene locus_tag LOCUS_23170 352233 349975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 352296 352991 gene locus_tag LOCUS_23180 352296 352991 CDS product global regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098333.1 protein_id gnl|my_center|LOCUS_23180 353736 353320 gene locus_tag LOCUS_23190 gene ruvX 353736 353320 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369733.1 protein_id gnl|my_center|LOCUS_23190 354233 353736 gene locus_tag LOCUS_23200 354233 353736 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 protein_id gnl|my_center|LOCUS_23200 355496 354549 gene locus_tag LOCUS_23210 gene gshB 355496 354549 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098663.1 protein_id gnl|my_center|LOCUS_23210 356241 355510 gene locus_tag LOCUS_23220 gene rsmE 356241 355510 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098662.1 protein_id gnl|my_center|LOCUS_23220 357013 356318 gene locus_tag LOCUS_23230 gene endA 357013 356318 CDS product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001327408.1 protein_id gnl|my_center|LOCUS_23230 357567 357109 gene locus_tag LOCUS_23240 357567 357109 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860035.1 protein_id gnl|my_center|LOCUS_23240 358503 357682 gene locus_tag LOCUS_23250 358503 357682 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095407.1 protein_id gnl|my_center|LOCUS_23250 359693 358548 gene locus_tag LOCUS_23260 359693 358548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 359700 360000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 360085 360489 gene locus_tag LOCUS_23270 360085 360489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 360918 360493 gene locus_tag LOCUS_23280 360918 360493 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095409.1 protein_id gnl|my_center|LOCUS_23280 362793 360922 gene locus_tag LOCUS_23290 362793 360922 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095410.1 protein_id gnl|my_center|LOCUS_23290 363128 363832 gene locus_tag LOCUS_23300 363128 363832 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095411.1 protein_id gnl|my_center|LOCUS_23300 363885 364115 gene locus_tag LOCUS_23310 363885 364115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 364118 364372 gene locus_tag LOCUS_23320 364118 364372 CDS product XapX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095413.1 protein_id gnl|my_center|LOCUS_23320 364409 364777 gene locus_tag LOCUS_23330 364409 364777 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095414.1 protein_id gnl|my_center|LOCUS_23330 364787 370372 gene locus_tag LOCUS_23340 364787 370372 CDS product ATP-binding sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095415.1 protein_id gnl|my_center|LOCUS_23340 371002 370382 gene locus_tag LOCUS_23350 371002 370382 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620669.1 protein_id gnl|my_center|LOCUS_23350 372641 371247 gene locus_tag LOCUS_23360 gene galP 372641 371247 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113171.1 protein_id gnl|my_center|LOCUS_23360 374228 373074 gene locus_tag LOCUS_23370 gene metK 374228 373074 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004149807.1 protein_id gnl|my_center|LOCUS_23370 375089 376987 gene locus_tag LOCUS_23380 gene speA 375089 376987 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833212.1 protein_id gnl|my_center|LOCUS_23380 377174 378094 gene locus_tag LOCUS_23390 gene speB 377174 378094 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105550.1 protein_id gnl|my_center|LOCUS_23390 378919 378161 gene locus_tag LOCUS_23400 378919 378161 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098638.1 protein_id gnl|my_center|LOCUS_23400 379212 381165 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 381498 381941 gene locus_tag LOCUS_23410 gene cmtB 381498 381941 CDS product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237038.1 protein_id gnl|my_center|LOCUS_23410 381965 383344 gene locus_tag LOCUS_23420 gene cmtA 381965 383344 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428805.1 protein_id gnl|my_center|LOCUS_23420 383362 384639 gene locus_tag LOCUS_23430 383362 384639 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853233.1 protein_id gnl|my_center|LOCUS_23430 384636 385607 gene locus_tag LOCUS_23440 gene glpX 384636 385607 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987297.1 protein_id gnl|my_center|LOCUS_23440 385623 386132 gene locus_tag LOCUS_23450 gene fumE 385623 386132 CDS product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224131.1 protein_id gnl|my_center|LOCUS_23450 386129 386857 gene locus_tag LOCUS_23460 386129 386857 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687742.1 protein_id gnl|my_center|LOCUS_23460 387527 386847 gene locus_tag LOCUS_23470 387527 386847 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956885.1 protein_id gnl|my_center|LOCUS_23470 388195 387521 gene locus_tag LOCUS_23480 388195 387521 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256969.1 protein_id gnl|my_center|LOCUS_23480 388890 388183 gene locus_tag LOCUS_23490 388890 388183 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553215.1 protein_id gnl|my_center|LOCUS_23490 389469 388891 gene locus_tag LOCUS_23500 389469 388891 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113903.1 protein_id gnl|my_center|LOCUS_23500 389942 389484 gene locus_tag LOCUS_23510 389942 389484 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218564.1 protein_id gnl|my_center|LOCUS_23510 390642 390445 gene locus_tag LOCUS_23520 390642 390445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 390663 391325 gene locus_tag LOCUS_23530 390663 391325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23530 391378 392541 gene locus_tag LOCUS_23540 gene pgk 391378 392541 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098635.1 protein_id gnl|my_center|LOCUS_23540 392625 393704 gene locus_tag LOCUS_23550 gene fbaA 392625 393704 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004144748.1 protein_id gnl|my_center|LOCUS_23550 393890 394750 gene locus_tag LOCUS_23560 393890 394750 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389833.1 protein_id gnl|my_center|LOCUS_23560 394882 395523 gene locus_tag LOCUS_23570 gene argO 394882 395523 CDS product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626874.1 protein_id gnl|my_center|LOCUS_23570 395615 396364 gene locus_tag LOCUS_23580 395615 396364 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098631.1 protein_id gnl|my_center|LOCUS_23580 397329 396415 gene locus_tag LOCUS_23590 gene argP 397329 396415 CDS product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499727.1 protein_id gnl|my_center|LOCUS_23590 397483 398142 gene locus_tag LOCUS_23600 gene rpiA 397483 398142 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098630.1 protein_id gnl|my_center|LOCUS_23600 398410 399642 gene locus_tag LOCUS_23610 gene serA 398410 399642 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098629.1 protein_id gnl|my_center|LOCUS_23610 399727 400326 gene locus_tag LOCUS_23620 399727 400326 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198733.1 protein_id gnl|my_center|LOCUS_23620 400943 400338 gene locus_tag LOCUS_23630 400943 400338 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098628.1 protein_id gnl|my_center|LOCUS_23630 401522 401193 gene locus_tag LOCUS_23640 gene zapA 401522 401193 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276011.1 protein_id gnl|my_center|LOCUS_23640 401739 402323 gene locus_tag LOCUS_23650 401739 402323 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027229.1 protein_id gnl|my_center|LOCUS_23650 402348 403664 gene locus_tag LOCUS_23660 gene pepP 402348 403664 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 protein_id gnl|my_center|LOCUS_23660 403661 404839 gene locus_tag LOCUS_23670 gene ubiH 403661 404839 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098625.1 protein_id gnl|my_center|LOCUS_23670 404886 406088 gene locus_tag LOCUS_23680 gene ubiI 404886 406088 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703429.1 protein_id gnl|my_center|LOCUS_23680 406503 407597 gene locus_tag LOCUS_23690 gene gcvT 406503 407597 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068738.1 protein_id gnl|my_center|LOCUS_23690 407623 408009 gene locus_tag LOCUS_23700 gene gcvH 407623 408009 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 protein_id gnl|my_center|LOCUS_23700 408081 410954 gene locus_tag LOCUS_23710 gene gcvP 408081 410954 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195016.1 protein_id gnl|my_center|LOCUS_23710 411120 411863 gene locus_tag LOCUS_23720 411120 411863 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098620.1 protein_id gnl|my_center|LOCUS_23720 413345 411906 gene locus_tag LOCUS_23730 gene bglA 413345 411906 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369787.1 protein_id gnl|my_center|LOCUS_23730 414189 413452 gene locus_tag LOCUS_23740 414189 413452 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703423.1 protein_id gnl|my_center|LOCUS_23740 414442 415101 gene locus_tag LOCUS_23750 414442 415101 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863433.1 protein_id gnl|my_center|LOCUS_23750 416133 415150 gene locus_tag LOCUS_23760 gene ygfZ 416133 415150 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886087.1 protein_id gnl|my_center|LOCUS_23760 416382 416648 gene locus_tag LOCUS_23770 gene sdhE 416382 416648 CDS product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 protein_id gnl|my_center|LOCUS_23770 416629 417045 gene locus_tag LOCUS_23780 416629 417045 CDS product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369792.1 protein_id gnl|my_center|LOCUS_23780 417569 417048 gene locus_tag LOCUS_23790 gene fldB 417569 417048 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098613.1 protein_id gnl|my_center|LOCUS_23790 417671 418567 gene locus_tag LOCUS_23800 gene xerD 417671 418567 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806650.1 protein_id gnl|my_center|LOCUS_23800 418592 419305 gene locus_tag LOCUS_23810 gene dsbC 418592 419305 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745614.1 protein_id gnl|my_center|LOCUS_23810 419311 421044 gene locus_tag LOCUS_23820 gene recJ 419311 421044 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098610.1 protein_id gnl|my_center|LOCUS_23820 421352 422233 gene locus_tag LOCUS_23830 gene prfB 421352 422233 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095908218.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23830 422243 423760 gene locus_tag LOCUS_23840 gene lysS 422243 423760 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098608.1 protein_id gnl|my_center|LOCUS_23840 424355 423807 gene locus_tag LOCUS_23850 gene idi 424355 423807 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133998.1 protein_id gnl|my_center|LOCUS_23850 425953 424475 gene locus_tag LOCUS_23860 425953 424475 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 protein_id gnl|my_center|LOCUS_23860 426170 427069 gene locus_tag LOCUS_23870 gene bsdA 426170 427069 CDS product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 protein_id gnl|my_center|LOCUS_23870 427150 427555 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 428330 428403 gene locus_tag LOCUS_t00400 428330 428403 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 429315 428644 gene locus_tag LOCUS_23880 429315 428644 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096194.1 protein_id gnl|my_center|LOCUS_23880 430567 429383 gene locus_tag LOCUS_23890 430567 429383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096193.1 protein_id gnl|my_center|LOCUS_23890 432307 431660 gene locus_tag LOCUS_23900 gene acpT 432307 431660 CDS product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284366.1 protein_id gnl|my_center|LOCUS_23900 432981 432310 gene locus_tag LOCUS_23910 432981 432310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23910 433538 433023 gene locus_tag LOCUS_23920 433538 433023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23920 434266 433535 gene locus_tag LOCUS_23930 434266 433535 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703724.1 protein_id gnl|my_center|LOCUS_23930 434739 434263 gene locus_tag LOCUS_23940 434739 434263 CDS product 3-hydroxy-fatty acyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369293.1 protein_id gnl|my_center|LOCUS_23940 435905 434736 gene locus_tag LOCUS_23950 435905 434736 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301690.1 protein_id gnl|my_center|LOCUS_23950 436488 435907 gene locus_tag LOCUS_23960 436488 435907 CDS product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597700.1 protein_id gnl|my_center|LOCUS_23960 438803 436485 gene locus_tag LOCUS_23970 438803 436485 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180184.1 protein_id gnl|my_center|LOCUS_23970 439380 438775 gene locus_tag LOCUS_23980 439380 438775 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670562.1 protein_id gnl|my_center|LOCUS_23980 439799 439380 gene locus_tag LOCUS_23990 439799 439380 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369298.1 protein_id gnl|my_center|LOCUS_23990 441493 439802 gene locus_tag LOCUS_24000 441493 439802 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703719.1 protein_id gnl|my_center|LOCUS_24000 441837 441484 gene locus_tag LOCUS_24010 441837 441484 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002431781.1 protein_id gnl|my_center|LOCUS_24010 442660 441824 gene locus_tag LOCUS_24020 442660 441824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24020 443184 442645 gene locus_tag LOCUS_24030 443184 442645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24030 443750 443181 gene locus_tag LOCUS_24040 443750 443181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014370.1 protein_id gnl|my_center|LOCUS_24040 444013 443762 gene locus_tag LOCUS_24050 444013 443762 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139646.1 protein_id gnl|my_center|LOCUS_24050 444283 444023 gene locus_tag LOCUS_24060 444283 444023 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436544.1 protein_id gnl|my_center|LOCUS_24060 445076 444261 gene locus_tag LOCUS_24070 445076 444261 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703715.1 protein_id gnl|my_center|LOCUS_24070 445795 445073 gene locus_tag LOCUS_24080 445795 445073 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301843.1 protein_id gnl|my_center|LOCUS_24080 446872 445814 gene locus_tag LOCUS_24090 446872 445814 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 protein_id gnl|my_center|LOCUS_24090 447361 446972 gene locus_tag LOCUS_24100 447361 446972 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 protein_id gnl|my_center|LOCUS_24100 447674 448708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 449284 449907 gene locus_tag LOCUS_24110 gene citX 449284 449907 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368283.1 protein_id gnl|my_center|LOCUS_24110 450952 449954 gene locus_tag LOCUS_24120 450952 449954 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705307.1 protein_id gnl|my_center|LOCUS_24120 451133 451996 gene locus_tag LOCUS_24130 451133 451996 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369901.1 protein_id gnl|my_center|LOCUS_24130 453231 452089 gene locus_tag LOCUS_24140 453231 452089 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705357.1 protein_id gnl|my_center|LOCUS_24140 454611 453241 gene locus_tag LOCUS_24150 454611 453241 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184109.1 protein_id gnl|my_center|LOCUS_24150 455005 456024 gene locus_tag LOCUS_24160 455005 456024 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096947.1 protein_id gnl|my_center|LOCUS_24160 456017 456685 gene locus_tag LOCUS_24170 456017 456685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096946.1 protein_id gnl|my_center|LOCUS_24170 456705 457517 gene locus_tag LOCUS_24180 456705 457517 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096945.1 protein_id gnl|my_center|LOCUS_24180 457665 458849 gene locus_tag LOCUS_24190 457665 458849 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656030.1 protein_id gnl|my_center|LOCUS_24190 459202 458990 gene locus_tag LOCUS_24200 459202 458990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 459401 460237 gene locus_tag LOCUS_24210 gene kduI 459401 460237 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 protein_id gnl|my_center|LOCUS_24210 460299 461060 gene locus_tag LOCUS_24220 gene kduD 460299 461060 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098575.1 protein_id gnl|my_center|LOCUS_24220 461190 461882 gene locus_tag LOCUS_24230 461190 461882 CDS product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703334.1 protein_id gnl|my_center|LOCUS_24230 462805 461879 gene locus_tag LOCUS_24240 462805 461879 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703333.1 protein_id gnl|my_center|LOCUS_24240 462922 464184 gene locus_tag LOCUS_24250 gene lysA 462922 464184 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369915.1 protein_id gnl|my_center|LOCUS_24250 465285 464257 gene locus_tag LOCUS_24260 465285 464257 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798777.1 protein_id gnl|my_center|LOCUS_24260 465535 466872 gene locus_tag LOCUS_24270 465535 466872 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098563.1 protein_id gnl|my_center|LOCUS_24270 466883 468310 gene locus_tag LOCUS_24280 466883 468310 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098562.1 protein_id gnl|my_center|LOCUS_24280 468320 468637 gene locus_tag LOCUS_24290 468320 468637 CDS product lactose/cellobiose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990040.1 protein_id gnl|my_center|LOCUS_24290 468732 469505 gene locus_tag LOCUS_24300 468732 469505 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098561.1 protein_id gnl|my_center|LOCUS_24300 469502 469951 gene locus_tag LOCUS_24310 469502 469951 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703332.1 protein_id gnl|my_center|LOCUS_24310 470955 469948 gene locus_tag LOCUS_24320 gene galR 470955 469948 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201064.1 protein_id gnl|my_center|LOCUS_24320 471140 471451 gene locus_tag LOCUS_24330 471140 471451 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074398.1 protein_id gnl|my_center|LOCUS_24330 471448 471870 gene locus_tag LOCUS_24340 471448 471870 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126294.1 protein_id gnl|my_center|LOCUS_24340 472363 474522 gene locus_tag LOCUS_24350 gene aas 472363 474522 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896085.1 protein_id gnl|my_center|LOCUS_24350 474515 475708 gene locus_tag LOCUS_24360 gene lplT 474515 475708 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 protein_id gnl|my_center|LOCUS_24360 476782 475742 gene locus_tag LOCUS_24370 476782 475742 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098556.1 protein_id gnl|my_center|LOCUS_24370 477128 476910 gene locus_tag LOCUS_24380 gene ygdR 477128 476910 CDS product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 protein_id gnl|my_center|LOCUS_24380 477986 477273 gene locus_tag LOCUS_24390 477986 477273 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895635.1 protein_id gnl|my_center|LOCUS_24390 478744 478049 gene locus_tag LOCUS_24400 gene mutH 478744 478049 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369924.1 protein_id gnl|my_center|LOCUS_24400 479571 479954 gene locus_tag LOCUS_24410 479571 479954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 479967 482213 gene locus_tag LOCUS_24420 gene ptsP 479967 482213 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957914.1 protein_id gnl|my_center|LOCUS_24420 482560 483435 gene locus_tag LOCUS_24430 gene lgt 482560 483435 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098551.1 protein_id gnl|my_center|LOCUS_24430 483442 484236 gene locus_tag LOCUS_24440 gene thyA 483442 484236 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098550.1 protein_id gnl|my_center|LOCUS_24440 484420 484884 gene locus_tag LOCUS_24450 484420 484884 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 protein_id gnl|my_center|LOCUS_24450 484878 485441 gene locus_tag LOCUS_24460 484878 485441 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029148.1 protein_id gnl|my_center|LOCUS_24460 485438 485845 gene locus_tag LOCUS_24470 485438 485845 CDS product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098548.1 protein_id gnl|my_center|LOCUS_24470 485830 486150 gene locus_tag LOCUS_24480 485830 486150 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276460.1 protein_id gnl|my_center|LOCUS_24480 486163 489534 gene locus_tag LOCUS_24490 gene recC 486163 489534 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946942.1 protein_id gnl|my_center|LOCUS_24490 489692 490486 gene locus_tag LOCUS_24500 489692 490486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24500 490495 492579 gene locus_tag LOCUS_24510 490495 492579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24510 492572 496117 gene locus_tag LOCUS_24520 gene recB 492572 496117 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322794.1 protein_id gnl|my_center|LOCUS_24520 496114 497946 gene locus_tag LOCUS_24530 gene recD 496114 497946 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155175.1 protein_id gnl|my_center|LOCUS_24530 498032 498764 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 499860 501056 gene locus_tag LOCUS_24540 gene amiC 499860 501056 CDS product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098541.1 protein_id gnl|my_center|LOCUS_24540 501228 501152 gene locus_tag LOCUS_t00410 501228 501152 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 501351 501275 gene locus_tag LOCUS_t00420 501351 501275 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 501597 502652 gene locus_tag LOCUS_24550 gene mltA 501597 502652 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098540.1 protein_id gnl|my_center|LOCUS_24550 502729 503535 gene locus_tag LOCUS_24560 gene tcdA 502729 503535 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117724.1 protein_id gnl|my_center|LOCUS_24560 504009 503566 gene locus_tag LOCUS_24570 gene csdE 504009 503566 CDS product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184268.1 protein_id gnl|my_center|LOCUS_24570 505283 504009 gene locus_tag LOCUS_24580 gene csdA 505283 504009 CDS product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098537.1 protein_id gnl|my_center|LOCUS_24580 505407 505634 gene locus_tag LOCUS_24590 505407 505634 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750393.1 protein_id gnl|my_center|LOCUS_24590 505983 506897 gene locus_tag LOCUS_24600 gene gcvA 505983 506897 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369945.1 protein_id gnl|my_center|LOCUS_24600 506931 507326 gene locus_tag LOCUS_24610 506931 507326 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862756.1 protein_id gnl|my_center|LOCUS_24610 507319 508419 gene locus_tag LOCUS_24620 gene rlmM 507319 508419 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369947.1 protein_id gnl|my_center|LOCUS_24620 509203 508451 gene locus_tag LOCUS_24630 gene xni 509203 508451 CDS product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532501.1 protein_id gnl|my_center|LOCUS_24630 510622 509333 gene locus_tag LOCUS_24640 510622 509333 CDS product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098531.1 protein_id gnl|my_center|LOCUS_24640 512460 511096 gene locus_tag LOCUS_24650 gene ppnN 512460 511096 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 protein_id gnl|my_center|LOCUS_24650 513424 512579 gene locus_tag LOCUS_24660 gene queF 513424 512579 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703314.1 protein_id gnl|my_center|LOCUS_24660 513495 514040 gene locus_tag LOCUS_24670 gene syd 513495 514040 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098528.1 protein_id gnl|my_center|LOCUS_24670 514676 515005 gene locus_tag LOCUS_24680 514676 515005 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098527.1 protein_id gnl|my_center|LOCUS_24680 515005 515787 gene locus_tag LOCUS_24690 gene truC 515005 515787 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703313.1 protein_id gnl|my_center|LOCUS_24690 515805 516254 gene locus_tag LOCUS_24700 515805 516254 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098525.1 protein_id gnl|my_center|LOCUS_24700 516745 518097 gene locus_tag LOCUS_24710 gene gudP 516745 518097 CDS product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097072.1 protein_id gnl|my_center|LOCUS_24710 518100 519440 gene locus_tag LOCUS_24720 518100 519440 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235392.1 protein_id gnl|my_center|LOCUS_24720 519484 520985 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 521073 522212 gene locus_tag LOCUS_24730 521073 522212 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098521.1 protein_id gnl|my_center|LOCUS_24730 525061 522311 gene locus_tag LOCUS_24740 gene barA 525061 522311 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186405.1 protein_id gnl|my_center|LOCUS_24740 525119 526417 gene locus_tag LOCUS_24750 gene rlmD 525119 526417 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098519.1 protein_id gnl|my_center|LOCUS_24750 526475 528709 gene locus_tag LOCUS_24760 gene relA 526475 528709 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226841.1 protein_id gnl|my_center|LOCUS_24760 528776 529567 gene locus_tag LOCUS_24770 gene mazG 528776 529567 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703306.1 protein_id gnl|my_center|LOCUS_24770 529795 531432 gene locus_tag LOCUS_24780 gene pyrG 529795 531432 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703305.1 protein_id gnl|my_center|LOCUS_24780 531511 532809 gene locus_tag LOCUS_24790 gene eno 531511 532809 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036734.1 protein_id gnl|my_center|LOCUS_24790 534204 532867 gene locus_tag LOCUS_24800 gene gntP 534204 532867 CDS product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159420.1 protein_id gnl|my_center|LOCUS_24800 534458 535129 gene locus_tag LOCUS_24810 gene queE 534458 535129 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098510.1 protein_id gnl|my_center|LOCUS_24810 535354 536482 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcgagcggggataaaccg 536870 536508 gene locus_tag LOCUS_24820 gene queD 536870 536508 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434567.1 protein_id gnl|my_center|LOCUS_24820 537184 538992 gene locus_tag LOCUS_24830 gene cysJ 537184 538992 CDS product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098509.1 protein_id gnl|my_center|LOCUS_24830 538992 540704 gene locus_tag LOCUS_24840 gene cysI 538992 540704 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291998.1 protein_id gnl|my_center|LOCUS_24840 540764 541498 gene locus_tag LOCUS_24850 gene cysH 540764 541498 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080392.1 protein_id gnl|my_center|LOCUS_24850 541720 542360 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgcgagcggggataaaccg 544899 542365 gene locus_tag LOCUS_24860 544899 542365 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233978.1 protein_id gnl|my_center|LOCUS_24860 545277 546812 gene locus_tag LOCUS_24870 gene casA 545277 546812 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366321.1 protein_id gnl|my_center|LOCUS_24870 546829 547428 gene locus_tag LOCUS_24880 gene casB 546829 547428 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935107.1 protein_id gnl|my_center|LOCUS_24880 547451 548509 gene locus_tag LOCUS_24890 gene cas7e 547451 548509 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_24890 548519 549244 gene locus_tag LOCUS_24900 gene cas5e 548519 549244 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_24900 549244 549948 gene locus_tag LOCUS_24910 gene cas6e 549244 549948 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281411.1 protein_id gnl|my_center|LOCUS_24910 550124 550864 gene locus_tag LOCUS_24920 gene cas1e 550124 550864 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24920 550867 551160 gene locus_tag LOCUS_24930 gene cas2e 550867 551160 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_24930 551245 551822 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgccagcggggataaaccg 551943 552218 gene locus_tag LOCUS_24940 551943 552218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 553220 552324 gene locus_tag LOCUS_24950 553220 552324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 553587 553255 gene locus_tag LOCUS_24960 553587 553255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 553928 553584 gene locus_tag LOCUS_24970 553928 553584 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094795.1 protein_id gnl|my_center|LOCUS_24970 555743 553980 gene locus_tag LOCUS_24980 555743 553980 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644028.1 protein_id gnl|my_center|LOCUS_24980 557134 555740 gene locus_tag LOCUS_24990 557134 555740 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_24990 559414 557414 gene locus_tag LOCUS_25000 559414 557414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073425.1 protein_id gnl|my_center|LOCUS_25000 560579 559401 gene locus_tag LOCUS_25010 560579 559401 CDS product DUF3142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073424.1 protein_id gnl|my_center|LOCUS_25010 561656 560613 gene locus_tag LOCUS_25020 gene iap 561656 560613 CDS product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490413.1 protein_id gnl|my_center|LOCUS_25020 561893 563308 gene locus_tag LOCUS_25030 gene cysG 561893 563308 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184003.1 protein_id gnl|my_center|LOCUS_25030 563341 564249 gene locus_tag LOCUS_25040 gene cysD 563341 564249 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369979.1 protein_id gnl|my_center|LOCUS_25040 564259 565686 gene locus_tag LOCUS_25050 gene cysN 564259 565686 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098504.1 protein_id gnl|my_center|LOCUS_25050 565686 566291 gene locus_tag LOCUS_25060 gene cysC 565686 566291 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369981.1 protein_id gnl|my_center|LOCUS_25060 566363 566686 gene locus_tag LOCUS_25070 566363 566686 CDS product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246107.1 protein_id gnl|my_center|LOCUS_25070 566861 567181 gene locus_tag LOCUS_25080 gene ftsB 566861 567181 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862095.1 protein_id gnl|my_center|LOCUS_25080 567201 567911 gene locus_tag LOCUS_25090 gene ispD 567201 567911 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703297.1 protein_id gnl|my_center|LOCUS_25090 567911 568390 gene locus_tag LOCUS_25100 gene ispF 567911 568390 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219244.1 protein_id gnl|my_center|LOCUS_25100 568387 569436 gene locus_tag LOCUS_25110 gene truD 568387 569436 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134253.1 protein_id gnl|my_center|LOCUS_25110 569417 570178 gene locus_tag LOCUS_25120 gene surE 569417 570178 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883175.1 protein_id gnl|my_center|LOCUS_25120 570172 570798 gene locus_tag LOCUS_25130 570172 570798 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098496.1 protein_id gnl|my_center|LOCUS_25130 571073 570891 gene locus_tag LOCUS_25140 571073 570891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 571087 572034 gene locus_tag LOCUS_25150 gene nlpD 571087 572034 CDS product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272567.1 protein_id gnl|my_center|LOCUS_25150 572157 573149 gene locus_tag LOCUS_25160 gene rpoS 572157 573149 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098493.1 protein_id gnl|my_center|LOCUS_25160 573445 573209 gene locus_tag LOCUS_25170 573445 573209 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562983.1 protein_id gnl|my_center|LOCUS_25170 574883 573456 gene locus_tag LOCUS_25180 574883 573456 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369995.1 protein_id gnl|my_center|LOCUS_25180 575475 574873 gene locus_tag LOCUS_25190 575475 574873 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098488.1 protein_id gnl|my_center|LOCUS_25190 575647 576051 gene locus_tag LOCUS_25200 575647 576051 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703289.1 protein_id gnl|my_center|LOCUS_25200 576537 576109 gene locus_tag LOCUS_25210 576537 576109 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705497.1 protein_id gnl|my_center|LOCUS_25210 579203 576642 gene locus_tag LOCUS_25220 gene mutS 579203 576642 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098485.1 protein_id gnl|my_center|LOCUS_25220 579315 580097 gene locus_tag LOCUS_25230 579315 580097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 580972 581916 gene locus_tag LOCUS_25240 580972 581916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 581913 582191 gene locus_tag LOCUS_25250 581913 582191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 582381 582689 gene locus_tag LOCUS_25260 582381 582689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 582885 583316 gene locus_tag LOCUS_25270 582885 583316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 583466 584380 gene locus_tag LOCUS_25280 583466 584380 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098383.1 protein_id gnl|my_center|LOCUS_25280 585245 584466 gene locus_tag LOCUS_25290 585245 584466 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098381.1 protein_id gnl|my_center|LOCUS_25290 585620 586972 gene locus_tag LOCUS_25300 585620 586972 CDS product aconitase/3-isopropylmalate dehydratase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098376.1 protein_id gnl|my_center|LOCUS_25300 586983 587504 gene locus_tag LOCUS_25310 586983 587504 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098375.1 protein_id gnl|my_center|LOCUS_25310 587604 587942 gene locus_tag LOCUS_25320 587604 587942 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098481.1 protein_id gnl|my_center|LOCUS_25320 589426 588002 gene locus_tag LOCUS_25330 589426 588002 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098460.1 protein_id gnl|my_center|LOCUS_25330 590887 589442 gene locus_tag LOCUS_25340 gene ascF 590887 589442 CDS product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107885.1 protein_id gnl|my_center|LOCUS_25340 591142 592152 gene locus_tag LOCUS_25350 591142 592152 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420952.1 protein_id gnl|my_center|LOCUS_25350 592800 592192 gene locus_tag LOCUS_25360 592800 592192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25360 593326 592811 gene locus_tag LOCUS_25370 593326 592811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25370 594765 593323 gene locus_tag LOCUS_25380 gene norV 594765 593323 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029647.1 protein_id gnl|my_center|LOCUS_25380 594945 596465 gene locus_tag LOCUS_25390 gene norR 594945 596465 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010723.1 protein_id gnl|my_center|LOCUS_25390 597424 596462 gene locus_tag LOCUS_25400 gene gutQ 597424 596462 CDS product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098450.1 protein_id gnl|my_center|LOCUS_25400 598190 597417 gene locus_tag LOCUS_25410 gene srlR 598190 597417 CDS product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804544.1 protein_id gnl|my_center|LOCUS_25410 598617 598261 gene locus_tag LOCUS_25420 gene gutM 598617 598261 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098448.1 protein_id gnl|my_center|LOCUS_25420 599504 598725 gene locus_tag LOCUS_25430 gene srlD 599504 598725 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077354.1 protein_id gnl|my_center|LOCUS_25430 599876 599514 gene locus_tag LOCUS_25440 gene srlB 599876 599514 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098446.1 protein_id gnl|my_center|LOCUS_25440 600860 599886 gene locus_tag LOCUS_25450 600860 599886 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098445.1 protein_id gnl|my_center|LOCUS_25450 601420 600857 gene locus_tag LOCUS_25460 gene srlA 601420 600857 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573324.1 protein_id gnl|my_center|LOCUS_25460 601842 602777 gene locus_tag LOCUS_25470 gene mltB 601842 602777 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476820.1 protein_id gnl|my_center|LOCUS_25470 603003 603668 gene locus_tag LOCUS_25480 603003 603668 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098442.1 protein_id gnl|my_center|LOCUS_25480 603665 604528 gene locus_tag LOCUS_25490 603665 604528 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098441.1 protein_id gnl|my_center|LOCUS_25490 604528 605400 gene locus_tag LOCUS_25500 604528 605400 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883886.1 protein_id gnl|my_center|LOCUS_25500 605522 606019 gene locus_tag LOCUS_25510 gene pncC 605522 606019 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_25510 606111 607175 gene locus_tag LOCUS_25520 gene recA 606111 607175 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963150.1 protein_id gnl|my_center|LOCUS_25520 607242 607742 gene locus_tag LOCUS_25530 gene recX 607242 607742 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703240.1 protein_id gnl|my_center|LOCUS_25530 607871 610498 gene locus_tag LOCUS_25540 gene alaS 607871 610498 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098436.1 protein_id gnl|my_center|LOCUS_25540 610740 610925 gene locus_tag LOCUS_25550 gene csrA 610740 610925 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 protein_id gnl|my_center|LOCUS_25550 611243 611335 gene locus_tag LOCUS_t00430 611243 611335 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 611339 611415 gene locus_tag LOCUS_t00440 611339 611415 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 611611 611687 gene locus_tag LOCUS_t00450 611611 611687 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 611916 612230 gene locus_tag LOCUS_25560 611916 612230 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_25560 612350 612916 gene locus_tag LOCUS_25570 gene yqaB 612350 612916 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273290.1 protein_id gnl|my_center|LOCUS_25570 612913 613311 gene locus_tag LOCUS_25580 612913 613311 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152081995.1 protein_id gnl|my_center|LOCUS_25580 613435 614979 gene locus_tag LOCUS_25590 gene gshA 613435 614979 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098433.1 protein_id gnl|my_center|LOCUS_25590 615129 615644 gene locus_tag LOCUS_25600 gene luxS 615129 615644 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130191.1 protein_id gnl|my_center|LOCUS_25600 615689 616447 gene locus_tag LOCUS_25610 615689 616447 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370065.1 protein_id gnl|my_center|LOCUS_25610 617679 616444 gene locus_tag LOCUS_25620 617679 616444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 617735 617953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 618601 618966 gene locus_tag LOCUS_25630 618601 618966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 618963 620693 gene locus_tag LOCUS_25640 618963 620693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 621820 620708 gene locus_tag LOCUS_25650 621820 620708 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638288.1 protein_id gnl|my_center|LOCUS_25650 622524 621817 gene locus_tag LOCUS_25660 622524 621817 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097134.1 protein_id gnl|my_center|LOCUS_25660 624326 622788 gene locus_tag LOCUS_25670 gene emrB 624326 622788 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296316.1 protein_id gnl|my_center|LOCUS_25670 625513 624341 gene locus_tag LOCUS_25680 gene emrA 625513 624341 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098428.1 protein_id gnl|my_center|LOCUS_25680 626169 625639 gene locus_tag LOCUS_25690 gene mprA 626169 625639 CDS product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378431.1 protein_id gnl|my_center|LOCUS_25690 627691 626507 gene locus_tag LOCUS_25700 627691 626507 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098426.1 protein_id gnl|my_center|LOCUS_25700 627767 628232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 629313 628318 gene locus_tag LOCUS_25710 gene proX 629313 628318 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098425.1 protein_id gnl|my_center|LOCUS_25710 630438 629380 gene locus_tag LOCUS_25720 gene proW 630438 629380 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098424.1 protein_id gnl|my_center|LOCUS_25720 631633 630431 gene locus_tag LOCUS_25730 gene proV 631633 630431 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098423.1 protein_id gnl|my_center|LOCUS_25730 633222 632260 gene locus_tag LOCUS_25740 gene nrdF 633222 632260 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098422.1 protein_id gnl|my_center|LOCUS_25740 635377 633233 gene locus_tag LOCUS_25750 gene nrdE 635377 633233 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098421.1 protein_id gnl|my_center|LOCUS_25750 635760 635350 gene locus_tag LOCUS_25760 gene nrdI 635760 635350 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080944.1 protein_id gnl|my_center|LOCUS_25760 636002 635757 gene locus_tag LOCUS_25770 gene nrdH 636002 635757 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028864.1 protein_id gnl|my_center|LOCUS_25770 636573 636247 gene locus_tag LOCUS_25780 636573 636247 CDS product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295174.1 protein_id gnl|my_center|LOCUS_25780 636737 637081 gene locus_tag LOCUS_25790 636737 637081 CDS product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370081.1 protein_id gnl|my_center|LOCUS_25790 637560 637114 gene locus_tag LOCUS_25800 gene alaE 637560 637114 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098416.1 protein_id gnl|my_center|LOCUS_25800 638172 637993 gene locus_tag LOCUS_25810 638172 637993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370085.1 protein_id gnl|my_center|LOCUS_25810 638391 638549 gene locus_tag LOCUS_25820 638391 638549 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705362.1 protein_id gnl|my_center|LOCUS_25820 638685 639533 gene locus_tag LOCUS_25830 638685 639533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 640988 639576 gene locus_tag LOCUS_25840 640988 639576 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223883297.1 protein_id gnl|my_center|LOCUS_25840 641646 641086 gene locus_tag LOCUS_25850 641646 641086 CDS product Ail/Lom family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605048.1 protein_id gnl|my_center|LOCUS_25850 641929 642897 gene locus_tag LOCUS_25860 641929 642897 CDS product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463279.1 protein_id gnl|my_center|LOCUS_25860 643103 643411 gene locus_tag LOCUS_25870 643103 643411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 643533 643742 gene locus_tag LOCUS_25880 643533 643742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 644019 644273 gene locus_tag LOCUS_25890 644019 644273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 644322 644618 gene locus_tag LOCUS_25900 644322 644618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 644702 644920 gene locus_tag LOCUS_25910 644702 644920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 645047 645262 gene locus_tag LOCUS_25920 645047 645262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 646366 645401 gene locus_tag LOCUS_25930 646366 645401 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097238.1 protein_id gnl|my_center|LOCUS_25930 647414 646377 gene locus_tag LOCUS_25940 gene hpxD 647414 646377 CDS product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097237.1 protein_id gnl|my_center|LOCUS_25940 647541 648452 gene locus_tag LOCUS_25950 gene hpxR 647541 648452 CDS product LysR family hpxDE operon transcriptional regulator HpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705425.1 protein_id gnl|my_center|LOCUS_25950 649603 648449 gene locus_tag LOCUS_25960 gene hpxO 649603 648449 CDS product FAD-dependent urate hydroxylase HpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705424.1 protein_id gnl|my_center|LOCUS_25960 649862 651244 gene locus_tag LOCUS_25970 649862 651244 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705423.1 protein_id gnl|my_center|LOCUS_25970 651222 651722 gene locus_tag LOCUS_25980 gene uraD 651222 651722 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366596.1 protein_id gnl|my_center|LOCUS_25980 651719 652036 gene locus_tag LOCUS_25990 gene uraH 651719 652036 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097234.1 protein_id gnl|my_center|LOCUS_25990 653345 652020 gene locus_tag LOCUS_26000 gene guaD 653345 652020 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097233.1 protein_id gnl|my_center|LOCUS_26000 654925 653435 gene locus_tag LOCUS_26010 654925 653435 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097232.1 protein_id gnl|my_center|LOCUS_26010 655071 655787 gene locus_tag LOCUS_26020 655071 655787 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097231.1 protein_id gnl|my_center|LOCUS_26020 655787 656524 gene locus_tag LOCUS_26030 gene hpxA 655787 656524 CDS product allantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014069663.1 protein_id gnl|my_center|LOCUS_26030 656534 657466 gene locus_tag LOCUS_26040 gene puuE 656534 657466 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097229.1 protein_id gnl|my_center|LOCUS_26040 658110 659297 gene locus_tag LOCUS_26050 658110 659297 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461849.1 protein_id gnl|my_center|LOCUS_26050 659322 661130 gene locus_tag LOCUS_26060 659322 661130 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_26060 661207 662256 gene locus_tag LOCUS_26070 gene asrA 661207 662256 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985218.1 protein_id gnl|my_center|LOCUS_26070 662253 663071 gene locus_tag LOCUS_26080 gene asrB 662253 663071 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017585.1 protein_id gnl|my_center|LOCUS_26080 663083 664105 gene locus_tag LOCUS_26090 gene asrC 663083 664105 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020685.1 protein_id gnl|my_center|LOCUS_26090 665856 664159 gene locus_tag LOCUS_26100 665856 664159 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111066.1 protein_id gnl|my_center|LOCUS_26100 666337 665999 gene locus_tag LOCUS_26110 666337 665999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 667049 666669 gene locus_tag LOCUS_26120 gene hpxZ 667049 666669 CDS product oxalurate catabolism protein HpxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705418.1 protein_id gnl|my_center|LOCUS_26120 668443 667049 gene locus_tag LOCUS_26130 668443 667049 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419059.1 protein_id gnl|my_center|LOCUS_26130 668628 668440 gene locus_tag LOCUS_26140 gene hpxX 668628 668440 CDS product oxalurate catabolism protein HpxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097226.1 protein_id gnl|my_center|LOCUS_26140 670222 668639 gene locus_tag LOCUS_26150 gene hpxW 670222 668639 CDS product oxamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705415.1 protein_id gnl|my_center|LOCUS_26150 670388 671227 gene locus_tag LOCUS_26160 gene hpxU 670388 671227 CDS product MurR/RpiR family transcriptional regulator HpxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097225.1 protein_id gnl|my_center|LOCUS_26160 671429 672670 gene locus_tag LOCUS_26170 671429 672670 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419062.1 protein_id gnl|my_center|LOCUS_26170 672706 673932 gene locus_tag LOCUS_26180 gene hpxK 672706 673932 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097219.1 protein_id gnl|my_center|LOCUS_26180 674266 675321 gene locus_tag LOCUS_26190 674266 675321 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029244.1 protein_id gnl|my_center|LOCUS_26190 675318 677186 gene locus_tag LOCUS_26200 675318 677186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 677324 677899 gene locus_tag LOCUS_26210 677324 677899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 678333 677941 gene locus_tag LOCUS_26220 678333 677941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 678426 679154 gene locus_tag LOCUS_26230 678426 679154 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113299.1 protein_id gnl|my_center|LOCUS_26230 679545 679910 gene locus_tag LOCUS_26240 679545 679910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 679921 682014 gene locus_tag LOCUS_26250 gene gcd 679921 682014 CDS product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309217.1 protein_id gnl|my_center|LOCUS_26250 682951 682679 gene locus_tag LOCUS_26260 682951 682679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 683294 683064 gene locus_tag LOCUS_26270 683294 683064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 684442 683747 gene locus_tag LOCUS_26280 684442 683747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 685458 684982 gene locus_tag LOCUS_26290 685458 684982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26290 685578 687086 gene locus_tag LOCUS_26300 685578 687086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529928.1 protein_id gnl|my_center|LOCUS_26300 687132 687437 gene locus_tag LOCUS_26310 687132 687437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26310 687754 687527 gene locus_tag LOCUS_26320 687754 687527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 689495 688593 gene locus_tag LOCUS_26330 689495 688593 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687183.1 protein_id gnl|my_center|LOCUS_26330 689606 690328 gene locus_tag LOCUS_26340 689606 690328 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361969.1 protein_id gnl|my_center|LOCUS_26340 691070 690579 gene locus_tag LOCUS_26350 691070 690579 CDS product tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824704.1 protein_id gnl|my_center|LOCUS_26350 691614 691105 gene locus_tag LOCUS_26360 691614 691105 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097477.1 protein_id gnl|my_center|LOCUS_26360 692667 691627 gene locus_tag LOCUS_26370 gene lpfD 692667 691627 CDS product long polar fimbrial protein LpfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694926.1 protein_id gnl|my_center|LOCUS_26370 695113 692687 gene locus_tag LOCUS_26380 695113 692687 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096967.1 protein_id gnl|my_center|LOCUS_26380 695926 695264 gene locus_tag LOCUS_26390 695926 695264 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 protein_id gnl|my_center|LOCUS_26390 696525 695989 gene locus_tag LOCUS_26400 696525 695989 CDS product long polar fimbria major subunit LpfA-O113 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827808.1 protein_id gnl|my_center|LOCUS_26400 697502 696951 gene locus_tag LOCUS_26410 697502 696951 CDS product tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369873.1 protein_id gnl|my_center|LOCUS_26410 701206 698309 gene locus_tag LOCUS_26420 701206 698309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 702413 701535 gene locus_tag LOCUS_26430 702413 701535 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220354845.1 protein_id gnl|my_center|LOCUS_26430 704575 702614 gene locus_tag LOCUS_26440 704575 702614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 705280 704957 gene locus_tag LOCUS_26450 705280 704957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 705557 705321 gene locus_tag LOCUS_26460 705557 705321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 706734 705742 gene locus_tag LOCUS_26470 706734 705742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 707065 707640 gene locus_tag LOCUS_26480 707065 707640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26480 707658 707909 gene locus_tag LOCUS_26490 707658 707909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26490 708076 708282 gene locus_tag LOCUS_26500 708076 708282 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815726.1 protein_id gnl|my_center|LOCUS_26500 708486 708761 gene locus_tag LOCUS_26510 708486 708761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 709867 709304 gene locus_tag LOCUS_26520 709867 709304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 710858 711283 gene locus_tag LOCUS_26530 710858 711283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815732.1 protein_id gnl|my_center|LOCUS_26530 711740 711420 gene locus_tag LOCUS_26540 711740 711420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 711937 711767 gene locus_tag LOCUS_26550 711937 711767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 713928 712663 gene locus_tag LOCUS_26560 713928 712663 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195816456.1 protein_id gnl|my_center|LOCUS_26560 714332 713925 gene locus_tag LOCUS_26570 714332 713925 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815736.1 protein_id gnl|my_center|LOCUS_26570 715483 714533 gene locus_tag LOCUS_26580 715483 714533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 715938 715498 gene locus_tag LOCUS_26590 715938 715498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 718375 716906 gene locus_tag LOCUS_26600 718375 716906 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294677.1 protein_id gnl|my_center|LOCUS_26600 720287 718386 gene locus_tag LOCUS_26610 gene bglP 720287 718386 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 protein_id gnl|my_center|LOCUS_26610 721238 720405 gene locus_tag LOCUS_26620 gene licT 721238 720405 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_26620 722432 721491 gene locus_tag LOCUS_26630 722432 721491 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039561.1 protein_id gnl|my_center|LOCUS_26630 722532 723296 gene locus_tag LOCUS_26640 722532 723296 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382879.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26640 724549 723650 gene locus_tag LOCUS_26650 724549 723650 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477420.1 protein_id gnl|my_center|LOCUS_26650 724681 726000 gene locus_tag LOCUS_26660 724681 726000 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477481.1 protein_id gnl|my_center|LOCUS_26660 726856 726647 gene locus_tag LOCUS_26670 726856 726647 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095921.1 protein_id gnl|my_center|LOCUS_26670 727364 727032 gene locus_tag LOCUS_26680 gene trxA 727364 727032 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_26680 727528 728433 gene locus_tag LOCUS_26690 727528 728433 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970995.1 protein_id gnl|my_center|LOCUS_26690 729290 728604 gene locus_tag LOCUS_26700 729290 728604 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104929.1 protein_id gnl|my_center|LOCUS_26700 730480 729371 gene locus_tag LOCUS_26710 730480 729371 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104924.1 protein_id gnl|my_center|LOCUS_26710 730695 731036 gene locus_tag LOCUS_26720 730695 731036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 731192 731986 gene locus_tag LOCUS_26730 731192 731986 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104931.1 protein_id gnl|my_center|LOCUS_26730 732013 732348 gene locus_tag LOCUS_26740 732013 732348 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807759.1 protein_id gnl|my_center|LOCUS_26740 732439 732990 gene locus_tag LOCUS_26750 732439 732990 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104932.1 protein_id gnl|my_center|LOCUS_26750 733078 733638 gene locus_tag LOCUS_26760 733078 733638 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104930.1 protein_id gnl|my_center|LOCUS_26760 735965 734727 gene locus_tag LOCUS_26770 735965 734727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 737996 737100 gene locus_tag LOCUS_26780 737996 737100 CDS product plasmid partitioning protein RepB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338948.1 protein_id gnl|my_center|LOCUS_26780 738610 737993 gene locus_tag LOCUS_26790 738610 737993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26790 739135 738878 gene locus_tag LOCUS_26800 739135 738878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26800 740433 739213 gene locus_tag LOCUS_26810 740433 739213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26810 741945 740716 gene locus_tag LOCUS_26820 741945 740716 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815743.1 protein_id gnl|my_center|LOCUS_26820 742473 742111 gene locus_tag LOCUS_tm00010 742473 742111 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 743693 743873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 744085 751854 gene locus_tag LOCUS_26830 744085 751854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 751167 751683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 751799 756301 gene locus_tag LOCUS_26840 751799 756301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 756371 757711 gene locus_tag LOCUS_26850 756371 757711 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090493.1 protein_id gnl|my_center|LOCUS_26850 757734 759866 gene locus_tag LOCUS_26860 757734 759866 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096691.1 protein_id gnl|my_center|LOCUS_26860 759877 761046 gene locus_tag LOCUS_26870 759877 761046 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208471.1 protein_id gnl|my_center|LOCUS_26870 761680 761198 gene locus_tag LOCUS_26880 gene smpB 761680 761198 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 protein_id gnl|my_center|LOCUS_26880 761839 762276 gene locus_tag LOCUS_26890 761839 762276 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502504.1 protein_id gnl|my_center|LOCUS_26890 762266 762562 gene locus_tag LOCUS_26900 762266 762562 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117838.1 protein_id gnl|my_center|LOCUS_26900 763077 762568 gene locus_tag LOCUS_26910 763077 762568 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707544.1 protein_id gnl|my_center|LOCUS_26910 763481 763140 gene locus_tag LOCUS_26920 gene bamE 763481 763140 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203445.1 protein_id gnl|my_center|LOCUS_26920 765291 763630 gene locus_tag LOCUS_26930 gene recN 765291 763630 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880915.1 protein_id gnl|my_center|LOCUS_26930 766256 765378 gene locus_tag LOCUS_26940 gene nadK 766256 765378 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059176.1 protein_id gnl|my_center|LOCUS_26940 766379 766972 gene locus_tag LOCUS_26950 gene grpE 766379 766972 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296310.1 protein_id gnl|my_center|LOCUS_26950 768267 767026 gene locus_tag LOCUS_26960 768267 767026 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028086.1 protein_id gnl|my_center|LOCUS_26960 769113 768325 gene locus_tag LOCUS_26970 769113 768325 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703199.1 protein_id gnl|my_center|LOCUS_26970 769287 770648 gene locus_tag LOCUS_26980 gene ffh 769287 770648 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098351.1 protein_id gnl|my_center|LOCUS_26980 770902 771150 gene locus_tag LOCUS_26990 gene rpsP 770902 771150 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370257.1 protein_id gnl|my_center|LOCUS_26990 771169 771717 gene locus_tag LOCUS_27000 gene rimM 771169 771717 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703198.1 protein_id gnl|my_center|LOCUS_27000 771762 772529 gene locus_tag LOCUS_27010 gene trmD 771762 772529 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 protein_id gnl|my_center|LOCUS_27010 772571 772918 gene locus_tag LOCUS_27020 gene rplS 772571 772918 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914145.1 protein_id gnl|my_center|LOCUS_27020 773053 773448 gene locus_tag LOCUS_27030 773053 773448 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098349.1 protein_id gnl|my_center|LOCUS_27030 773508 774860 gene locus_tag LOCUS_27040 773508 774860 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703197.1 protein_id gnl|my_center|LOCUS_27040 775065 776135 gene locus_tag LOCUS_27050 gene aroF 775065 776135 CDS product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 protein_id gnl|my_center|LOCUS_27050 777188 777522 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 777671 778543 gene locus_tag LOCUS_27060 777671 778543 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098341.1 protein_id gnl|my_center|LOCUS_27060 779700 778540 gene locus_tag LOCUS_27070 gene pheA 779700 778540 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098340.1 protein_id gnl|my_center|LOCUS_27070 780282 779953 gene locus_tag LOCUS_27080 gene raiA 780282 779953 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914111.1 protein_id gnl|my_center|LOCUS_27080 781287 780550 gene locus_tag LOCUS_27090 gene bamD 781287 780550 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098339.1 protein_id gnl|my_center|LOCUS_27090 781418 782398 gene locus_tag LOCUS_27100 gene rluD 781418 782398 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882082.1 protein_id gnl|my_center|LOCUS_27100 782395 783126 gene locus_tag LOCUS_27110 gene yfiH 782395 783126 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703192.1 protein_id gnl|my_center|LOCUS_27110 783256 785829 gene locus_tag LOCUS_27120 gene clpB 783256 785829 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235094.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence03 490 50 gene locus_tag LOCUS_27130 490 50 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236960.1 protein_id gnl|my_center|LOCUS_27130 646 1575 gene locus_tag LOCUS_27140 gene metA 646 1575 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122765.1 protein_id gnl|my_center|LOCUS_27140 1842 3443 gene locus_tag LOCUS_27150 gene aceB 1842 3443 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069369.1 protein_id gnl|my_center|LOCUS_27150 3460 4779 gene locus_tag LOCUS_27160 gene aceA 3460 4779 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857886.1 protein_id gnl|my_center|LOCUS_27160 4828 6603 gene locus_tag LOCUS_27170 gene aceK 4828 6603 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137261.1 protein_id gnl|my_center|LOCUS_27170 6741 6992 gene locus_tag LOCUS_27180 6741 6992 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 protein_id gnl|my_center|LOCUS_27180 7013 7321 gene locus_tag LOCUS_27190 7013 7321 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220181.1 protein_id gnl|my_center|LOCUS_27190 7751 7338 gene locus_tag LOCUS_27200 7751 7338 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096735.1 protein_id gnl|my_center|LOCUS_27200 8579 7752 gene locus_tag LOCUS_27210 gene iclR 8579 7752 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095025.1 protein_id gnl|my_center|LOCUS_27210 8760 11009 gene locus_tag LOCUS_27220 8760 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27220 11003 12442 gene locus_tag LOCUS_27230 11003 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27230 13180 13710 gene locus_tag LOCUS_27240 13180 13710 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521426.1 protein_id gnl|my_center|LOCUS_27240 13854 16457 gene locus_tag LOCUS_27250 13854 16457 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 protein_id gnl|my_center|LOCUS_27250 16495 17217 gene locus_tag LOCUS_27260 16495 17217 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 protein_id gnl|my_center|LOCUS_27260 17214 18473 gene locus_tag LOCUS_27270 17214 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 18485 19081 gene locus_tag LOCUS_27280 18485 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 19486 20769 gene locus_tag LOCUS_27290 gene sdaC 19486 20769 CDS product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859030.1 protein_id gnl|my_center|LOCUS_27290 20830 22197 gene locus_tag LOCUS_27300 gene sdaA 20830 22197 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 protein_id gnl|my_center|LOCUS_27300 22674 22234 gene locus_tag LOCUS_27310 22674 22234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 23027 23482 gene locus_tag LOCUS_27320 23027 23482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189562.1 protein_id gnl|my_center|LOCUS_27320 23574 25205 gene locus_tag LOCUS_27330 23574 25205 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095027.1 protein_id gnl|my_center|LOCUS_27330 25325 25507 gene locus_tag LOCUS_27340 25325 25507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 25507 25824 gene locus_tag LOCUS_27350 25507 25824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 25972 26841 gene locus_tag LOCUS_27360 gene rluF 25972 26841 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936361.1 protein_id gnl|my_center|LOCUS_27360 27110 26838 gene locus_tag LOCUS_27370 27110 26838 CDS product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207628.1 protein_id gnl|my_center|LOCUS_27370 27942 27184 gene locus_tag LOCUS_27380 27942 27184 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068169.1 protein_id gnl|my_center|LOCUS_27380 28792 27929 gene locus_tag LOCUS_27390 28792 27929 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924650.1 protein_id gnl|my_center|LOCUS_27390 29642 28803 gene locus_tag LOCUS_27400 29642 28803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472332.1 protein_id gnl|my_center|LOCUS_27400 31255 29669 gene locus_tag LOCUS_27410 31255 29669 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099738.1 protein_id gnl|my_center|LOCUS_27410 32436 31504 gene locus_tag LOCUS_27420 gene panS 32436 31504 CDS product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704027.1 protein_id gnl|my_center|LOCUS_27420 34135 32555 gene locus_tag LOCUS_27430 gene rtcR 34135 32555 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704028.1 protein_id gnl|my_center|LOCUS_27430 34592 35707 gene locus_tag LOCUS_27440 34592 35707 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704029.1 protein_id gnl|my_center|LOCUS_27440 35713 36939 gene locus_tag LOCUS_27450 35713 36939 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 protein_id gnl|my_center|LOCUS_27450 36944 37747 gene locus_tag LOCUS_27460 36944 37747 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130548.1 protein_id gnl|my_center|LOCUS_27460 38239 37784 gene locus_tag LOCUS_27470 38239 37784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047947.1 protein_id gnl|my_center|LOCUS_27470 39984 38311 gene locus_tag LOCUS_27480 39984 38311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 40619 39987 gene locus_tag LOCUS_27490 40619 39987 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082824.1 protein_id gnl|my_center|LOCUS_27490 41244 40612 gene locus_tag LOCUS_27500 41244 40612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 41624 41292 gene locus_tag LOCUS_27510 41624 41292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 41974 41615 gene locus_tag LOCUS_27520 41974 41615 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093498.1 protein_id gnl|my_center|LOCUS_27520 42894 42151 gene locus_tag LOCUS_27530 42894 42151 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679404.1 protein_id gnl|my_center|LOCUS_27530 43944 42904 gene locus_tag LOCUS_27540 43944 42904 CDS product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808053.1 protein_id gnl|my_center|LOCUS_27540 44141 43932 gene locus_tag LOCUS_27550 44141 43932 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269712.1 protein_id gnl|my_center|LOCUS_27550 45094 44141 gene locus_tag LOCUS_27560 45094 44141 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271439.1 protein_id gnl|my_center|LOCUS_27560 47421 45094 gene locus_tag LOCUS_27570 47421 45094 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262480.1 protein_id gnl|my_center|LOCUS_27570 47923 47606 gene locus_tag LOCUS_27580 47923 47606 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658214.1 protein_id gnl|my_center|LOCUS_27580 48489 47965 gene locus_tag LOCUS_27590 48489 47965 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907492.1 protein_id gnl|my_center|LOCUS_27590 49919 48489 gene locus_tag LOCUS_27600 49919 48489 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729839.1 protein_id gnl|my_center|LOCUS_27600 50112 49909 gene locus_tag LOCUS_27610 50112 49909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 50561 50109 gene locus_tag LOCUS_27620 50561 50109 CDS product Gp37 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404765.1 protein_id gnl|my_center|LOCUS_27620 51102 50788 gene locus_tag LOCUS_27630 51102 50788 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777272.1 protein_id gnl|my_center|LOCUS_27630 51721 51116 gene locus_tag LOCUS_27640 51721 51116 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266449.1 protein_id gnl|my_center|LOCUS_27640 52008 51721 gene locus_tag LOCUS_27650 52008 51721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 52579 52926 gene locus_tag LOCUS_27660 52579 52926 CDS product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619864.1 protein_id gnl|my_center|LOCUS_27660 54315 52966 gene locus_tag LOCUS_27670 gene lysC 54315 52966 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095032.1 protein_id gnl|my_center|LOCUS_27670 54622 56268 gene locus_tag LOCUS_27680 gene pgi 54622 56268 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790033.1 protein_id gnl|my_center|LOCUS_27680 56638 56880 gene locus_tag LOCUS_27690 56638 56880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 56945 57583 gene locus_tag LOCUS_27700 56945 57583 CDS product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095035.1 protein_id gnl|my_center|LOCUS_27700 57580 58317 gene locus_tag LOCUS_27710 57580 58317 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595524.1 protein_id gnl|my_center|LOCUS_27710 58320 60416 gene locus_tag LOCUS_27720 58320 60416 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750797.1 protein_id gnl|my_center|LOCUS_27720 61455 60946 gene locus_tag LOCUS_27730 61455 60946 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096749.1 protein_id gnl|my_center|LOCUS_27730 61590 62000 gene locus_tag LOCUS_27740 gene psiE 61590 62000 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202963.1 protein_id gnl|my_center|LOCUS_27740 62985 62095 gene locus_tag LOCUS_27750 gene malG 62985 62095 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368774.1 protein_id gnl|my_center|LOCUS_27750 64544 63000 gene locus_tag LOCUS_27760 gene malF 64544 63000 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368773.1 protein_id gnl|my_center|LOCUS_27760 65924 64734 gene locus_tag LOCUS_27770 gene malE 65924 64734 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095045.1 protein_id gnl|my_center|LOCUS_27770 66294 67403 gene locus_tag LOCUS_27780 gene malK 66294 67403 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500080.1 protein_id gnl|my_center|LOCUS_27780 67500 68807 gene locus_tag LOCUS_27790 67500 68807 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095047.1 protein_id gnl|my_center|LOCUS_27790 68916 69878 gene locus_tag LOCUS_27800 gene malM 68916 69878 CDS product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782497.1 protein_id gnl|my_center|LOCUS_27800 70058 70555 gene locus_tag LOCUS_27810 gene ubiC 70058 70555 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095049.1 protein_id gnl|my_center|LOCUS_27810 70568 71437 gene locus_tag LOCUS_27820 gene ubiA 70568 71437 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095050.1 protein_id gnl|my_center|LOCUS_27820 73943 71523 gene locus_tag LOCUS_27830 gene plsB 73943 71523 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095051.1 protein_id gnl|my_center|LOCUS_27830 74072 74440 gene locus_tag LOCUS_27840 74072 74440 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095052.1 protein_id gnl|my_center|LOCUS_27840 74549 75163 gene locus_tag LOCUS_27850 gene lexA 74549 75163 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646079.1 protein_id gnl|my_center|LOCUS_27850 75367 75612 gene locus_tag LOCUS_27860 75367 75612 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 protein_id gnl|my_center|LOCUS_27860 76216 75701 gene locus_tag LOCUS_27870 gene zur 76216 75701 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416271.1 protein_id gnl|my_center|LOCUS_27870 76487 77812 gene locus_tag LOCUS_27880 76487 77812 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 protein_id gnl|my_center|LOCUS_27880 77898 78893 gene locus_tag LOCUS_27890 gene dusA 77898 78893 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110630.1 protein_id gnl|my_center|LOCUS_27890 79027 79269 gene locus_tag LOCUS_27900 gene pspG 79027 79269 CDS product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891396.1 protein_id gnl|my_center|LOCUS_27900 80444 79461 gene locus_tag LOCUS_27910 80444 79461 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235562.1 protein_id gnl|my_center|LOCUS_27910 80563 81909 gene locus_tag LOCUS_27920 gene dnaB 80563 81909 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918353.1 protein_id gnl|my_center|LOCUS_27920 81941 82210 gene locus_tag LOCUS_27930 81941 82210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27930 82234 83016 gene locus_tag LOCUS_27940 82234 83016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27940 83134 84327 gene locus_tag LOCUS_27950 gene tyrB 83134 84327 CDS product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368753.1 protein_id gnl|my_center|LOCUS_27950 84506 85210 gene locus_tag LOCUS_27960 gene aphA 84506 85210 CDS product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095066.1 protein_id gnl|my_center|LOCUS_27960 85313 85729 gene locus_tag LOCUS_27970 85313 85729 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095067.1 protein_id gnl|my_center|LOCUS_27970 85732 86085 gene locus_tag LOCUS_27980 85732 86085 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095068.1 protein_id gnl|my_center|LOCUS_27980 88911 86086 gene locus_tag LOCUS_27990 gene uvrA 88911 86086 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368747.1 protein_id gnl|my_center|LOCUS_27990 89160 89699 gene locus_tag LOCUS_28000 gene ssb1 89160 89699 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 protein_id gnl|my_center|LOCUS_28000 90139 89858 gene locus_tag LOCUS_28010 90139 89858 CDS product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719058.1 protein_id gnl|my_center|LOCUS_28010 90796 92367 gene locus_tag LOCUS_28020 90796 92367 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418469.1 protein_id gnl|my_center|LOCUS_28020 92706 92383 gene locus_tag LOCUS_28030 gene soxS 92706 92383 CDS product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095071.1 protein_id gnl|my_center|LOCUS_28030 92785 93243 gene locus_tag LOCUS_28040 gene soxR 92785 93243 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095072.1 protein_id gnl|my_center|LOCUS_28040 93512 94186 gene locus_tag LOCUS_28050 93512 94186 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095073.1 protein_id gnl|my_center|LOCUS_28050 94485 95834 gene locus_tag LOCUS_28060 gene ghxP 94485 95834 CDS product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106903.1 protein_id gnl|my_center|LOCUS_28060 95972 97618 gene locus_tag LOCUS_28070 95972 97618 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001536604.1 protein_id gnl|my_center|LOCUS_28070 98614 97733 gene locus_tag LOCUS_28080 98614 97733 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354962.1 protein_id gnl|my_center|LOCUS_28080 98788 99183 gene locus_tag LOCUS_28090 98788 99183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 99223 100170 gene locus_tag LOCUS_28100 99223 100170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 101869 100220 gene locus_tag LOCUS_28110 gene actP 101869 100220 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095079.1 protein_id gnl|my_center|LOCUS_28110 102183 101866 gene locus_tag LOCUS_28120 102183 101866 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095080.1 protein_id gnl|my_center|LOCUS_28120 102239 102485 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 104463 102505 gene locus_tag LOCUS_28130 gene acs 104463 102505 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078239.1 protein_id gnl|my_center|LOCUS_28130 104878 106191 gene locus_tag LOCUS_28140 gene gltP 104878 106191 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095082.1 protein_id gnl|my_center|LOCUS_28140 106324 106800 gene locus_tag LOCUS_28150 106324 106800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 106800 107297 gene locus_tag LOCUS_28160 106800 107297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 107316 107702 gene locus_tag LOCUS_28170 107316 107702 CDS product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095417.1 protein_id gnl|my_center|LOCUS_28170 110000 107853 gene locus_tag LOCUS_28180 gene fdhF 110000 107853 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077681898.1 transl_except (pos:complement(109581..109583),aa:Sec) note codon on position 140 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_28180 110265 110996 gene locus_tag LOCUS_28190 110265 110996 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095088.1 protein_id gnl|my_center|LOCUS_28190 112034 111096 gene locus_tag LOCUS_28200 112034 111096 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095094.1 protein_id gnl|my_center|LOCUS_28200 113059 112064 gene locus_tag LOCUS_28210 113059 112064 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095095.1 protein_id gnl|my_center|LOCUS_28210 114576 113056 gene locus_tag LOCUS_28220 114576 113056 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095096.1 protein_id gnl|my_center|LOCUS_28220 114757 117045 gene locus_tag LOCUS_28230 114757 117045 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095097.1 protein_id gnl|my_center|LOCUS_28230 117316 119157 gene locus_tag LOCUS_28240 117316 119157 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895539.1 protein_id gnl|my_center|LOCUS_28240 119161 121479 gene locus_tag LOCUS_28250 119161 121479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112509.1 protein_id gnl|my_center|LOCUS_28250 121575 121892 gene locus_tag LOCUS_28260 121575 121892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 122234 121899 gene locus_tag LOCUS_28270 122234 121899 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704081.1 protein_id gnl|my_center|LOCUS_28270 122847 125198 gene locus_tag LOCUS_28280 gene crfC 122847 125198 CDS product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095116.1 protein_id gnl|my_center|LOCUS_28280 125195 126073 gene locus_tag LOCUS_28290 125195 126073 CDS product diguanylate cyclase regulator RdcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882903.1 protein_id gnl|my_center|LOCUS_28290 126107 126483 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 127572 126574 gene locus_tag LOCUS_28300 gene kdgT 127572 126574 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095118.1 protein_id gnl|my_center|LOCUS_28300 128272 129774 gene locus_tag LOCUS_28310 gene proP 128272 129774 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095119.1 protein_id gnl|my_center|LOCUS_28310 130764 129811 gene locus_tag LOCUS_28320 130764 129811 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418498.1 protein_id gnl|my_center|LOCUS_28320 133723 130859 gene locus_tag LOCUS_28330 133723 130859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 134043 134789 gene locus_tag LOCUS_28340 134043 134789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103250.1 protein_id gnl|my_center|LOCUS_28340 135148 134783 gene locus_tag LOCUS_28350 135148 134783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 136367 135300 gene locus_tag LOCUS_28360 136367 135300 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400551.1 protein_id gnl|my_center|LOCUS_28360 137020 136364 gene locus_tag LOCUS_28370 137020 136364 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_28370 137598 137023 gene locus_tag LOCUS_28380 137598 137023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 137973 137898 gene locus_tag LOCUS_t00460 137973 137898 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 138142 138987 gene locus_tag LOCUS_28390 138142 138987 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 protein_id gnl|my_center|LOCUS_28390 139026 139616 gene locus_tag LOCUS_28400 139026 139616 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 protein_id gnl|my_center|LOCUS_28400 140209 139613 gene locus_tag LOCUS_28410 140209 139613 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520566.1 protein_id gnl|my_center|LOCUS_28410 141883 140237 gene locus_tag LOCUS_28420 141883 140237 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095255.1 protein_id gnl|my_center|LOCUS_28420 142293 141970 gene locus_tag LOCUS_28430 gene cutA 142293 141970 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704145.1 protein_id gnl|my_center|LOCUS_28430 143677 142376 gene locus_tag LOCUS_28440 143677 142376 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 protein_id gnl|my_center|LOCUS_28440 145210 143774 gene locus_tag LOCUS_28450 gene aspA 145210 143774 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855923.1 protein_id gnl|my_center|LOCUS_28450 145547 146017 gene locus_tag LOCUS_28460 gene fxsA 145547 146017 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267445.1 protein_id gnl|my_center|LOCUS_28460 147274 146036 gene locus_tag LOCUS_28470 gene yjeH 147274 146036 CDS product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015837.1 protein_id gnl|my_center|LOCUS_28470 147526 147819 gene locus_tag LOCUS_28480 147526 147819 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027827.1 protein_id gnl|my_center|LOCUS_28480 147865 149511 gene locus_tag LOCUS_28490 gene groL 147865 149511 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729126.1 protein_id gnl|my_center|LOCUS_28490 150600 149866 gene locus_tag LOCUS_28500 150600 149866 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703401.1 protein_id gnl|my_center|LOCUS_28500 150996 153089 gene locus_tag LOCUS_28510 gene tkt 150996 153089 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088084.1 protein_id gnl|my_center|LOCUS_28510 153116 153580 gene locus_tag LOCUS_28520 153116 153580 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705656.1 protein_id gnl|my_center|LOCUS_28520 153618 153890 gene locus_tag LOCUS_28530 153618 153890 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699818.1 protein_id gnl|my_center|LOCUS_28530 153931 155298 gene locus_tag LOCUS_28540 153931 155298 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 protein_id gnl|my_center|LOCUS_28540 155679 156032 gene locus_tag LOCUS_28550 155679 156032 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605289.1 protein_id gnl|my_center|LOCUS_28550 156939 156076 gene locus_tag LOCUS_28560 156939 156076 CDS product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229237.1 protein_id gnl|my_center|LOCUS_28560 158048 157068 gene locus_tag LOCUS_28570 gene epmB 158048 157068 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940500.1 protein_id gnl|my_center|LOCUS_28570 158137 158703 gene locus_tag LOCUS_28580 gene efp 158137 158703 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257282.1 protein_id gnl|my_center|LOCUS_28580 158856 159002 gene locus_tag LOCUS_28590 gene ecnB 158856 159002 CDS product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239598.1 protein_id gnl|my_center|LOCUS_28590 159633 159031 gene locus_tag LOCUS_28600 159633 159031 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095267.1 protein_id gnl|my_center|LOCUS_28600 159898 160215 gene locus_tag LOCUS_28610 gene sugE 159898 160215 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118469.1 protein_id gnl|my_center|LOCUS_28610 160741 160187 gene locus_tag LOCUS_28620 160741 160187 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 protein_id gnl|my_center|LOCUS_28620 160996 162528 gene locus_tag LOCUS_28630 gene ptsG 160996 162528 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838205.1 protein_id gnl|my_center|LOCUS_28630 162561 164303 gene locus_tag LOCUS_28640 162561 164303 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_28640 164304 165182 gene locus_tag LOCUS_28650 164304 165182 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531513.1 protein_id gnl|my_center|LOCUS_28650 165175 166128 gene locus_tag LOCUS_28660 165175 166128 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433673.1 protein_id gnl|my_center|LOCUS_28660 166115 166498 gene locus_tag LOCUS_28670 166115 166498 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703889.1 protein_id gnl|my_center|LOCUS_28670 166495 166749 gene locus_tag LOCUS_28680 166495 166749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 167141 166782 gene locus_tag LOCUS_28690 gene frdD 167141 166782 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609663.1 protein_id gnl|my_center|LOCUS_28690 167547 167152 gene locus_tag LOCUS_28700 gene frdC 167547 167152 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208763.1 protein_id gnl|my_center|LOCUS_28700 168292 167558 gene locus_tag LOCUS_28710 gene frdB 168292 167558 CDS product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095274.1 protein_id gnl|my_center|LOCUS_28710 169952 168285 gene locus_tag LOCUS_28720 gene frdA 169952 168285 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704157.1 protein_id gnl|my_center|LOCUS_28720 170355 170203 gene locus_tag LOCUS_28730 170355 170203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 170318 171295 gene locus_tag LOCUS_28740 gene epmA 170318 171295 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 protein_id gnl|my_center|LOCUS_28740 174787 171455 gene locus_tag LOCUS_28750 gene mscM 174787 171455 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095277.1 protein_id gnl|my_center|LOCUS_28750 175586 174807 gene locus_tag LOCUS_28760 gene asd 175586 174807 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934927.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28760 175776 175558 gene locus_tag LOCUS_28770 175776 175558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28770 176930 175875 gene locus_tag LOCUS_28780 gene rsgA 176930 175875 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041948.1 protein_id gnl|my_center|LOCUS_28780 177038 177583 gene locus_tag LOCUS_28790 gene orn 177038 177583 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704162.1 protein_id gnl|my_center|LOCUS_28790 177753 177828 gene locus_tag LOCUS_t00470 177753 177828 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 177871 178438 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 178500 178575 gene locus_tag LOCUS_t00480 178500 178575 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 178658 178733 gene locus_tag LOCUS_t00490 178658 178733 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 180142 179003 gene locus_tag LOCUS_28800 gene queG 180142 179003 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095281.1 protein_id gnl|my_center|LOCUS_28800 180141 181688 gene locus_tag LOCUS_28810 gene nnr 180141 181688 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418520.1 protein_id gnl|my_center|LOCUS_28810 181663 182121 gene locus_tag LOCUS_28820 gene tsaE 181663 182121 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981984.1 protein_id gnl|my_center|LOCUS_28820 182138 183475 gene locus_tag LOCUS_28830 gene amiB 182138 183475 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619489.1 protein_id gnl|my_center|LOCUS_28830 183485 185341 gene locus_tag LOCUS_28840 gene mutL 183485 185341 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095285.1 protein_id gnl|my_center|LOCUS_28840 185334 186260 gene locus_tag LOCUS_28850 gene miaA 185334 186260 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095286.1 protein_id gnl|my_center|LOCUS_28850 186381 186686 gene locus_tag LOCUS_28860 gene hfq 186381 186686 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051883.1 protein_id gnl|my_center|LOCUS_28860 186762 188042 gene locus_tag LOCUS_28870 gene hflX 186762 188042 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095288.1 protein_id gnl|my_center|LOCUS_28870 188124 189383 gene locus_tag LOCUS_28880 gene hflK 188124 189383 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312504.1 protein_id gnl|my_center|LOCUS_28880 189386 190390 gene locus_tag LOCUS_28890 gene hflC 189386 190390 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095290.1 protein_id gnl|my_center|LOCUS_28890 190465 190662 gene locus_tag LOCUS_28900 190465 190662 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368629.1 protein_id gnl|my_center|LOCUS_28900 190927 190670 gene locus_tag LOCUS_28910 190927 190670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 190958 192064 gene locus_tag LOCUS_28920 190958 192064 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002885665.1 protein_id gnl|my_center|LOCUS_28920 192215 192640 gene locus_tag LOCUS_28930 gene nsrR 192215 192640 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 protein_id gnl|my_center|LOCUS_28930 192679 195123 gene locus_tag LOCUS_28940 gene rnr 192679 195123 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076357.1 protein_id gnl|my_center|LOCUS_28940 195333 196349 gene locus_tag LOCUS_28950 195333 196349 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_28950 196342 197067 gene locus_tag LOCUS_28960 196342 197067 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262121.1 protein_id gnl|my_center|LOCUS_28960 197150 198151 gene locus_tag LOCUS_28970 gene tauA 197150 198151 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 protein_id gnl|my_center|LOCUS_28970 198148 198918 gene locus_tag LOCUS_28980 gene tauC 198148 198918 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114620.1 protein_id gnl|my_center|LOCUS_28980 198918 199694 gene locus_tag LOCUS_28990 198918 199694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531158.1 protein_id gnl|my_center|LOCUS_28990 199749 200966 gene locus_tag LOCUS_29000 199749 200966 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_29000 200990 202552 gene locus_tag LOCUS_29010 200990 202552 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064672.1 protein_id gnl|my_center|LOCUS_29010 202565 203521 gene locus_tag LOCUS_29020 202565 203521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808548.1 protein_id gnl|my_center|LOCUS_29020 203521 204378 gene locus_tag LOCUS_29030 203521 204378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_29030 204371 205363 gene locus_tag LOCUS_29040 204371 205363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024318146.1 protein_id gnl|my_center|LOCUS_29040 205360 205629 gene locus_tag LOCUS_29050 205360 205629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29050 205626 206159 gene locus_tag LOCUS_29060 205626 206159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29060 206263 206994 gene locus_tag LOCUS_29070 gene rlmB 206263 206994 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293282.1 protein_id gnl|my_center|LOCUS_29070 207207 207611 gene locus_tag LOCUS_29080 207207 207611 CDS product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220134.1 protein_id gnl|my_center|LOCUS_29080 207624 208325 gene locus_tag LOCUS_29090 207624 208325 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 protein_id gnl|my_center|LOCUS_29090 208329 208988 gene locus_tag LOCUS_29100 208329 208988 CDS product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012542.1 protein_id gnl|my_center|LOCUS_29100 209004 209402 gene locus_tag LOCUS_29110 209004 209402 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547734.1 protein_id gnl|my_center|LOCUS_29110 209402 210052 gene locus_tag LOCUS_29120 209402 210052 CDS product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101658.1 protein_id gnl|my_center|LOCUS_29120 210055 211218 gene locus_tag LOCUS_29130 210055 211218 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943959.1 protein_id gnl|my_center|LOCUS_29130 211303 212922 gene locus_tag LOCUS_29140 211303 212922 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095296.1 protein_id gnl|my_center|LOCUS_29140 212882 213217 gene locus_tag LOCUS_29150 212882 213217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 213728 213423 gene locus_tag LOCUS_29160 gene bsmA 213728 213423 CDS product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368621.1 protein_id gnl|my_center|LOCUS_29160 213938 214687 gene locus_tag LOCUS_29170 gene yjfP 213938 214687 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560304.1 protein_id gnl|my_center|LOCUS_29170 215452 214697 gene locus_tag LOCUS_29180 gene ulaR 215452 214697 CDS product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095301.1 protein_id gnl|my_center|LOCUS_29180 216464 215571 gene locus_tag LOCUS_29190 gene ulaG 216464 215571 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049161.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29190 216636 216370 gene locus_tag LOCUS_29200 216636 216370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29200 217042 218394 gene locus_tag LOCUS_29210 gene ulaA 217042 218394 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368616.1 protein_id gnl|my_center|LOCUS_29210 218409 218714 gene locus_tag LOCUS_29220 gene ulaB 218409 218714 CDS product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004109091.1 protein_id gnl|my_center|LOCUS_29220 218724 219188 gene locus_tag LOCUS_29230 gene ulaC 218724 219188 CDS product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095304.1 protein_id gnl|my_center|LOCUS_29230 219201 219854 gene locus_tag LOCUS_29240 gene ulaD 219201 219854 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095305.1 protein_id gnl|my_center|LOCUS_29240 219864 220718 gene locus_tag LOCUS_29250 gene ulaE 219864 220718 CDS product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949511.1 protein_id gnl|my_center|LOCUS_29250 220718 221404 gene locus_tag LOCUS_29260 220718 221404 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170772.1 protein_id gnl|my_center|LOCUS_29260 221803 221531 gene locus_tag LOCUS_29270 gene yjfY 221803 221531 CDS product DUF1471 family protein YjfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095308.1 protein_id gnl|my_center|LOCUS_29270 222148 222543 gene locus_tag LOCUS_29280 gene rpsF 222148 222543 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216673.1 protein_id gnl|my_center|LOCUS_29280 222549 222863 gene locus_tag LOCUS_29290 gene priB 222549 222863 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296681.1 protein_id gnl|my_center|LOCUS_29290 222868 223095 gene locus_tag LOCUS_29300 gene rpsR 222868 223095 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 protein_id gnl|my_center|LOCUS_29300 223137 223586 gene locus_tag LOCUS_29310 gene rplI 223137 223586 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196065.1 protein_id gnl|my_center|LOCUS_29310 223738 224676 gene locus_tag LOCUS_29320 223738 224676 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381071.1 protein_id gnl|my_center|LOCUS_29320 225361 224711 gene locus_tag LOCUS_29330 225361 224711 CDS product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119449.1 protein_id gnl|my_center|LOCUS_29330 225628 226248 gene locus_tag LOCUS_29340 gene fklB 225628 226248 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502892.1 protein_id gnl|my_center|LOCUS_29340 226545 227954 gene locus_tag LOCUS_29350 gene cycA 226545 227954 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228366.1 protein_id gnl|my_center|LOCUS_29350 228693 228031 gene locus_tag LOCUS_29360 gene ytfE 228693 228031 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331451.1 protein_id gnl|my_center|LOCUS_29360 229765 228794 gene locus_tag LOCUS_29370 229765 228794 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095314.1 protein_id gnl|my_center|LOCUS_29370 230665 229841 gene locus_tag LOCUS_29380 230665 229841 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095315.1 protein_id gnl|my_center|LOCUS_29380 231593 230745 gene locus_tag LOCUS_29390 231593 230745 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095319.1 protein_id gnl|my_center|LOCUS_29390 231678 232061 gene locus_tag LOCUS_29400 231678 232061 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201297.1 protein_id gnl|my_center|LOCUS_29400 234045 232102 gene locus_tag LOCUS_29410 234045 232102 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589381.1 protein_id gnl|my_center|LOCUS_29410 234234 234983 gene locus_tag LOCUS_29420 gene cysQ 234234 234983 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886884.1 protein_id gnl|my_center|LOCUS_29420 235530 234973 gene locus_tag LOCUS_29430 235530 234973 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175301.1 protein_id gnl|my_center|LOCUS_29430 235856 236062 gene locus_tag LOCUS_29440 235856 236062 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 protein_id gnl|my_center|LOCUS_29440 237477 236140 gene locus_tag LOCUS_29450 237477 236140 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095324.1 protein_id gnl|my_center|LOCUS_29450 238269 237631 gene locus_tag LOCUS_29460 gene msrA 238269 237631 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305659.1 protein_id gnl|my_center|LOCUS_29460 238481 240214 gene locus_tag LOCUS_29470 gene tamA 238481 240214 CDS product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095333.1 protein_id gnl|my_center|LOCUS_29470 240211 243987 gene locus_tag LOCUS_29480 gene tamB 240211 243987 CDS product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095334.1 protein_id gnl|my_center|LOCUS_29480 243990 244334 gene locus_tag LOCUS_29490 243990 244334 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704194.1 protein_id gnl|my_center|LOCUS_29490 245989 244406 gene locus_tag LOCUS_29500 245989 244406 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531504.1 protein_id gnl|my_center|LOCUS_29500 246007 246228 gene locus_tag LOCUS_29510 246007 246228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 246765 246235 gene locus_tag LOCUS_29520 gene ppa 246765 246235 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501423.1 protein_id gnl|my_center|LOCUS_29520 247217 248122 gene locus_tag LOCUS_29530 gene ytfQ 247217 248122 CDS product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014882271.1 protein_id gnl|my_center|LOCUS_29530 248192 249694 gene locus_tag LOCUS_29540 248192 249694 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095340.1 protein_id gnl|my_center|LOCUS_29540 249708 250730 gene locus_tag LOCUS_29550 249708 250730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704197.1 protein_id gnl|my_center|LOCUS_29550 250717 251727 gene locus_tag LOCUS_29560 gene yjfF 250717 251727 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830436.1 protein_id gnl|my_center|LOCUS_29560 251826 253388 gene locus_tag LOCUS_29570 251826 253388 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095343.1 protein_id gnl|my_center|LOCUS_29570 254460 253462 gene locus_tag LOCUS_29580 gene fbp 254460 253462 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 protein_id gnl|my_center|LOCUS_29580 254635 256014 gene locus_tag LOCUS_29590 gene mpl 254635 256014 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219793.1 protein_id gnl|my_center|LOCUS_29590 257268 256060 gene locus_tag LOCUS_29600 257268 256060 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096422.1 protein_id gnl|my_center|LOCUS_29600 258122 257571 gene locus_tag LOCUS_29610 gene yjgA 258122 257571 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704200.1 protein_id gnl|my_center|LOCUS_29610 258229 259569 gene locus_tag LOCUS_29620 gene pmbA 258229 259569 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852994.1 protein_id gnl|my_center|LOCUS_29620 259625 260014 gene locus_tag LOCUS_29630 gene cybC 259625 260014 CDS product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232231.1 protein_id gnl|my_center|LOCUS_29630 260317 260637 gene locus_tag LOCUS_29640 260317 260637 CDS product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027887.1 protein_id gnl|my_center|LOCUS_29640 260648 261010 gene locus_tag LOCUS_29650 260648 261010 CDS product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435389.1 protein_id gnl|my_center|LOCUS_29650 261013 261312 gene locus_tag LOCUS_29660 261013 261312 CDS product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810338.1 protein_id gnl|my_center|LOCUS_29660 261335 262111 gene locus_tag LOCUS_29670 261335 262111 CDS product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368574.1 protein_id gnl|my_center|LOCUS_29670 262121 262762 gene locus_tag LOCUS_29680 262121 262762 CDS product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368573.1 protein_id gnl|my_center|LOCUS_29680 262805 263938 gene locus_tag LOCUS_29690 262805 263938 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459938.1 protein_id gnl|my_center|LOCUS_29690 263922 265040 gene locus_tag LOCUS_29700 263922 265040 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139189.1 protein_id gnl|my_center|LOCUS_29700 265037 265783 gene locus_tag LOCUS_29710 265037 265783 CDS product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095353.1 protein_id gnl|my_center|LOCUS_29710 265907 267817 gene locus_tag LOCUS_29720 265907 267817 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704203.1 protein_id gnl|my_center|LOCUS_29720 268091 268690 gene locus_tag LOCUS_29730 268091 268690 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113348.1 protein_id gnl|my_center|LOCUS_29730 269217 268753 gene locus_tag LOCUS_29740 gene nrdG 269217 268753 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106222.1 protein_id gnl|my_center|LOCUS_29740 271576 269438 gene locus_tag LOCUS_29750 gene nrdD 271576 269438 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187820.1 protein_id gnl|my_center|LOCUS_29750 272904 271957 gene locus_tag LOCUS_29760 gene treR 272904 271957 CDS product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181306.1 protein_id gnl|my_center|LOCUS_29760 273270 275975 gene locus_tag LOCUS_29770 gene mgtA 273270 275975 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775586.1 protein_id gnl|my_center|LOCUS_29770 276433 275978 gene locus_tag LOCUS_29780 276433 275978 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251083.1 protein_id gnl|my_center|LOCUS_29780 276887 276501 gene locus_tag LOCUS_29790 gene ridA 276887 276501 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704212.1 protein_id gnl|my_center|LOCUS_29790 277441 276980 gene locus_tag LOCUS_29800 gene pyrI 277441 276980 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148566.1 protein_id gnl|my_center|LOCUS_29800 278386 277454 gene locus_tag LOCUS_29810 gene pyrB 278386 277454 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095365.1 protein_id gnl|my_center|LOCUS_29810 278801 279253 gene locus_tag LOCUS_29820 278801 279253 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095372.1 protein_id gnl|my_center|LOCUS_29820 279465 280439 gene locus_tag LOCUS_29830 279465 280439 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288613.1 protein_id gnl|my_center|LOCUS_29830 280450 281280 gene locus_tag LOCUS_29840 280450 281280 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002400076.1 protein_id gnl|my_center|LOCUS_29840 281367 282935 gene locus_tag LOCUS_29850 281367 282935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 283004 284422 gene locus_tag LOCUS_29860 283004 284422 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298077.1 protein_id gnl|my_center|LOCUS_29860 284508 285233 gene locus_tag LOCUS_29870 284508 285233 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_29870 286325 285318 gene locus_tag LOCUS_29880 gene argF 286325 285318 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012908.1 protein_id gnl|my_center|LOCUS_29880 286488 286907 gene locus_tag LOCUS_29890 gene rraB 286488 286907 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002940.1 protein_id gnl|my_center|LOCUS_29890 286955 287713 gene locus_tag LOCUS_29900 gene miaE 286955 287713 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218459.1 protein_id gnl|my_center|LOCUS_29900 288772 287750 gene locus_tag LOCUS_29910 288772 287750 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700204.1 protein_id gnl|my_center|LOCUS_29910 289466 288963 gene locus_tag LOCUS_29920 289466 288963 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368548.1 protein_id gnl|my_center|LOCUS_29920 289644 290837 gene locus_tag LOCUS_29930 289644 290837 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066967.1 protein_id gnl|my_center|LOCUS_29930 291023 292225 gene locus_tag LOCUS_29940 291023 292225 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066967.1 protein_id gnl|my_center|LOCUS_29940 295188 292333 gene locus_tag LOCUS_29950 295188 292333 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368547.1 protein_id gnl|my_center|LOCUS_29950 295631 295188 gene locus_tag LOCUS_29960 gene holC 295631 295188 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786399.1 protein_id gnl|my_center|LOCUS_29960 295743 296042 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 297628 296117 gene locus_tag LOCUS_29970 gene pepA 297628 296117 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 protein_id gnl|my_center|LOCUS_29970 297999 298997 gene locus_tag LOCUS_29980 gene lptF 297999 298997 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584132.1 protein_id gnl|my_center|LOCUS_29980 298997 300079 gene locus_tag LOCUS_29990 gene lptG 298997 300079 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 protein_id gnl|my_center|LOCUS_29990 300236 301876 gene locus_tag LOCUS_30000 300236 301876 CDS product glycerone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098955.1 protein_id gnl|my_center|LOCUS_30000 302952 301933 gene locus_tag LOCUS_30010 302952 301933 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098954.1 protein_id gnl|my_center|LOCUS_30010 303588 303010 gene locus_tag LOCUS_30020 303588 303010 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109982.1 protein_id gnl|my_center|LOCUS_30020 304601 303588 gene locus_tag LOCUS_30030 304601 303588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 304846 304930 gene locus_tag LOCUS_t00500 304846 304930 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 305265 306377 gene locus_tag LOCUS_30040 305265 306377 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209313.1 protein_id gnl|my_center|LOCUS_30040 306625 306852 gene locus_tag LOCUS_30050 306625 306852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 306852 308351 gene locus_tag LOCUS_30060 306852 308351 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263391.1 protein_id gnl|my_center|LOCUS_30060 308348 309574 gene locus_tag LOCUS_30070 308348 309574 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30070 309505 309831 gene locus_tag LOCUS_30080 309505 309831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 309824 311008 gene locus_tag LOCUS_30090 309824 311008 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263394.1 protein_id gnl|my_center|LOCUS_30090 311011 314073 gene locus_tag LOCUS_30100 311011 314073 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_30100 314804 314361 gene locus_tag LOCUS_30110 314804 314361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 315869 315030 gene locus_tag LOCUS_30120 315869 315030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30120 316540 315896 gene locus_tag LOCUS_30130 316540 315896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30130 317085 320600 gene locus_tag LOCUS_30140 gene yjhR 317085 320600 CDS product helicase YjhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181238188.1 protein_id gnl|my_center|LOCUS_30140 321310 320753 gene locus_tag LOCUS_30150 321310 320753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 321915 321604 gene locus_tag LOCUS_30160 321915 321604 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 protein_id gnl|my_center|LOCUS_30160 322011 322373 gene locus_tag LOCUS_30170 322011 322373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 324259 323156 gene locus_tag LOCUS_30180 324259 323156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 325152 324406 gene locus_tag LOCUS_30190 325152 324406 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095760.1 protein_id gnl|my_center|LOCUS_30190 326039 325152 gene locus_tag LOCUS_30200 326039 325152 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681808.1 protein_id gnl|my_center|LOCUS_30200 326307 326050 gene locus_tag LOCUS_30210 326307 326050 CDS product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095761.1 protein_id gnl|my_center|LOCUS_30210 326982 326590 gene locus_tag LOCUS_30220 326982 326590 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974579.1 protein_id gnl|my_center|LOCUS_30220 327651 328250 gene locus_tag LOCUS_30230 327651 328250 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278645.1 protein_id gnl|my_center|LOCUS_30230 328385 328615 gene locus_tag LOCUS_30240 328385 328615 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091314.1 protein_id gnl|my_center|LOCUS_30240 328801 329127 gene locus_tag LOCUS_30250 328801 329127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 329135 329959 gene locus_tag LOCUS_30260 329135 329959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211460.1 protein_id gnl|my_center|LOCUS_30260 330067 331323 gene locus_tag LOCUS_30270 330067 331323 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817199.1 protein_id gnl|my_center|LOCUS_30270 331320 331796 gene locus_tag LOCUS_30280 331320 331796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 331808 332914 gene locus_tag LOCUS_30290 331808 332914 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174045.1 protein_id gnl|my_center|LOCUS_30290 332915 334195 gene locus_tag LOCUS_30300 332915 334195 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213785.1 protein_id gnl|my_center|LOCUS_30300 334198 335070 gene locus_tag LOCUS_30310 334198 335070 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212164.1 protein_id gnl|my_center|LOCUS_30310 335070 335909 gene locus_tag LOCUS_30320 335070 335909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 335896 336636 gene locus_tag LOCUS_30330 335896 336636 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162526983.1 protein_id gnl|my_center|LOCUS_30330 336633 337124 gene locus_tag LOCUS_30340 336633 337124 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212167.1 protein_id gnl|my_center|LOCUS_30340 337087 337677 gene locus_tag LOCUS_30350 gene tadF 337087 337677 CDS product tight adherence pilus pseudopilin TadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817205.1 protein_id gnl|my_center|LOCUS_30350 337681 338043 gene locus_tag LOCUS_30360 337681 338043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 338019 339269 gene locus_tag LOCUS_30370 338019 339269 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817206.1 protein_id gnl|my_center|LOCUS_30370 339572 340114 gene locus_tag LOCUS_30380 339572 340114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 340201 340671 gene locus_tag LOCUS_30390 340201 340671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 340689 343232 gene locus_tag LOCUS_30400 340689 343232 CDS product CS1-pili formation C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094843.1 protein_id gnl|my_center|LOCUS_30400 343880 344323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 344386 345276 gene locus_tag LOCUS_30410 344386 345276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 345294 345794 gene locus_tag LOCUS_30420 345294 345794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 346115 346561 gene locus_tag LOCUS_30430 346115 346561 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383881.1 protein_id gnl|my_center|LOCUS_30430 346729 346929 gene locus_tag LOCUS_30440 gene glgS 346729 346929 CDS product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928927.1 protein_id gnl|my_center|LOCUS_30440 347194 349161 gene locus_tag LOCUS_30450 gene yagF 347194 349161 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151261.1 protein_id gnl|my_center|LOCUS_30450 349486 350865 gene locus_tag LOCUS_30460 349486 350865 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095375.1 protein_id gnl|my_center|LOCUS_30460 350876 352492 gene locus_tag LOCUS_30470 350876 352492 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095376.1 protein_id gnl|my_center|LOCUS_30470 353278 352505 gene locus_tag LOCUS_30480 gene xynR 353278 352505 CDS product DNA-binding transcriptional repressor XynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121657.1 protein_id gnl|my_center|LOCUS_30480 353497 353811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 356009 353820 gene locus_tag LOCUS_30490 356009 353820 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229242.1 protein_id gnl|my_center|LOCUS_30490 358677 355999 gene locus_tag LOCUS_30500 358677 355999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 359111 358677 gene locus_tag LOCUS_30510 359111 358677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 360502 359108 gene locus_tag LOCUS_30520 360502 359108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 362034 360487 gene locus_tag LOCUS_30530 362034 360487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 363362 362031 gene locus_tag LOCUS_30540 363362 362031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 365173 363359 gene locus_tag LOCUS_30550 365173 363359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 365469 366686 gene locus_tag LOCUS_30560 365469 366686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 366698 367606 gene locus_tag LOCUS_30570 366698 367606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 367616 368824 gene locus_tag LOCUS_30580 367616 368824 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 protein_id gnl|my_center|LOCUS_30580 368821 369156 gene locus_tag LOCUS_30590 368821 369156 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 protein_id gnl|my_center|LOCUS_30590 369163 369588 gene locus_tag LOCUS_30600 369163 369588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 370164 369592 gene locus_tag LOCUS_30610 370164 369592 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268672.1 protein_id gnl|my_center|LOCUS_30610 370489 371331 gene locus_tag LOCUS_30620 370489 371331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 371506 372807 gene locus_tag LOCUS_30630 371506 372807 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776803.1 protein_id gnl|my_center|LOCUS_30630 372821 375484 gene locus_tag LOCUS_30640 372821 375484 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_30640 375609 376970 gene locus_tag LOCUS_30650 375609 376970 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749944.1 protein_id gnl|my_center|LOCUS_30650 377230 378264 gene locus_tag LOCUS_30660 377230 378264 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227893.1 protein_id gnl|my_center|LOCUS_30660 378824 379231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 379856 381382 gene locus_tag LOCUS_30670 gene gguA 379856 381382 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_30670 381375 382394 gene locus_tag LOCUS_30680 381375 382394 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_30680 382466 383845 gene locus_tag LOCUS_30690 382466 383845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062228580.1 protein_id gnl|my_center|LOCUS_30690 383842 384774 gene locus_tag LOCUS_30700 383842 384774 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532707.1 protein_id gnl|my_center|LOCUS_30700 386369 384834 gene locus_tag LOCUS_30710 386369 384834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 387802 386366 gene locus_tag LOCUS_30720 387802 386366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 398080 388172 gene locus_tag LOCUS_30730 gene yapH 398080 388172 CDS product autotransporter adhesin YapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211638.1 protein_id gnl|my_center|LOCUS_30730 399140 400261 gene locus_tag LOCUS_30740 399140 400261 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816845.1 protein_id gnl|my_center|LOCUS_30740 400306 400662 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 401909 400665 gene locus_tag LOCUS_30750 gene mtr 401909 400665 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098910.1 protein_id gnl|my_center|LOCUS_30750 403404 402016 gene locus_tag LOCUS_30760 gene tnaA 403404 402016 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167041.1 protein_id gnl|my_center|LOCUS_30760 403880 405505 gene locus_tag LOCUS_30770 403880 405505 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963679.1 protein_id gnl|my_center|LOCUS_30770 408644 405648 gene locus_tag LOCUS_30780 408644 405648 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963680.1 protein_id gnl|my_center|LOCUS_30780 408852 409805 gene locus_tag LOCUS_30790 gene foxR 408852 409805 CDS product ferrioxamine uptake transcriptional regulator FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074609.1 protein_id gnl|my_center|LOCUS_30790 409815 410150 gene locus_tag LOCUS_30800 409815 410150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30800 410047 410610 gene locus_tag LOCUS_30810 410047 410610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30810 410643 410984 gene locus_tag LOCUS_30820 410643 410984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30820 411175 413265 gene locus_tag LOCUS_30830 gene foxA 411175 413265 CDS product ferrioxamine B receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127727.1 protein_id gnl|my_center|LOCUS_30830 414751 413333 gene locus_tag LOCUS_30840 414751 413333 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095421.1 protein_id gnl|my_center|LOCUS_30840 414928 415095 gene locus_tag LOCUS_30850 414928 415095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 415174 415776 gene locus_tag LOCUS_30860 415174 415776 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095419.1 protein_id gnl|my_center|LOCUS_30860 416843 417277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 417529 417840 gene locus_tag LOCUS_30870 417529 417840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 417846 419081 gene locus_tag LOCUS_30880 417846 419081 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_30880 419898 419119 gene locus_tag LOCUS_30890 419898 419119 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187753.1 protein_id gnl|my_center|LOCUS_30890 419986 420906 gene locus_tag LOCUS_30900 419986 420906 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523537.1 protein_id gnl|my_center|LOCUS_30900 422325 420985 gene locus_tag LOCUS_30910 422325 420985 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704269.1 protein_id gnl|my_center|LOCUS_30910 423233 422322 gene locus_tag LOCUS_30920 423233 422322 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704270.1 protein_id gnl|my_center|LOCUS_30920 423591 424541 gene locus_tag LOCUS_30930 423591 424541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 424569 425000 gene locus_tag LOCUS_30940 424569 425000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 425115 425576 gene locus_tag LOCUS_30950 425115 425576 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095432.1 protein_id gnl|my_center|LOCUS_30950 425587 426651 gene locus_tag LOCUS_30960 425587 426651 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095433.1 protein_id gnl|my_center|LOCUS_30960 426641 427702 gene locus_tag LOCUS_30970 426641 427702 CDS product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095434.1 protein_id gnl|my_center|LOCUS_30970 428997 427783 gene locus_tag LOCUS_30980 gene mdtM 428997 427783 CDS product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188918.1 protein_id gnl|my_center|LOCUS_30980 430351 429071 gene locus_tag LOCUS_30990 430351 429071 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033044.1 protein_id gnl|my_center|LOCUS_30990 430514 431956 gene locus_tag LOCUS_31000 430514 431956 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649434.1 protein_id gnl|my_center|LOCUS_31000 432501 431980 gene locus_tag LOCUS_31010 432501 431980 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026192141.1 protein_id gnl|my_center|LOCUS_31010 433519 432551 gene locus_tag LOCUS_31020 gene yjiA 433519 432551 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095443.1 protein_id gnl|my_center|LOCUS_31020 433731 433528 gene locus_tag LOCUS_31030 433731 433528 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856610.1 protein_id gnl|my_center|LOCUS_31030 435946 433829 gene locus_tag LOCUS_31040 435946 433829 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095444.1 protein_id gnl|my_center|LOCUS_31040 435954 436115 gene locus_tag LOCUS_31050 435954 436115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 436339 438003 gene locus_tag LOCUS_31060 gene tsr 436339 438003 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095457.1 protein_id gnl|my_center|LOCUS_31060 440451 438160 gene locus_tag LOCUS_31070 gene opgB 440451 438160 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292715.1 protein_id gnl|my_center|LOCUS_31070 441388 440651 gene locus_tag LOCUS_31080 gene dnaC 441388 440651 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799923.1 protein_id gnl|my_center|LOCUS_31080 441930 441391 gene locus_tag LOCUS_31090 gene dnaT 441930 441391 CDS product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378979.1 protein_id gnl|my_center|LOCUS_31090 442546 442118 gene locus_tag LOCUS_31100 442546 442118 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 protein_id gnl|my_center|LOCUS_31100 443080 442625 gene locus_tag LOCUS_31110 443080 442625 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 protein_id gnl|my_center|LOCUS_31110 443624 443151 gene locus_tag LOCUS_31120 443624 443151 CDS product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095466.1 protein_id gnl|my_center|LOCUS_31120 444391 443615 gene locus_tag LOCUS_31130 444391 443615 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989102.1 protein_id gnl|my_center|LOCUS_31130 444426 444638 gene locus_tag LOCUS_31140 444426 444638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 444936 445619 gene locus_tag LOCUS_31150 444936 445619 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688833.1 protein_id gnl|my_center|LOCUS_31150 445619 446239 gene locus_tag LOCUS_31160 gene bglJ 445619 446239 CDS product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095473.1 protein_id gnl|my_center|LOCUS_31160 446732 446274 gene locus_tag LOCUS_31170 446732 446274 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368396.1 protein_id gnl|my_center|LOCUS_31170 447070 448413 gene locus_tag LOCUS_31180 447070 448413 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095475.1 protein_id gnl|my_center|LOCUS_31180 449220 448465 gene locus_tag LOCUS_31190 gene fhuF 449220 448465 CDS product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331545.1 protein_id gnl|my_center|LOCUS_31190 450412 449348 gene locus_tag LOCUS_31200 450412 449348 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418641.1 protein_id gnl|my_center|LOCUS_31200 450663 450902 gene locus_tag LOCUS_31210 450663 450902 CDS product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001577669.1 protein_id gnl|my_center|LOCUS_31210 451023 450937 gene locus_tag LOCUS_t00510 451023 450937 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 451143 451057 gene locus_tag LOCUS_t00520 451143 451057 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 451258 451172 gene locus_tag LOCUS_t00530 451258 451172 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 452523 451492 gene locus_tag LOCUS_31220 gene rsmC 452523 451492 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095479.1 protein_id gnl|my_center|LOCUS_31220 452849 453069 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 453204 453674 gene locus_tag LOCUS_31230 gene rimI 453204 453674 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 protein_id gnl|my_center|LOCUS_31230 453714 454391 gene locus_tag LOCUS_31240 gene yjjG 453714 454391 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095482.1 protein_id gnl|my_center|LOCUS_31240 454480 456069 gene locus_tag LOCUS_31250 gene prfC 454480 456069 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175968.1 protein_id gnl|my_center|LOCUS_31250 456469 457089 gene locus_tag LOCUS_31260 gene osmY 456469 457089 CDS product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095484.1 protein_id gnl|my_center|LOCUS_31260 457222 457383 gene locus_tag LOCUS_31270 457222 457383 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 protein_id gnl|my_center|LOCUS_31270 457500 458594 gene locus_tag LOCUS_31280 457500 458594 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531551.1 protein_id gnl|my_center|LOCUS_31280 458591 459373 gene locus_tag LOCUS_31290 458591 459373 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095486.1 protein_id gnl|my_center|LOCUS_31290 459764 460543 gene locus_tag LOCUS_31300 gene deoC 459764 460543 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095489.1 protein_id gnl|my_center|LOCUS_31300 460599 461921 gene locus_tag LOCUS_31310 gene deoA 460599 461921 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095490.1 protein_id gnl|my_center|LOCUS_31310 461974 463197 gene locus_tag LOCUS_31320 gene deoB 461974 463197 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095491.1 protein_id gnl|my_center|LOCUS_31320 463280 463999 gene locus_tag LOCUS_31330 gene deoD 463280 463999 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224864.1 protein_id gnl|my_center|LOCUS_31330 465105 464089 gene locus_tag LOCUS_31340 gene lplA 465105 464089 CDS product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105844.1 protein_id gnl|my_center|LOCUS_31340 465777 465133 gene locus_tag LOCUS_31350 465777 465133 CDS product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090067.1 protein_id gnl|my_center|LOCUS_31350 465883 466854 gene locus_tag LOCUS_31360 gene serB 465883 466854 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132955.1 protein_id gnl|my_center|LOCUS_31360 466878 468260 gene locus_tag LOCUS_31370 gene radA 466878 468260 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029720.1 protein_id gnl|my_center|LOCUS_31370 468343 469581 gene locus_tag LOCUS_31380 gene nadR 468343 469581 CDS product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532645.1 protein_id gnl|my_center|LOCUS_31380 470769 469663 gene locus_tag LOCUS_31390 470769 469663 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366291.1 protein_id gnl|my_center|LOCUS_31390 471124 470813 gene locus_tag LOCUS_31400 471124 470813 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705652.1 protein_id gnl|my_center|LOCUS_31400 471667 471197 gene locus_tag LOCUS_31410 471667 471197 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705653.1 protein_id gnl|my_center|LOCUS_31410 472410 471769 gene locus_tag LOCUS_31420 472410 471769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 472430 473699 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 474670 473711 gene locus_tag LOCUS_31430 gene tal 474670 473711 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003709.1 protein_id gnl|my_center|LOCUS_31430 475422 474742 gene locus_tag LOCUS_31440 gene alsE 475422 474742 CDS product D-allulose 6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185669695.1 protein_id gnl|my_center|LOCUS_31440 476709 475447 gene locus_tag LOCUS_31450 476709 475447 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705655.1 protein_id gnl|my_center|LOCUS_31450 477006 476740 gene locus_tag LOCUS_31460 477006 476740 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366287.1 protein_id gnl|my_center|LOCUS_31460 477457 477020 gene locus_tag LOCUS_31470 477457 477020 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705656.1 protein_id gnl|my_center|LOCUS_31470 477672 478721 gene locus_tag LOCUS_31480 477672 478721 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366285.1 protein_id gnl|my_center|LOCUS_31480 480736 479069 gene locus_tag LOCUS_31490 gene ettA 480736 479069 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095500.1 protein_id gnl|my_center|LOCUS_31490 480942 482882 gene locus_tag LOCUS_31500 gene sltY 480942 482882 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409451.1 protein_id gnl|my_center|LOCUS_31500 482946 483275 gene locus_tag LOCUS_31510 gene trpR 482946 483275 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368371.1 protein_id gnl|my_center|LOCUS_31510 483787 483266 gene locus_tag LOCUS_31520 gene yjjX 483787 483266 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704327.1 protein_id gnl|my_center|LOCUS_31520 483877 484524 gene locus_tag LOCUS_31530 gene gpmB 483877 484524 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942359.1 protein_id gnl|my_center|LOCUS_31530 485390 484521 gene locus_tag LOCUS_31540 gene robA 485390 484521 CDS product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704329.1 protein_id gnl|my_center|LOCUS_31540 485568 486071 gene locus_tag LOCUS_31550 gene creA 485568 486071 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095506.1 protein_id gnl|my_center|LOCUS_31550 486077 486772 gene locus_tag LOCUS_31560 gene creB 486077 486772 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368366.1 protein_id gnl|my_center|LOCUS_31560 486772 488196 gene locus_tag LOCUS_31570 gene creC 486772 488196 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219579.1 protein_id gnl|my_center|LOCUS_31570 488254 489636 gene locus_tag LOCUS_31580 gene creD 488254 489636 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445894.1 protein_id gnl|my_center|LOCUS_31580 490433 489717 gene locus_tag LOCUS_31590 gene arcA 490433 489717 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 protein_id gnl|my_center|LOCUS_31590 491068 491754 gene locus_tag LOCUS_31600 491068 491754 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095507.1 protein_id gnl|my_center|LOCUS_31600 492111 494573 gene locus_tag LOCUS_31610 gene thrA 492111 494573 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264731.1 protein_id gnl|my_center|LOCUS_31610 494575 495504 gene locus_tag LOCUS_31620 gene thrB 494575 495504 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095510.1 protein_id gnl|my_center|LOCUS_31620 495508 496791 gene locus_tag LOCUS_31630 gene thrC 495508 496791 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095511.1 protein_id gnl|my_center|LOCUS_31630 496997 497278 gene locus_tag LOCUS_31640 496997 497278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 498099 497326 gene locus_tag LOCUS_31650 gene yaaA 498099 497326 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 protein_id gnl|my_center|LOCUS_31650 499604 498177 gene locus_tag LOCUS_31660 499604 498177 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095514.1 protein_id gnl|my_center|LOCUS_31660 499818 500771 gene locus_tag LOCUS_31670 gene tal 499818 500771 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368356.1 protein_id gnl|my_center|LOCUS_31670 500873 501460 gene locus_tag LOCUS_31680 gene mog 500873 501460 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094685.1 protein_id gnl|my_center|LOCUS_31680 501587 502897 gene locus_tag LOCUS_31690 501587 502897 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095517.1 protein_id gnl|my_center|LOCUS_31690 504166 502907 gene locus_tag LOCUS_31700 504166 502907 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200855.1 protein_id gnl|my_center|LOCUS_31700 504843 504277 gene locus_tag LOCUS_31710 gene satP 504843 504277 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095518.1 protein_id gnl|my_center|LOCUS_31710 505139 507055 gene locus_tag LOCUS_31720 gene dnaK 505139 507055 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516126.1 protein_id gnl|my_center|LOCUS_31720 507140 508285 gene locus_tag LOCUS_31730 gene dnaJ 507140 508285 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119009.1 protein_id gnl|my_center|LOCUS_31730 508663 509424 gene locus_tag LOCUS_31740 508663 509424 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274832.1 protein_id gnl|my_center|LOCUS_31740 509444 510946 gene locus_tag LOCUS_31750 509444 510946 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831876.1 protein_id gnl|my_center|LOCUS_31750 511117 512370 gene locus_tag LOCUS_31760 511117 512370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494928.1 protein_id gnl|my_center|LOCUS_31760 512480 512935 gene locus_tag LOCUS_31770 512480 512935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31770 512947 513654 gene locus_tag LOCUS_31780 512947 513654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31780 513707 514597 gene locus_tag LOCUS_31790 gene nhaR 513707 514597 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368331.1 protein_id gnl|my_center|LOCUS_31790 514680 514991 gene locus_tag LOCUS_31800 514680 514991 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095429.1 protein_id gnl|my_center|LOCUS_31800 514996 515394 gene locus_tag LOCUS_31810 514996 515394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460651.1 protein_id gnl|my_center|LOCUS_31810 515378 516079 gene locus_tag LOCUS_31820 515378 516079 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095431.1 protein_id gnl|my_center|LOCUS_31820 516404 516141 gene locus_tag LOCUS_31830 gene rpsT 516404 516141 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 protein_id gnl|my_center|LOCUS_31830 516734 517672 gene locus_tag LOCUS_31840 gene ribF 516734 517672 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767329.1 protein_id gnl|my_center|LOCUS_31840 517706 520555 gene locus_tag LOCUS_31850 gene ileS 517706 520555 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095526.1 protein_id gnl|my_center|LOCUS_31850 520555 521055 gene locus_tag LOCUS_31860 gene lspA 520555 521055 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095527.1 protein_id gnl|my_center|LOCUS_31860 521080 521583 gene locus_tag LOCUS_31870 gene fkpB 521080 521583 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004655.1 protein_id gnl|my_center|LOCUS_31870 521585 522535 gene locus_tag LOCUS_31880 gene ispH 521585 522535 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368325.1 protein_id gnl|my_center|LOCUS_31880 522600 523514 gene locus_tag LOCUS_31890 gene rihC 522600 523514 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704354.1 protein_id gnl|my_center|LOCUS_31890 523715 523945 gene locus_tag LOCUS_31900 523715 523945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31900 524525 523920 gene locus_tag LOCUS_31910 524525 523920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 524555 524857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 525253 525876 gene locus_tag LOCUS_31920 525253 525876 CDS product alanyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368315.1 protein_id gnl|my_center|LOCUS_31920 526628 525930 gene locus_tag LOCUS_31930 526628 525930 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368314.1 protein_id gnl|my_center|LOCUS_31930 528249 526621 gene locus_tag LOCUS_31940 528249 526621 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704359.1 protein_id gnl|my_center|LOCUS_31940 528528 531004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 532418 531078 gene locus_tag LOCUS_31950 gene citS 532418 531078 CDS product citrate/sodium symporter CitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704361.1 protein_id gnl|my_center|LOCUS_31950 532676 533704 gene locus_tag LOCUS_31960 gene citC 532676 533704 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704362.1 protein_id gnl|my_center|LOCUS_31960 533735 534028 gene locus_tag LOCUS_31970 gene citD 533735 534028 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542888.1 protein_id gnl|my_center|LOCUS_31970 534325 534689 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 534789 535286 gene locus_tag LOCUS_31980 534789 535286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 535297 536832 gene locus_tag LOCUS_31990 gene citF 535297 536832 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368306.1 protein_id gnl|my_center|LOCUS_31990 536855 537763 gene locus_tag LOCUS_32000 gene citG 536855 537763 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704364.1 protein_id gnl|my_center|LOCUS_32000 538025 538846 gene locus_tag LOCUS_32010 gene dapB 538025 538846 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543604.1 protein_id gnl|my_center|LOCUS_32010 539092 539274 gene locus_tag LOCUS_32020 539092 539274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 539303 540451 gene locus_tag LOCUS_32030 gene carA 539303 540451 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704367.1 protein_id gnl|my_center|LOCUS_32030 540469 543693 gene locus_tag LOCUS_32040 gene carB 540469 543693 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095532.1 protein_id gnl|my_center|LOCUS_32040 543834 544067 gene locus_tag LOCUS_32050 543834 544067 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172089.1 protein_id gnl|my_center|LOCUS_32050 545077 544070 gene locus_tag LOCUS_32060 545077 544070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 545726 546313 gene locus_tag LOCUS_32070 545726 546313 CDS product common pilus major fimbrillin subunit EcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704519.1 protein_id gnl|my_center|LOCUS_32070 546375 547043 gene locus_tag LOCUS_32080 546375 547043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368090.1 protein_id gnl|my_center|LOCUS_32080 547069 548283 gene locus_tag LOCUS_32090 547069 548283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32090 548381 549598 gene locus_tag LOCUS_32100 548381 549598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32100 549599 551221 gene locus_tag LOCUS_32110 gene ecpD 549599 551221 CDS product fimbrial adhesin EcpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012968862.1 protein_id gnl|my_center|LOCUS_32110 551190 551888 gene locus_tag LOCUS_32120 551190 551888 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704522.1 protein_id gnl|my_center|LOCUS_32120 551995 552525 gene locus_tag LOCUS_32130 gene kefF 551995 552525 CDS product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600737.1 protein_id gnl|my_center|LOCUS_32130 552518 554380 gene locus_tag LOCUS_32140 gene kefC 552518 554380 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095537.1 protein_id gnl|my_center|LOCUS_32140 554535 555014 gene locus_tag LOCUS_32150 gene folA 554535 555014 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502023.1 protein_id gnl|my_center|LOCUS_32150 555898 555050 gene locus_tag LOCUS_32160 gene apaH 555898 555050 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095538.1 protein_id gnl|my_center|LOCUS_32160 556280 555903 gene locus_tag LOCUS_32170 gene apaG 556280 555903 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095539.1 protein_id gnl|my_center|LOCUS_32170 557099 556281 gene locus_tag LOCUS_32180 gene rsmA 557099 556281 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065397.1 protein_id gnl|my_center|LOCUS_32180 558082 557096 gene locus_tag LOCUS_32190 gene pdxA 558082 557096 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241277.1 protein_id gnl|my_center|LOCUS_32190 559368 558082 gene locus_tag LOCUS_32200 gene surA 559368 558082 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 protein_id gnl|my_center|LOCUS_32200 561791 559425 gene locus_tag LOCUS_32210 gene lptD 561791 559425 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095543.1 protein_id gnl|my_center|LOCUS_32210 561965 562777 gene locus_tag LOCUS_32220 gene djlA 561965 562777 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200595.1 protein_id gnl|my_center|LOCUS_32220 563545 562886 gene locus_tag LOCUS_32230 gene rluA 563545 562886 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888348.1 protein_id gnl|my_center|LOCUS_32230 566463 563557 gene locus_tag LOCUS_32240 gene rapA 566463 563557 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418667.1 protein_id gnl|my_center|LOCUS_32240 569025 566647 gene locus_tag LOCUS_32250 gene polB 569025 566647 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095547.1 protein_id gnl|my_center|LOCUS_32250 569678 569049 gene locus_tag LOCUS_32260 569678 569049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 570521 569826 gene locus_tag LOCUS_32270 gene araD 570521 569826 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888666.1 protein_id gnl|my_center|LOCUS_32270 572161 570659 gene locus_tag LOCUS_32280 gene araA 572161 570659 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095549.1 protein_id gnl|my_center|LOCUS_32280 573866 572172 gene locus_tag LOCUS_32290 gene araB 573866 572172 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095550.1 protein_id gnl|my_center|LOCUS_32290 574202 575047 gene locus_tag LOCUS_32300 gene araC 574202 575047 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368277.1 protein_id gnl|my_center|LOCUS_32300 575317 576549 gene locus_tag LOCUS_32310 575317 576549 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703938.1 protein_id gnl|my_center|LOCUS_32310 576577 577503 gene locus_tag LOCUS_32320 576577 577503 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_32320 577554 578504 gene locus_tag LOCUS_32330 577554 578504 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 protein_id gnl|my_center|LOCUS_32330 578554 578997 gene locus_tag LOCUS_32340 578554 578997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 579006 580499 gene locus_tag LOCUS_32350 579006 580499 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_32350 580646 581410 gene locus_tag LOCUS_32360 580646 581410 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095552.1 protein_id gnl|my_center|LOCUS_32360 582098 581403 gene locus_tag LOCUS_32370 gene thiQ 582098 581403 CDS product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915973.1 protein_id gnl|my_center|LOCUS_32370 583692 582082 gene locus_tag LOCUS_32380 gene thiP 583692 582082 CDS product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235674.1 protein_id gnl|my_center|LOCUS_32380 584651 583668 gene locus_tag LOCUS_32390 gene thiB 584651 583668 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915326.1 protein_id gnl|my_center|LOCUS_32390 586474 584819 gene locus_tag LOCUS_32400 gene sgrR 586474 584819 CDS product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095556.1 protein_id gnl|my_center|LOCUS_32400 586716 587876 gene locus_tag LOCUS_32410 586716 587876 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095558.1 protein_id gnl|my_center|LOCUS_32410 589122 587914 gene locus_tag LOCUS_32420 589122 587914 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704387.1 protein_id gnl|my_center|LOCUS_32420 589453 590349 gene locus_tag LOCUS_32430 589453 590349 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704388.1 protein_id gnl|my_center|LOCUS_32430 591154 590387 gene locus_tag LOCUS_32440 gene aroD 591154 590387 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704389.1 protein_id gnl|my_center|LOCUS_32440 592388 591174 gene locus_tag LOCUS_32450 592388 591174 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704390.1 protein_id gnl|my_center|LOCUS_32450 593263 592400 gene locus_tag LOCUS_32460 593263 592400 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704391.1 protein_id gnl|my_center|LOCUS_32460 595307 593274 gene locus_tag LOCUS_32470 595307 593274 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704392.1 protein_id gnl|my_center|LOCUS_32470 596291 595686 gene locus_tag LOCUS_32480 gene leuD 596291 595686 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095559.1 protein_id gnl|my_center|LOCUS_32480 597699 596302 gene locus_tag LOCUS_32490 gene leuC 597699 596302 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140632.1 protein_id gnl|my_center|LOCUS_32490 598793 597702 gene locus_tag LOCUS_32500 gene leuB 598793 597702 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368262.1 protein_id gnl|my_center|LOCUS_32500 600364 598793 gene locus_tag LOCUS_32510 gene leuA 600364 598793 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095562.1 protein_id gnl|my_center|LOCUS_32510 601137 602099 gene locus_tag LOCUS_32520 gene leuO 601137 602099 CDS product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095563.1 protein_id gnl|my_center|LOCUS_32520 602474 604198 gene locus_tag LOCUS_32530 gene ilvI 602474 604198 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425651.1 protein_id gnl|my_center|LOCUS_32530 604171 604692 gene locus_tag LOCUS_32540 gene ilvN 604171 604692 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252744.1 protein_id gnl|my_center|LOCUS_32540 604874 605878 gene locus_tag LOCUS_32550 gene cra 604874 605878 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762406.1 protein_id gnl|my_center|LOCUS_32550 606482 606940 gene locus_tag LOCUS_32560 gene mraZ 606482 606940 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095567.1 protein_id gnl|my_center|LOCUS_32560 606940 607884 gene locus_tag LOCUS_32570 gene rsmH 606940 607884 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095568.1 protein_id gnl|my_center|LOCUS_32570 607881 608246 gene locus_tag LOCUS_32580 gene ftsL 607881 608246 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501989.1 protein_id gnl|my_center|LOCUS_32580 608262 610031 gene locus_tag LOCUS_32590 608262 610031 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368251.1 protein_id gnl|my_center|LOCUS_32590 610090 611505 gene locus_tag LOCUS_32600 gene murE 610090 611505 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 protein_id gnl|my_center|LOCUS_32600 611502 612860 gene locus_tag LOCUS_32610 gene murF 611502 612860 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626681.1 protein_id gnl|my_center|LOCUS_32610 612854 613936 gene locus_tag LOCUS_32620 gene mraY 612854 613936 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501985.1 protein_id gnl|my_center|LOCUS_32620 613939 615255 gene locus_tag LOCUS_32630 gene murD 613939 615255 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095572.1 protein_id gnl|my_center|LOCUS_32630 615255 616499 gene locus_tag LOCUS_32640 gene ftsW 615255 616499 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239803.1 protein_id gnl|my_center|LOCUS_32640 616496 617563 gene locus_tag LOCUS_32650 gene murG 616496 617563 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016559.1 protein_id gnl|my_center|LOCUS_32650 617622 619091 gene locus_tag LOCUS_32660 gene murC 617622 619091 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096072.1 protein_id gnl|my_center|LOCUS_32660 619084 620004 gene locus_tag LOCUS_32670 gene ddlB 619084 620004 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130042.1 protein_id gnl|my_center|LOCUS_32670 620006 620836 gene locus_tag LOCUS_32680 gene ftsQ 620006 620836 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368242.1 protein_id gnl|my_center|LOCUS_32680 620836 622092 gene locus_tag LOCUS_32690 gene ftsA 620836 622092 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006173845.1 protein_id gnl|my_center|LOCUS_32690 622155 623303 gene locus_tag LOCUS_32700 gene ftsZ 622155 623303 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004857884.1 protein_id gnl|my_center|LOCUS_32700 623404 624321 gene locus_tag LOCUS_32710 gene lpxC 623404 624321 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 protein_id gnl|my_center|LOCUS_32710 624585 625085 gene locus_tag LOCUS_32720 gene secM 624585 625085 CDS product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095579.1 protein_id gnl|my_center|LOCUS_32720 625145 627850 gene locus_tag LOCUS_32730 gene secA 625145 627850 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905763.1 protein_id gnl|my_center|LOCUS_32730 628067 628462 gene locus_tag LOCUS_32740 gene mutT 628067 628462 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368238.1 protein_id gnl|my_center|LOCUS_32740 628706 628512 gene locus_tag LOCUS_32750 gene yacG 628706 628512 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368237.1 protein_id gnl|my_center|LOCUS_32750 629459 628716 gene locus_tag LOCUS_32760 gene zapD 629459 628716 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095583.1 protein_id gnl|my_center|LOCUS_32760 630079 629459 gene locus_tag LOCUS_32770 gene coaE 630079 629459 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270913.1 protein_id gnl|my_center|LOCUS_32770 631360 631797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 633288 632086 gene locus_tag LOCUS_32780 gene hofC 633288 632086 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157266.1 protein_id gnl|my_center|LOCUS_32780 634663 633278 gene locus_tag LOCUS_32790 gene gspE 634663 633278 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095587.1 protein_id gnl|my_center|LOCUS_32790 635110 634673 gene locus_tag LOCUS_32800 gene ppdD 635110 634673 CDS product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095588.1 protein_id gnl|my_center|LOCUS_32800 636205 635309 gene locus_tag LOCUS_32810 gene nadC 636205 635309 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704410.1 protein_id gnl|my_center|LOCUS_32810 636347 636910 gene locus_tag LOCUS_32820 gene ampD 636347 636910 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 protein_id gnl|my_center|LOCUS_32820 636907 637761 gene locus_tag LOCUS_32830 gene ampE 636907 637761 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095591.1 protein_id gnl|my_center|LOCUS_32830 638727 637780 gene locus_tag LOCUS_32840 638727 637780 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095592.1 protein_id gnl|my_center|LOCUS_32840 640133 638727 gene locus_tag LOCUS_32850 640133 638727 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357550.1 protein_id gnl|my_center|LOCUS_32850 641673 640300 gene locus_tag LOCUS_32860 gene aroP 641673 640300 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 protein_id gnl|my_center|LOCUS_32860 642205 642969 gene locus_tag LOCUS_32870 gene pdhR 642205 642969 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 protein_id gnl|my_center|LOCUS_32870 643132 645795 gene locus_tag LOCUS_32880 gene aceE 643132 645795 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095597.1 protein_id gnl|my_center|LOCUS_32880 645810 647708 gene locus_tag LOCUS_32890 gene aceF 645810 647708 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 protein_id gnl|my_center|LOCUS_32890 647907 649331 gene locus_tag LOCUS_32900 gene lpdA 647907 649331 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519338.1 protein_id gnl|my_center|LOCUS_32900 649558 649842 gene locus_tag LOCUS_32910 649558 649842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704416.1 protein_id gnl|my_center|LOCUS_32910 650722 649931 gene locus_tag LOCUS_32920 650722 649931 CDS product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095600.1 protein_id gnl|my_center|LOCUS_32920 651131 650733 gene locus_tag LOCUS_32930 651131 650733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32930 652275 651034 gene locus_tag LOCUS_32940 652275 651034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32940 652605 655202 gene locus_tag LOCUS_32950 gene acnB 652605 655202 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888954.1 protein_id gnl|my_center|LOCUS_32950 655388 655750 gene locus_tag LOCUS_32960 gene yacL 655388 655750 CDS product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095603.1 protein_id gnl|my_center|LOCUS_32960 656570 655776 gene locus_tag LOCUS_32970 gene speD 656570 655776 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095609.1 protein_id gnl|my_center|LOCUS_32970 657439 656585 gene locus_tag LOCUS_32980 gene speE 657439 656585 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829972.1 protein_id gnl|my_center|LOCUS_32980 657855 657532 gene locus_tag LOCUS_32990 657855 657532 CDS product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295568.1 protein_id gnl|my_center|LOCUS_32990 658069 659622 gene locus_tag LOCUS_33000 gene cueO 658069 659622 CDS product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095612.1 protein_id gnl|my_center|LOCUS_33000 659781 660015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 662479 660092 gene locus_tag LOCUS_33010 662479 660092 CDS product pyrroloquinoline quinone-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095613.1 protein_id gnl|my_center|LOCUS_33010 662707 663222 gene locus_tag LOCUS_33020 gene hpt 662707 663222 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 protein_id gnl|my_center|LOCUS_33020 663960 663298 gene locus_tag LOCUS_33030 gene can 663960 663298 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651600.1 protein_id gnl|my_center|LOCUS_33030 664068 664994 gene locus_tag LOCUS_33040 664068 664994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095616.1 protein_id gnl|my_center|LOCUS_33040 664991 665761 gene locus_tag LOCUS_33050 664991 665761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095617.1 protein_id gnl|my_center|LOCUS_33050 665882 666322 gene locus_tag LOCUS_33060 665882 666322 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095618.1 protein_id gnl|my_center|LOCUS_33060 666385 667629 gene locus_tag LOCUS_33070 666385 667629 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420882.1 protein_id gnl|my_center|LOCUS_33070 668011 667631 gene locus_tag LOCUS_33080 gene panD 668011 667631 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621526.1 protein_id gnl|my_center|LOCUS_33080 668928 668074 gene locus_tag LOCUS_33090 gene panC 668928 668074 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095627.1 protein_id gnl|my_center|LOCUS_33090 669734 668940 gene locus_tag LOCUS_33100 gene panB 669734 668940 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805455.1 protein_id gnl|my_center|LOCUS_33100 670327 669842 gene locus_tag LOCUS_33110 gene folK 670327 669842 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704426.1 protein_id gnl|my_center|LOCUS_33110 671742 670372 gene locus_tag LOCUS_33120 gene pcnB 671742 670372 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295781.1 protein_id gnl|my_center|LOCUS_33120 672726 671824 gene locus_tag LOCUS_33130 gene gluQRS 672726 671824 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937424.1 protein_id gnl|my_center|LOCUS_33130 673248 672793 gene locus_tag LOCUS_33140 gene dksA 673248 672793 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007373199.1 protein_id gnl|my_center|LOCUS_33140 674131 673427 gene locus_tag LOCUS_33150 gene sfsA 674131 673427 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095633.1 protein_id gnl|my_center|LOCUS_33150 674674 674144 gene locus_tag LOCUS_33160 gene thpR 674674 674144 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095634.1 protein_id gnl|my_center|LOCUS_33160 674730 677231 gene locus_tag LOCUS_33170 gene hrpB 674730 677231 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309224.1 protein_id gnl|my_center|LOCUS_33170 677440 679980 gene locus_tag LOCUS_33180 gene mrcB 677440 679980 CDS product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095636.1 protein_id gnl|my_center|LOCUS_33180 680304 682469 gene locus_tag LOCUS_33190 gene fhuA 680304 682469 CDS product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035485.1 protein_id gnl|my_center|LOCUS_33190 682514 683311 gene locus_tag LOCUS_33200 gene fhuC 682514 683311 CDS product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704433.1 protein_id gnl|my_center|LOCUS_33200 683311 684201 gene locus_tag LOCUS_33210 gene fhuD 683311 684201 CDS product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208784.1 protein_id gnl|my_center|LOCUS_33210 684198 686180 gene locus_tag LOCUS_33220 gene fhuB 684198 686180 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095640.1 protein_id gnl|my_center|LOCUS_33220 687557 686277 gene locus_tag LOCUS_33230 gene hemL 687557 686277 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045309.1 protein_id gnl|my_center|LOCUS_33230 687718 689115 gene locus_tag LOCUS_33240 gene clcA 687718 689115 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368182.1 protein_id gnl|my_center|LOCUS_33240 689197 689541 gene locus_tag LOCUS_33250 gene erpA 689197 689541 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 protein_id gnl|my_center|LOCUS_33250 690223 689600 gene locus_tag LOCUS_33260 690223 689600 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 protein_id gnl|my_center|LOCUS_33260 691033 690236 gene locus_tag LOCUS_33270 gene btuF 691033 690236 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118833.1 protein_id gnl|my_center|LOCUS_33270 691724 691026 gene locus_tag LOCUS_33280 gene mtnN 691724 691026 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689821.1 protein_id gnl|my_center|LOCUS_33280 691833 693347 gene locus_tag LOCUS_33290 gene dgt 691833 693347 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057067.1 protein_id gnl|my_center|LOCUS_33290 693484 694911 gene locus_tag LOCUS_33300 gene degP 693484 694911 CDS product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095648.1 protein_id gnl|my_center|LOCUS_33300 695074 696231 gene locus_tag LOCUS_33310 gene cdaR 695074 696231 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 protein_id gnl|my_center|LOCUS_33310 696758 696369 gene locus_tag LOCUS_33320 696758 696369 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501916.1 protein_id gnl|my_center|LOCUS_33320 697704 696880 gene locus_tag LOCUS_33330 gene dapD 697704 696880 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186656.1 protein_id gnl|my_center|LOCUS_33330 700410 697735 gene locus_tag LOCUS_33340 gene glnD 700410 697735 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095651.1 protein_id gnl|my_center|LOCUS_33340 701386 700595 gene locus_tag LOCUS_33350 gene map 701386 700595 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095652.1 protein_id gnl|my_center|LOCUS_33350 701705 702430 gene locus_tag LOCUS_33360 gene rpsB 701705 702430 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095653.1 protein_id gnl|my_center|LOCUS_33360 702552 703403 gene locus_tag LOCUS_33370 gene tsf 702552 703403 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501911.1 protein_id gnl|my_center|LOCUS_33370 703549 704274 gene locus_tag LOCUS_33380 gene pyrH 703549 704274 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856194.1 protein_id gnl|my_center|LOCUS_33380 704429 704986 gene locus_tag LOCUS_33390 gene frr 704429 704986 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622423.1 protein_id gnl|my_center|LOCUS_33390 705082 706281 gene locus_tag LOCUS_33400 gene ispC 705082 706281 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811924.1 protein_id gnl|my_center|LOCUS_33400 706535 707224 gene locus_tag LOCUS_33410 gene ispU 706535 707224 CDS product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028110.1 protein_id gnl|my_center|LOCUS_33410 707237 708094 gene locus_tag LOCUS_33420 gene cdsA 707237 708094 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 protein_id gnl|my_center|LOCUS_33420 708106 709455 gene locus_tag LOCUS_33430 gene rseP 708106 709455 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095658.1 protein_id gnl|my_center|LOCUS_33430 709487 711904 gene locus_tag LOCUS_33440 gene bamA 709487 711904 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 protein_id gnl|my_center|LOCUS_33440 712023 712517 gene locus_tag LOCUS_33450 gene skp 712023 712517 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095660.1 protein_id gnl|my_center|LOCUS_33450 712521 713546 gene locus_tag LOCUS_33460 gene lpxD 712521 713546 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368156.1 protein_id gnl|my_center|LOCUS_33460 713651 714106 gene locus_tag LOCUS_33470 gene fabZ 713651 714106 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145858.1 protein_id gnl|my_center|LOCUS_33470 714110 714898 gene locus_tag LOCUS_33480 gene lpxA 714110 714898 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368155.1 protein_id gnl|my_center|LOCUS_33480 714898 716046 gene locus_tag LOCUS_33490 gene lpxB 714898 716046 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741216.1 protein_id gnl|my_center|LOCUS_33490 716043 716639 gene locus_tag LOCUS_33500 gene rnhB 716043 716639 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095664.1 protein_id gnl|my_center|LOCUS_33500 716678 720160 gene locus_tag LOCUS_33510 gene dnaE 716678 720160 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095665.1 protein_id gnl|my_center|LOCUS_33510 720173 721132 gene locus_tag LOCUS_33520 gene accA 720173 721132 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055741.1 protein_id gnl|my_center|LOCUS_33520 721262 723382 gene locus_tag LOCUS_33530 721262 723382 CDS product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095667.1 protein_id gnl|my_center|LOCUS_33530 723437 723826 gene locus_tag LOCUS_33540 723437 723826 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704453.1 protein_id gnl|my_center|LOCUS_33540 723889 725187 gene locus_tag LOCUS_33550 gene tilS 723889 725187 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176578.1 protein_id gnl|my_center|LOCUS_33550 725476 725216 gene locus_tag LOCUS_33560 gene rof 725476 725216 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062305.1 protein_id gnl|my_center|LOCUS_33560 725663 725463 gene locus_tag LOCUS_33570 725663 725463 CDS product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501889.1 protein_id gnl|my_center|LOCUS_33570 725844 726389 gene locus_tag LOCUS_33580 725844 726389 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 protein_id gnl|my_center|LOCUS_33580 726386 726814 gene locus_tag LOCUS_33590 gene arfB 726386 726814 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095673.1 protein_id gnl|my_center|LOCUS_33590 726838 727530 gene locus_tag LOCUS_33600 gene nlpE 726838 727530 CDS product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095674.1 protein_id gnl|my_center|LOCUS_33600 729283 727565 gene locus_tag LOCUS_33610 gene proS 729283 727565 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260694.1 protein_id gnl|my_center|LOCUS_33610 730103 729396 gene locus_tag LOCUS_33620 gene tsaA 730103 729396 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095676.1 protein_id gnl|my_center|LOCUS_33620 730507 730100 gene locus_tag LOCUS_33630 gene rcsF 730507 730100 CDS product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 protein_id gnl|my_center|LOCUS_33630 731431 730616 gene locus_tag LOCUS_33640 gene metQ 731431 730616 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 protein_id gnl|my_center|LOCUS_33640 732128 731475 gene locus_tag LOCUS_33650 732128 731475 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 protein_id gnl|my_center|LOCUS_33650 733152 732121 gene locus_tag LOCUS_33660 gene metN 733152 732121 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593994.1 protein_id gnl|my_center|LOCUS_33660 733341 733913 gene locus_tag LOCUS_33670 gene gmhB 733341 733913 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140174.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence04 143 838 gene locus_tag LOCUS_33680 143 838 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099390.1 protein_id gnl|my_center|LOCUS_33680 850 2241 gene locus_tag LOCUS_33690 gene mdtD 850 2241 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 protein_id gnl|my_center|LOCUS_33690 3236 2244 gene locus_tag LOCUS_33700 gene rbsR 3236 2244 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703923.1 protein_id gnl|my_center|LOCUS_33700 4169 3240 gene locus_tag LOCUS_33710 gene rbsK 4169 3240 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420966.1 protein_id gnl|my_center|LOCUS_33710 5118 4228 gene locus_tag LOCUS_33720 gene rbsB 5118 4228 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056273.1 protein_id gnl|my_center|LOCUS_33720 6110 5145 gene locus_tag LOCUS_33730 gene rbsC 6110 5145 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099395.1 protein_id gnl|my_center|LOCUS_33730 7621 6116 gene locus_tag LOCUS_33740 gene rbsA 7621 6116 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099396.1 protein_id gnl|my_center|LOCUS_33740 8048 7629 gene locus_tag LOCUS_33750 gene rbsD 8048 7629 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099397.1 protein_id gnl|my_center|LOCUS_33750 10122 8254 gene locus_tag LOCUS_33760 gene kup 10122 8254 CDS product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099398.1 protein_id gnl|my_center|LOCUS_33760 10357 11856 gene locus_tag LOCUS_33770 gene ravA 10357 11856 CDS product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099399.1 protein_id gnl|my_center|LOCUS_33770 11850 11987 gene locus_tag LOCUS_33780 11850 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33780 12367 12593 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12627 13523 gene locus_tag LOCUS_33790 12627 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 14426 13527 gene locus_tag LOCUS_33800 gene asnA 14426 13527 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368997.1 protein_id gnl|my_center|LOCUS_33800 14670 15128 gene locus_tag LOCUS_33810 gene asnC 14670 15128 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 protein_id gnl|my_center|LOCUS_33810 15228 15677 gene locus_tag LOCUS_33820 gene mioC 15228 15677 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099402.1 protein_id gnl|my_center|LOCUS_33820 16050 17939 gene locus_tag LOCUS_33830 gene mnmG 16050 17939 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 protein_id gnl|my_center|LOCUS_33830 18044 18667 gene locus_tag LOCUS_33840 gene rsmG 18044 18667 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932839.1 protein_id gnl|my_center|LOCUS_33840 19284 19664 gene locus_tag LOCUS_33850 gene atpI 19284 19664 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500194.1 protein_id gnl|my_center|LOCUS_33850 19673 20491 gene locus_tag LOCUS_33860 gene atpB 19673 20491 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135618.1 protein_id gnl|my_center|LOCUS_33860 20541 20780 gene locus_tag LOCUS_33870 gene atpE 20541 20780 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 protein_id gnl|my_center|LOCUS_33870 20839 21309 gene locus_tag LOCUS_33880 gene atpF 20839 21309 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004107293.1 protein_id gnl|my_center|LOCUS_33880 21324 21857 gene locus_tag LOCUS_33890 gene atpH 21324 21857 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288957.1 protein_id gnl|my_center|LOCUS_33890 21870 23411 gene locus_tag LOCUS_33900 gene atpA 21870 23411 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 protein_id gnl|my_center|LOCUS_33900 23462 24325 gene locus_tag LOCUS_33910 gene atpG 23462 24325 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369007.1 protein_id gnl|my_center|LOCUS_33910 24357 25739 gene locus_tag LOCUS_33920 gene atpD 24357 25739 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190499.1 protein_id gnl|my_center|LOCUS_33920 25760 26179 gene locus_tag LOCUS_33930 25760 26179 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251971.1 protein_id gnl|my_center|LOCUS_33930 26506 27876 gene locus_tag LOCUS_33940 gene glmU 26506 27876 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933729.1 protein_id gnl|my_center|LOCUS_33940 28056 29885 gene locus_tag LOCUS_33950 gene glmS 28056 29885 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099409.1 protein_id gnl|my_center|LOCUS_33950 29954 30517 gene locus_tag LOCUS_33960 29954 30517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 30627 31667 gene locus_tag LOCUS_33970 gene pstS 30627 31667 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 protein_id gnl|my_center|LOCUS_33970 31775 32734 gene locus_tag LOCUS_33980 gene pstC 31775 32734 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099411.1 protein_id gnl|my_center|LOCUS_33980 32734 33621 gene locus_tag LOCUS_33990 gene pstA 32734 33621 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212190.1 protein_id gnl|my_center|LOCUS_33990 33668 34441 gene locus_tag LOCUS_34000 gene pstB 33668 34441 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369015.1 protein_id gnl|my_center|LOCUS_34000 34456 35181 gene locus_tag LOCUS_34010 gene phoU 34456 35181 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500182.1 protein_id gnl|my_center|LOCUS_34010 35362 36540 gene locus_tag LOCUS_34020 35362 36540 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_34020 37242 36577 gene locus_tag LOCUS_34030 gene yieH 37242 36577 CDS product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099413.1 protein_id gnl|my_center|LOCUS_34030 37411 38748 gene locus_tag LOCUS_34040 gene adeP 37411 38748 CDS product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214973.1 protein_id gnl|my_center|LOCUS_34040 39541 38798 gene locus_tag LOCUS_34050 39541 38798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099416.1 protein_id gnl|my_center|LOCUS_34050 40410 39712 gene locus_tag LOCUS_34060 40410 39712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 40894 40487 gene locus_tag LOCUS_34070 40894 40487 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026330850.1 protein_id gnl|my_center|LOCUS_34070 41325 40942 gene locus_tag LOCUS_34080 41325 40942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 41351 41828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44515 42872 gene locus_tag LOCUS_34090 gene yidC 44515 42872 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099419.1 protein_id gnl|my_center|LOCUS_34090 45928 47256 gene locus_tag LOCUS_34100 gene dnaA 45928 47256 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 protein_id gnl|my_center|LOCUS_34100 47261 48361 gene locus_tag LOCUS_34110 gene dnaN 47261 48361 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 protein_id gnl|my_center|LOCUS_34110 48509 49582 gene locus_tag LOCUS_34120 gene recF 48509 49582 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094779.1 protein_id gnl|my_center|LOCUS_34120 49611 52025 gene locus_tag LOCUS_34130 gene gyrB 49611 52025 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 protein_id gnl|my_center|LOCUS_34130 52895 52086 gene locus_tag LOCUS_34140 gene mutM 52895 52086 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094894.1 protein_id gnl|my_center|LOCUS_34140 53132 52965 gene locus_tag LOCUS_34150 gene rpmG 53132 52965 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 protein_id gnl|my_center|LOCUS_34150 53389 53153 gene locus_tag LOCUS_34160 gene rpmB 53389 53153 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436699.1 protein_id gnl|my_center|LOCUS_34160 54273 53605 gene locus_tag LOCUS_34170 gene radC 54273 53605 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298959.1 protein_id gnl|my_center|LOCUS_34170 54476 56089 gene locus_tag LOCUS_34180 54476 56089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 56209 56805 gene locus_tag LOCUS_34190 gene slmA 56209 56805 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094890.1 protein_id gnl|my_center|LOCUS_34190 56986 58002 gene locus_tag LOCUS_34200 56986 58002 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_34200 58678 58037 gene locus_tag LOCUS_34210 gene pyrE 58678 58037 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 protein_id gnl|my_center|LOCUS_34210 59498 58782 gene locus_tag LOCUS_34220 gene rph 59498 58782 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 protein_id gnl|my_center|LOCUS_34220 59623 60486 gene locus_tag LOCUS_34230 59623 60486 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621352.1 protein_id gnl|my_center|LOCUS_34230 60655 61416 gene locus_tag LOCUS_34240 60655 61416 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098370.1 protein_id gnl|my_center|LOCUS_34240 61403 61588 gene locus_tag LOCUS_34250 61403 61588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 61569 62318 gene locus_tag LOCUS_34260 61569 62318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 62441 62980 gene locus_tag LOCUS_34270 62441 62980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 62920 64092 gene locus_tag LOCUS_34280 62920 64092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34280 65777 64098 gene locus_tag LOCUS_34290 gene ligB 65777 64098 CDS product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703813.1 protein_id gnl|my_center|LOCUS_34290 66034 66657 gene locus_tag LOCUS_34300 gene gmk 66034 66657 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046966.1 protein_id gnl|my_center|LOCUS_34300 66711 66986 gene locus_tag LOCUS_34310 gene rpoZ 66711 66986 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 protein_id gnl|my_center|LOCUS_34310 67005 69125 gene locus_tag LOCUS_34320 gene spoT 67005 69125 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280491.1 protein_id gnl|my_center|LOCUS_34320 69131 69820 gene locus_tag LOCUS_34330 gene trmH 69131 69820 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070177.1 protein_id gnl|my_center|LOCUS_34330 69824 71905 gene locus_tag LOCUS_34340 gene recG 69824 71905 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016758.1 protein_id gnl|my_center|LOCUS_34340 72981 71923 gene locus_tag LOCUS_34350 gene gltS 72981 71923 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468824.1 protein_id gnl|my_center|LOCUS_34350 73350 74741 gene locus_tag LOCUS_34360 gene xanP 73350 74741 CDS product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295238.1 protein_id gnl|my_center|LOCUS_34360 74861 76588 gene locus_tag LOCUS_34370 74861 76588 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094876.1 protein_id gnl|my_center|LOCUS_34370 76654 77127 gene locus_tag LOCUS_34380 gene trmL 76654 77127 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932331.1 protein_id gnl|my_center|LOCUS_34380 77991 77170 gene locus_tag LOCUS_34390 gene cysE 77991 77170 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 protein_id gnl|my_center|LOCUS_34390 79089 78070 gene locus_tag LOCUS_34400 gene gpsA 79089 78070 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 protein_id gnl|my_center|LOCUS_34400 79556 79089 gene locus_tag LOCUS_34410 gene secB 79556 79089 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860835.1 protein_id gnl|my_center|LOCUS_34410 79895 79644 gene locus_tag LOCUS_34420 gene grxC 79895 79644 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273795.1 protein_id gnl|my_center|LOCUS_34420 80399 79968 gene locus_tag LOCUS_34430 80399 79968 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369178.1 protein_id gnl|my_center|LOCUS_34430 80644 82188 gene locus_tag LOCUS_34440 gene gpmM 80644 82188 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296527.1 protein_id gnl|my_center|LOCUS_34440 82282 83463 gene locus_tag LOCUS_34450 gene envC 82282 83463 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214137.1 protein_id gnl|my_center|LOCUS_34450 83467 84399 gene locus_tag LOCUS_34460 83467 84399 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135520.1 protein_id gnl|my_center|LOCUS_34460 85193 84396 gene locus_tag LOCUS_34470 85193 84396 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152082698.1 protein_id gnl|my_center|LOCUS_34470 86446 85421 gene locus_tag LOCUS_34480 gene tdh 86446 85421 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646019.1 protein_id gnl|my_center|LOCUS_34480 87654 86458 gene locus_tag LOCUS_34490 gene kbl 87654 86458 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213794.1 protein_id gnl|my_center|LOCUS_34490 87870 88802 gene locus_tag LOCUS_34500 gene rfaD 87870 88802 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587764.1 protein_id gnl|my_center|LOCUS_34500 88812 89858 gene locus_tag LOCUS_34510 gene rfaF 88812 89858 CDS product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 protein_id gnl|my_center|LOCUS_34510 89862 90845 gene locus_tag LOCUS_34520 gene rfaC 89862 90845 CDS product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264584.1 protein_id gnl|my_center|LOCUS_34520 90838 91941 gene locus_tag LOCUS_34530 gene rfaQ 90838 91941 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703803.1 protein_id gnl|my_center|LOCUS_34530 91938 93047 gene locus_tag LOCUS_34540 91938 93047 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094900.1 protein_id gnl|my_center|LOCUS_34540 94081 93026 gene locus_tag LOCUS_34550 94081 93026 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925698.1 protein_id gnl|my_center|LOCUS_34550 94367 95737 gene locus_tag LOCUS_34560 94367 95737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 95865 96848 gene locus_tag LOCUS_34570 95865 96848 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094898.1 protein_id gnl|my_center|LOCUS_34570 96857 97828 gene locus_tag LOCUS_34580 96857 97828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 97843 99477 gene locus_tag LOCUS_34590 97843 99477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 99659 100933 gene locus_tag LOCUS_34600 gene waaA 99659 100933 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 protein_id gnl|my_center|LOCUS_34600 100933 101703 gene locus_tag LOCUS_34610 100933 101703 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094896.1 protein_id gnl|my_center|LOCUS_34610 101707 102192 gene locus_tag LOCUS_34620 gene coaD 101707 102192 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703808.1 protein_id gnl|my_center|LOCUS_34620 103066 102179 gene locus_tag LOCUS_34630 103066 102179 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366976.1 protein_id gnl|my_center|LOCUS_34630 103269 104318 gene locus_tag LOCUS_34640 gene yahK 103269 104318 CDS product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692761.1 protein_id gnl|my_center|LOCUS_34640 104759 105946 gene locus_tag LOCUS_34650 104759 105946 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583058.1 protein_id gnl|my_center|LOCUS_34650 105974 107254 gene locus_tag LOCUS_34660 105974 107254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 107251 108408 gene locus_tag LOCUS_34670 107251 108408 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919017.1 protein_id gnl|my_center|LOCUS_34670 109224 108475 gene locus_tag LOCUS_34680 109224 108475 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223997.1 protein_id gnl|my_center|LOCUS_34680 109343 110242 gene locus_tag LOCUS_34690 109343 110242 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969186.1 protein_id gnl|my_center|LOCUS_34690 111152 110253 gene locus_tag LOCUS_34700 111152 110253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 111474 112364 gene locus_tag LOCUS_34710 111474 112364 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770246.1 protein_id gnl|my_center|LOCUS_34710 113860 112421 gene locus_tag LOCUS_34720 113860 112421 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392014.1 protein_id gnl|my_center|LOCUS_34720 114867 113866 gene locus_tag LOCUS_34730 114867 113866 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098398.1 protein_id gnl|my_center|LOCUS_34730 115712 114867 gene locus_tag LOCUS_34740 115712 114867 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098399.1 protein_id gnl|my_center|LOCUS_34740 116662 115811 gene locus_tag LOCUS_34750 116662 115811 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803721.1 protein_id gnl|my_center|LOCUS_34750 118012 117059 gene locus_tag LOCUS_34760 118012 117059 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704664.1 protein_id gnl|my_center|LOCUS_34760 119079 118144 gene locus_tag LOCUS_34770 119079 118144 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850115.1 protein_id gnl|my_center|LOCUS_34770 120292 119084 gene locus_tag LOCUS_34780 120292 119084 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037802.1 protein_id gnl|my_center|LOCUS_34780 121074 120313 gene locus_tag LOCUS_34790 121074 120313 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971207.1 protein_id gnl|my_center|LOCUS_34790 122100 121168 gene locus_tag LOCUS_34800 122100 121168 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039278.1 protein_id gnl|my_center|LOCUS_34800 122300 122953 gene locus_tag LOCUS_34810 gene nfsB 122300 122953 CDS product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367810.1 protein_id gnl|my_center|LOCUS_34810 123868 122963 gene locus_tag LOCUS_34820 123868 122963 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703863.1 protein_id gnl|my_center|LOCUS_34820 123991 124527 gene locus_tag LOCUS_34830 123991 124527 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369089.1 protein_id gnl|my_center|LOCUS_34830 124675 125229 gene locus_tag LOCUS_34840 124675 125229 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111523.1 protein_id gnl|my_center|LOCUS_34840 126274 125321 gene locus_tag LOCUS_34850 126274 125321 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094823.1 protein_id gnl|my_center|LOCUS_34850 126626 126880 gene locus_tag LOCUS_34860 126626 126880 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094822.1 protein_id gnl|my_center|LOCUS_34860 126893 128221 gene locus_tag LOCUS_34870 126893 128221 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703869.1 protein_id gnl|my_center|LOCUS_34870 128236 129624 gene locus_tag LOCUS_34880 128236 129624 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270464.1 protein_id gnl|my_center|LOCUS_34880 129631 129933 gene locus_tag LOCUS_34890 129631 129933 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500136.1 protein_id gnl|my_center|LOCUS_34890 130072 131451 gene locus_tag LOCUS_34900 130072 131451 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094819.1 protein_id gnl|my_center|LOCUS_34900 131542 132447 gene locus_tag LOCUS_34910 131542 132447 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094818.1 protein_id gnl|my_center|LOCUS_34910 132668 132762 gene locus_tag LOCUS_t00540 132668 132762 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 132958 133491 gene locus_tag LOCUS_34920 132958 133491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 133644 133853 gene locus_tag LOCUS_34930 133644 133853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 133855 134505 gene locus_tag LOCUS_34940 133855 134505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 135049 134858 gene locus_tag LOCUS_34950 135049 134858 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703844.1 protein_id gnl|my_center|LOCUS_34950 135186 135473 gene locus_tag LOCUS_34960 135186 135473 CDS product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703845.1 protein_id gnl|my_center|LOCUS_34960 135597 135857 gene locus_tag LOCUS_34970 135597 135857 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 protein_id gnl|my_center|LOCUS_34970 136138 136926 gene locus_tag LOCUS_34980 136138 136926 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251798.1 protein_id gnl|my_center|LOCUS_34980 136931 137836 gene locus_tag LOCUS_34990 136931 137836 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714563.1 protein_id gnl|my_center|LOCUS_34990 137845 139809 gene locus_tag LOCUS_35000 gene yjhG 137845 139809 CDS product xylonate dehydratase YjhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116326.1 protein_id gnl|my_center|LOCUS_35000 139900 141249 gene locus_tag LOCUS_35010 139900 141249 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128363.1 protein_id gnl|my_center|LOCUS_35010 141444 142256 gene locus_tag LOCUS_35020 gene yidA 141444 142256 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 protein_id gnl|my_center|LOCUS_35020 142939 142283 gene locus_tag LOCUS_35030 gene yidX 142939 142283 CDS product protein YidX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772953.1 protein_id gnl|my_center|LOCUS_35030 143257 143946 gene locus_tag LOCUS_35040 gene dgoR 143257 143946 CDS product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369039.1 protein_id gnl|my_center|LOCUS_35040 143943 144857 gene locus_tag LOCUS_35050 gene dgoK 143943 144857 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127076.1 protein_id gnl|my_center|LOCUS_35050 144930 145547 gene locus_tag LOCUS_35060 144930 145547 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703895.1 protein_id gnl|my_center|LOCUS_35060 145544 146692 gene locus_tag LOCUS_35070 gene dgoD 145544 146692 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094786.1 protein_id gnl|my_center|LOCUS_35070 146907 148199 gene locus_tag LOCUS_35080 146907 148199 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496901.1 protein_id gnl|my_center|LOCUS_35080 149302 148196 gene locus_tag LOCUS_35090 gene cbrA 149302 148196 CDS product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052030.1 protein_id gnl|my_center|LOCUS_35090 149426 150652 gene locus_tag LOCUS_35100 149426 150652 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094788.1 protein_id gnl|my_center|LOCUS_35100 150983 150654 gene locus_tag LOCUS_35110 150983 150654 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685435.1 protein_id gnl|my_center|LOCUS_35110 151287 151700 gene locus_tag LOCUS_35120 gene ibpA 151287 151700 CDS product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532742.1 protein_id gnl|my_center|LOCUS_35120 151863 152291 gene locus_tag LOCUS_35130 gene ibpB 151863 152291 CDS product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094790.1 protein_id gnl|my_center|LOCUS_35130 152450 154111 gene locus_tag LOCUS_35140 152450 154111 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279784.1 protein_id gnl|my_center|LOCUS_35140 154995 154114 gene locus_tag LOCUS_35150 154995 154114 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 protein_id gnl|my_center|LOCUS_35150 155175 156890 gene locus_tag LOCUS_35160 155175 156890 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087177.1 protein_id gnl|my_center|LOCUS_35160 156887 158380 gene locus_tag LOCUS_35170 156887 158380 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828527.1 protein_id gnl|my_center|LOCUS_35170 158880 158425 gene locus_tag LOCUS_35180 gene yidI 158880 158425 CDS product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511287.1 protein_id gnl|my_center|LOCUS_35180 158965 159312 gene locus_tag LOCUS_35190 158965 159312 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703889.1 protein_id gnl|my_center|LOCUS_35190 159302 159652 gene locus_tag LOCUS_35200 159302 159652 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094796.1 protein_id gnl|my_center|LOCUS_35200 161011 159653 gene locus_tag LOCUS_35210 gene dsdA 161011 159653 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426437.1 protein_id gnl|my_center|LOCUS_35210 161153 162241 gene locus_tag LOCUS_35220 161153 162241 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238915.1 protein_id gnl|my_center|LOCUS_35220 163295 162144 gene locus_tag LOCUS_35230 gene emrD 163295 162144 CDS product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420858.1 protein_id gnl|my_center|LOCUS_35230 163611 164360 gene locus_tag LOCUS_35240 163611 164360 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438650.1 protein_id gnl|my_center|LOCUS_35240 164705 166171 gene locus_tag LOCUS_35250 164705 166171 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640209.1 protein_id gnl|my_center|LOCUS_35250 166180 167196 gene locus_tag LOCUS_35260 166180 167196 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853929.1 protein_id gnl|my_center|LOCUS_35260 167209 168216 gene locus_tag LOCUS_35270 167209 168216 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214544.1 protein_id gnl|my_center|LOCUS_35270 169088 168255 gene locus_tag LOCUS_35280 169088 168255 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094802.1 protein_id gnl|my_center|LOCUS_35280 170057 171745 gene locus_tag LOCUS_35290 gene ilvB 170057 171745 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094808.1 protein_id gnl|my_center|LOCUS_35290 171749 172039 gene locus_tag LOCUS_35300 gene ilvN 171749 172039 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171826.1 protein_id gnl|my_center|LOCUS_35300 173418 172072 gene locus_tag LOCUS_35310 173418 172072 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942667.1 protein_id gnl|my_center|LOCUS_35310 175003 173480 gene locus_tag LOCUS_35320 175003 173480 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_35320 175918 175019 gene locus_tag LOCUS_35330 gene yagE 175918 175019 CDS product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095373.1 protein_id gnl|my_center|LOCUS_35330 176136 176903 gene locus_tag LOCUS_35340 176136 176903 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894191.1 protein_id gnl|my_center|LOCUS_35340 177751 176957 gene locus_tag LOCUS_35350 177751 176957 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448638.1 protein_id gnl|my_center|LOCUS_35350 178015 178935 gene locus_tag LOCUS_35360 gene rbsK 178015 178935 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350272.1 protein_id gnl|my_center|LOCUS_35360 179050 180342 gene locus_tag LOCUS_35370 gene fucP 179050 180342 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998359.1 protein_id gnl|my_center|LOCUS_35370 180353 181366 gene locus_tag LOCUS_35380 180353 181366 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213216.1 protein_id gnl|my_center|LOCUS_35380 181462 181914 gene locus_tag LOCUS_35390 181462 181914 CDS product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094815.1 protein_id gnl|my_center|LOCUS_35390 182020 183201 gene locus_tag LOCUS_35400 gene nepI 182020 183201 CDS product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004798.1 protein_id gnl|my_center|LOCUS_35400 184023 183256 gene locus_tag LOCUS_35410 gene tpiA 184023 183256 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862019.1 protein_id gnl|my_center|LOCUS_35410 184710 184129 gene locus_tag LOCUS_35420 184710 184129 CDS product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802217.1 protein_id gnl|my_center|LOCUS_35420 184823 185242 gene locus_tag LOCUS_35430 184823 185242 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 protein_id gnl|my_center|LOCUS_35430 185989 185243 gene locus_tag LOCUS_35440 gene fpr 185989 185243 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796310.1 protein_id gnl|my_center|LOCUS_35440 187096 186086 gene locus_tag LOCUS_35450 gene glpX 187096 186086 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 protein_id gnl|my_center|LOCUS_35450 188371 187184 gene locus_tag LOCUS_35460 gene lldD 188371 187184 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094925.1 protein_id gnl|my_center|LOCUS_35460 189143 188349 gene locus_tag LOCUS_35470 gene lldR 189143 188349 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636695.1 protein_id gnl|my_center|LOCUS_35470 189714 189352 gene locus_tag LOCUS_35480 189714 189352 CDS product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665687.1 protein_id gnl|my_center|LOCUS_35480 189852 190070 gene locus_tag LOCUS_35490 189852 190070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369187.1 protein_id gnl|my_center|LOCUS_35490 190689 190099 gene locus_tag LOCUS_35500 gene mtlR 190689 190099 CDS product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094931.1 protein_id gnl|my_center|LOCUS_35500 191834 190686 gene locus_tag LOCUS_35510 gene mtlD 191834 190686 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703789.1 protein_id gnl|my_center|LOCUS_35510 193914 192004 gene locus_tag LOCUS_35520 193914 192004 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094933.1 protein_id gnl|my_center|LOCUS_35520 194436 195044 gene locus_tag LOCUS_35530 194436 195044 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 protein_id gnl|my_center|LOCUS_35530 195139 196527 gene locus_tag LOCUS_35540 gene selA 195139 196527 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206261.1 protein_id gnl|my_center|LOCUS_35540 196524 198374 gene locus_tag LOCUS_35550 gene selB 196524 198374 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094939.1 protein_id gnl|my_center|LOCUS_35550 199291 198410 gene locus_tag LOCUS_35560 199291 198410 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188270.1 protein_id gnl|my_center|LOCUS_35560 199745 200152 gene locus_tag LOCUS_35570 199745 200152 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499744.1 protein_id gnl|my_center|LOCUS_35570 200237 200446 gene locus_tag LOCUS_35580 200237 200446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 200532 201905 gene locus_tag LOCUS_35590 gene dbpA 200532 201905 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123708.1 protein_id gnl|my_center|LOCUS_35590 202442 201972 gene locus_tag LOCUS_35600 202442 201972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 204192 203497 gene locus_tag LOCUS_35610 gene araD 204192 203497 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893174.1 protein_id gnl|my_center|LOCUS_35610 205046 204186 gene locus_tag LOCUS_35620 205046 204186 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361569.1 protein_id gnl|my_center|LOCUS_35620 205702 205049 gene locus_tag LOCUS_35630 gene ulaD 205702 205049 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089538.1 protein_id gnl|my_center|LOCUS_35630 207195 205699 gene locus_tag LOCUS_35640 207195 205699 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094950.1 protein_id gnl|my_center|LOCUS_35640 208198 207212 gene locus_tag LOCUS_35650 gene yiaO 208198 207212 CDS product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776911.1 protein_id gnl|my_center|LOCUS_35650 209488 208211 gene locus_tag LOCUS_35660 gene yiaN 209488 208211 CDS product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279599.1 protein_id gnl|my_center|LOCUS_35660 209799 209491 gene locus_tag LOCUS_35670 209799 209491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 210585 210118 gene locus_tag LOCUS_35680 210585 210118 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094953.1 protein_id gnl|my_center|LOCUS_35680 211595 210597 gene locus_tag LOCUS_35690 gene yiaK 211595 210597 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869039.1 protein_id gnl|my_center|LOCUS_35690 211919 212740 gene locus_tag LOCUS_35700 gene yiaJ 211919 212740 CDS product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514240.1 protein_id gnl|my_center|LOCUS_35700 212852 213349 gene locus_tag LOCUS_35710 212852 213349 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337793.1 protein_id gnl|my_center|LOCUS_35710 214619 213366 gene locus_tag LOCUS_35720 gene avtA 214619 213366 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094957.1 protein_id gnl|my_center|LOCUS_35720 216828 214798 gene locus_tag LOCUS_35730 216828 214798 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418400.1 protein_id gnl|my_center|LOCUS_35730 217404 217976 gene locus_tag LOCUS_35740 217404 217976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 219239 218061 gene locus_tag LOCUS_35750 219239 218061 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094960.1 protein_id gnl|my_center|LOCUS_35750 220514 219333 gene locus_tag LOCUS_35760 gene xylH 220514 219333 CDS product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045978.1 protein_id gnl|my_center|LOCUS_35760 222033 220492 gene locus_tag LOCUS_35770 222033 220492 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094962.1 protein_id gnl|my_center|LOCUS_35770 223105 222113 gene locus_tag LOCUS_35780 gene xylF 223105 222113 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094963.1 protein_id gnl|my_center|LOCUS_35780 223471 224793 gene locus_tag LOCUS_35790 gene xylA 223471 224793 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830210.1 protein_id gnl|my_center|LOCUS_35790 224853 226307 gene locus_tag LOCUS_35800 gene xylB 224853 226307 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275365.1 protein_id gnl|my_center|LOCUS_35800 226442 226981 gene locus_tag LOCUS_35810 226442 226981 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094966.1 protein_id gnl|my_center|LOCUS_35810 226978 227895 gene locus_tag LOCUS_35820 226978 227895 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 protein_id gnl|my_center|LOCUS_35820 228065 228448 gene locus_tag LOCUS_35830 gene yiaA 228065 228448 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001329946.1 protein_id gnl|my_center|LOCUS_35830 229476 228481 gene locus_tag LOCUS_35840 gene wecH 229476 228481 CDS product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182653.1 protein_id gnl|my_center|LOCUS_35840 229642 229944 gene locus_tag LOCUS_35850 229642 229944 CDS product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094969.1 protein_id gnl|my_center|LOCUS_35850 230050 230961 gene locus_tag LOCUS_35860 gene glyQ 230050 230961 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 protein_id gnl|my_center|LOCUS_35860 230971 233040 gene locus_tag LOCUS_35870 gene glyS 230971 233040 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291805.1 protein_id gnl|my_center|LOCUS_35870 233996 233706 gene locus_tag LOCUS_35880 233996 233706 CDS product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455790.1 protein_id gnl|my_center|LOCUS_35880 234379 235089 gene locus_tag LOCUS_35890 234379 235089 CDS product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190524.1 protein_id gnl|my_center|LOCUS_35890 235337 235549 gene locus_tag LOCUS_35900 gene cspA 235337 235549 CDS product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 protein_id gnl|my_center|LOCUS_35900 236573 235599 gene locus_tag LOCUS_35910 gene ghrB 236573 235599 CDS product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369217.1 protein_id gnl|my_center|LOCUS_35910 237880 236594 gene locus_tag LOCUS_35920 237880 236594 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094976.1 protein_id gnl|my_center|LOCUS_35920 238902 237964 gene locus_tag LOCUS_35930 238902 237964 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703773.1 protein_id gnl|my_center|LOCUS_35930 239656 238907 gene locus_tag LOCUS_35940 239656 238907 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094978.1 protein_id gnl|my_center|LOCUS_35940 240784 239768 gene locus_tag LOCUS_35950 240784 239768 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094979.1 protein_id gnl|my_center|LOCUS_35950 240989 243319 gene locus_tag LOCUS_35960 240989 243319 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094982.1 protein_id gnl|my_center|LOCUS_35960 243728 243282 gene locus_tag LOCUS_35970 243728 243282 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094983.1 protein_id gnl|my_center|LOCUS_35970 244287 243706 gene locus_tag LOCUS_35980 gene tag 244287 243706 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094984.1 protein_id gnl|my_center|LOCUS_35980 244514 245203 gene locus_tag LOCUS_35990 244514 245203 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637074.1 protein_id gnl|my_center|LOCUS_35990 245447 246649 gene locus_tag LOCUS_36000 245447 246649 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703768.1 protein_id gnl|my_center|LOCUS_36000 246883 248034 gene locus_tag LOCUS_36010 246883 248034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36010 247997 248566 gene locus_tag LOCUS_36020 247997 248566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36020 248656 248732 gene locus_tag LOCUS_t00550 248656 248732 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 249247 249665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 250027 251607 gene locus_tag LOCUS_36030 250027 251607 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418419.1 protein_id gnl|my_center|LOCUS_36030 251737 252756 gene locus_tag LOCUS_36040 gene dppB 251737 252756 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830232.1 protein_id gnl|my_center|LOCUS_36040 252766 253668 gene locus_tag LOCUS_36050 gene dppC 252766 253668 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 protein_id gnl|my_center|LOCUS_36050 253679 254662 gene locus_tag LOCUS_36060 gene dppD 253679 254662 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196507.1 protein_id gnl|my_center|LOCUS_36060 254659 255669 gene locus_tag LOCUS_36070 gene dppF 254659 255669 CDS product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094995.1 protein_id gnl|my_center|LOCUS_36070 257472 255874 gene locus_tag LOCUS_36080 257472 255874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 protein_id gnl|my_center|LOCUS_36080 257887 257492 gene locus_tag LOCUS_36090 257887 257492 CDS product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214035.1 protein_id gnl|my_center|LOCUS_36090 258870 257917 gene locus_tag LOCUS_36100 gene arcC 258870 257917 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240546.1 protein_id gnl|my_center|LOCUS_36100 260266 258863 gene locus_tag LOCUS_36110 260266 258863 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093933.1 protein_id gnl|my_center|LOCUS_36110 261814 260267 gene locus_tag LOCUS_36120 gene fdrA 261814 260267 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865648.1 protein_id gnl|my_center|LOCUS_36120 262516 261854 gene locus_tag LOCUS_36130 262516 261854 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 protein_id gnl|my_center|LOCUS_36130 262690 263433 gene locus_tag LOCUS_36140 262690 263433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 264336 263425 gene locus_tag LOCUS_36150 264336 263425 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470719.1 protein_id gnl|my_center|LOCUS_36150 264834 265373 gene locus_tag LOCUS_36160 264834 265373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 265364 266167 gene locus_tag LOCUS_36170 265364 266167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 266185 268299 gene locus_tag LOCUS_36180 266185 268299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 268296 270563 gene locus_tag LOCUS_36190 gene bcsB 268296 270563 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263700.1 protein_id gnl|my_center|LOCUS_36190 270577 274578 gene locus_tag LOCUS_36200 270577 274578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 274578 275057 gene locus_tag LOCUS_36210 274578 275057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 275066 276061 gene locus_tag LOCUS_36220 275066 276061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 276159 276502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 278239 276563 gene locus_tag LOCUS_36230 gene bcsG 278239 276563 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099223.1 protein_id gnl|my_center|LOCUS_36230 278429 278232 gene locus_tag LOCUS_36240 gene bcsF 278429 278232 CDS product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099222.1 protein_id gnl|my_center|LOCUS_36240 279511 278426 gene locus_tag LOCUS_36250 279511 278426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 280169 280357 gene locus_tag LOCUS_36260 gene bcsR 280169 280357 CDS product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282616.1 protein_id gnl|my_center|LOCUS_36260 280367 281131 gene locus_tag LOCUS_36270 gene bcsQ 280367 281131 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996130.1 protein_id gnl|my_center|LOCUS_36270 281128 283719 gene locus_tag LOCUS_36280 gene bcsA 281128 283719 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099218.1 protein_id gnl|my_center|LOCUS_36280 283999 284269 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 286475 287584 gene locus_tag LOCUS_36290 gene bcsZ 286475 287584 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988805.1 protein_id gnl|my_center|LOCUS_36290 287617 291057 gene locus_tag LOCUS_36300 gene bcsC 287617 291057 CDS product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225139.1 protein_id gnl|my_center|LOCUS_36300 291157 291481 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 291598 293604 gene locus_tag LOCUS_36310 gene hmsP 291598 293604 CDS product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099214.1 protein_id gnl|my_center|LOCUS_36310 293762 295048 gene locus_tag LOCUS_36320 293762 295048 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099213.1 protein_id gnl|my_center|LOCUS_36320 295309 296760 gene locus_tag LOCUS_36330 295309 296760 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099212.1 protein_id gnl|my_center|LOCUS_36330 296835 297232 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 298172 297243 gene locus_tag LOCUS_36340 gene kdgK 298172 297243 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306595.1 protein_id gnl|my_center|LOCUS_36340 298405 299175 gene locus_tag LOCUS_36350 gene pdeH 298405 299175 CDS product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099209.1 protein_id gnl|my_center|LOCUS_36350 299245 301299 gene locus_tag LOCUS_36360 299245 301299 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 protein_id gnl|my_center|LOCUS_36360 302708 301392 gene locus_tag LOCUS_36370 302708 301392 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099207.1 protein_id gnl|my_center|LOCUS_36370 304014 302971 gene locus_tag LOCUS_36380 gene yhjD 304014 302971 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099206.1 protein_id gnl|my_center|LOCUS_36380 304965 304279 gene locus_tag LOCUS_36390 304965 304279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36390 305084 305842 gene locus_tag LOCUS_36400 305084 305842 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_36400 306289 305891 gene locus_tag LOCUS_36410 306289 305891 CDS product YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776348.1 protein_id gnl|my_center|LOCUS_36410 306893 306357 gene locus_tag LOCUS_36420 306893 306357 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099201.1 protein_id gnl|my_center|LOCUS_36420 307044 308636 gene locus_tag LOCUS_36430 307044 308636 CDS product STY4199 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099200.1 protein_id gnl|my_center|LOCUS_36430 308773 309186 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 310900 309251 gene locus_tag LOCUS_36440 310900 309251 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099199.1 protein_id gnl|my_center|LOCUS_36440 312487 311408 gene locus_tag LOCUS_36450 gene aguA 312487 311408 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209980.1 protein_id gnl|my_center|LOCUS_36450 313374 312487 gene locus_tag LOCUS_36460 gene aguB 313374 312487 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209979.1 protein_id gnl|my_center|LOCUS_36460 313504 314418 gene locus_tag LOCUS_36470 313504 314418 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096239.1 protein_id gnl|my_center|LOCUS_36470 315133 315915 gene locus_tag LOCUS_36480 315133 315915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 316755 315997 gene locus_tag LOCUS_36490 316755 315997 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930359.1 protein_id gnl|my_center|LOCUS_36490 317259 317062 gene locus_tag LOCUS_36500 317259 317062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 317730 318638 gene locus_tag LOCUS_36510 317730 318638 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027274180.1 protein_id gnl|my_center|LOCUS_36510 318999 319310 gene locus_tag LOCUS_36520 318999 319310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 319762 320280 gene locus_tag LOCUS_36530 319762 320280 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097473.1 protein_id gnl|my_center|LOCUS_36530 320380 321069 gene locus_tag LOCUS_36540 320380 321069 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 protein_id gnl|my_center|LOCUS_36540 321123 323711 gene locus_tag LOCUS_36550 321123 323711 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096967.1 protein_id gnl|my_center|LOCUS_36550 323733 324722 gene locus_tag LOCUS_36560 323733 324722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 324840 325229 gene locus_tag LOCUS_36570 324840 325229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 325379 327277 gene locus_tag LOCUS_36580 325379 327277 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175141.1 protein_id gnl|my_center|LOCUS_36580 328567 327359 gene locus_tag LOCUS_36590 328567 327359 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817956.1 protein_id gnl|my_center|LOCUS_36590 328636 329733 gene locus_tag LOCUS_36600 328636 329733 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974704.1 protein_id gnl|my_center|LOCUS_36600 330640 329717 gene locus_tag LOCUS_36610 gene dapA 330640 329717 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121621.1 protein_id gnl|my_center|LOCUS_36610 331819 330650 gene locus_tag LOCUS_36620 331819 330650 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974705.1 protein_id gnl|my_center|LOCUS_36620 332906 331803 gene locus_tag LOCUS_36630 332906 331803 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974706.1 protein_id gnl|my_center|LOCUS_36630 334078 332903 gene locus_tag LOCUS_36640 334078 332903 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_36640 334838 334092 gene locus_tag LOCUS_36650 334838 334092 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313623.1 protein_id gnl|my_center|LOCUS_36650 335560 334835 gene locus_tag LOCUS_36660 335560 334835 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313622.1 protein_id gnl|my_center|LOCUS_36660 336398 335589 gene locus_tag LOCUS_36670 336398 335589 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974708.1 protein_id gnl|my_center|LOCUS_36670 336588 337484 gene locus_tag LOCUS_36680 336588 337484 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047183.1 protein_id gnl|my_center|LOCUS_36680 337536 338321 gene locus_tag LOCUS_36690 337536 338321 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064849.1 protein_id gnl|my_center|LOCUS_36690 339070 338372 gene locus_tag LOCUS_36700 339070 338372 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198318.1 protein_id gnl|my_center|LOCUS_36700 339509 339102 gene locus_tag LOCUS_36710 339509 339102 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704559.1 protein_id gnl|my_center|LOCUS_36710 339720 340078 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 341578 340226 gene locus_tag LOCUS_36720 gene gorA 341578 340226 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703747.1 protein_id gnl|my_center|LOCUS_36720 342503 341661 gene locus_tag LOCUS_36730 342503 341661 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703746.1 protein_id gnl|my_center|LOCUS_36730 343028 342582 gene locus_tag LOCUS_36740 343028 342582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065356403.1 protein_id gnl|my_center|LOCUS_36740 343204 345246 gene locus_tag LOCUS_36750 gene prlC 343204 345246 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337565.1 protein_id gnl|my_center|LOCUS_36750 345253 346017 gene locus_tag LOCUS_36760 gene rsmJ 345253 346017 CDS product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686608.1 protein_id gnl|my_center|LOCUS_36760 346493 346056 gene locus_tag LOCUS_36770 gene uspA 346493 346056 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145166.1 protein_id gnl|my_center|LOCUS_36770 346888 347223 gene locus_tag LOCUS_36780 gene uspB 346888 347223 CDS product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703743.1 protein_id gnl|my_center|LOCUS_36780 348756 347260 gene locus_tag LOCUS_36790 gene pitA 348756 347260 CDS product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099193.1 protein_id gnl|my_center|LOCUS_36790 348984 350174 gene locus_tag LOCUS_36800 348984 350174 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 protein_id gnl|my_center|LOCUS_36800 350683 350180 gene locus_tag LOCUS_36810 350683 350180 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227784.1 protein_id gnl|my_center|LOCUS_36810 351002 350697 gene locus_tag LOCUS_36820 351002 350697 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053053.1 protein_id gnl|my_center|LOCUS_36820 351180 351431 gene locus_tag LOCUS_36830 351180 351431 CDS product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079039.1 protein_id gnl|my_center|LOCUS_36830 351428 352213 gene locus_tag LOCUS_36840 gene map 351428 352213 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817158.1 protein_id gnl|my_center|LOCUS_36840 353521 352259 gene locus_tag LOCUS_36850 353521 352259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36850 354870 353449 gene locus_tag LOCUS_36860 354870 353449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36860 355932 354931 gene locus_tag LOCUS_36870 355932 354931 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098398.1 protein_id gnl|my_center|LOCUS_36870 356777 355932 gene locus_tag LOCUS_36880 356777 355932 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098399.1 protein_id gnl|my_center|LOCUS_36880 357538 356789 gene locus_tag LOCUS_36890 357538 356789 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098400.1 protein_id gnl|my_center|LOCUS_36890 358907 357579 gene locus_tag LOCUS_36900 358907 357579 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098401.1 protein_id gnl|my_center|LOCUS_36900 359408 360223 gene locus_tag LOCUS_36910 359408 360223 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098402.1 protein_id gnl|my_center|LOCUS_36910 362132 360249 gene locus_tag LOCUS_36920 362132 360249 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861721.1 protein_id gnl|my_center|LOCUS_36920 363435 362272 gene locus_tag LOCUS_36930 363435 362272 CDS product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 protein_id gnl|my_center|LOCUS_36930 364846 363452 gene locus_tag LOCUS_36940 364846 363452 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036471.1 protein_id gnl|my_center|LOCUS_36940 365614 364916 gene locus_tag LOCUS_36950 365614 364916 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 protein_id gnl|my_center|LOCUS_36950 366578 365625 gene locus_tag LOCUS_36960 366578 365625 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_36960 367376 368341 gene locus_tag LOCUS_36970 367376 368341 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815364.1 protein_id gnl|my_center|LOCUS_36970 369255 368398 gene locus_tag LOCUS_36980 369255 368398 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703733.1 protein_id gnl|my_center|LOCUS_36980 369354 369860 gene locus_tag LOCUS_36990 369354 369860 CDS product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369282.1 protein_id gnl|my_center|LOCUS_36990 370914 369865 gene locus_tag LOCUS_37000 370914 369865 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449758.1 protein_id gnl|my_center|LOCUS_37000 372295 372692 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 373356 372799 gene locus_tag LOCUS_37010 373356 372799 CDS product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099152.1 protein_id gnl|my_center|LOCUS_37010 374094 373429 gene locus_tag LOCUS_37020 374094 373429 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100467.1 protein_id gnl|my_center|LOCUS_37020 374203 374505 gene locus_tag LOCUS_37030 gene tusA 374203 374505 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833603.1 protein_id gnl|my_center|LOCUS_37030 374703 375686 gene locus_tag LOCUS_37040 374703 375686 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_37040 375708 376217 gene locus_tag LOCUS_37050 375708 376217 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099148.1 protein_id gnl|my_center|LOCUS_37050 376633 376960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 380058 377887 gene locus_tag LOCUS_37060 gene zntA 380058 377887 CDS product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099146.1 protein_id gnl|my_center|LOCUS_37060 380760 380134 gene locus_tag LOCUS_37070 380760 380134 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964735.1 protein_id gnl|my_center|LOCUS_37070 381159 380884 gene locus_tag LOCUS_37080 381159 380884 CDS product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099143.1 protein_id gnl|my_center|LOCUS_37080 381745 381143 gene locus_tag LOCUS_37090 gene rsmD 381745 381143 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883606.1 protein_id gnl|my_center|LOCUS_37090 382065 383354 gene locus_tag LOCUS_37100 gene ftsY 382065 383354 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040639.1 protein_id gnl|my_center|LOCUS_37100 383357 384025 gene locus_tag LOCUS_37110 gene ftsE 383357 384025 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617723.1 protein_id gnl|my_center|LOCUS_37110 384018 385076 gene locus_tag LOCUS_37120 gene ftsX 384018 385076 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099139.1 protein_id gnl|my_center|LOCUS_37120 385343 386200 gene locus_tag LOCUS_37130 gene rpoH 385343 386200 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920815.1 protein_id gnl|my_center|LOCUS_37130 387749 386286 gene locus_tag LOCUS_37140 387749 386286 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 protein_id gnl|my_center|LOCUS_37140 387798 389117 gene locus_tag LOCUS_37150 387798 389117 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099137.1 protein_id gnl|my_center|LOCUS_37150 389363 390460 gene locus_tag LOCUS_37160 gene livJ 389363 390460 CDS product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021986.1 protein_id gnl|my_center|LOCUS_37160 390684 390953 gene locus_tag LOCUS_37170 gene ataR 390684 390953 CDS product type II toxin-antitoxin system antitoxin AtaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277108.1 protein_id gnl|my_center|LOCUS_37170 390957 391475 gene locus_tag LOCUS_37180 gene ataT 390957 391475 CDS product type II toxin-antitoxin system toxin acetyltransferase AtaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342448.1 protein_id gnl|my_center|LOCUS_37180 391855 391472 gene locus_tag LOCUS_37190 gene panM 391855 391472 CDS product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099135.1 protein_id gnl|my_center|LOCUS_37190 392299 393387 gene locus_tag LOCUS_37200 gene livK 392299 393387 CDS product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827696.1 protein_id gnl|my_center|LOCUS_37200 393442 394368 gene locus_tag LOCUS_37210 gene livH 393442 394368 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295111.1 protein_id gnl|my_center|LOCUS_37210 394365 395639 gene locus_tag LOCUS_37220 gene livM 394365 395639 CDS product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803764.1 protein_id gnl|my_center|LOCUS_37220 395636 396403 gene locus_tag LOCUS_37230 gene livG 395636 396403 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369325.1 protein_id gnl|my_center|LOCUS_37230 396405 397118 gene locus_tag LOCUS_37240 gene livF 396405 397118 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 protein_id gnl|my_center|LOCUS_37240 397303 397524 gene locus_tag LOCUS_37250 397303 397524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 397521 397889 gene locus_tag LOCUS_37260 397521 397889 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816307.1 protein_id gnl|my_center|LOCUS_37260 398111 399427 gene locus_tag LOCUS_37270 gene ugpB 398111 399427 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 protein_id gnl|my_center|LOCUS_37270 399553 400440 gene locus_tag LOCUS_37280 gene ugpA 399553 400440 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099126.1 protein_id gnl|my_center|LOCUS_37280 400437 401282 gene locus_tag LOCUS_37290 gene ugpE 400437 401282 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703702.1 protein_id gnl|my_center|LOCUS_37290 401297 402370 gene locus_tag LOCUS_37300 401297 402370 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 protein_id gnl|my_center|LOCUS_37300 402367 403107 gene locus_tag LOCUS_37310 gene ugpQ 402367 403107 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073552.1 protein_id gnl|my_center|LOCUS_37310 403556 403104 gene locus_tag LOCUS_37320 403556 403104 CDS product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 protein_id gnl|my_center|LOCUS_37320 403815 405464 gene locus_tag LOCUS_37330 gene ggt 403815 405464 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 protein_id gnl|my_center|LOCUS_37330 406069 405581 gene locus_tag LOCUS_37340 gene yhhY 406069 405581 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301731.1 protein_id gnl|my_center|LOCUS_37340 406373 407410 gene locus_tag LOCUS_37350 406373 407410 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099119.1 protein_id gnl|my_center|LOCUS_37350 407535 408230 gene locus_tag LOCUS_37360 407535 408230 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639789.1 protein_id gnl|my_center|LOCUS_37360 408389 409327 gene locus_tag LOCUS_37370 gene gntR 408389 409327 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833579.1 protein_id gnl|my_center|LOCUS_37370 409463 409984 gene locus_tag LOCUS_37380 gene gntK 409463 409984 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420757.1 protein_id gnl|my_center|LOCUS_37380 410070 411335 gene locus_tag LOCUS_37390 gene gntU 410070 411335 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833577.1 protein_id gnl|my_center|LOCUS_37390 412039 411446 gene locus_tag LOCUS_37400 gene yhgN 412039 411446 CDS product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 protein_id gnl|my_center|LOCUS_37400 412199 413305 gene locus_tag LOCUS_37410 gene asd 412199 413305 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799940.1 protein_id gnl|my_center|LOCUS_37410 413563 415749 gene locus_tag LOCUS_37420 gene glgB 413563 415749 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283713.1 protein_id gnl|my_center|LOCUS_37420 415746 417722 gene locus_tag LOCUS_37430 gene glgX 415746 417722 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099111.1 protein_id gnl|my_center|LOCUS_37430 417737 419023 gene locus_tag LOCUS_37440 gene glgC 417737 419023 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099110.1 protein_id gnl|my_center|LOCUS_37440 419114 420547 gene locus_tag LOCUS_37450 gene glgA 419114 420547 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 protein_id gnl|my_center|LOCUS_37450 420567 423014 gene locus_tag LOCUS_37460 gene glgP 420567 423014 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993423.1 protein_id gnl|my_center|LOCUS_37460 423155 424675 gene locus_tag LOCUS_37470 423155 424675 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061090571.1 protein_id gnl|my_center|LOCUS_37470 426324 424819 gene locus_tag LOCUS_37480 gene glpD 426324 424819 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099107.1 protein_id gnl|my_center|LOCUS_37480 426506 426835 gene locus_tag LOCUS_37490 gene glpE 426506 426835 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369349.1 protein_id gnl|my_center|LOCUS_37490 426895 427725 gene locus_tag LOCUS_37500 gene glpG 426895 427725 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928731.1 protein_id gnl|my_center|LOCUS_37500 427742 428500 gene locus_tag LOCUS_37510 427742 428500 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099103.1 protein_id gnl|my_center|LOCUS_37510 431226 428521 gene locus_tag LOCUS_37520 gene malT 431226 428521 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420753.1 protein_id gnl|my_center|LOCUS_37520 431848 434241 gene locus_tag LOCUS_37530 gene malP 431848 434241 CDS product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099099.1 protein_id gnl|my_center|LOCUS_37530 434250 436337 gene locus_tag LOCUS_37540 gene malQ 434250 436337 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099098.1 protein_id gnl|my_center|LOCUS_37540 437718 436402 gene locus_tag LOCUS_37550 gene gntT 437718 436402 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131741.1 protein_id gnl|my_center|LOCUS_37550 438619 438044 gene locus_tag LOCUS_37560 gene nfuA 438619 438044 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099096.1 protein_id gnl|my_center|LOCUS_37560 439172 438678 gene locus_tag LOCUS_37570 439172 438678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 439192 439380 gene locus_tag LOCUS_37580 439192 439380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 439400 440170 gene locus_tag LOCUS_37590 gene bioH 439400 440170 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703680.1 protein_id gnl|my_center|LOCUS_37590 440285 440554 gene locus_tag LOCUS_37600 440285 440554 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369359.1 protein_id gnl|my_center|LOCUS_37600 440830 440588 gene locus_tag LOCUS_37610 gene feoC 440830 440588 CDS product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703679.1 protein_id gnl|my_center|LOCUS_37610 443161 440843 gene locus_tag LOCUS_37620 gene feoB 443161 440843 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099092.1 protein_id gnl|my_center|LOCUS_37620 443416 443189 gene locus_tag LOCUS_37630 gene feoA 443416 443189 CDS product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436417.1 protein_id gnl|my_center|LOCUS_37630 446183 443685 gene locus_tag LOCUS_37640 446183 443685 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703676.1 protein_id gnl|my_center|LOCUS_37640 446743 446264 gene locus_tag LOCUS_37650 gene greB 446743 446264 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703675.1 protein_id gnl|my_center|LOCUS_37650 446947 447666 gene locus_tag LOCUS_37660 gene ompR 446947 447666 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 protein_id gnl|my_center|LOCUS_37660 447672 449009 gene locus_tag LOCUS_37670 gene envZ 447672 449009 CDS product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882169.1 protein_id gnl|my_center|LOCUS_37670 450748 449129 gene locus_tag LOCUS_37680 gene pckA 450748 449129 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099086.1 protein_id gnl|my_center|LOCUS_37680 451974 451096 gene locus_tag LOCUS_37690 gene hslO 451974 451096 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775502.1 protein_id gnl|my_center|LOCUS_37690 452400 451999 gene locus_tag LOCUS_37700 gene hslR 452400 451999 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 protein_id gnl|my_center|LOCUS_37700 453080 452400 gene locus_tag LOCUS_37710 gene yrfG 453080 452400 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099082.1 protein_id gnl|my_center|LOCUS_37710 455214 453145 gene locus_tag LOCUS_37720 455214 453145 CDS product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099081.1 protein_id gnl|my_center|LOCUS_37720 455599 456159 gene locus_tag LOCUS_37730 gene nudE 455599 456159 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519362.1 protein_id gnl|my_center|LOCUS_37730 458797 456245 gene locus_tag LOCUS_37740 gene mrcA 458797 456245 CDS product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013215.1 protein_id gnl|my_center|LOCUS_37740 459366 459704 gene locus_tag LOCUS_37750 459366 459704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37750 459704 460243 gene locus_tag LOCUS_37760 459704 460243 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951390.1 protein_id gnl|my_center|LOCUS_37760 460227 460685 gene locus_tag LOCUS_37770 460227 460685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992480.1 protein_id gnl|my_center|LOCUS_37770 460672 461079 gene locus_tag LOCUS_37780 460672 461079 CDS product HofP DNA utilization family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868832.1 protein_id gnl|my_center|LOCUS_37780 460991 462229 gene locus_tag LOCUS_37790 gene hofQ 460991 462229 CDS product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832818.1 protein_id gnl|my_center|LOCUS_37790 462524 463045 gene locus_tag LOCUS_37800 gene aroK 462524 463045 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920267.1 protein_id gnl|my_center|LOCUS_37800 463222 464310 gene locus_tag LOCUS_37810 gene aroB 463222 464310 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420740.1 protein_id gnl|my_center|LOCUS_37810 464400 465719 gene locus_tag LOCUS_37820 gene damX 464400 465719 CDS product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343217.1 protein_id gnl|my_center|LOCUS_37820 465905 466735 gene locus_tag LOCUS_37830 gene dam 465905 466735 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742132.1 protein_id gnl|my_center|LOCUS_37830 466803 467480 gene locus_tag LOCUS_37840 gene rpe 466803 467480 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503032.1 protein_id gnl|my_center|LOCUS_37840 467473 468234 gene locus_tag LOCUS_37850 gene gph 467473 468234 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703653.1 protein_id gnl|my_center|LOCUS_37850 468227 469231 gene locus_tag LOCUS_37860 gene trpS 468227 469231 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369391.1 protein_id gnl|my_center|LOCUS_37860 470037 469306 gene locus_tag LOCUS_37870 gene frlR 470037 469306 CDS product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302327.1 protein_id gnl|my_center|LOCUS_37870 470919 470134 gene locus_tag LOCUS_37880 gene frlD 470919 470134 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853346.1 protein_id gnl|my_center|LOCUS_37880 471746 470916 gene locus_tag LOCUS_37890 gene frlC 471746 470916 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847837.1 protein_id gnl|my_center|LOCUS_37890 472818 471796 gene locus_tag LOCUS_37900 gene frlB 472818 471796 CDS product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 protein_id gnl|my_center|LOCUS_37900 474179 472839 gene locus_tag LOCUS_37910 gene frlA 474179 472839 CDS product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 protein_id gnl|my_center|LOCUS_37910 475944 474580 gene locus_tag LOCUS_37920 gene cysG 475944 474580 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349908.1 protein_id gnl|my_center|LOCUS_37920 476765 475956 gene locus_tag LOCUS_37930 gene nirC 476765 475956 CDS product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493575.1 protein_id gnl|my_center|LOCUS_37930 477291 476965 gene locus_tag LOCUS_37940 gene nirD 477291 476965 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 protein_id gnl|my_center|LOCUS_37940 479831 477288 gene locus_tag LOCUS_37950 gene nirB 479831 477288 CDS product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049259.1 protein_id gnl|my_center|LOCUS_37950 480268 480840 gene locus_tag LOCUS_37960 gene ppiA 480268 480840 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920482.1 protein_id gnl|my_center|LOCUS_37960 480970 481134 gene locus_tag LOCUS_37970 480970 481134 CDS product YhfG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519136.1 protein_id gnl|my_center|LOCUS_37970 481131 481733 gene locus_tag LOCUS_37980 481131 481733 CDS product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280641.1 protein_id gnl|my_center|LOCUS_37980 481765 482337 gene locus_tag LOCUS_37990 gene pabA 481765 482337 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099059.1 protein_id gnl|my_center|LOCUS_37990 482417 483637 gene locus_tag LOCUS_38000 gene argD 482417 483637 CDS product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963789.1 protein_id gnl|my_center|LOCUS_38000 485712 483634 gene locus_tag LOCUS_38010 485712 483634 CDS product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099057.1 protein_id gnl|my_center|LOCUS_38010 486396 485764 gene locus_tag LOCUS_38020 gene crp 486396 485764 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 protein_id gnl|my_center|LOCUS_38020 486704 487108 gene locus_tag LOCUS_38030 486704 487108 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027906.1 protein_id gnl|my_center|LOCUS_38030 487182 487574 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 488495 487626 gene locus_tag LOCUS_38040 488495 487626 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 protein_id gnl|my_center|LOCUS_38040 488744 488526 gene locus_tag LOCUS_38050 488744 488526 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586568.1 protein_id gnl|my_center|LOCUS_38050 489759 488746 gene locus_tag LOCUS_38060 489759 488746 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057395.1 protein_id gnl|my_center|LOCUS_38060 490009 491664 gene locus_tag LOCUS_38070 gene mdcA 490009 491664 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099050.1 protein_id gnl|my_center|LOCUS_38070 491664 492521 gene locus_tag LOCUS_38080 491664 492521 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099049.1 protein_id gnl|my_center|LOCUS_38080 492531 492830 gene locus_tag LOCUS_38090 gene mdcC 492531 492830 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099048.1 protein_id gnl|my_center|LOCUS_38090 492823 493656 gene locus_tag LOCUS_38100 492823 493656 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099047.1 protein_id gnl|my_center|LOCUS_38100 493653 494456 gene locus_tag LOCUS_38110 gene mdcE 493653 494456 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099046.1 protein_id gnl|my_center|LOCUS_38110 494581 495540 gene locus_tag LOCUS_38120 494581 495540 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099045.1 protein_id gnl|my_center|LOCUS_38120 495544 496161 gene locus_tag LOCUS_38130 495544 496161 CDS product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099044.1 protein_id gnl|my_center|LOCUS_38130 496162 497064 gene locus_tag LOCUS_38140 gene mdcH 496162 497064 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420731.1 protein_id gnl|my_center|LOCUS_38140 497989 497048 gene locus_tag LOCUS_38150 497989 497048 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099042.1 protein_id gnl|my_center|LOCUS_38150 499906 498005 gene locus_tag LOCUS_38160 499906 498005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634798.1 protein_id gnl|my_center|LOCUS_38160 500077 500631 gene locus_tag LOCUS_38170 gene kefG 500077 500631 CDS product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987657.1 protein_id gnl|my_center|LOCUS_38170 500631 502436 gene locus_tag LOCUS_38180 gene kefB 500631 502436 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399162.1 protein_id gnl|my_center|LOCUS_38180 502447 502647 gene locus_tag LOCUS_38190 502447 502647 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007730.1 protein_id gnl|my_center|LOCUS_38190 502742 503329 gene locus_tag LOCUS_38200 gene slyD 502742 503329 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861345.1 protein_id gnl|my_center|LOCUS_38200 503619 503401 gene locus_tag LOCUS_38210 503619 503401 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152702.1 protein_id gnl|my_center|LOCUS_38210 503853 504680 gene locus_tag LOCUS_38220 gene fkpA 503853 504680 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099036.1 protein_id gnl|my_center|LOCUS_38220 504885 505607 gene locus_tag LOCUS_38230 504885 505607 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 protein_id gnl|my_center|LOCUS_38230 505607 505993 gene locus_tag LOCUS_38240 gene tusD 505607 505993 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 protein_id gnl|my_center|LOCUS_38240 506359 506646 gene locus_tag LOCUS_38250 gene tusB 506359 506646 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099033.1 protein_id gnl|my_center|LOCUS_38250 506771 507145 gene locus_tag LOCUS_38260 gene rpsL 506771 507145 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 protein_id gnl|my_center|LOCUS_38260 507241 507711 gene locus_tag LOCUS_38270 gene rpsG 507241 507711 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369416.1 protein_id gnl|my_center|LOCUS_38270 507809 509923 gene locus_tag LOCUS_38280 gene fusA 507809 509923 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124693.1 protein_id gnl|my_center|LOCUS_38280 510134 510920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 511119 511313 gene locus_tag LOCUS_38290 gene bfd 511119 511313 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289090.1 protein_id gnl|my_center|LOCUS_38290 511386 511862 gene locus_tag LOCUS_38300 gene bfr 511386 511862 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675515.1 protein_id gnl|my_center|LOCUS_38300 512328 511846 gene locus_tag LOCUS_38310 512328 511846 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340167.1 protein_id gnl|my_center|LOCUS_38310 512698 513009 gene locus_tag LOCUS_38320 gene rpsJ 512698 513009 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 protein_id gnl|my_center|LOCUS_38320 513042 513671 gene locus_tag LOCUS_38330 gene rplC 513042 513671 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579833.1 protein_id gnl|my_center|LOCUS_38330 513682 514287 gene locus_tag LOCUS_38340 gene rplD 513682 514287 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 protein_id gnl|my_center|LOCUS_38340 514284 514586 gene locus_tag LOCUS_38350 gene rplW 514284 514586 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617546.1 protein_id gnl|my_center|LOCUS_38350 514604 515425 gene locus_tag LOCUS_38360 gene rplB 514604 515425 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301859.1 protein_id gnl|my_center|LOCUS_38360 515442 515720 gene locus_tag LOCUS_38370 gene rpsS 515442 515720 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138115.1 protein_id gnl|my_center|LOCUS_38370 515735 516067 gene locus_tag LOCUS_38380 gene rplV 515735 516067 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919773.1 protein_id gnl|my_center|LOCUS_38380 516085 516783 gene locus_tag LOCUS_38390 gene rpsC 516085 516783 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919766.1 protein_id gnl|my_center|LOCUS_38390 516796 517206 gene locus_tag LOCUS_38400 gene rplP 516796 517206 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919759.1 protein_id gnl|my_center|LOCUS_38400 517206 517397 gene locus_tag LOCUS_38410 gene rpmC 517206 517397 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919754.1 protein_id gnl|my_center|LOCUS_38410 517397 517651 gene locus_tag LOCUS_38420 gene rpsQ 517397 517651 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438707.1 protein_id gnl|my_center|LOCUS_38420 517816 518187 gene locus_tag LOCUS_38430 gene rplN 517816 518187 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 protein_id gnl|my_center|LOCUS_38430 518198 518512 gene locus_tag LOCUS_38440 gene rplX 518198 518512 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 protein_id gnl|my_center|LOCUS_38440 518527 519066 gene locus_tag LOCUS_38450 gene rplE 518527 519066 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096206.1 protein_id gnl|my_center|LOCUS_38450 519081 519386 gene locus_tag LOCUS_38460 gene rpsN 519081 519386 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118932.1 protein_id gnl|my_center|LOCUS_38460 519420 519812 gene locus_tag LOCUS_38470 gene rpsH 519420 519812 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 protein_id gnl|my_center|LOCUS_38470 519825 520358 gene locus_tag LOCUS_38480 gene rplF 519825 520358 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091939.1 protein_id gnl|my_center|LOCUS_38480 520368 520721 gene locus_tag LOCUS_38490 gene rplR 520368 520721 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358960.1 protein_id gnl|my_center|LOCUS_38490 520736 521236 gene locus_tag LOCUS_38500 gene rpsE 520736 521236 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863299.1 protein_id gnl|my_center|LOCUS_38500 521243 521422 gene locus_tag LOCUS_38510 gene rpmD 521243 521422 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140434.1 protein_id gnl|my_center|LOCUS_38510 521426 521860 gene locus_tag LOCUS_38520 gene rplO 521426 521860 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 protein_id gnl|my_center|LOCUS_38520 521868 523199 gene locus_tag LOCUS_38530 gene secY 521868 523199 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863305.1 protein_id gnl|my_center|LOCUS_38530 523494 523850 gene locus_tag LOCUS_38540 gene rpsM 523494 523850 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099021.1 protein_id gnl|my_center|LOCUS_38540 523867 524256 gene locus_tag LOCUS_38550 gene rpsK 523867 524256 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003031137.1 protein_id gnl|my_center|LOCUS_38550 524290 524910 gene locus_tag LOCUS_38560 gene rpsD 524290 524910 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919224.1 protein_id gnl|my_center|LOCUS_38560 524936 525925 gene locus_tag LOCUS_38570 gene rpoA 524936 525925 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438685.1 protein_id gnl|my_center|LOCUS_38570 525966 526352 gene locus_tag LOCUS_38580 gene rplQ 525966 526352 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216372.1 protein_id gnl|my_center|LOCUS_38580 526460 526828 gene locus_tag LOCUS_38590 526460 526828 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266531.1 protein_id gnl|my_center|LOCUS_38590 526831 527256 gene locus_tag LOCUS_38600 gene zntR 526831 527256 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285589.1 protein_id gnl|my_center|LOCUS_38600 527253 527528 gene locus_tag LOCUS_38610 527253 527528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 527942 527529 gene locus_tag LOCUS_38620 gene mscL 527942 527529 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008119.1 protein_id gnl|my_center|LOCUS_38620 529461 528085 gene locus_tag LOCUS_38630 gene trkA 529461 528085 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691374.1 protein_id gnl|my_center|LOCUS_38630 530772 529483 gene locus_tag LOCUS_38640 gene rsmB 530772 529483 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744779.1 protein_id gnl|my_center|LOCUS_38640 531771 530824 gene locus_tag LOCUS_38650 gene fmt 531771 530824 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285161.1 protein_id gnl|my_center|LOCUS_38650 532295 531786 gene locus_tag LOCUS_38660 gene def 532295 531786 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114992.1 protein_id gnl|my_center|LOCUS_38660 532423 533547 gene locus_tag LOCUS_38670 gene dprA 532423 533547 CDS product DNA-protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420725.1 protein_id gnl|my_center|LOCUS_38670 533519 533992 gene locus_tag LOCUS_38680 gene smg 533519 533992 CDS product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460672.1 protein_id gnl|my_center|LOCUS_38680 534019 534573 gene locus_tag LOCUS_38690 534019 534573 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369441.1 protein_id gnl|my_center|LOCUS_38690 534566 535138 gene locus_tag LOCUS_38700 gene tsaC 534566 535138 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361937.1 protein_id gnl|my_center|LOCUS_38700 >Feature sequence05 959 78 gene locus_tag LOCUS_38710 gene yafC 959 78 CDS product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095682.1 protein_id gnl|my_center|LOCUS_38710 1185 1985 gene locus_tag LOCUS_38720 1185 1985 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230964.1 protein_id gnl|my_center|LOCUS_38720 2063 2833 gene locus_tag LOCUS_38730 2063 2833 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 protein_id gnl|my_center|LOCUS_38730 4104 2881 gene locus_tag LOCUS_38740 gene mltD 4104 2881 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 protein_id gnl|my_center|LOCUS_38740 5078 4323 gene locus_tag LOCUS_38750 gene gloB 5078 4323 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704465.1 protein_id gnl|my_center|LOCUS_38750 5111 5827 gene locus_tag LOCUS_38760 5111 5827 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307587.1 protein_id gnl|my_center|LOCUS_38760 6291 5818 gene locus_tag LOCUS_38770 gene rnhA 6291 5818 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917872.1 protein_id gnl|my_center|LOCUS_38770 6343 7071 gene locus_tag LOCUS_38780 gene dnaQ 6343 7071 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368125.1 protein_id gnl|my_center|LOCUS_38780 7204 7280 gene locus_tag LOCUS_t00560 7204 7280 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7636 7424 gene locus_tag LOCUS_38790 7636 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 7674 8013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8335 8931 gene locus_tag LOCUS_38800 8335 8931 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705801.1 protein_id gnl|my_center|LOCUS_38800 9131 8952 gene locus_tag LOCUS_38810 9131 8952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 9943 9617 gene locus_tag LOCUS_38820 9943 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 10765 10319 gene locus_tag LOCUS_38830 10765 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 11244 10768 gene locus_tag LOCUS_38840 11244 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 11557 11893 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12290 13996 gene locus_tag LOCUS_38850 12290 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 14820 15458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16501 15470 gene locus_tag LOCUS_38860 16501 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 17094 16576 gene locus_tag LOCUS_38870 17094 16576 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142963.1 protein_id gnl|my_center|LOCUS_38870 17533 18030 gene locus_tag LOCUS_38880 gene tssB 17533 18030 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212098.1 protein_id gnl|my_center|LOCUS_38880 18066 19547 gene locus_tag LOCUS_38890 gene tssC 18066 19547 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212099.1 protein_id gnl|my_center|LOCUS_38890 19557 19991 gene locus_tag LOCUS_38900 gene tssE 19557 19991 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705714.1 protein_id gnl|my_center|LOCUS_38900 21724 22713 gene locus_tag LOCUS_38910 gene tssG 21724 22713 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705716.1 protein_id gnl|my_center|LOCUS_38910 22720 24015 gene locus_tag LOCUS_38920 gene tagH 22720 24015 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212103.1 protein_id gnl|my_center|LOCUS_38920 24012 24569 gene locus_tag LOCUS_38930 gene tssJ 24012 24569 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212104.1 protein_id gnl|my_center|LOCUS_38930 24570 24770 gene locus_tag LOCUS_38940 24570 24770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38940 24770 25915 gene locus_tag LOCUS_38950 gene tssK 24770 25915 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212105.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38950 25912 26664 gene locus_tag LOCUS_38960 gene icmH 25912 26664 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212106.1 protein_id gnl|my_center|LOCUS_38960 26676 29270 gene locus_tag LOCUS_38970 gene tssH 26676 29270 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212107.1 protein_id gnl|my_center|LOCUS_38970 29272 29937 gene locus_tag LOCUS_38980 gene vasI 29272 29937 CDS product type VI secretion system-associated protein VasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088845.1 protein_id gnl|my_center|LOCUS_38980 29953 31350 gene locus_tag LOCUS_38990 gene tssA 29953 31350 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212110.1 protein_id gnl|my_center|LOCUS_38990 31570 31352 gene locus_tag LOCUS_39000 31570 31352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 31724 34876 gene locus_tag LOCUS_39010 gene tssM 31724 34876 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212111.1 protein_id gnl|my_center|LOCUS_39010 35600 36190 gene locus_tag LOCUS_39020 35600 36190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 36938 36210 gene locus_tag LOCUS_39030 36938 36210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049698.1 protein_id gnl|my_center|LOCUS_39030 37051 37377 gene locus_tag LOCUS_39040 37051 37377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 37401 39158 gene locus_tag LOCUS_39050 gene tssF 37401 39158 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189792.1 protein_id gnl|my_center|LOCUS_39050 39171 41327 gene locus_tag LOCUS_39060 gene tssI 39171 41327 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705728.1 protein_id gnl|my_center|LOCUS_39060 41285 41464 gene locus_tag LOCUS_39070 41285 41464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 42458 43661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 44529 43759 gene locus_tag LOCUS_39080 44529 43759 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 protein_id gnl|my_center|LOCUS_39080 47082 44638 gene locus_tag LOCUS_39090 gene fadE 47082 44638 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095726.1 protein_id gnl|my_center|LOCUS_39090 47319 47897 gene locus_tag LOCUS_39100 gene lpcA 47319 47897 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 protein_id gnl|my_center|LOCUS_39100 48002 48769 gene locus_tag LOCUS_39110 48002 48769 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095728.1 protein_id gnl|my_center|LOCUS_39110 49480 48740 gene locus_tag LOCUS_39120 gene dpaA 49480 48740 CDS product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095729.1 protein_id gnl|my_center|LOCUS_39120 50003 49836 gene locus_tag LOCUS_39130 50003 49836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 49932 50498 gene locus_tag LOCUS_39140 49932 50498 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001389087.1 protein_id gnl|my_center|LOCUS_39140 50734 50495 gene locus_tag LOCUS_39150 50734 50495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 52924 50831 gene locus_tag LOCUS_39160 gene flhA 52924 50831 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140817.1 protein_id gnl|my_center|LOCUS_39160 54047 52908 gene locus_tag LOCUS_39170 54047 52908 CDS product flagellar type III secretion system protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785648.1 protein_id gnl|my_center|LOCUS_39170 54819 54037 gene locus_tag LOCUS_39180 gene fliR 54819 54037 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260504.1 protein_id gnl|my_center|LOCUS_39180 55093 54821 gene locus_tag LOCUS_39190 55093 54821 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958542.1 protein_id gnl|my_center|LOCUS_39190 55863 55105 gene locus_tag LOCUS_39200 gene fliP 55863 55105 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830282.1 protein_id gnl|my_center|LOCUS_39200 56228 55860 gene locus_tag LOCUS_39210 56228 55860 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043127.1 protein_id gnl|my_center|LOCUS_39210 57087 56221 gene locus_tag LOCUS_39220 57087 56221 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922504.1 protein_id gnl|my_center|LOCUS_39220 57652 58635 gene locus_tag LOCUS_39230 57652 58635 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292195.1 protein_id gnl|my_center|LOCUS_39230 58671 59033 gene locus_tag LOCUS_39240 58671 59033 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029087.1 protein_id gnl|my_center|LOCUS_39240 59038 60696 gene locus_tag LOCUS_39250 gene fliF 59038 60696 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993674.1 protein_id gnl|my_center|LOCUS_39250 60674 61690 gene locus_tag LOCUS_39260 60674 61690 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293168.1 protein_id gnl|my_center|LOCUS_39260 61694 62404 gene locus_tag LOCUS_39270 gene fliH 61694 62404 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151516.1 protein_id gnl|my_center|LOCUS_39270 62397 63737 gene locus_tag LOCUS_39280 gene fliI 62397 63737 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279402.1 protein_id gnl|my_center|LOCUS_39280 63740 64177 gene locus_tag LOCUS_39290 gene fliJ 63740 64177 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248917.1 protein_id gnl|my_center|LOCUS_39290 64203 64847 gene locus_tag LOCUS_39300 64203 64847 CDS product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211333.1 protein_id gnl|my_center|LOCUS_39300 67580 64929 gene locus_tag LOCUS_39310 67580 64929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 68532 67588 gene locus_tag LOCUS_39320 68532 67588 CDS product lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191775953.1 protein_id gnl|my_center|LOCUS_39320 69090 68662 gene locus_tag LOCUS_39330 69090 68662 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027804.1 protein_id gnl|my_center|LOCUS_39330 69384 69103 gene locus_tag LOCUS_39340 gene flgM 69384 69103 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705404.1 protein_id gnl|my_center|LOCUS_39340 70208 69477 gene locus_tag LOCUS_39350 gene flgA 70208 69477 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309268.1 protein_id gnl|my_center|LOCUS_39350 70330 70677 gene locus_tag LOCUS_39360 70330 70677 CDS product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512950.1 protein_id gnl|my_center|LOCUS_39360 70680 71006 gene locus_tag LOCUS_39370 70680 71006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 71008 72129 gene locus_tag LOCUS_39380 71008 72129 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059224973.1 protein_id gnl|my_center|LOCUS_39380 72129 72440 gene locus_tag LOCUS_39390 72129 72440 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867281.1 protein_id gnl|my_center|LOCUS_39390 72524 73900 gene locus_tag LOCUS_39400 gene flgK 72524 73900 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367245.1 protein_id gnl|my_center|LOCUS_39400 73913 74842 gene locus_tag LOCUS_39410 gene flgL 73913 74842 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 protein_id gnl|my_center|LOCUS_39410 74868 75212 gene locus_tag LOCUS_39420 74868 75212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39420 75094 75861 gene locus_tag LOCUS_39430 75094 75861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39430 76400 75921 gene locus_tag LOCUS_39440 76400 75921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 77268 76381 gene locus_tag LOCUS_39450 77268 76381 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181672479.1 protein_id gnl|my_center|LOCUS_39450 77734 78642 gene locus_tag LOCUS_39460 gene lafA 77734 78642 CDS product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 protein_id gnl|my_center|LOCUS_39460 78739 80154 gene locus_tag LOCUS_39470 gene fliD 78739 80154 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609678.1 protein_id gnl|my_center|LOCUS_39470 80187 80579 gene locus_tag LOCUS_39480 gene fliS 80187 80579 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285322.1 protein_id gnl|my_center|LOCUS_39480 80584 80901 gene locus_tag LOCUS_39490 80584 80901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415004.1 protein_id gnl|my_center|LOCUS_39490 80898 82043 gene locus_tag LOCUS_39500 80898 82043 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067489.1 protein_id gnl|my_center|LOCUS_39500 82049 82513 gene locus_tag LOCUS_39510 82049 82513 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725259.1 protein_id gnl|my_center|LOCUS_39510 82534 83250 gene locus_tag LOCUS_39520 82534 83250 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938726.1 protein_id gnl|my_center|LOCUS_39520 83228 84142 gene locus_tag LOCUS_39530 gene motA 83228 84142 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169518.1 protein_id gnl|my_center|LOCUS_39530 84145 85140 gene locus_tag LOCUS_39540 gene lafU 84145 85140 CDS product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232550.1 protein_id gnl|my_center|LOCUS_39540 85652 85960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 86020 86493 gene locus_tag LOCUS_39550 86020 86493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 86710 87849 gene locus_tag LOCUS_39560 86710 87849 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528865.1 protein_id gnl|my_center|LOCUS_39560 87846 88454 gene locus_tag LOCUS_39570 gene prfH 87846 88454 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602112.1 protein_id gnl|my_center|LOCUS_39570 89976 88519 gene locus_tag LOCUS_39580 gene pepD 89976 88519 CDS product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095740.1 protein_id gnl|my_center|LOCUS_39580 90235 90693 gene locus_tag LOCUS_39590 gene gpt 90235 90693 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 protein_id gnl|my_center|LOCUS_39590 90798 92042 gene locus_tag LOCUS_39600 gene frsA 90798 92042 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095741.1 protein_id gnl|my_center|LOCUS_39600 92100 92498 gene locus_tag LOCUS_39610 gene crl 92100 92498 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025760274.1 protein_id gnl|my_center|LOCUS_39610 93658 92594 gene locus_tag LOCUS_39620 gene phoE 93658 92594 CDS product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095744.1 protein_id gnl|my_center|LOCUS_39620 93949 95052 gene locus_tag LOCUS_39630 gene proB 93949 95052 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095745.1 protein_id gnl|my_center|LOCUS_39630 95480 95868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 96835 96910 gene locus_tag LOCUS_t00570 96835 96910 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 98296 101415 gene locus_tag LOCUS_39640 98296 101415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 101741 102610 gene locus_tag LOCUS_39650 101741 102610 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098484.1 protein_id gnl|my_center|LOCUS_39650 102603 102953 gene locus_tag LOCUS_39660 102603 102953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39660 103207 104133 gene locus_tag LOCUS_39670 103207 104133 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910711.1 protein_id gnl|my_center|LOCUS_39670 104196 105083 gene locus_tag LOCUS_39680 104196 105083 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398787.1 protein_id gnl|my_center|LOCUS_39680 105794 105216 gene locus_tag LOCUS_39690 105794 105216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032707811.1 protein_id gnl|my_center|LOCUS_39690 106092 106925 gene locus_tag LOCUS_39700 gene bglG 106092 106925 CDS product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365726.1 protein_id gnl|my_center|LOCUS_39700 107054 108907 gene locus_tag LOCUS_39710 gene bglF 107054 108907 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277858.1 protein_id gnl|my_center|LOCUS_39710 108924 110318 gene locus_tag LOCUS_39720 gene ascB 108924 110318 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706100.1 protein_id gnl|my_center|LOCUS_39720 110523 111647 gene locus_tag LOCUS_39730 110523 111647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 112977 111751 gene locus_tag LOCUS_39740 112977 111751 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971151.1 protein_id gnl|my_center|LOCUS_39740 114710 112974 gene locus_tag LOCUS_39750 114710 112974 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_39750 115233 117059 gene locus_tag LOCUS_39760 115233 117059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 117335 117141 gene locus_tag LOCUS_39770 117335 117141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 117762 117388 gene locus_tag LOCUS_39780 117762 117388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 118477 117779 gene locus_tag LOCUS_39790 118477 117779 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094792.1 protein_id gnl|my_center|LOCUS_39790 118741 120270 gene locus_tag LOCUS_39800 118741 120270 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948069.1 protein_id gnl|my_center|LOCUS_39800 120278 121609 gene locus_tag LOCUS_39810 120278 121609 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948070.1 protein_id gnl|my_center|LOCUS_39810 122585 121695 gene locus_tag LOCUS_39820 122585 121695 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268899.1 protein_id gnl|my_center|LOCUS_39820 123429 122659 gene locus_tag LOCUS_39830 123429 122659 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105046.1 protein_id gnl|my_center|LOCUS_39830 123612 124511 gene locus_tag LOCUS_39840 123612 124511 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_39840 124511 125449 gene locus_tag LOCUS_39850 124511 125449 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769341.1 protein_id gnl|my_center|LOCUS_39850 125446 126291 gene locus_tag LOCUS_39860 125446 126291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268896.1 protein_id gnl|my_center|LOCUS_39860 126288 127271 gene locus_tag LOCUS_39870 126288 127271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268895.1 protein_id gnl|my_center|LOCUS_39870 127268 128302 gene locus_tag LOCUS_39880 127268 128302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105043.1 protein_id gnl|my_center|LOCUS_39880 128283 129797 gene locus_tag LOCUS_39890 128283 129797 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268893.1 protein_id gnl|my_center|LOCUS_39890 129957 129829 gene locus_tag LOCUS_39900 129957 129829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 130967 129957 gene locus_tag LOCUS_39910 gene cydB 130967 129957 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096468.1 protein_id gnl|my_center|LOCUS_39910 132367 130967 gene locus_tag LOCUS_39920 132367 130967 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096665.1 protein_id gnl|my_center|LOCUS_39920 133314 132436 gene locus_tag LOCUS_39930 133314 132436 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488351.1 protein_id gnl|my_center|LOCUS_39930 133842 133333 gene locus_tag LOCUS_39940 133842 133333 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109977.1 protein_id gnl|my_center|LOCUS_39940 134401 133904 gene locus_tag LOCUS_39950 134401 133904 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022822.1 protein_id gnl|my_center|LOCUS_39950 134692 134507 gene locus_tag LOCUS_39960 134692 134507 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004143718.1 protein_id gnl|my_center|LOCUS_39960 135553 136356 gene locus_tag LOCUS_39970 135553 136356 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39970 136452 137807 gene locus_tag LOCUS_39980 136452 137807 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_39980 137878 139233 gene locus_tag LOCUS_39990 137878 139233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 139223 141469 gene locus_tag LOCUS_40000 139223 141469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 143481 141511 gene locus_tag LOCUS_40010 143481 141511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 143550 143877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 144096 144563 gene locus_tag LOCUS_40020 144096 144563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 146301 144550 gene locus_tag LOCUS_40030 146301 144550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 147292 146453 gene locus_tag LOCUS_40040 147292 146453 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066853.1 protein_id gnl|my_center|LOCUS_40040 148671 147289 gene locus_tag LOCUS_40050 148671 147289 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707552.1 protein_id gnl|my_center|LOCUS_40050 149393 148839 gene locus_tag LOCUS_40060 149393 148839 CDS product 2-oxo-tetronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024810.1 protein_id gnl|my_center|LOCUS_40060 149910 149467 gene locus_tag LOCUS_40070 149910 149467 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096670.1 protein_id gnl|my_center|LOCUS_40070 150430 149921 gene locus_tag LOCUS_40080 150430 149921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705355.1 protein_id gnl|my_center|LOCUS_40080 151251 150475 gene locus_tag LOCUS_40090 gene eutC 151251 150475 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195860.1 protein_id gnl|my_center|LOCUS_40090 152636 151248 gene locus_tag LOCUS_40100 152636 151248 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_40100 154025 152646 gene locus_tag LOCUS_40110 gene eat 154025 152646 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267271.1 protein_id gnl|my_center|LOCUS_40110 155287 154241 gene locus_tag LOCUS_40120 gene fbpC 155287 154241 CDS product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 protein_id gnl|my_center|LOCUS_40120 157378 155300 gene locus_tag LOCUS_40130 157378 155300 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095788.1 protein_id gnl|my_center|LOCUS_40130 158495 157464 gene locus_tag LOCUS_40140 158495 157464 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095789.1 protein_id gnl|my_center|LOCUS_40140 159801 158500 gene locus_tag LOCUS_40150 gene uhpC 159801 158500 CDS product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 protein_id gnl|my_center|LOCUS_40150 161429 159888 gene locus_tag LOCUS_40160 161429 159888 CDS product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095791.1 protein_id gnl|my_center|LOCUS_40160 162058 161426 gene locus_tag LOCUS_40170 162058 161426 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621918.1 protein_id gnl|my_center|LOCUS_40170 162797 162180 gene locus_tag LOCUS_40180 162797 162180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 162881 163204 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 164218 163358 gene locus_tag LOCUS_40190 164218 163358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40190 165320 164349 gene locus_tag LOCUS_40200 gene hemB 165320 164349 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095798.1 protein_id gnl|my_center|LOCUS_40200 165773 168604 gene locus_tag LOCUS_40210 165773 168604 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556534.1 protein_id gnl|my_center|LOCUS_40210 168698 169324 gene locus_tag LOCUS_40220 gene iprA 168698 169324 CDS product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950094.1 protein_id gnl|my_center|LOCUS_40220 170271 169336 gene locus_tag LOCUS_40230 gene ampH 170271 169336 CDS product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830774.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40230 170684 171217 gene locus_tag LOCUS_40240 170684 171217 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095802.1 protein_id gnl|my_center|LOCUS_40240 171342 172562 gene locus_tag LOCUS_40250 gene sbmA 171342 172562 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304845.1 protein_id gnl|my_center|LOCUS_40250 172576 173703 gene locus_tag LOCUS_40260 gene yaiW 172576 173703 CDS product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092067.1 protein_id gnl|my_center|LOCUS_40260 174050 173700 gene locus_tag LOCUS_40270 174050 173700 CDS product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763139.1 protein_id gnl|my_center|LOCUS_40270 174259 174492 gene locus_tag LOCUS_40280 174259 174492 CDS product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095806.1 protein_id gnl|my_center|LOCUS_40280 175622 174489 gene locus_tag LOCUS_40290 gene ddlA 175622 174489 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095807.1 protein_id gnl|my_center|LOCUS_40290 175673 176356 gene locus_tag LOCUS_40300 175673 176356 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095808.1 protein_id gnl|my_center|LOCUS_40300 176526 177719 gene locus_tag LOCUS_40310 176526 177719 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 protein_id gnl|my_center|LOCUS_40310 177970 178230 gene locus_tag LOCUS_40320 gene iraP 177970 178230 CDS product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095810.1 protein_id gnl|my_center|LOCUS_40320 178328 179743 gene locus_tag LOCUS_40330 gene phoA 178328 179743 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368025.1 protein_id gnl|my_center|LOCUS_40330 179837 180157 gene locus_tag LOCUS_40340 gene psiF 179837 180157 CDS product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 protein_id gnl|my_center|LOCUS_40340 180372 181361 gene locus_tag LOCUS_40350 gene adrA 180372 181361 CDS product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484048.1 protein_id gnl|my_center|LOCUS_40350 181488 183014 gene locus_tag LOCUS_40360 181488 183014 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965761.1 protein_id gnl|my_center|LOCUS_40360 183791 183021 gene locus_tag LOCUS_40370 gene proC 183791 183021 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412190.1 protein_id gnl|my_center|LOCUS_40370 183959 184414 gene locus_tag LOCUS_40380 183959 184414 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095815.1 protein_id gnl|my_center|LOCUS_40380 184679 185203 gene locus_tag LOCUS_40390 gene aroL 184679 185203 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 protein_id gnl|my_center|LOCUS_40390 185253 185444 gene locus_tag LOCUS_40400 gene yaiA 185253 185444 CDS product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142439.1 protein_id gnl|my_center|LOCUS_40400 185631 186308 gene locus_tag LOCUS_40410 185631 186308 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095818.1 protein_id gnl|my_center|LOCUS_40410 186396 186680 gene locus_tag LOCUS_40420 gene ppnP 186396 186680 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368017.1 protein_id gnl|my_center|LOCUS_40420 187596 186802 gene locus_tag LOCUS_40430 gene rdgC 187596 186802 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964305.1 protein_id gnl|my_center|LOCUS_40430 187872 188060 gene locus_tag LOCUS_40440 187872 188060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40440 188152 188718 gene locus_tag LOCUS_40450 188152 188718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40450 188965 190350 gene locus_tag LOCUS_40460 gene dosC 188965 190350 CDS product diguanylate cyclase DosC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776396.1 protein_id gnl|my_center|LOCUS_40460 190384 191319 gene locus_tag LOCUS_40470 190384 191319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40470 191433 192803 gene locus_tag LOCUS_40480 191433 192803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40480 196014 192865 gene locus_tag LOCUS_40490 gene sbcC 196014 192865 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698907.1 protein_id gnl|my_center|LOCUS_40490 197210 196011 gene locus_tag LOCUS_40500 gene sbcD 197210 196011 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704550.1 protein_id gnl|my_center|LOCUS_40500 197405 198094 gene locus_tag LOCUS_40510 gene phoB 197405 198094 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004099401.1 protein_id gnl|my_center|LOCUS_40510 198115 199404 gene locus_tag LOCUS_40520 gene phoR 198115 199404 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893611.1 protein_id gnl|my_center|LOCUS_40520 199887 201206 gene locus_tag LOCUS_40530 gene brnQ 199887 201206 CDS product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149625.1 protein_id gnl|my_center|LOCUS_40530 201225 202655 gene locus_tag LOCUS_40540 gene proY 201225 202655 CDS product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445555.1 protein_id gnl|my_center|LOCUS_40540 204942 202702 gene locus_tag LOCUS_40550 204942 202702 CDS product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060811.1 protein_id gnl|my_center|LOCUS_40550 205156 206970 gene locus_tag LOCUS_40560 gene malZ 205156 206970 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302367.1 protein_id gnl|my_center|LOCUS_40560 207051 209765 gene locus_tag LOCUS_40570 207051 209765 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 protein_id gnl|my_center|LOCUS_40570 209762 211138 gene locus_tag LOCUS_40580 209762 211138 CDS product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114469.1 protein_id gnl|my_center|LOCUS_40580 211720 211139 gene locus_tag LOCUS_40590 gene acpH 211720 211139 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095830.1 protein_id gnl|my_center|LOCUS_40590 211812 212882 gene locus_tag LOCUS_40600 211812 212882 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 protein_id gnl|my_center|LOCUS_40600 213031 214158 gene locus_tag LOCUS_40610 213031 214158 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667319.1 protein_id gnl|my_center|LOCUS_40610 214181 214513 gene locus_tag LOCUS_40620 gene yajC 214181 214513 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007630.1 protein_id gnl|my_center|LOCUS_40620 214574 216388 gene locus_tag LOCUS_40630 gene secD 214574 216388 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095833.1 protein_id gnl|my_center|LOCUS_40630 216399 217370 gene locus_tag LOCUS_40640 gene secF 216399 217370 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095834.1 protein_id gnl|my_center|LOCUS_40640 217504 217851 gene locus_tag LOCUS_40650 gene yajD 217504 217851 CDS product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974818.1 protein_id gnl|my_center|LOCUS_40650 217902 219116 gene locus_tag LOCUS_40660 217902 219116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 220139 219258 gene locus_tag LOCUS_40670 220139 219258 CDS product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025756198.1 protein_id gnl|my_center|LOCUS_40670 220967 220419 gene locus_tag LOCUS_40680 220967 220419 CDS product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830864.1 protein_id gnl|my_center|LOCUS_40680 221131 220964 gene locus_tag LOCUS_40690 221131 220964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 221449 221992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 222008 222139 gene locus_tag LOCUS_40700 222008 222139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 222142 222501 gene locus_tag LOCUS_40710 222142 222501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40710 222483 223244 gene locus_tag LOCUS_40720 222483 223244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40720 223334 223804 gene locus_tag LOCUS_40730 gene ribE 223334 223804 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 protein_id gnl|my_center|LOCUS_40730 223824 224243 gene locus_tag LOCUS_40740 gene nusB 223824 224243 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809908.1 protein_id gnl|my_center|LOCUS_40740 224319 225296 gene locus_tag LOCUS_40750 gene thiL 224319 225296 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742109.1 protein_id gnl|my_center|LOCUS_40750 225274 225789 gene locus_tag LOCUS_40760 gene pgpA 225274 225789 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154043.1 protein_id gnl|my_center|LOCUS_40760 226824 225850 gene locus_tag LOCUS_40770 gene yajO 226824 225850 CDS product 1-deoxyxylulose-5-phosphate synthase YajO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199800.1 protein_id gnl|my_center|LOCUS_40770 228750 226888 gene locus_tag LOCUS_40780 gene dxs 228750 226888 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006816.1 protein_id gnl|my_center|LOCUS_40780 229736 228837 gene locus_tag LOCUS_40790 gene ispA 229736 228837 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348078.1 protein_id gnl|my_center|LOCUS_40790 229979 229737 gene locus_tag LOCUS_40800 gene xseB 229979 229737 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 protein_id gnl|my_center|LOCUS_40800 230208 231656 gene locus_tag LOCUS_40810 gene thiI 230208 231656 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668658.1 protein_id gnl|my_center|LOCUS_40810 231684 232313 gene locus_tag LOCUS_40820 231684 232313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 232943 232350 gene locus_tag LOCUS_40830 gene yajL 232943 232350 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275809.1 protein_id gnl|my_center|LOCUS_40830 233817 232906 gene locus_tag LOCUS_40840 gene panE 233817 232906 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705855.1 protein_id gnl|my_center|LOCUS_40840 233958 234449 gene locus_tag LOCUS_40850 233958 234449 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704566.1 protein_id gnl|my_center|LOCUS_40850 235862 234498 gene locus_tag LOCUS_40860 235862 234498 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095847.1 protein_id gnl|my_center|LOCUS_40860 236655 236008 gene locus_tag LOCUS_40870 gene fucA 236655 236008 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440772.1 protein_id gnl|my_center|LOCUS_40870 237732 236737 gene locus_tag LOCUS_40880 237732 236737 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 protein_id gnl|my_center|LOCUS_40880 239133 237769 gene locus_tag LOCUS_40890 239133 237769 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_40890 240547 239123 gene locus_tag LOCUS_40900 gene nhaC 240547 239123 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261868.1 protein_id gnl|my_center|LOCUS_40900 241061 242839 gene locus_tag LOCUS_40910 gene fucI 241061 242839 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724173.1 protein_id gnl|my_center|LOCUS_40910 242887 244275 gene locus_tag LOCUS_40920 gene fucK 242887 244275 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763972.1 protein_id gnl|my_center|LOCUS_40920 248060 244284 gene locus_tag LOCUS_40930 248060 244284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 249512 248625 gene locus_tag LOCUS_40940 gene cyoE 249512 248625 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971326.1 protein_id gnl|my_center|LOCUS_40940 249850 249524 gene locus_tag LOCUS_40950 249850 249524 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176899.1 protein_id gnl|my_center|LOCUS_40950 250464 249850 gene locus_tag LOCUS_40960 250464 249850 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061708214.1 protein_id gnl|my_center|LOCUS_40960 252446 250464 gene locus_tag LOCUS_40970 gene cyoB 252446 250464 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704587.1 protein_id gnl|my_center|LOCUS_40970 253414 252467 gene locus_tag LOCUS_40980 gene cyoA 253414 252467 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095851.1 protein_id gnl|my_center|LOCUS_40980 255457 253982 gene locus_tag LOCUS_40990 gene ampG 255457 253982 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095853.1 protein_id gnl|my_center|LOCUS_40990 256128 255499 gene locus_tag LOCUS_41000 256128 255499 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981453.1 protein_id gnl|my_center|LOCUS_41000 256380 256697 gene locus_tag LOCUS_41010 gene bolA 256380 256697 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973433.1 protein_id gnl|my_center|LOCUS_41010 257041 258339 gene locus_tag LOCUS_41020 gene tig 257041 258339 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198406.1 protein_id gnl|my_center|LOCUS_41020 258627 259250 gene locus_tag LOCUS_41030 gene clpP 258627 259250 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021624.1 protein_id gnl|my_center|LOCUS_41030 259376 260650 gene locus_tag LOCUS_41040 gene clpX 259376 260650 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095858.1 protein_id gnl|my_center|LOCUS_41040 260834 263188 gene locus_tag LOCUS_41050 gene lon 260834 263188 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067728.1 protein_id gnl|my_center|LOCUS_41050 263399 263671 gene locus_tag LOCUS_41060 gene hupB 263399 263671 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002444653.1 protein_id gnl|my_center|LOCUS_41060 263878 265752 gene locus_tag LOCUS_41070 gene ppiD 263878 265752 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095860.1 protein_id gnl|my_center|LOCUS_41070 265897 266277 gene locus_tag LOCUS_41080 265897 266277 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680322.1 protein_id gnl|my_center|LOCUS_41080 266375 266782 gene locus_tag LOCUS_41090 gene fadM 266375 266782 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 protein_id gnl|my_center|LOCUS_41090 267633 266932 gene locus_tag LOCUS_41100 gene queC 267633 266932 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095864.1 protein_id gnl|my_center|LOCUS_41100 269393 267657 gene locus_tag LOCUS_41110 269393 267657 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238179.1 protein_id gnl|my_center|LOCUS_41110 269493 270311 gene locus_tag LOCUS_41120 gene cof 269493 270311 CDS product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095866.1 protein_id gnl|my_center|LOCUS_41120 271398 270352 gene locus_tag LOCUS_41130 271398 270352 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704598.1 protein_id gnl|my_center|LOCUS_41130 271514 271972 gene locus_tag LOCUS_41140 271514 271972 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367940.1 protein_id gnl|my_center|LOCUS_41140 272017 273780 gene locus_tag LOCUS_41150 272017 273780 CDS product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095869.1 protein_id gnl|my_center|LOCUS_41150 273773 275551 gene locus_tag LOCUS_41160 273773 275551 CDS product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256206.1 protein_id gnl|my_center|LOCUS_41160 275795 276133 gene locus_tag LOCUS_41170 gene glnK 275795 276133 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 protein_id gnl|my_center|LOCUS_41170 276168 277454 gene locus_tag LOCUS_41180 gene amtB 276168 277454 CDS product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095872.1 protein_id gnl|my_center|LOCUS_41180 278269 277529 gene locus_tag LOCUS_41190 278269 277529 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 protein_id gnl|my_center|LOCUS_41190 279863 278376 gene locus_tag LOCUS_41200 279863 278376 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 protein_id gnl|my_center|LOCUS_41200 280027 280920 gene locus_tag LOCUS_41210 280027 280920 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704602.1 protein_id gnl|my_center|LOCUS_41210 281824 280961 gene locus_tag LOCUS_41220 gene tesB 281824 280961 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095873.1 protein_id gnl|my_center|LOCUS_41220 282039 282608 gene locus_tag LOCUS_41230 282039 282608 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779831.1 protein_id gnl|my_center|LOCUS_41230 282958 282647 gene locus_tag LOCUS_41240 282958 282647 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095875.1 protein_id gnl|my_center|LOCUS_41240 283328 284416 gene locus_tag LOCUS_41250 283328 284416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 284600 284917 gene locus_tag LOCUS_41260 284600 284917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 284898 285554 gene locus_tag LOCUS_41270 284898 285554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 285946 285737 gene locus_tag LOCUS_41280 285946 285737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 286116 286868 gene locus_tag LOCUS_41290 286116 286868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 287256 287834 gene locus_tag LOCUS_41300 287256 287834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 288894 287794 gene locus_tag LOCUS_41310 288894 287794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 289117 289815 gene locus_tag LOCUS_41320 289117 289815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 290169 289885 gene locus_tag LOCUS_41330 290169 289885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036801.1 protein_id gnl|my_center|LOCUS_41330 291230 290781 gene locus_tag LOCUS_41340 291230 290781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 292672 293394 gene locus_tag LOCUS_41350 292672 293394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 293840 294091 gene locus_tag LOCUS_41360 293840 294091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095876.1 protein_id gnl|my_center|LOCUS_41360 294088 294333 gene locus_tag LOCUS_41370 294088 294333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367928.1 protein_id gnl|my_center|LOCUS_41370 294524 295603 gene locus_tag LOCUS_41380 294524 295603 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095880.1 protein_id gnl|my_center|LOCUS_41380 295707 298781 gene locus_tag LOCUS_41390 295707 298781 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095881.1 protein_id gnl|my_center|LOCUS_41390 300379 298820 gene locus_tag LOCUS_41400 300379 298820 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095884.1 protein_id gnl|my_center|LOCUS_41400 300478 301194 gene locus_tag LOCUS_41410 300478 301194 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922320.1 protein_id gnl|my_center|LOCUS_41410 302394 301195 gene locus_tag LOCUS_41420 302394 301195 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 protein_id gnl|my_center|LOCUS_41420 302666 304033 gene locus_tag LOCUS_41430 302666 304033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 304706 304035 gene locus_tag LOCUS_41440 304706 304035 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161798788.1 protein_id gnl|my_center|LOCUS_41440 305482 304691 gene locus_tag LOCUS_41450 305482 304691 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705346.1 protein_id gnl|my_center|LOCUS_41450 306285 305479 gene locus_tag LOCUS_41460 306285 305479 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366692.1 protein_id gnl|my_center|LOCUS_41460 307334 306312 gene locus_tag LOCUS_41470 307334 306312 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705347.1 protein_id gnl|my_center|LOCUS_41470 307602 307862 gene locus_tag LOCUS_41480 307602 307862 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801415.1 protein_id gnl|my_center|LOCUS_41480 308701 308003 gene locus_tag LOCUS_41490 308701 308003 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704607.1 protein_id gnl|my_center|LOCUS_41490 309265 308798 gene locus_tag LOCUS_41500 309265 308798 CDS product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 protein_id gnl|my_center|LOCUS_41500 309804 309586 gene locus_tag LOCUS_41510 309804 309586 CDS product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095889.1 protein_id gnl|my_center|LOCUS_41510 310201 309827 gene locus_tag LOCUS_41520 gene tomB 310201 309827 CDS product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344807.1 protein_id gnl|my_center|LOCUS_41520 313854 310705 gene locus_tag LOCUS_41530 gene acrB 313854 310705 CDS product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132507.1 protein_id gnl|my_center|LOCUS_41530 314857 313877 gene locus_tag LOCUS_41540 gene acrA 314857 313877 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095891.1 protein_id gnl|my_center|LOCUS_41540 315218 315871 gene locus_tag LOCUS_41550 gene acrR 315218 315871 CDS product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095892.1 protein_id gnl|my_center|LOCUS_41550 316001 319321 gene locus_tag LOCUS_41560 gene mscK 316001 319321 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095893.1 protein_id gnl|my_center|LOCUS_41560 319533 319372 gene locus_tag LOCUS_41570 319533 319372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 320075 319548 gene locus_tag LOCUS_41580 gene priC 320075 319548 CDS product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704614.1 protein_id gnl|my_center|LOCUS_41580 320145 320522 gene locus_tag LOCUS_41590 320145 320522 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 protein_id gnl|my_center|LOCUS_41590 320674 321225 gene locus_tag LOCUS_41600 gene apt 320674 321225 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127359.1 protein_id gnl|my_center|LOCUS_41600 321383 323254 gene locus_tag LOCUS_41610 gene dnaX 321383 323254 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685009.1 protein_id gnl|my_center|LOCUS_41610 323337 323669 gene locus_tag LOCUS_41620 323337 323669 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008805448.1 protein_id gnl|my_center|LOCUS_41620 323669 324274 gene locus_tag LOCUS_41630 gene recR 323669 324274 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195026.1 protein_id gnl|my_center|LOCUS_41630 324387 326261 gene locus_tag LOCUS_41640 gene htpG 324387 326261 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001682145.1 protein_id gnl|my_center|LOCUS_41640 326490 327134 gene locus_tag LOCUS_41650 gene adk 326490 327134 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220233.1 protein_id gnl|my_center|LOCUS_41650 327259 328221 gene locus_tag LOCUS_41660 gene hemH 327259 328221 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095900.1 protein_id gnl|my_center|LOCUS_41660 328284 329588 gene locus_tag LOCUS_41670 328284 329588 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095901.1 protein_id gnl|my_center|LOCUS_41670 330324 329713 gene locus_tag LOCUS_41680 330324 329713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41680 331390 330212 gene locus_tag LOCUS_41690 331390 330212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41690 332837 331623 gene locus_tag LOCUS_41700 gene fsr 332837 331623 CDS product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 protein_id gnl|my_center|LOCUS_41700 333001 333921 gene locus_tag LOCUS_41710 333001 333921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41710 333807 334652 gene locus_tag LOCUS_41720 333807 334652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41720 335227 334748 gene locus_tag LOCUS_41730 gene ybaK 335227 334748 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428207.1 protein_id gnl|my_center|LOCUS_41730 336212 335343 gene locus_tag LOCUS_41740 336212 335343 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421856.1 protein_id gnl|my_center|LOCUS_41740 338786 336285 gene locus_tag LOCUS_41750 gene copA 338786 336285 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418822.1 protein_id gnl|my_center|LOCUS_41750 338972 339304 gene locus_tag LOCUS_41760 gene cueR 338972 339304 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095907.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41760 339959 339261 gene locus_tag LOCUS_41770 339959 339261 CDS product DUF3142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209913.1 protein_id gnl|my_center|LOCUS_41770 340450 339971 gene locus_tag LOCUS_41780 340450 339971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41780 342134 340443 gene locus_tag LOCUS_41790 342134 340443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209914.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41790 342612 342148 gene locus_tag LOCUS_41800 342612 342148 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561177.1 protein_id gnl|my_center|LOCUS_41800 343526 342609 gene locus_tag LOCUS_41810 343526 342609 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906145.1 protein_id gnl|my_center|LOCUS_41810 344469 343615 gene locus_tag LOCUS_41820 gene cnoX 344469 343615 CDS product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295322.1 protein_id gnl|my_center|LOCUS_41820 345295 344528 gene locus_tag LOCUS_41830 345295 344528 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095912.1 protein_id gnl|my_center|LOCUS_41830 345977 345324 gene locus_tag LOCUS_41840 gene tesA 345977 345324 CDS product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 protein_id gnl|my_center|LOCUS_41840 345915 346226 gene locus_tag LOCUS_41850 345915 346226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41850 346189 346602 gene locus_tag LOCUS_41860 346189 346602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41860 346599 349013 gene locus_tag LOCUS_41870 346599 349013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095915.1 protein_id gnl|my_center|LOCUS_41870 349244 350077 gene locus_tag LOCUS_41880 349244 350077 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524312.1 protein_id gnl|my_center|LOCUS_41880 350133 351149 gene locus_tag LOCUS_41890 gene sfbB 350133 351149 CDS product virulence-associated ABC transporter ATP-binding protein SfbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569655.1 protein_id gnl|my_center|LOCUS_41890 351142 351801 gene locus_tag LOCUS_41900 351142 351801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 protein_id gnl|my_center|LOCUS_41900 352966 351875 gene locus_tag LOCUS_41910 gene mnmH 352966 351875 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154074.1 protein_id gnl|my_center|LOCUS_41910 354126 353059 gene locus_tag LOCUS_41920 gene purK 354126 353059 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815527.1 protein_id gnl|my_center|LOCUS_41920 354632 354123 gene locus_tag LOCUS_41930 gene purE 354632 354123 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095919.1 protein_id gnl|my_center|LOCUS_41930 355473 354751 gene locus_tag LOCUS_41940 gene lpxH 355473 354751 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095922.1 protein_id gnl|my_center|LOCUS_41940 355971 355477 gene locus_tag LOCUS_41950 gene ppiB 355971 355477 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256006.1 protein_id gnl|my_center|LOCUS_41950 356145 357530 gene locus_tag LOCUS_41960 gene cysS 356145 357530 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912345.1 protein_id gnl|my_center|LOCUS_41960 358114 357587 gene locus_tag LOCUS_41970 358114 357587 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095925.1 protein_id gnl|my_center|LOCUS_41970 359204 358188 gene locus_tag LOCUS_41980 gene malI 359204 358188 CDS product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095926.1 protein_id gnl|my_center|LOCUS_41980 360797 359298 gene locus_tag LOCUS_41990 360797 359298 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095927.1 protein_id gnl|my_center|LOCUS_41990 361233 361021 gene locus_tag LOCUS_42000 gene ybcJ 361233 361021 CDS product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190278.1 protein_id gnl|my_center|LOCUS_42000 362099 361233 gene locus_tag LOCUS_42010 gene folD 362099 361233 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367875.1 protein_id gnl|my_center|LOCUS_42010 362601 363170 gene locus_tag LOCUS_42020 gene fimA 362601 363170 CDS product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095930.1 protein_id gnl|my_center|LOCUS_42020 363276 363794 gene locus_tag LOCUS_42030 gene fimI 363276 363794 CDS product type 1 fimbrial protein subunit FimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095931.1 protein_id gnl|my_center|LOCUS_42030 363859 364521 gene locus_tag LOCUS_42040 gene fimC 363859 364521 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095932.1 protein_id gnl|my_center|LOCUS_42040 364558 367155 gene locus_tag LOCUS_42050 364558 367155 CDS product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095933.1 protein_id gnl|my_center|LOCUS_42050 367177 368181 gene locus_tag LOCUS_42060 gene fimH 367177 368181 CDS product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095934.1 protein_id gnl|my_center|LOCUS_42060 368192 368710 gene locus_tag LOCUS_42070 gene sfmF 368192 368710 CDS product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095935.1 protein_id gnl|my_center|LOCUS_42070 369328 368759 gene locus_tag LOCUS_42080 gene fimZ 369328 368759 CDS product fimbria biosynthesis transcriptional regulator FimZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801270.1 protein_id gnl|my_center|LOCUS_42080 370572 370030 gene locus_tag LOCUS_42090 370572 370030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 371068 371144 gene locus_tag LOCUS_t00580 371068 371144 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 371639 371160 gene locus_tag LOCUS_42100 371639 371160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 371835 371662 gene locus_tag LOCUS_42110 371835 371662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 372535 372200 gene locus_tag LOCUS_42120 372535 372200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 372993 372619 gene locus_tag LOCUS_42130 372993 372619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281200.1 protein_id gnl|my_center|LOCUS_42130 373276 373461 gene locus_tag LOCUS_42140 373276 373461 CDS product phage NinH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144767.1 protein_id gnl|my_center|LOCUS_42140 373463 373642 gene locus_tag LOCUS_42150 373463 373642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 373639 373800 gene locus_tag LOCUS_42160 373639 373800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 373964 375049 gene locus_tag LOCUS_42170 373964 375049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 375105 375533 gene locus_tag LOCUS_42180 375105 375533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 375502 375705 gene locus_tag LOCUS_42190 375502 375705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 376214 376059 gene locus_tag LOCUS_42200 376214 376059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 376359 376652 gene locus_tag LOCUS_42210 376359 376652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434330.1 protein_id gnl|my_center|LOCUS_42210 377076 377993 gene locus_tag LOCUS_42220 377076 377993 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_42220 377993 378436 gene locus_tag LOCUS_42230 377993 378436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42230 378429 378848 gene locus_tag LOCUS_42240 378429 378848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42240 378776 379021 gene locus_tag LOCUS_42250 378776 379021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42250 379018 380283 gene locus_tag LOCUS_42260 379018 380283 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330441.1 protein_id gnl|my_center|LOCUS_42260 380280 381458 gene locus_tag LOCUS_42270 380280 381458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 381451 382929 gene locus_tag LOCUS_42280 381451 382929 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106515452.1 protein_id gnl|my_center|LOCUS_42280 382929 383876 gene locus_tag LOCUS_42290 382929 383876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 384348 383791 gene locus_tag LOCUS_42300 384348 383791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 385486 384455 gene locus_tag LOCUS_42310 385486 384455 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210897.1 protein_id gnl|my_center|LOCUS_42310 385873 385661 gene locus_tag LOCUS_42320 385873 385661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 386330 386028 gene locus_tag LOCUS_42330 386330 386028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 386886 386476 gene locus_tag LOCUS_42340 386886 386476 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419542.1 protein_id gnl|my_center|LOCUS_42340 389524 386921 gene locus_tag LOCUS_42350 389524 386921 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096775.1 protein_id gnl|my_center|LOCUS_42350 390557 389757 gene locus_tag LOCUS_42360 390557 389757 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267673.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42360 390769 390551 gene locus_tag LOCUS_42370 390769 390551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 390872 391777 gene locus_tag LOCUS_42380 390872 391777 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103634.1 protein_id gnl|my_center|LOCUS_42380 392053 391793 gene locus_tag LOCUS_42390 392053 391793 CDS product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097997.1 protein_id gnl|my_center|LOCUS_42390 392333 393679 gene locus_tag LOCUS_42400 392333 393679 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705969.1 protein_id gnl|my_center|LOCUS_42400 395247 393970 gene locus_tag LOCUS_42410 395247 393970 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268608.1 protein_id gnl|my_center|LOCUS_42410 396926 395244 gene locus_tag LOCUS_42420 396926 395244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 397196 398518 gene locus_tag LOCUS_42430 397196 398518 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038841.1 protein_id gnl|my_center|LOCUS_42430 399022 398780 gene locus_tag LOCUS_42440 399022 398780 CDS product biofilm/acid-resistance regulator YmgB/AriR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208085.1 protein_id gnl|my_center|LOCUS_42440 401833 399275 gene locus_tag LOCUS_42450 401833 399275 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210844.1 protein_id gnl|my_center|LOCUS_42450 402745 401984 gene locus_tag LOCUS_42460 402745 401984 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465929.1 protein_id gnl|my_center|LOCUS_42460 403358 402768 gene locus_tag LOCUS_42470 403358 402768 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074180.1 protein_id gnl|my_center|LOCUS_42470 404008 403553 gene locus_tag LOCUS_42480 404008 403553 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705537.1 protein_id gnl|my_center|LOCUS_42480 405794 404556 gene locus_tag LOCUS_42490 405794 404556 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097093.1 protein_id gnl|my_center|LOCUS_42490 406230 406748 gene locus_tag LOCUS_42500 406230 406748 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399415.1 protein_id gnl|my_center|LOCUS_42500 407909 407145 gene locus_tag LOCUS_42510 407909 407145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 408124 407903 gene locus_tag LOCUS_42520 408124 407903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 408320 408162 gene locus_tag LOCUS_42530 408320 408162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 408894 408313 gene locus_tag LOCUS_42540 408894 408313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 410111 408903 gene locus_tag LOCUS_42550 410111 408903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 410627 411712 gene locus_tag LOCUS_42560 410627 411712 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704680.1 protein_id gnl|my_center|LOCUS_42560 411767 413965 gene locus_tag LOCUS_42570 411767 413965 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704681.1 protein_id gnl|my_center|LOCUS_42570 414072 414611 gene locus_tag LOCUS_42580 414072 414611 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229479.1 protein_id gnl|my_center|LOCUS_42580 415086 415415 gene locus_tag LOCUS_42590 415086 415415 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280945.1 protein_id gnl|my_center|LOCUS_42590 415555 416967 gene locus_tag LOCUS_42600 gene pheP 415555 416967 CDS product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786278.1 protein_id gnl|my_center|LOCUS_42600 417383 417012 gene locus_tag LOCUS_42610 417383 417012 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348987.1 protein_id gnl|my_center|LOCUS_42610 417963 417373 gene locus_tag LOCUS_42620 417963 417373 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097680.1 protein_id gnl|my_center|LOCUS_42620 418155 419255 gene locus_tag LOCUS_42630 418155 419255 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_42630 419290 419646 gene locus_tag LOCUS_42640 419290 419646 CDS product RamA family antibiotic efflux transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367806.1 protein_id gnl|my_center|LOCUS_42640 419715 420021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 420316 420071 gene locus_tag LOCUS_42650 420316 420071 CDS product DUF1158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682500.1 protein_id gnl|my_center|LOCUS_42650 421510 420392 gene locus_tag LOCUS_42660 421510 420392 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130654.1 protein_id gnl|my_center|LOCUS_42660 423045 421582 gene locus_tag LOCUS_42670 423045 421582 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527998.1 protein_id gnl|my_center|LOCUS_42670 423304 424152 gene locus_tag LOCUS_42680 423304 424152 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167356.1 protein_id gnl|my_center|LOCUS_42680 424199 424840 gene locus_tag LOCUS_42690 424199 424840 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389051.1 protein_id gnl|my_center|LOCUS_42690 424855 425520 gene locus_tag LOCUS_42700 424855 425520 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522302.1 protein_id gnl|my_center|LOCUS_42700 425513 426274 gene locus_tag LOCUS_42710 425513 426274 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389905.1 protein_id gnl|my_center|LOCUS_42710 428591 426393 gene locus_tag LOCUS_42720 gene iutA 428591 426393 CDS product ferric aerobactin receptor IutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973519.1 protein_id gnl|my_center|LOCUS_42720 428903 429874 gene locus_tag LOCUS_42730 gene uvsE 428903 429874 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 protein_id gnl|my_center|LOCUS_42730 430641 429883 gene locus_tag LOCUS_42740 430641 429883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389976.1 protein_id gnl|my_center|LOCUS_42740 430825 432162 gene locus_tag LOCUS_42750 430825 432162 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_42750 433142 432714 gene locus_tag LOCUS_42760 433142 432714 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642289.1 protein_id gnl|my_center|LOCUS_42760 434250 433207 gene locus_tag LOCUS_42770 434250 433207 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764889.1 protein_id gnl|my_center|LOCUS_42770 435480 434335 gene locus_tag LOCUS_42780 435480 434335 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127753.1 protein_id gnl|my_center|LOCUS_42780 436479 435742 gene locus_tag LOCUS_42790 436479 435742 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_42790 437278 436502 gene locus_tag LOCUS_42800 437278 436502 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967423.1 protein_id gnl|my_center|LOCUS_42800 437749 437291 gene locus_tag LOCUS_42810 437749 437291 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975041.1 protein_id gnl|my_center|LOCUS_42810 437928 438839 gene locus_tag LOCUS_42820 437928 438839 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_42820 439263 440000 gene locus_tag LOCUS_42830 439263 440000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 >Feature sequence06 155 265 gene locus_tag LOCUS_r00010 155 265 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 861 346 gene locus_tag LOCUS_42840 gene mobB 861 346 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989262.1 protein_id gnl|my_center|LOCUS_42840 1385 858 gene locus_tag LOCUS_42850 gene mobA 1385 858 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052181.1 protein_id gnl|my_center|LOCUS_42850 1512 1781 gene locus_tag LOCUS_42860 1512 1781 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099387.1 protein_id gnl|my_center|LOCUS_42860 1856 2842 gene locus_tag LOCUS_42870 gene srkA 1856 2842 CDS product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065516.1 protein_id gnl|my_center|LOCUS_42870 2870 3493 gene locus_tag LOCUS_42880 gene dsbA 2870 3493 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099385.1 protein_id gnl|my_center|LOCUS_42880 4416 3508 gene locus_tag LOCUS_42890 4416 3508 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099384.1 protein_id gnl|my_center|LOCUS_42890 4836 7613 gene locus_tag LOCUS_42900 gene polA 4836 7613 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 protein_id gnl|my_center|LOCUS_42900 8569 7910 gene locus_tag LOCUS_42910 gene yihA 8569 7910 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099382.1 protein_id gnl|my_center|LOCUS_42910 9114 9626 gene locus_tag LOCUS_42920 gene yihI 9114 9626 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 protein_id gnl|my_center|LOCUS_42920 9812 11185 gene locus_tag LOCUS_42930 gene hemN 9812 11185 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003520.1 protein_id gnl|my_center|LOCUS_42930 12855 11446 gene locus_tag LOCUS_42940 gene glnG 12855 11446 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602497.1 protein_id gnl|my_center|LOCUS_42940 13913 12864 gene locus_tag LOCUS_42950 gene glnL 13913 12864 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501857.1 protein_id gnl|my_center|LOCUS_42950 15586 14177 gene locus_tag LOCUS_42960 gene glnA 15586 14177 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 protein_id gnl|my_center|LOCUS_42960 15965 17788 gene locus_tag LOCUS_42970 gene typA 15965 17788 CDS product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099375.1 protein_id gnl|my_center|LOCUS_42970 18059 18658 gene locus_tag LOCUS_42980 gene yihX 18059 18658 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099365.1 protein_id gnl|my_center|LOCUS_42980 18652 19512 gene locus_tag LOCUS_42990 18652 19512 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920751.1 protein_id gnl|my_center|LOCUS_42990 19509 19946 gene locus_tag LOCUS_43000 gene dtd 19509 19946 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560978.1 protein_id gnl|my_center|LOCUS_43000 19943 20932 gene locus_tag LOCUS_43010 gene fabY 19943 20932 CDS product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080770.1 protein_id gnl|my_center|LOCUS_43010 21397 21639 gene locus_tag LOCUS_43020 21397 21639 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001523745.1 protein_id gnl|my_center|LOCUS_43020 21642 22013 gene locus_tag LOCUS_43030 21642 22013 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238494.1 protein_id gnl|my_center|LOCUS_43030 22980 22051 gene locus_tag LOCUS_43040 gene fdhE 22980 22051 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027727.1 protein_id gnl|my_center|LOCUS_43040 23612 22977 gene locus_tag LOCUS_43050 gene fdoI 23612 22977 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368962.1 protein_id gnl|my_center|LOCUS_43050 24514 23609 gene locus_tag LOCUS_43060 gene fdxH 24514 23609 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368961.1 protein_id gnl|my_center|LOCUS_43060 27577 24527 gene locus_tag LOCUS_43070 gene fdnG 27577 24527 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086527976.1 transl_except (pos:complement(26990..26992),aa:Sec) note codon on position 196 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_43070 27793 28569 gene locus_tag LOCUS_43080 gene fdhD 27793 28569 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753589.1 protein_id gnl|my_center|LOCUS_43080 28694 28906 gene locus_tag LOCUS_43090 28694 28906 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099352.1 protein_id gnl|my_center|LOCUS_43090 29315 30295 gene locus_tag LOCUS_43100 gene pfkA 29315 30295 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208966.1 protein_id gnl|my_center|LOCUS_43100 30307 30621 gene locus_tag LOCUS_43110 30307 30621 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292534.1 protein_id gnl|my_center|LOCUS_43110 30614 31981 gene locus_tag LOCUS_43120 30614 31981 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 protein_id gnl|my_center|LOCUS_43120 31968 32810 gene locus_tag LOCUS_43130 31968 32810 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294699.1 protein_id gnl|my_center|LOCUS_43130 32874 33143 gene locus_tag LOCUS_43140 32874 33143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 33153 33590 gene locus_tag LOCUS_43150 33153 33590 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050067.1 protein_id gnl|my_center|LOCUS_43150 33587 34132 gene locus_tag LOCUS_43160 33587 34132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 35007 34309 gene locus_tag LOCUS_43170 gene ompL 35007 34309 CDS product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309878.1 protein_id gnl|my_center|LOCUS_43170 35739 35155 gene locus_tag LOCUS_43180 35739 35155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43180 35996 35730 gene locus_tag LOCUS_43190 35996 35730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 36789 35989 gene locus_tag LOCUS_43200 36789 35989 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365419.1 protein_id gnl|my_center|LOCUS_43200 37298 36801 gene locus_tag LOCUS_43210 37298 36801 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354800.1 protein_id gnl|my_center|LOCUS_43210 38494 37319 gene locus_tag LOCUS_43220 38494 37319 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703474.1 protein_id gnl|my_center|LOCUS_43220 38973 38491 gene locus_tag LOCUS_43230 38973 38491 CDS product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 protein_id gnl|my_center|LOCUS_43230 41809 39209 gene locus_tag LOCUS_43240 41809 39209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 42174 43388 gene locus_tag LOCUS_43250 42174 43388 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703938.1 protein_id gnl|my_center|LOCUS_43250 43404 44327 gene locus_tag LOCUS_43260 43404 44327 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_43260 44341 45615 gene locus_tag LOCUS_43270 44341 45615 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368950.1 protein_id gnl|my_center|LOCUS_43270 46068 45754 gene locus_tag LOCUS_43280 gene rhaM 46068 45754 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619478.1 protein_id gnl|my_center|LOCUS_43280 47213 46065 gene locus_tag LOCUS_43290 gene fucO 47213 46065 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099340.1 protein_id gnl|my_center|LOCUS_43290 48320 47316 gene locus_tag LOCUS_43300 48320 47316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968717.1 protein_id gnl|my_center|LOCUS_43300 49321 48317 gene locus_tag LOCUS_43310 49321 48317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973085.1 protein_id gnl|my_center|LOCUS_43310 50823 49321 gene locus_tag LOCUS_43320 50823 49321 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974436.1 protein_id gnl|my_center|LOCUS_43320 51922 50936 gene locus_tag LOCUS_43330 gene rhaS 51922 50936 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973083.1 protein_id gnl|my_center|LOCUS_43330 52841 52011 gene locus_tag LOCUS_43340 gene rhaD 52841 52011 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099339.1 protein_id gnl|my_center|LOCUS_43340 54185 52926 gene locus_tag LOCUS_43350 54185 52926 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211475.1 protein_id gnl|my_center|LOCUS_43350 55651 54182 gene locus_tag LOCUS_43360 gene rhaB 55651 54182 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143961.1 protein_id gnl|my_center|LOCUS_43360 55944 56792 gene locus_tag LOCUS_43370 gene rhaS 55944 56792 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217112.1 protein_id gnl|my_center|LOCUS_43370 57019 57867 gene locus_tag LOCUS_43380 gene rhaR 57019 57867 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099334.1 protein_id gnl|my_center|LOCUS_43380 58055 58675 gene locus_tag LOCUS_43390 gene sodA 58055 58675 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297064.1 protein_id gnl|my_center|LOCUS_43390 58895 59917 gene locus_tag LOCUS_43400 gene kdgT 58895 59917 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166063.1 protein_id gnl|my_center|LOCUS_43400 60862 59966 gene locus_tag LOCUS_43410 60862 59966 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117946.1 protein_id gnl|my_center|LOCUS_43410 61020 61727 gene locus_tag LOCUS_43420 gene yiiM 61020 61727 CDS product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014343930.1 protein_id gnl|my_center|LOCUS_43420 63101 61728 gene locus_tag LOCUS_43430 gene cpxA 63101 61728 CDS product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099331.1 protein_id gnl|my_center|LOCUS_43430 63796 63098 gene locus_tag LOCUS_43440 gene cpxR 63796 63098 CDS product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 protein_id gnl|my_center|LOCUS_43440 63948 64439 gene locus_tag LOCUS_43450 gene cpxP 63948 64439 CDS product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233466.1 protein_id gnl|my_center|LOCUS_43450 64732 65031 gene locus_tag LOCUS_43460 64732 65031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 65231 66115 gene locus_tag LOCUS_43470 gene fieF 65231 66115 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368935.1 protein_id gnl|my_center|LOCUS_43470 66318 67280 gene locus_tag LOCUS_43480 gene pfkA 66318 67280 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 protein_id gnl|my_center|LOCUS_43480 67430 68419 gene locus_tag LOCUS_43490 67430 68419 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099326.1 protein_id gnl|my_center|LOCUS_43490 68555 69310 gene locus_tag LOCUS_43500 68555 69310 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369135.1 protein_id gnl|my_center|LOCUS_43500 69384 70688 gene locus_tag LOCUS_43510 69384 70688 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 protein_id gnl|my_center|LOCUS_43510 72242 70734 gene locus_tag LOCUS_43520 gene glpK 72242 70734 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369131.1 protein_id gnl|my_center|LOCUS_43520 73109 72264 gene locus_tag LOCUS_43530 73109 72264 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099317.1 protein_id gnl|my_center|LOCUS_43530 73634 73873 gene locus_tag LOCUS_43540 gene zapB 73634 73873 CDS product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099316.1 protein_id gnl|my_center|LOCUS_43540 75127 74102 gene locus_tag LOCUS_43550 75127 74102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 75703 75218 gene locus_tag LOCUS_43560 gene rraA 75703 75218 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872918.1 protein_id gnl|my_center|LOCUS_43560 76725 75796 gene locus_tag LOCUS_43570 gene menA 76725 75796 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139635.1 protein_id gnl|my_center|LOCUS_43570 78126 76792 gene locus_tag LOCUS_43580 gene hslU 78126 76792 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368931.1 protein_id gnl|my_center|LOCUS_43580 78666 78136 gene locus_tag LOCUS_43590 gene hslV 78666 78136 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501802.1 protein_id gnl|my_center|LOCUS_43590 79611 78757 gene locus_tag LOCUS_43600 gene ftsN 79611 78757 CDS product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099312.1 protein_id gnl|my_center|LOCUS_43600 80837 79812 gene locus_tag LOCUS_43610 gene cytR 80837 79812 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099311.1 protein_id gnl|my_center|LOCUS_43610 83157 80962 gene locus_tag LOCUS_43620 gene priA 83157 80962 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703950.1 protein_id gnl|my_center|LOCUS_43620 83430 83642 gene locus_tag LOCUS_43630 gene rpmE 83430 83642 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 protein_id gnl|my_center|LOCUS_43630 83994 84674 gene locus_tag LOCUS_43640 83994 84674 CDS product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378721.1 protein_id gnl|my_center|LOCUS_43640 85700 85092 gene locus_tag LOCUS_43650 85700 85092 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702296.1 protein_id gnl|my_center|LOCUS_43650 86074 85757 gene locus_tag LOCUS_43660 gene metJ 86074 85757 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862042.1 protein_id gnl|my_center|LOCUS_43660 86350 87510 gene locus_tag LOCUS_43670 gene metB 86350 87510 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099309.1 protein_id gnl|my_center|LOCUS_43670 87513 89945 gene locus_tag LOCUS_43680 gene metL 87513 89945 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110772.1 protein_id gnl|my_center|LOCUS_43680 90794 91043 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 91095 91307 gene locus_tag LOCUS_43690 91095 91307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 91773 91354 gene locus_tag LOCUS_43700 91773 91354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 94230 93001 gene locus_tag LOCUS_43710 94230 93001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 95096 94521 gene locus_tag LOCUS_43720 95096 94521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 95108 96368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 97793 96651 gene locus_tag LOCUS_43730 gene nagA 97793 96651 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243413.1 protein_id gnl|my_center|LOCUS_43730 98541 97807 gene locus_tag LOCUS_43740 gene nagB 98541 97807 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228092.1 protein_id gnl|my_center|LOCUS_43740 99465 98551 gene locus_tag LOCUS_43750 99465 98551 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099515.1 protein_id gnl|my_center|LOCUS_43750 101901 99478 gene locus_tag LOCUS_43760 101901 99478 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101845.1 protein_id gnl|my_center|LOCUS_43760 102729 102058 gene locus_tag LOCUS_43770 102729 102058 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226344.1 protein_id gnl|my_center|LOCUS_43770 104045 102942 gene locus_tag LOCUS_43780 gene gldA 104045 102942 CDS product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373992.1 protein_id gnl|my_center|LOCUS_43780 104762 104100 gene locus_tag LOCUS_43790 gene fsa 104762 104100 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703953.1 protein_id gnl|my_center|LOCUS_43790 105847 104987 gene locus_tag LOCUS_43800 105847 104987 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274608.1 protein_id gnl|my_center|LOCUS_43800 108573 105961 gene locus_tag LOCUS_43810 gene ppc 108573 105961 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099302.1 protein_id gnl|my_center|LOCUS_43810 110023 108872 gene locus_tag LOCUS_43820 gene argE 110023 108872 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 protein_id gnl|my_center|LOCUS_43820 110112 111116 gene locus_tag LOCUS_43830 gene argC 110112 111116 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099300.1 protein_id gnl|my_center|LOCUS_43830 111123 111899 gene locus_tag LOCUS_43840 gene argB 111123 111899 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686923.1 protein_id gnl|my_center|LOCUS_43840 111963 113336 gene locus_tag LOCUS_43850 gene argH 111963 113336 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368911.1 protein_id gnl|my_center|LOCUS_43850 113613 114530 gene locus_tag LOCUS_43860 gene oxyR 113613 114530 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099297.1 protein_id gnl|my_center|LOCUS_43860 115847 114513 gene locus_tag LOCUS_43870 gene sthA 115847 114513 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120789.1 protein_id gnl|my_center|LOCUS_43870 116113 116748 gene locus_tag LOCUS_43880 gene fabR 116113 116748 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501784.1 protein_id gnl|my_center|LOCUS_43880 116759 117112 gene locus_tag LOCUS_43890 116759 117112 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813838.1 protein_id gnl|my_center|LOCUS_43890 118257 117157 gene locus_tag LOCUS_43900 gene trmA 118257 117157 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187008.1 protein_id gnl|my_center|LOCUS_43900 118608 120467 gene locus_tag LOCUS_43910 gene btuB 118608 120467 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815316.1 protein_id gnl|my_center|LOCUS_43910 120412 121263 gene locus_tag LOCUS_43920 gene murI 120412 121263 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201804.1 protein_id gnl|my_center|LOCUS_43920 >Feature sequence07 9 84 gene locus_tag LOCUS_t00590 9 84 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 998 177 gene locus_tag LOCUS_43930 gene hdfR 998 177 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001541181.1 protein_id gnl|my_center|LOCUS_43930 1117 1455 gene locus_tag LOCUS_43940 1117 1455 CDS product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099290.1 protein_id gnl|my_center|LOCUS_43940 3007 1481 gene locus_tag LOCUS_43950 3007 1481 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058995.1 protein_id gnl|my_center|LOCUS_43950 3738 5231 gene locus_tag LOCUS_43960 gene ilvG 3738 5231 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703962.1 protein_id gnl|my_center|LOCUS_43960 5228 5491 gene locus_tag LOCUS_43970 gene ilvM 5228 5491 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860184.1 protein_id gnl|my_center|LOCUS_43970 5508 6437 gene locus_tag LOCUS_43980 gene ilvE 5508 6437 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208528.1 protein_id gnl|my_center|LOCUS_43980 6498 8348 gene locus_tag LOCUS_43990 gene ilvD 6498 8348 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703963.1 protein_id gnl|my_center|LOCUS_43990 8351 9895 gene locus_tag LOCUS_44000 gene ilvA 8351 9895 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833732.1 protein_id gnl|my_center|LOCUS_44000 10782 9892 gene locus_tag LOCUS_44010 gene ilvY 10782 9892 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365791.1 protein_id gnl|my_center|LOCUS_44010 10936 12411 gene locus_tag LOCUS_44020 gene ilvC 10936 12411 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024951.1 protein_id gnl|my_center|LOCUS_44020 12902 12630 gene locus_tag LOCUS_44030 gene ppiC 12902 12630 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099282.1 protein_id gnl|my_center|LOCUS_44030 12997 15021 gene locus_tag LOCUS_44040 gene rep 12997 15021 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 protein_id gnl|my_center|LOCUS_44040 16072 15077 gene locus_tag LOCUS_44050 16072 15077 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368889.1 protein_id gnl|my_center|LOCUS_44050 17127 16219 gene locus_tag LOCUS_44060 17127 16219 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703967.1 protein_id gnl|my_center|LOCUS_44060 18639 17146 gene locus_tag LOCUS_44070 gene gppA 18639 17146 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099280.1 protein_id gnl|my_center|LOCUS_44070 19913 18645 gene locus_tag LOCUS_44080 gene rhlB 19913 18645 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047509.1 protein_id gnl|my_center|LOCUS_44080 20058 20387 gene locus_tag LOCUS_44090 gene trxA 20058 20387 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004386384.1 protein_id gnl|my_center|LOCUS_44090 20726 21985 gene locus_tag LOCUS_44100 gene rho 20726 21985 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883293.1 protein_id gnl|my_center|LOCUS_44100 22306 23331 gene locus_tag LOCUS_44110 gene wecA 22306 23331 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 protein_id gnl|my_center|LOCUS_44110 23345 24391 gene locus_tag LOCUS_44120 gene wzzE 23345 24391 CDS product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099277.1 protein_id gnl|my_center|LOCUS_44120 24448 25578 gene locus_tag LOCUS_44130 gene wecB 24448 25578 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703970.1 protein_id gnl|my_center|LOCUS_44130 25575 26837 gene locus_tag LOCUS_44140 gene wecC 25575 26837 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 protein_id gnl|my_center|LOCUS_44140 26846 27523 gene locus_tag LOCUS_44150 gene rffC 26846 27523 CDS product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099274.1 protein_id gnl|my_center|LOCUS_44150 27528 28658 gene locus_tag LOCUS_44160 gene rffA 27528 28658 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_44160 28660 29910 gene locus_tag LOCUS_44170 gene wzxE 28660 29910 CDS product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050302.1 protein_id gnl|my_center|LOCUS_44170 29907 30986 gene locus_tag LOCUS_44180 29907 30986 CDS product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217177.1 protein_id gnl|my_center|LOCUS_44180 30983 32323 gene locus_tag LOCUS_44190 gene wzyE 30983 32323 CDS product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055604.1 protein_id gnl|my_center|LOCUS_44190 32336 33076 gene locus_tag LOCUS_44200 gene wecG 32336 33076 CDS product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064040.1 protein_id gnl|my_center|LOCUS_44200 33396 34688 gene locus_tag LOCUS_44210 33396 34688 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818378.1 protein_id gnl|my_center|LOCUS_44210 34791 34867 gene locus_tag LOCUS_t00600 34791 34867 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34935 35010 gene locus_tag LOCUS_t00610 34935 35010 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 35039 35125 gene locus_tag LOCUS_t00620 35039 35125 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35163 35239 gene locus_tag LOCUS_t00630 35163 35239 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 36970 35762 gene locus_tag LOCUS_44220 36970 35762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705169.1 protein_id gnl|my_center|LOCUS_44220 38414 37218 gene locus_tag LOCUS_44230 gene hemY 38414 37218 CDS product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979262.1 protein_id gnl|my_center|LOCUS_44230 39583 38417 gene locus_tag LOCUS_44240 gene hemX 39583 38417 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139074.1 protein_id gnl|my_center|LOCUS_44240 40345 39605 gene locus_tag LOCUS_44250 gene hemD 40345 39605 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025500.1 protein_id gnl|my_center|LOCUS_44250 41298 40342 gene locus_tag LOCUS_44260 gene hemC 41298 40342 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099264.1 protein_id gnl|my_center|LOCUS_44260 41594 44137 gene locus_tag LOCUS_44270 gene cyaA 41594 44137 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281718.1 protein_id gnl|my_center|LOCUS_44270 44519 44196 gene locus_tag LOCUS_44280 gene cyaY 44519 44196 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999925.1 protein_id gnl|my_center|LOCUS_44280 44657 44860 gene locus_tag LOCUS_44290 44657 44860 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799903.1 protein_id gnl|my_center|LOCUS_44290 44897 45721 gene locus_tag LOCUS_44300 gene dapF 44897 45721 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703982.1 protein_id gnl|my_center|LOCUS_44300 45718 46425 gene locus_tag LOCUS_44310 45718 46425 CDS product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812770.1 protein_id gnl|my_center|LOCUS_44310 46422 47324 gene locus_tag LOCUS_44320 gene xerC 46422 47324 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141123.1 protein_id gnl|my_center|LOCUS_44320 47324 48040 gene locus_tag LOCUS_44330 gene yigB 47324 48040 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099256.1 protein_id gnl|my_center|LOCUS_44330 48147 50309 gene locus_tag LOCUS_44340 gene uvrD 48147 50309 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383444.1 protein_id gnl|my_center|LOCUS_44340 50668 51618 gene locus_tag LOCUS_44350 gene corA 50668 51618 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883400.1 protein_id gnl|my_center|LOCUS_44350 52051 51659 gene locus_tag LOCUS_44360 52051 51659 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356594.1 protein_id gnl|my_center|LOCUS_44360 52465 52088 gene locus_tag LOCUS_44370 52465 52088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 53589 52702 gene locus_tag LOCUS_44380 gene rarD 53589 52702 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368860.1 protein_id gnl|my_center|LOCUS_44380 54108 53641 gene locus_tag LOCUS_44390 gene yigI 54108 53641 CDS product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099253.1 protein_id gnl|my_center|LOCUS_44390 54267 55142 gene locus_tag LOCUS_44400 gene pldA 54267 55142 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259700.1 protein_id gnl|my_center|LOCUS_44400 55208 57034 gene locus_tag LOCUS_44410 gene recQ 55208 57034 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001533487.1 protein_id gnl|my_center|LOCUS_44410 57102 57722 gene locus_tag LOCUS_44420 gene rhtC 57102 57722 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928814.1 protein_id gnl|my_center|LOCUS_44420 58419 57799 gene locus_tag LOCUS_44430 gene rhtB 58419 57799 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099249.1 protein_id gnl|my_center|LOCUS_44430 58583 59518 gene locus_tag LOCUS_44440 gene pldB 58583 59518 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099248.1 protein_id gnl|my_center|LOCUS_44440 59544 60344 gene locus_tag LOCUS_44450 gene yigL 59544 60344 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285362.1 protein_id gnl|my_center|LOCUS_44450 60424 61323 gene locus_tag LOCUS_44460 gene bioP 60424 61323 CDS product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 protein_id gnl|my_center|LOCUS_44460 62164 61211 gene locus_tag LOCUS_44470 gene metR 62164 61211 CDS product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099245.1 protein_id gnl|my_center|LOCUS_44470 62415 64676 gene locus_tag LOCUS_44480 gene metE 62415 64676 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153917.1 protein_id gnl|my_center|LOCUS_44480 64782 65759 gene locus_tag LOCUS_44490 64782 65759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509960.1 protein_id gnl|my_center|LOCUS_44490 65763 66320 gene locus_tag LOCUS_44500 65763 66320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44500 66344 67474 gene locus_tag LOCUS_44510 66344 67474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44510 67462 68490 gene locus_tag LOCUS_44520 67462 68490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180938249.1 protein_id gnl|my_center|LOCUS_44520 68487 69548 gene locus_tag LOCUS_44530 68487 69548 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529322.1 protein_id gnl|my_center|LOCUS_44530 69698 71128 gene locus_tag LOCUS_44540 69698 71128 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362674.1 protein_id gnl|my_center|LOCUS_44540 71150 72898 gene locus_tag LOCUS_44550 71150 72898 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_44550 72944 73669 gene locus_tag LOCUS_44560 72944 73669 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435717.1 protein_id gnl|my_center|LOCUS_44560 73666 74010 gene locus_tag LOCUS_44570 73666 74010 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703889.1 protein_id gnl|my_center|LOCUS_44570 74007 74354 gene locus_tag LOCUS_44580 74007 74354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 74356 75654 gene locus_tag LOCUS_44590 74356 75654 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017936.1 protein_id gnl|my_center|LOCUS_44590 76493 75675 gene locus_tag LOCUS_44600 76493 75675 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099243.1 protein_id gnl|my_center|LOCUS_44600 76755 77516 gene locus_tag LOCUS_44610 gene udp 76755 77516 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860792.1 protein_id gnl|my_center|LOCUS_44610 79050 77557 gene locus_tag LOCUS_44620 79050 77557 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 protein_id gnl|my_center|LOCUS_44620 79395 79063 gene locus_tag LOCUS_44630 79395 79063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 80555 79581 gene locus_tag LOCUS_44640 80555 79581 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 protein_id gnl|my_center|LOCUS_44640 81193 80567 gene locus_tag LOCUS_44650 81193 80567 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116472.1 protein_id gnl|my_center|LOCUS_44650 82177 81194 gene locus_tag LOCUS_44660 82177 81194 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117536.1 protein_id gnl|my_center|LOCUS_44660 82965 82198 gene locus_tag LOCUS_44670 82965 82198 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852398.1 protein_id gnl|my_center|LOCUS_44670 83255 84010 gene locus_tag LOCUS_44680 gene ubiE 83255 84010 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229009.1 protein_id gnl|my_center|LOCUS_44680 84022 84627 gene locus_tag LOCUS_44690 gene ubiJ 84022 84627 CDS product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 protein_id gnl|my_center|LOCUS_44690 84624 86264 gene locus_tag LOCUS_44700 gene ubiB 84624 86264 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187530.1 protein_id gnl|my_center|LOCUS_44700 86343 86597 gene locus_tag LOCUS_44710 gene tatA 86343 86597 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099238.1 protein_id gnl|my_center|LOCUS_44710 86601 87116 gene locus_tag LOCUS_44720 gene tatB 86601 87116 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099237.1 protein_id gnl|my_center|LOCUS_44720 87119 87871 gene locus_tag LOCUS_44730 gene tatC 87119 87871 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 protein_id gnl|my_center|LOCUS_44730 87911 88693 gene locus_tag LOCUS_44740 gene tatD 87911 88693 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277865.1 protein_id gnl|my_center|LOCUS_44740 89096 88701 gene locus_tag LOCUS_44750 gene rfaH 89096 88701 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192407.1 protein_id gnl|my_center|LOCUS_44750 89369 90853 gene locus_tag LOCUS_44760 gene ubiD 89369 90853 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368839.1 protein_id gnl|my_center|LOCUS_44760 90912 91613 gene locus_tag LOCUS_44770 gene fre 90912 91613 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209828.1 protein_id gnl|my_center|LOCUS_44770 92958 91795 gene locus_tag LOCUS_44780 gene fadA 92958 91795 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438747.1 protein_id gnl|my_center|LOCUS_44780 95157 92968 gene locus_tag LOCUS_44790 gene fadB 95157 92968 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965965.1 protein_id gnl|my_center|LOCUS_44790 95348 96679 gene locus_tag LOCUS_44800 gene pepQ 95348 96679 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444529.1 protein_id gnl|my_center|LOCUS_44800 96679 97293 gene locus_tag LOCUS_44810 96679 97293 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704001.1 protein_id gnl|my_center|LOCUS_44810 97334 98785 gene locus_tag LOCUS_44820 gene trkH 97334 98785 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545686.1 protein_id gnl|my_center|LOCUS_44820 98797 99339 gene locus_tag LOCUS_44830 gene hemG 98797 99339 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099226.1 protein_id gnl|my_center|LOCUS_44830 >Feature sequence08 2606 456 gene locus_tag LOCUS_44840 2606 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 2719 3636 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4021 4482 gene locus_tag LOCUS_44850 4021 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 5543 4518 gene locus_tag LOCUS_44860 gene galK 5543 4518 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 protein_id gnl|my_center|LOCUS_44860 6730 5675 gene locus_tag LOCUS_44870 gene galT 6730 5675 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191517.1 protein_id gnl|my_center|LOCUS_44870 7447 7190 gene locus_tag LOCUS_44880 7447 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 7514 8103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9438 8338 gene locus_tag LOCUS_44890 9438 8338 CDS product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171545.1 protein_id gnl|my_center|LOCUS_44890 10180 9515 gene locus_tag LOCUS_44900 10180 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 10215 10545 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12766 13182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13283 14197 gene locus_tag LOCUS_44910 13283 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 17063 14856 gene locus_tag LOCUS_44920 17063 14856 CDS product P-loop NTPase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698737.1 protein_id gnl|my_center|LOCUS_44920 17486 17064 gene locus_tag LOCUS_44930 17486 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44930 18153 17458 gene locus_tag LOCUS_44940 18153 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44940 18531 19875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20160 20330 gene locus_tag LOCUS_44950 20160 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 22092 21082 gene locus_tag LOCUS_44960 gene repA 22092 21082 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293470.1 protein_id gnl|my_center|LOCUS_44960 22957 23910 gene locus_tag LOCUS_44970 22957 23910 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200287.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44970 23895 24152 gene locus_tag LOCUS_44980 23895 24152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44980 24160 24399 gene locus_tag LOCUS_44990 24160 24399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 24636 25127 gene locus_tag LOCUS_45000 24636 25127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 25287 25598 gene locus_tag LOCUS_45010 25287 25598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 26524 26288 gene locus_tag LOCUS_45020 26524 26288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 26539 28031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28075 28383 gene locus_tag LOCUS_45030 28075 28383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 28386 29051 gene locus_tag LOCUS_45040 28386 29051 CDS product plasmid partitioning/stability family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087138.1 protein_id gnl|my_center|LOCUS_45040 29063 29320 gene locus_tag LOCUS_45050 29063 29320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087139.1 protein_id gnl|my_center|LOCUS_45050 29471 30285 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30550 31575 gene locus_tag LOCUS_45060 30550 31575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 31618 32046 gene locus_tag LOCUS_45070 gene psiB 31618 32046 CDS product conjugation system SOS inhibitor PsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143347806.1 protein_id gnl|my_center|LOCUS_45070 32347 33213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34171 33689 gene locus_tag LOCUS_45080 34171 33689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416123.1 protein_id gnl|my_center|LOCUS_45080 34430 34699 gene locus_tag LOCUS_45090 34430 34699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 34702 34842 gene locus_tag LOCUS_45100 34702 34842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 35426 35966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36692 37474 gene locus_tag LOCUS_45110 36692 37474 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087230.1 protein_id gnl|my_center|LOCUS_45110 38401 38790 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39309 39127 gene locus_tag LOCUS_45120 39309 39127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 40036 39242 gene locus_tag LOCUS_45130 40036 39242 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103062.1 protein_id gnl|my_center|LOCUS_45130 40110 40571 gene locus_tag LOCUS_45140 40110 40571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45140 42086 41160 gene locus_tag LOCUS_45150 42086 41160 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895557.1 protein_id gnl|my_center|LOCUS_45150 42245 43069 gene locus_tag LOCUS_45160 42245 43069 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728098.1 protein_id gnl|my_center|LOCUS_45160 43072 43818 gene locus_tag LOCUS_45170 43072 43818 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_45170 44100 44965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45986 45507 gene locus_tag LOCUS_45180 45986 45507 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095424.1 protein_id gnl|my_center|LOCUS_45180 46610 46002 gene locus_tag LOCUS_45190 46610 46002 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530163.1 protein_id gnl|my_center|LOCUS_45190 46634 47325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47469 47690 gene locus_tag LOCUS_45200 47469 47690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 47863 48957 gene locus_tag LOCUS_45210 47863 48957 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095423.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45210 48957 49241 gene locus_tag LOCUS_45220 48957 49241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45220 49917 49468 gene locus_tag LOCUS_45230 49917 49468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 50406 50793 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52002 52415 gene locus_tag LOCUS_45240 52002 52415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 53284 52823 gene locus_tag LOCUS_45250 53284 52823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 53370 53813 gene locus_tag LOCUS_45260 53370 53813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 53810 54280 gene locus_tag LOCUS_45270 53810 54280 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 protein_id gnl|my_center|LOCUS_45270 54921 55772 gene locus_tag LOCUS_45280 54921 55772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097240.1 protein_id gnl|my_center|LOCUS_45280 56455 57204 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57388 58143 gene locus_tag LOCUS_45290 57388 58143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097242.1 protein_id gnl|my_center|LOCUS_45290 58814 59287 gene locus_tag LOCUS_45300 58814 59287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 59619 59482 gene locus_tag LOCUS_45310 59619 59482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 59636 59818 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60603 59872 gene locus_tag LOCUS_45320 60603 59872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45320 60843 62153 gene locus_tag LOCUS_45330 60843 62153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45330 62381 63181 gene locus_tag LOCUS_45340 62381 63181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45340 63710 63561 gene locus_tag LOCUS_45350 63710 63561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 63747 64392 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 65725 65348 gene locus_tag LOCUS_45360 65725 65348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45360 67244 67882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69092 68772 gene locus_tag LOCUS_45370 69092 68772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420575.1 protein_id gnl|my_center|LOCUS_45370 69542 69264 gene locus_tag LOCUS_45380 69542 69264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 70495 69743 gene locus_tag LOCUS_45390 70495 69743 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087103.1 protein_id gnl|my_center|LOCUS_45390 71086 71412 gene locus_tag LOCUS_45400 71086 71412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 71701 72144 gene locus_tag LOCUS_45410 71701 72144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 72146 72307 gene locus_tag LOCUS_45420 72146 72307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 72564 72701 gene locus_tag LOCUS_45430 72564 72701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 73271 73083 gene locus_tag LOCUS_45440 73271 73083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 74104 73667 gene locus_tag LOCUS_45450 74104 73667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 74165 74565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 75412 75702 gene locus_tag LOCUS_45460 75412 75702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 76381 75992 gene locus_tag LOCUS_45470 76381 75992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 76905 77636 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 78706 77918 gene locus_tag LOCUS_45480 78706 77918 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090120423.1 protein_id gnl|my_center|LOCUS_45480 78966 79184 gene locus_tag LOCUS_45490 78966 79184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366962.1 protein_id gnl|my_center|LOCUS_45490 80617 79571 gene locus_tag LOCUS_45500 80617 79571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 80730 81349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 81437 81691 gene locus_tag LOCUS_45510 81437 81691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 81622 82296 gene locus_tag LOCUS_45520 81622 82296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 82910 82299 gene locus_tag LOCUS_45530 82910 82299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084912.1 protein_id gnl|my_center|LOCUS_45530 83900 82926 gene locus_tag LOCUS_45540 83900 82926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 84245 87442 gene locus_tag LOCUS_45550 84245 87442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 88537 88100 gene locus_tag LOCUS_45560 88537 88100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 89782 88850 gene locus_tag LOCUS_45570 89782 88850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 90781 89786 gene locus_tag LOCUS_45580 90781 89786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 >Feature sequence09 135 1163 gene locus_tag LOCUS_45590 gene murB 135 1163 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016664.1 protein_id gnl|my_center|LOCUS_45590 1160 2122 gene locus_tag LOCUS_45600 gene birA 1160 2122 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655746.1 protein_id gnl|my_center|LOCUS_45600 3101 2151 gene locus_tag LOCUS_45610 gene coaA 3101 2151 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023068.1 protein_id gnl|my_center|LOCUS_45610 3557 3632 gene locus_tag LOCUS_t00640 3557 3632 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3641 3725 gene locus_tag LOCUS_t00650 3641 3725 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3838 3912 gene locus_tag LOCUS_t00660 3838 3912 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3918 3993 gene locus_tag LOCUS_t00670 3918 3993 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4254 5153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5398 5781 gene locus_tag LOCUS_45620 gene secE 5398 5781 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275702.1 protein_id gnl|my_center|LOCUS_45620 5783 6328 gene locus_tag LOCUS_45630 gene nusG 5783 6328 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287521.1 protein_id gnl|my_center|LOCUS_45630 6487 6915 gene locus_tag LOCUS_45640 gene rplK 6487 6915 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 protein_id gnl|my_center|LOCUS_45640 6919 7623 gene locus_tag LOCUS_45650 gene rplA 6919 7623 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 protein_id gnl|my_center|LOCUS_45650 7895 8392 gene locus_tag LOCUS_45660 gene rplJ 7895 8392 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 protein_id gnl|my_center|LOCUS_45660 8459 8827 gene locus_tag LOCUS_45670 gene rplL 8459 8827 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095002.1 protein_id gnl|my_center|LOCUS_45670 9147 13175 gene locus_tag LOCUS_45680 gene rpoB 9147 13175 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704004.1 protein_id gnl|my_center|LOCUS_45680 13252 17475 gene locus_tag LOCUS_45690 gene rpoC 13252 17475 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095003.1 protein_id gnl|my_center|LOCUS_45690 17794 18117 gene locus_tag LOCUS_45700 17794 18117 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_45700 18492 18175 gene locus_tag LOCUS_45710 18492 18175 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704005.1 protein_id gnl|my_center|LOCUS_45710 18802 18497 gene locus_tag LOCUS_45720 18802 18497 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023334100.1 protein_id gnl|my_center|LOCUS_45720 20268 19114 gene locus_tag LOCUS_45730 gene thiH 20268 19114 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847474.1 protein_id gnl|my_center|LOCUS_45730 21035 20265 gene locus_tag LOCUS_45740 gene thiG 21035 20265 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944065.1 protein_id gnl|my_center|LOCUS_45740 21237 21037 gene locus_tag LOCUS_45750 gene thiS 21237 21037 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035896383.1 protein_id gnl|my_center|LOCUS_45750 21976 21218 gene locus_tag LOCUS_45760 21976 21218 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999774.1 protein_id gnl|my_center|LOCUS_45760 22604 21963 gene locus_tag LOCUS_45770 gene thiE 22604 21963 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284600.1 protein_id gnl|my_center|LOCUS_45770 24499 22604 gene locus_tag LOCUS_45780 gene thiC 24499 22604 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276897.1 protein_id gnl|my_center|LOCUS_45780 25494 24991 gene locus_tag LOCUS_45790 25494 24991 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095013.1 protein_id gnl|my_center|LOCUS_45790 25744 26358 gene locus_tag LOCUS_45800 gene nudC 25744 26358 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095014.1 protein_id gnl|my_center|LOCUS_45800 26399 27460 gene locus_tag LOCUS_45810 gene hemE 26399 27460 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137653.1 protein_id gnl|my_center|LOCUS_45810 27470 28141 gene locus_tag LOCUS_45820 gene nfi 27470 28141 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362359.1 protein_id gnl|my_center|LOCUS_45820 28184 28774 gene locus_tag LOCUS_45830 28184 28774 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704016.1 protein_id gnl|my_center|LOCUS_45830 28961 29233 gene locus_tag LOCUS_45840 gene hupA 28961 29233 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002884342.1 protein_id gnl|my_center|LOCUS_45840 29239 29937 gene locus_tag LOCUS_45850 29239 29937 CDS product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621286.1 protein_id gnl|my_center|LOCUS_45850 30941 31489 gene locus_tag LOCUS_45860 30941 31489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 31924 32526 gene locus_tag LOCUS_45870 31924 32526 CDS product common pilus major fimbrillin subunit EcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704519.1 protein_id gnl|my_center|LOCUS_45870 32576 33244 gene locus_tag LOCUS_45880 32576 33244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368090.1 protein_id gnl|my_center|LOCUS_45880 33270 35795 gene locus_tag LOCUS_45890 33270 35795 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704520.1 protein_id gnl|my_center|LOCUS_45890 35785 37434 gene locus_tag LOCUS_45900 gene ecpD 35785 37434 CDS product fimbrial adhesin EcpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012968862.1 protein_id gnl|my_center|LOCUS_45900 37403 38107 gene locus_tag LOCUS_45910 37403 38107 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704522.1 protein_id gnl|my_center|LOCUS_45910 39491 38199 gene locus_tag LOCUS_45920 gene purD 39491 38199 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866809.1 protein_id gnl|my_center|LOCUS_45920 41092 39503 gene locus_tag LOCUS_45930 gene purH 41092 39503 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 protein_id gnl|my_center|LOCUS_45930 >Feature sequence10 2948 45 gene locus_tag LOCUS_r00020 2948 45 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence11 <1 808 gene locus_tag LOCUS_45940 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000150450.1:sodium-extruding oxaloacetate decarboxylase subunit alpha >Feature sequence12 >Feature sequence13 >Feature sequence14 10 85 gene locus_tag LOCUS_t00680 10 85 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence15 130 55 gene locus_tag LOCUS_t00690 130 55 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 >Feature sequence17 >Feature sequence18 >Feature sequence19 >Feature sequence20 >Feature sequence21 >Feature sequence22 >Feature sequence23 >Feature sequence24 105 180 gene locus_tag LOCUS_t00700 105 180 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence25 >Feature sequence26 >Feature sequence27 >Feature sequence28 >Feature sequence29 >Feature sequence30 >Feature sequence31 >Feature sequence32 >Feature sequence33 349 53 gene locus_tag LOCUS_45950 349 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 >Feature sequence34 246 49 gene locus_tag LOCUS_45960 246 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45960 >Feature sequence35 >Feature sequence36 104 180 gene locus_tag LOCUS_t00710 104 180 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 191 266 gene locus_tag LOCUS_t00720 191 266 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence37 >Feature sequence38 65 388 gene locus_tag LOCUS_45970 65 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 >Feature sequence39 >Feature sequence40 >Feature sequence41 >Feature sequence42 >Feature sequence43 >Feature sequence44 >Feature sequence45 >Feature sequence46 >Feature sequence47 >Feature sequence48 157 306 gene locus_tag LOCUS_45980 157 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 339 488 gene locus_tag LOCUS_45990 339 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45990 >Feature sequence49 >Feature sequence50 >Feature sequence51 369 79 gene locus_tag LOCUS_46000 369 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 >Feature sequence52 670 353 gene locus_tag LOCUS_46010 670 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 >Feature sequence53 >Feature sequence54 <1 551 gene locus_tag LOCUS_46020 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097083.1:two-component system response regulator PhoP >Feature sequence55 <1 569 gene locus_tag LOCUS_46030 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098542.1:amino-acid N-acetyltransferase >Feature sequence56 <1 896 gene locus_tag LOCUS_46040 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013087098.1:plasmid replication initiator RepA >Feature sequence57 >Feature sequence58 >Feature sequence59 >Feature sequence60 >Feature sequence61 <1 1317 gene locus_tag LOCUS_46050 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000098243.1:glucarate dehydratase >Feature sequence62 >Feature sequence63 235 789 gene locus_tag LOCUS_46060 235 789 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099006.1 protein_id gnl|my_center|LOCUS_46060 1022 765 gene locus_tag LOCUS_46070 1022 765 CDS product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 protein_id gnl|my_center|LOCUS_46070 >Feature sequence64 577 167 gene locus_tag LOCUS_46080 gene rnk 577 167 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097604.1 protein_id gnl|my_center|LOCUS_46080 1539 730 gene locus_tag LOCUS_46090 gene rna 1539 730 CDS product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097602.1 protein_id gnl|my_center|LOCUS_46090 >Feature sequence65 1583 46 gene locus_tag LOCUS_r00030 1583 46 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8