>Feature sequence01 >Feature sequence02 >Feature sequence03 >Feature sequence04 >Feature sequence05 418 107 gene locus_tag LOCUS_00010 418 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 784 999 gene locus_tag LOCUS_00020 784 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 996 1766 gene locus_tag LOCUS_00030 996 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1885 2178 gene locus_tag LOCUS_00040 1885 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2175 2663 gene locus_tag LOCUS_00050 2175 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2660 3181 gene locus_tag LOCUS_00060 2660 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3184 3903 gene locus_tag LOCUS_00070 3184 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 3900 4586 gene locus_tag LOCUS_00080 3900 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 4661 5107 gene locus_tag LOCUS_00090 4661 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5256 5774 gene locus_tag LOCUS_00100 5256 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 5949 6275 gene locus_tag LOCUS_00110 5949 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6272 6595 gene locus_tag LOCUS_00120 6272 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 6876 6658 gene locus_tag LOCUS_00130 6876 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7197 7565 gene locus_tag LOCUS_00140 7197 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 7614 8600 gene locus_tag LOCUS_00150 7614 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 8597 8998 gene locus_tag LOCUS_00160 8597 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 9183 9566 gene locus_tag LOCUS_00170 9183 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 9563 10015 gene locus_tag LOCUS_00180 9563 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 10391 10020 gene locus_tag LOCUS_00190 10391 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 11275 10388 gene locus_tag LOCUS_00200 11275 10388 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115864494.1 protein_id gnl|my_center|LOCUS_00200 >Feature sequence06 547 203 gene locus_tag LOCUS_00210 547 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 851 534 gene locus_tag LOCUS_00220 851 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 1096 848 gene locus_tag LOCUS_00230 1096 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 1334 1089 gene locus_tag LOCUS_00240 1334 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 1726 1331 gene locus_tag LOCUS_00250 1726 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 2094 1729 gene locus_tag LOCUS_00260 2094 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 2762 2091 gene locus_tag LOCUS_00270 2762 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 3192 2755 gene locus_tag LOCUS_00280 3192 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 3347 3192 gene locus_tag LOCUS_00290 3347 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 3608 3390 gene locus_tag LOCUS_00300 3608 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 >Feature sequence07 650 144 gene locus_tag LOCUS_00310 650 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 941 651 gene locus_tag LOCUS_00320 941 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 >Feature sequence08 438 85 gene locus_tag LOCUS_00330 438 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 872 438 gene locus_tag LOCUS_00340 872 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 1522 872 gene locus_tag LOCUS_00350 1522 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 1848 1522 gene locus_tag LOCUS_00360 1848 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 2239 2066 gene locus_tag LOCUS_00370 2239 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 2525 2301 gene locus_tag LOCUS_00380 2525 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 3081 2518 gene locus_tag LOCUS_00390 3081 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 3293 3078 gene locus_tag LOCUS_00400 3293 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 3910 3290 gene locus_tag LOCUS_00410 3910 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 4416 3997 gene locus_tag LOCUS_00420 4416 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 5164 4505 gene locus_tag LOCUS_00430 5164 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 5490 5161 gene locus_tag LOCUS_00440 5490 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 7540 5483 gene locus_tag LOCUS_00450 7540 5483 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268015.1 protein_id gnl|my_center|LOCUS_00450 8075 7737 gene locus_tag LOCUS_00460 8075 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 8852 8076 gene locus_tag LOCUS_00470 8852 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 >Feature sequence09 1694 402 gene locus_tag LOCUS_00480 1694 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 2564 2109 gene locus_tag LOCUS_00490 2564 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 >Feature sequence10 35 292 gene locus_tag LOCUS_00500 35 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 578 787 gene locus_tag LOCUS_00510 578 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 884 1174 gene locus_tag LOCUS_00520 884 1174 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_00520 2233 1184 gene locus_tag LOCUS_00530 2233 1184 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289552.1 protein_id gnl|my_center|LOCUS_00530 2887 2366 gene locus_tag LOCUS_00540 2887 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 3536 2913 gene locus_tag LOCUS_00550 3536 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 3678 4472 gene locus_tag LOCUS_00560 3678 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059055354.1 protein_id gnl|my_center|LOCUS_00560 5013 5228 gene locus_tag LOCUS_00570 5013 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 5364 5669 gene locus_tag LOCUS_00580 5364 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 5871 5713 gene locus_tag LOCUS_00590 5871 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 6848 5868 gene locus_tag LOCUS_00600 6848 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 7360 6845 gene locus_tag LOCUS_00610 7360 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 8783 7485 gene locus_tag LOCUS_00620 8783 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 9642 8773 gene locus_tag LOCUS_00630 9642 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 10253 9639 gene locus_tag LOCUS_00640 10253 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 >Feature sequence11 3359 2517 gene locus_tag LOCUS_00650 3359 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 3714 3364 gene locus_tag LOCUS_00660 3714 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4107 3715 gene locus_tag LOCUS_00670 4107 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 4272 4499 gene locus_tag LOCUS_00680 4272 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 4626 4784 gene locus_tag LOCUS_00690 4626 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 4784 6049 gene locus_tag LOCUS_00700 4784 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 >Feature sequence12 >Feature sequence13 502 651 gene locus_tag LOCUS_00710 502 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 648 950 gene locus_tag LOCUS_00720 648 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 947 1207 gene locus_tag LOCUS_00730 947 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 1211 1462 gene locus_tag LOCUS_00740 1211 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 1459 1701 gene locus_tag LOCUS_00750 1459 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 1698 1979 gene locus_tag LOCUS_00760 1698 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 1972 2331 gene locus_tag LOCUS_00770 1972 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 2830 2994 gene locus_tag LOCUS_00780 2830 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 >Feature sequence14 >Feature sequence15 >Feature sequence16 >Feature sequence17 >Feature sequence18 941 123 gene locus_tag LOCUS_00790 941 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 >Feature sequence19 442 765 gene locus_tag LOCUS_00800 442 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 1256 954 gene locus_tag LOCUS_00810 1256 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 3157 1346 gene locus_tag LOCUS_00820 3157 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 >Feature sequence20 >Feature sequence21 111 1556 gene locus_tag LOCUS_00830 111 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 1619 1837 gene locus_tag LOCUS_00840 1619 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 2387 1839 gene locus_tag LOCUS_00850 2387 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 3253 2384 gene locus_tag LOCUS_00860 3253 2384 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079990227.1 protein_id gnl|my_center|LOCUS_00860 3410 3766 gene locus_tag LOCUS_00870 3410 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 4197 3772 gene locus_tag LOCUS_00880 4197 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 4740 4210 gene locus_tag LOCUS_00890 4740 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 5339 4755 gene locus_tag LOCUS_00900 5339 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6704 5406 gene locus_tag LOCUS_00910 6704 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 6963 7148 gene locus_tag LOCUS_00920 6963 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 8355 7159 gene locus_tag LOCUS_00930 8355 7159 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_00930 9053 8355 gene locus_tag LOCUS_00940 9053 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 10292 9150 gene locus_tag LOCUS_00950 10292 9150 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107353.1 protein_id gnl|my_center|LOCUS_00950 11339 11055 gene locus_tag LOCUS_00960 11339 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 11544 13016 gene locus_tag LOCUS_00970 11544 13016 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963423.1 protein_id gnl|my_center|LOCUS_00970 13017 14162 gene locus_tag LOCUS_00980 13017 14162 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902726.1 protein_id gnl|my_center|LOCUS_00980 14164 15828 gene locus_tag LOCUS_00990 14164 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 16052 17224 gene locus_tag LOCUS_01000 16052 17224 CDS product ISH3-like element ISH27-3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289728.1 protein_id gnl|my_center|LOCUS_01000 18322 18618 gene locus_tag LOCUS_01010 18322 18618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 18625 19044 gene locus_tag LOCUS_01020 18625 19044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 19071 20807 gene locus_tag LOCUS_01030 19071 20807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890505.1 protein_id gnl|my_center|LOCUS_01030 20811 21656 gene locus_tag LOCUS_01040 20811 21656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 21649 22764 gene locus_tag LOCUS_01050 21649 22764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 22767 23888 gene locus_tag LOCUS_01060 22767 23888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904034.1 protein_id gnl|my_center|LOCUS_01060 23881 25125 gene locus_tag LOCUS_01070 23881 25125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 25118 26173 gene locus_tag LOCUS_01080 25118 26173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 26184 30485 gene locus_tag LOCUS_01090 26184 30485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 30835 32187 gene locus_tag LOCUS_01100 30835 32187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 33419 32484 gene locus_tag LOCUS_01110 gene rfaD 33419 32484 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_01110 33797 34087 gene locus_tag LOCUS_01120 33797 34087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289727.1 protein_id gnl|my_center|LOCUS_01120 34087 34410 gene locus_tag LOCUS_01130 34087 34410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892774.1 protein_id gnl|my_center|LOCUS_01130 34487 35224 gene locus_tag LOCUS_01140 34487 35224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 35234 35719 gene locus_tag LOCUS_01150 35234 35719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 36484 37347 gene locus_tag LOCUS_01160 36484 37347 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289724.1 protein_id gnl|my_center|LOCUS_01160 37573 38499 gene locus_tag LOCUS_01170 37573 38499 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904212.1 protein_id gnl|my_center|LOCUS_01170 38579 39475 gene locus_tag LOCUS_01180 38579 39475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 39611 39799 gene locus_tag LOCUS_01190 39611 39799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 39893 40273 gene locus_tag LOCUS_01200 39893 40273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 40361 40798 gene locus_tag LOCUS_01210 40361 40798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 40998 41489 gene locus_tag LOCUS_01220 40998 41489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 41493 41858 gene locus_tag LOCUS_01230 41493 41858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 42322 41897 gene locus_tag LOCUS_01240 42322 41897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 42486 42364 gene locus_tag LOCUS_01250 42486 42364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 42828 43223 gene locus_tag LOCUS_01260 42828 43223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 43403 43705 gene locus_tag LOCUS_01270 43403 43705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 43729 44007 gene locus_tag LOCUS_01280 43729 44007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 44056 44277 gene locus_tag LOCUS_01290 44056 44277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 44332 44631 gene locus_tag LOCUS_01300 44332 44631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 44634 44999 gene locus_tag LOCUS_01310 44634 44999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 45160 45579 gene locus_tag LOCUS_01320 45160 45579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 45590 45856 gene locus_tag LOCUS_01330 45590 45856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 46038 47042 gene locus_tag LOCUS_01340 46038 47042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 47120 47467 gene locus_tag LOCUS_01350 47120 47467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 47715 47560 gene locus_tag LOCUS_01360 47715 47560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 47840 48799 gene locus_tag LOCUS_01370 47840 48799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 48912 49736 gene locus_tag LOCUS_01380 48912 49736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 49794 50117 gene locus_tag LOCUS_01390 49794 50117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904196.1 protein_id gnl|my_center|LOCUS_01390 51643 50249 gene locus_tag LOCUS_01400 gene orc4 51643 50249 CDS product DNA replication protein Orc4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904194.1 protein_id gnl|my_center|LOCUS_01400 52814 52344 gene locus_tag LOCUS_01410 52814 52344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 53894 52857 gene locus_tag LOCUS_01420 53894 52857 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289552.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence22 1048 803 gene locus_tag LOCUS_01430 1048 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 1331 1062 gene locus_tag LOCUS_01440 1331 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 1926 1663 gene locus_tag LOCUS_01450 1926 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 >Feature sequence23 >Feature sequence24 >Feature sequence25 335 619 gene locus_tag LOCUS_01460 335 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 >Feature sequence26 449 204 gene locus_tag LOCUS_01470 449 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence27 681 433 gene locus_tag LOCUS_01480 681 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 1050 871 gene locus_tag LOCUS_01490 1050 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence28 >Feature sequence29 1619 828 gene locus_tag LOCUS_01500 gene coxB 1619 828 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902455.1 protein_id gnl|my_center|LOCUS_01500 1841 4129 gene locus_tag LOCUS_01510 gene ctaD 1841 4129 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902450.1 protein_id gnl|my_center|LOCUS_01510 4126 4710 gene locus_tag LOCUS_01520 4126 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 5717 4770 gene locus_tag LOCUS_01530 5717 4770 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969609.1 protein_id gnl|my_center|LOCUS_01530 7015 6107 gene locus_tag LOCUS_01540 7015 6107 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902453.1 protein_id gnl|my_center|LOCUS_01540 8557 7166 gene locus_tag LOCUS_01550 8557 7166 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902866.1 protein_id gnl|my_center|LOCUS_01550 9083 8739 gene locus_tag LOCUS_01560 9083 8739 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289310.1 protein_id gnl|my_center|LOCUS_01560 9185 10036 gene locus_tag LOCUS_01570 9185 10036 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_01570 10033 10662 gene locus_tag LOCUS_01580 10033 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 10753 10944 gene locus_tag LOCUS_01590 10753 10944 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903043.1 protein_id gnl|my_center|LOCUS_01590 11347 11090 gene locus_tag LOCUS_01600 11347 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 11570 12604 gene locus_tag LOCUS_01610 gene asd 11570 12604 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903044.1 protein_id gnl|my_center|LOCUS_01610 13270 12839 gene locus_tag LOCUS_01620 13270 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 14398 13427 gene locus_tag LOCUS_01630 14398 13427 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289328.1 protein_id gnl|my_center|LOCUS_01630 15345 14596 gene locus_tag LOCUS_01640 15345 14596 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289327.1 protein_id gnl|my_center|LOCUS_01640 16351 15359 gene locus_tag LOCUS_01650 gene cofD 16351 15359 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903040.1 protein_id gnl|my_center|LOCUS_01650 18984 16489 gene locus_tag LOCUS_01660 18984 16489 CDS product DUF5059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902140.1 protein_id gnl|my_center|LOCUS_01660 19284 20681 gene locus_tag LOCUS_01670 19284 20681 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563245.1 protein_id gnl|my_center|LOCUS_01670 22249 20696 gene locus_tag LOCUS_01680 22249 20696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 22353 24110 gene locus_tag LOCUS_01690 gene ligA 22353 24110 CDS product ATP-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902619.1 protein_id gnl|my_center|LOCUS_01690 24232 24429 gene locus_tag LOCUS_01700 24232 24429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 24556 25710 gene locus_tag LOCUS_01710 gene hisC 24556 25710 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289267.1 protein_id gnl|my_center|LOCUS_01710 25707 26261 gene locus_tag LOCUS_01720 25707 26261 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902737.1 protein_id gnl|my_center|LOCUS_01720 26258 26872 gene locus_tag LOCUS_01730 26258 26872 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902736.1 protein_id gnl|my_center|LOCUS_01730 27220 26963 gene locus_tag LOCUS_01740 27220 26963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 27207 27503 gene locus_tag LOCUS_01750 27207 27503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 27580 28224 gene locus_tag LOCUS_01760 gene tpiA 27580 28224 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902734.1 protein_id gnl|my_center|LOCUS_01760 28302 28754 gene locus_tag LOCUS_01770 28302 28754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 28814 29419 gene locus_tag LOCUS_01780 28814 29419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 30008 30433 gene locus_tag LOCUS_01790 30008 30433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 30729 30944 gene locus_tag LOCUS_01800 30729 30944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 31012 32010 gene locus_tag LOCUS_01810 31012 32010 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902989.1 protein_id gnl|my_center|LOCUS_01810 32102 32287 gene locus_tag LOCUS_01820 32102 32287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 33956 32433 gene locus_tag LOCUS_01830 33956 32433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 >Feature sequence30 617 1783 gene locus_tag LOCUS_01840 617 1783 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662722.1 protein_id gnl|my_center|LOCUS_01840 2317 1853 gene locus_tag LOCUS_01850 2317 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 2377 3159 gene locus_tag LOCUS_01860 2377 3159 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902372.1 protein_id gnl|my_center|LOCUS_01860 3488 3306 gene locus_tag LOCUS_01870 3488 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3651 3875 gene locus_tag LOCUS_01880 3651 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 4183 4383 gene locus_tag LOCUS_01890 4183 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 4391 4909 gene locus_tag LOCUS_01900 4391 4909 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902933.1 protein_id gnl|my_center|LOCUS_01900 5077 5697 gene locus_tag LOCUS_01910 5077 5697 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902501.1 protein_id gnl|my_center|LOCUS_01910 5694 7169 gene locus_tag LOCUS_01920 5694 7169 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_01920 7315 7797 gene locus_tag LOCUS_01930 7315 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 7775 9535 gene locus_tag LOCUS_01940 7775 9535 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892506.1 protein_id gnl|my_center|LOCUS_01940 10165 9626 gene locus_tag LOCUS_01950 10165 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 10331 10810 gene locus_tag LOCUS_01960 10331 10810 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289517.1 protein_id gnl|my_center|LOCUS_01960 10959 11570 gene locus_tag LOCUS_01970 10959 11570 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_01970 13140 11638 gene locus_tag LOCUS_01980 gene guaB 13140 11638 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289261.1 protein_id gnl|my_center|LOCUS_01980 13718 14605 gene locus_tag LOCUS_01990 13718 14605 CDS product DUF5794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902715.1 protein_id gnl|my_center|LOCUS_01990 16249 15224 gene locus_tag LOCUS_02000 16249 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 16662 17723 gene locus_tag LOCUS_02010 16662 17723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 18567 17857 gene locus_tag LOCUS_02020 18567 17857 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289362.1 protein_id gnl|my_center|LOCUS_02020 18696 19340 gene locus_tag LOCUS_02030 18696 19340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 20165 19404 gene locus_tag LOCUS_02040 20165 19404 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902530.1 protein_id gnl|my_center|LOCUS_02040 20524 21885 gene locus_tag LOCUS_02050 20524 21885 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904150.1 protein_id gnl|my_center|LOCUS_02050 22136 23086 gene locus_tag LOCUS_02060 22136 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 23288 23518 gene locus_tag LOCUS_02070 23288 23518 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846632.1 protein_id gnl|my_center|LOCUS_02070 23519 23893 gene locus_tag LOCUS_02080 23519 23893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 23937 25439 gene locus_tag LOCUS_02090 23937 25439 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289363.1 protein_id gnl|my_center|LOCUS_02090 25557 25778 gene locus_tag LOCUS_02100 25557 25778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 26503 25796 gene locus_tag LOCUS_02110 gene bioD 26503 25796 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880330.1 protein_id gnl|my_center|LOCUS_02110 27747 26500 gene locus_tag LOCUS_02120 gene bioF 27747 26500 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_02120 28926 27868 gene locus_tag LOCUS_02130 28926 27868 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_02130 30060 28957 gene locus_tag LOCUS_02140 gene bioB 30060 28957 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_02140 31460 30195 gene locus_tag LOCUS_02150 gene rbcL 31460 30195 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 protein_id gnl|my_center|LOCUS_02150 31720 32604 gene locus_tag LOCUS_02160 31720 32604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 32956 32729 gene locus_tag LOCUS_02170 32956 32729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 33942 33070 gene locus_tag LOCUS_02180 gene sucD 33942 33070 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903125.1 protein_id gnl|my_center|LOCUS_02180 35090 33939 gene locus_tag LOCUS_02190 gene sucC 35090 33939 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289349.1 protein_id gnl|my_center|LOCUS_02190 35245 35487 gene locus_tag LOCUS_02200 35245 35487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 35447 36280 gene locus_tag LOCUS_02210 35447 36280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 36644 36417 gene locus_tag LOCUS_02220 36644 36417 CDS product DUF5795 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902716.1 protein_id gnl|my_center|LOCUS_02220 37785 36988 gene locus_tag LOCUS_02230 37785 36988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 37965 38294 gene locus_tag LOCUS_02240 37965 38294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 39073 38291 gene locus_tag LOCUS_02250 39073 38291 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_02250 39456 39202 gene locus_tag LOCUS_02260 39456 39202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 40041 39586 gene locus_tag LOCUS_02270 gene lrp 40041 39586 CDS product HTH-type transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903541.1 protein_id gnl|my_center|LOCUS_02270 40288 40605 gene locus_tag LOCUS_02280 40288 40605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 40871 40797 gene locus_tag LOCUS_t00010 40871 40797 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 41281 42018 gene locus_tag LOCUS_02290 41281 42018 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289269.1 protein_id gnl|my_center|LOCUS_02290 42091 42795 gene locus_tag LOCUS_02300 42091 42795 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902621.1 protein_id gnl|my_center|LOCUS_02300 43208 42903 gene locus_tag LOCUS_02310 43208 42903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 43252 43467 gene locus_tag LOCUS_02320 43252 43467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 43457 44809 gene locus_tag LOCUS_02330 43457 44809 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_02330 46176 45085 gene locus_tag LOCUS_02340 46176 45085 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902622.1 protein_id gnl|my_center|LOCUS_02340 48656 46173 gene locus_tag LOCUS_02350 48656 46173 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902623.1 protein_id gnl|my_center|LOCUS_02350 49132 48776 gene locus_tag LOCUS_02360 49132 48776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 50722 49283 gene locus_tag LOCUS_02370 50722 49283 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 protein_id gnl|my_center|LOCUS_02370 51834 50830 gene locus_tag LOCUS_02380 51834 50830 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242752.1 protein_id gnl|my_center|LOCUS_02380 53090 51831 gene locus_tag LOCUS_02390 53090 51831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 54593 53355 gene locus_tag LOCUS_02400 54593 53355 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088858.1 protein_id gnl|my_center|LOCUS_02400 55013 55756 gene locus_tag LOCUS_02410 gene psmA 55013 55756 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902078.1 protein_id gnl|my_center|LOCUS_02410 55749 56468 gene locus_tag LOCUS_02420 gene psmB 55749 56468 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289244.1 protein_id gnl|my_center|LOCUS_02420 56581 58509 gene locus_tag LOCUS_02430 gene gyrB 56581 58509 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049928262.1 protein_id gnl|my_center|LOCUS_02430 58528 61011 gene locus_tag LOCUS_02440 gene gyrA 58528 61011 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902625.1 protein_id gnl|my_center|LOCUS_02440 61721 61188 gene locus_tag LOCUS_02450 61721 61188 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902626.1 protein_id gnl|my_center|LOCUS_02450 62576 61896 gene locus_tag LOCUS_02460 62576 61896 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289175.1 protein_id gnl|my_center|LOCUS_02460 62674 63594 gene locus_tag LOCUS_02470 gene rocF 62674 63594 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258791.1 protein_id gnl|my_center|LOCUS_02470 63698 64867 gene locus_tag LOCUS_02480 63698 64867 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902627.1 protein_id gnl|my_center|LOCUS_02480 66051 64996 gene locus_tag LOCUS_02490 66051 64996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 66707 66174 gene locus_tag LOCUS_02500 66707 66174 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903007.1 protein_id gnl|my_center|LOCUS_02500 67614 66805 gene locus_tag LOCUS_02510 67614 66805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 68001 68735 gene locus_tag LOCUS_02520 68001 68735 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903097.1 protein_id gnl|my_center|LOCUS_02520 68951 72082 gene locus_tag LOCUS_02530 68951 72082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 72079 72834 gene locus_tag LOCUS_02540 72079 72834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 73929 72862 gene locus_tag LOCUS_02550 73929 72862 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903099.1 protein_id gnl|my_center|LOCUS_02550 74123 74740 gene locus_tag LOCUS_02560 74123 74740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 75020 75562 gene locus_tag LOCUS_02570 75020 75562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 76196 76002 gene locus_tag LOCUS_02580 76196 76002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 76248 77039 gene locus_tag LOCUS_02590 76248 77039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 77213 78490 gene locus_tag LOCUS_02600 77213 78490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 80792 78624 gene locus_tag LOCUS_02610 gene rqcH 80792 78624 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903100.1 protein_id gnl|my_center|LOCUS_02610 81071 81715 gene locus_tag LOCUS_02620 81071 81715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 81917 82162 gene locus_tag LOCUS_02630 81917 82162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 84647 83019 gene locus_tag LOCUS_02640 84647 83019 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903101.1 protein_id gnl|my_center|LOCUS_02640 84803 87235 gene locus_tag LOCUS_02650 84803 87235 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338646.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02650 87232 87696 gene locus_tag LOCUS_02660 87232 87696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02660 87693 88046 gene locus_tag LOCUS_02670 87693 88046 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_02670 88120 89769 gene locus_tag LOCUS_02680 88120 89769 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125097.1 protein_id gnl|my_center|LOCUS_02680 89769 90374 gene locus_tag LOCUS_02690 89769 90374 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024441.1 protein_id gnl|my_center|LOCUS_02690 90367 90657 gene locus_tag LOCUS_02700 90367 90657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 90654 91019 gene locus_tag LOCUS_02710 90654 91019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 91519 91025 gene locus_tag LOCUS_02720 91519 91025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 92095 91643 gene locus_tag LOCUS_02730 92095 91643 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_02730 93780 92206 gene locus_tag LOCUS_02740 93780 92206 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890489.1 protein_id gnl|my_center|LOCUS_02740 94557 94162 gene locus_tag LOCUS_02750 94557 94162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 94872 94696 gene locus_tag LOCUS_02760 94872 94696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 95898 95173 gene locus_tag LOCUS_02770 95898 95173 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902743.1 protein_id gnl|my_center|LOCUS_02770 96295 96558 gene locus_tag LOCUS_02780 96295 96558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289345.1 protein_id gnl|my_center|LOCUS_02780 96649 98856 gene locus_tag LOCUS_02790 96649 98856 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289344.1 protein_id gnl|my_center|LOCUS_02790 99006 99389 gene locus_tag LOCUS_02800 99006 99389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 99989 99474 gene locus_tag LOCUS_02810 99989 99474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902326.1 protein_id gnl|my_center|LOCUS_02810 100897 99989 gene locus_tag LOCUS_02820 100897 99989 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_02820 101252 101998 gene locus_tag LOCUS_02830 101252 101998 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902328.1 protein_id gnl|my_center|LOCUS_02830 102409 102143 gene locus_tag LOCUS_02840 102409 102143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 102667 104016 gene locus_tag LOCUS_02850 102667 104016 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902279.1 protein_id gnl|my_center|LOCUS_02850 104195 103983 gene locus_tag LOCUS_02860 104195 103983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 104311 105153 gene locus_tag LOCUS_02870 104311 105153 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289160.1 protein_id gnl|my_center|LOCUS_02870 105399 106040 gene locus_tag LOCUS_02880 105399 106040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 106119 106307 gene locus_tag LOCUS_02890 106119 106307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 107594 106359 gene locus_tag LOCUS_02900 107594 106359 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970646.1 protein_id gnl|my_center|LOCUS_02900 108675 107704 gene locus_tag LOCUS_02910 108675 107704 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902295.1 protein_id gnl|my_center|LOCUS_02910 108986 109732 gene locus_tag LOCUS_02920 108986 109732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 110238 109729 gene locus_tag LOCUS_02930 110238 109729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 110360 110926 gene locus_tag LOCUS_02940 110360 110926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 111579 110995 gene locus_tag LOCUS_02950 111579 110995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 112088 111699 gene locus_tag LOCUS_02960 112088 111699 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289157.1 protein_id gnl|my_center|LOCUS_02960 112969 112172 gene locus_tag LOCUS_02970 112969 112172 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405419.1 protein_id gnl|my_center|LOCUS_02970 113713 113219 gene locus_tag LOCUS_02980 113713 113219 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903017.1 protein_id gnl|my_center|LOCUS_02980 114006 114134 gene locus_tag LOCUS_02990 114006 114134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 114668 114378 gene locus_tag LOCUS_03000 114668 114378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 115213 114704 gene locus_tag LOCUS_03010 115213 114704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 116693 115941 gene locus_tag LOCUS_03020 116693 115941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 118411 118181 gene locus_tag LOCUS_03030 118411 118181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 118718 118801 gene locus_tag LOCUS_t00020 118718 118801 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 119067 120323 gene locus_tag LOCUS_03040 119067 120323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 120330 122111 gene locus_tag LOCUS_03050 120330 122111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 122470 122718 gene locus_tag LOCUS_03060 122470 122718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 122931 123734 gene locus_tag LOCUS_03070 122931 123734 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903001.1 protein_id gnl|my_center|LOCUS_03070 123822 124949 gene locus_tag LOCUS_03080 123822 124949 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903025.1 protein_id gnl|my_center|LOCUS_03080 125081 125359 gene locus_tag LOCUS_03090 125081 125359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 126189 126995 gene locus_tag LOCUS_03100 gene cas6 126189 126995 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870746.1 protein_id gnl|my_center|LOCUS_03100 126988 129117 gene locus_tag LOCUS_03110 126988 129117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 129092 130162 gene locus_tag LOCUS_03120 gene cas7b 129092 130162 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_03120 130166 130954 gene locus_tag LOCUS_03130 130166 130954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 130954 133533 gene locus_tag LOCUS_03140 130954 133533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 133530 134090 gene locus_tag LOCUS_03150 gene cas4 133530 134090 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582993.1 protein_id gnl|my_center|LOCUS_03150 134093 135085 gene locus_tag LOCUS_03160 gene cas1b 134093 135085 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545291.1 protein_id gnl|my_center|LOCUS_03160 135088 135351 gene locus_tag LOCUS_03170 gene cas2 135088 135351 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064580.1 protein_id gnl|my_center|LOCUS_03170 135464 143097 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttacagacggacccttgtggggtcgaagc 143787 144107 gene locus_tag LOCUS_03180 143787 144107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03180 144011 144592 gene locus_tag LOCUS_03190 144011 144592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03190 144673 144879 gene locus_tag LOCUS_03200 144673 144879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03200 145143 145994 gene locus_tag LOCUS_03210 145143 145994 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902847.1 protein_id gnl|my_center|LOCUS_03210 145987 146622 gene locus_tag LOCUS_03220 145987 146622 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902848.1 protein_id gnl|my_center|LOCUS_03220 147501 147232 gene locus_tag LOCUS_03230 147501 147232 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008526012.1 protein_id gnl|my_center|LOCUS_03230 147717 148172 gene locus_tag LOCUS_03240 147717 148172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 148961 148359 gene locus_tag LOCUS_03250 148961 148359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 149437 149075 gene locus_tag LOCUS_03260 149437 149075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 149430 150143 gene locus_tag LOCUS_03270 149430 150143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 150306 151388 gene locus_tag LOCUS_03280 150306 151388 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903015.1 protein_id gnl|my_center|LOCUS_03280 152681 151524 gene locus_tag LOCUS_03290 152681 151524 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892719.1 protein_id gnl|my_center|LOCUS_03290 153088 153771 gene locus_tag LOCUS_03300 153088 153771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 154925 153801 gene locus_tag LOCUS_03310 154925 153801 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816110.1 protein_id gnl|my_center|LOCUS_03310 155413 156117 gene locus_tag LOCUS_03320 155413 156117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 156306 157142 gene locus_tag LOCUS_03330 156306 157142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 157657 157166 gene locus_tag LOCUS_03340 157657 157166 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144262395.1 protein_id gnl|my_center|LOCUS_03340 157760 158428 gene locus_tag LOCUS_03350 157760 158428 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289213.1 protein_id gnl|my_center|LOCUS_03350 158743 158441 gene locus_tag LOCUS_03360 158743 158441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 158895 159956 gene locus_tag LOCUS_03370 158895 159956 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902123.1 protein_id gnl|my_center|LOCUS_03370 160121 161278 gene locus_tag LOCUS_03380 160121 161278 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902857.1 protein_id gnl|my_center|LOCUS_03380 161403 162578 gene locus_tag LOCUS_03390 161403 162578 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_03390 162614 163792 gene locus_tag LOCUS_03400 162614 163792 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_03400 164049 163819 gene locus_tag LOCUS_03410 164049 163819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 165020 164046 gene locus_tag LOCUS_03420 165020 164046 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_03420 165214 165627 gene locus_tag LOCUS_03430 165214 165627 CDS product DUF5830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903194.1 protein_id gnl|my_center|LOCUS_03430 166805 165624 gene locus_tag LOCUS_03440 166805 165624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903193.1 protein_id gnl|my_center|LOCUS_03440 167491 167781 gene locus_tag LOCUS_03450 167491 167781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 168068 168829 gene locus_tag LOCUS_03460 168068 168829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 169864 168830 gene locus_tag LOCUS_03470 169864 168830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 171935 171198 gene locus_tag LOCUS_03480 171935 171198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 172580 172245 gene locus_tag LOCUS_03490 172580 172245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 174010 172577 gene locus_tag LOCUS_03500 174010 172577 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228947.1 protein_id gnl|my_center|LOCUS_03500 174692 174141 gene locus_tag LOCUS_03510 174692 174141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 175758 175021 gene locus_tag LOCUS_03520 175758 175021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 175959 175768 gene locus_tag LOCUS_03530 175959 175768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 177451 176354 gene locus_tag LOCUS_03540 177451 176354 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086637760.1 protein_id gnl|my_center|LOCUS_03540 178435 177452 gene locus_tag LOCUS_03550 178435 177452 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902406.1 protein_id gnl|my_center|LOCUS_03550 179394 178528 gene locus_tag LOCUS_03560 179394 178528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 181056 179518 gene locus_tag LOCUS_03570 181056 179518 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_03570 181457 182476 gene locus_tag LOCUS_03580 181457 182476 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902103.1 protein_id gnl|my_center|LOCUS_03580 182534 183046 gene locus_tag LOCUS_03590 182534 183046 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144262395.1 protein_id gnl|my_center|LOCUS_03590 183546 183082 gene locus_tag LOCUS_03600 183546 183082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 183705 184226 gene locus_tag LOCUS_03610 183705 184226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 185216 184359 gene locus_tag LOCUS_03620 185216 184359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 186791 185394 gene locus_tag LOCUS_03630 186791 185394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 187776 186898 gene locus_tag LOCUS_03640 187776 186898 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_03640 189049 187892 gene locus_tag LOCUS_03650 189049 187892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 189575 189330 gene locus_tag LOCUS_03660 189575 189330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 192779 189750 gene locus_tag LOCUS_03670 192779 189750 CDS product bacterio-opsin activator domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289108.1 protein_id gnl|my_center|LOCUS_03670 194001 192946 gene locus_tag LOCUS_03680 194001 192946 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903126.1 protein_id gnl|my_center|LOCUS_03680 194735 194181 gene locus_tag LOCUS_03690 194735 194181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 195047 195682 gene locus_tag LOCUS_03700 195047 195682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 196284 195691 gene locus_tag LOCUS_03710 196284 195691 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903176.1 protein_id gnl|my_center|LOCUS_03710 196225 197406 gene locus_tag LOCUS_03720 196225 197406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289510.1 protein_id gnl|my_center|LOCUS_03720 197863 197498 gene locus_tag LOCUS_03730 197863 197498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 199153 198158 gene locus_tag LOCUS_03740 199153 198158 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929006.1 protein_id gnl|my_center|LOCUS_03740 199449 199589 gene locus_tag LOCUS_03750 199449 199589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 200086 199676 gene locus_tag LOCUS_03760 200086 199676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 200396 201853 gene locus_tag LOCUS_03770 200396 201853 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421525.1 protein_id gnl|my_center|LOCUS_03770 202116 201823 gene locus_tag LOCUS_03780 202116 201823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 204675 202720 gene locus_tag LOCUS_03790 204675 202720 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662706.1 protein_id gnl|my_center|LOCUS_03790 205317 204739 gene locus_tag LOCUS_03800 205317 204739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904053.1 protein_id gnl|my_center|LOCUS_03800 206112 205876 gene locus_tag LOCUS_03810 206112 205876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 206086 208302 gene locus_tag LOCUS_03820 206086 208302 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903183.1 protein_id gnl|my_center|LOCUS_03820 208737 208327 gene locus_tag LOCUS_03830 208737 208327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 209085 208849 gene locus_tag LOCUS_03840 209085 208849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 210547 209108 gene locus_tag LOCUS_03850 210547 209108 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_03850 210914 211465 gene locus_tag LOCUS_03860 210914 211465 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904142.1 protein_id gnl|my_center|LOCUS_03860 <212771 211883 gene locus_tag LOCUS_03870 <212771 211883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060900.1:hydroxymethylglutaryl-CoA synthase >Feature sequence31 907 470 gene locus_tag LOCUS_03880 907 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 2755 1112 gene locus_tag LOCUS_03890 2755 1112 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_03890 4768 3590 gene locus_tag LOCUS_03900 4768 3590 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129610996.1 protein_id gnl|my_center|LOCUS_03900 4987 5982 gene locus_tag LOCUS_03910 4987 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 5989 7995 gene locus_tag LOCUS_03920 5989 7995 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064637.1 protein_id gnl|my_center|LOCUS_03920 8941 8186 gene locus_tag LOCUS_03930 8941 8186 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246196.1 protein_id gnl|my_center|LOCUS_03930 9852 8941 gene locus_tag LOCUS_03940 9852 8941 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768681.1 protein_id gnl|my_center|LOCUS_03940 10031 10822 gene locus_tag LOCUS_03950 10031 10822 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065256.1 protein_id gnl|my_center|LOCUS_03950 11030 11491 gene locus_tag LOCUS_03960 11030 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 11661 11470 gene locus_tag LOCUS_03970 11661 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 11614 11802 gene locus_tag LOCUS_03980 11614 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 13494 13171 gene locus_tag LOCUS_03990 13494 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904196.1 protein_id gnl|my_center|LOCUS_03990 13633 14559 gene locus_tag LOCUS_04000 13633 14559 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289741.1 protein_id gnl|my_center|LOCUS_04000 14556 15359 gene locus_tag LOCUS_04010 14556 15359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 15585 15373 gene locus_tag LOCUS_04020 15585 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 17214 16267 gene locus_tag LOCUS_04030 17214 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 17729 17382 gene locus_tag LOCUS_04040 17729 17382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 17850 18002 gene locus_tag LOCUS_04050 17850 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 18201 19637 gene locus_tag LOCUS_04060 18201 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 19665 20390 gene locus_tag LOCUS_04070 19665 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 20506 22416 gene locus_tag LOCUS_04080 20506 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 22431 22619 gene locus_tag LOCUS_04090 22431 22619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 22616 23611 gene locus_tag LOCUS_04100 22616 23611 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385787.1 protein_id gnl|my_center|LOCUS_04100 23608 24528 gene locus_tag LOCUS_04110 23608 24528 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385788.1 protein_id gnl|my_center|LOCUS_04110 24525 26627 gene locus_tag LOCUS_04120 24525 26627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 26632 28020 gene locus_tag LOCUS_04130 26632 28020 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_04130 28478 28029 gene locus_tag LOCUS_04140 28478 28029 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289215.1 protein_id gnl|my_center|LOCUS_04140 29143 28649 gene locus_tag LOCUS_04150 29143 28649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 29483 29716 gene locus_tag LOCUS_04160 29483 29716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 29728 30006 gene locus_tag LOCUS_04170 29728 30006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 31106 31708 gene locus_tag LOCUS_04180 31106 31708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 32127 32771 gene locus_tag LOCUS_04190 32127 32771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04190 32919 33215 gene locus_tag LOCUS_04200 32919 33215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 33873 33601 gene locus_tag LOCUS_04210 33873 33601 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_04210 34355 34062 gene locus_tag LOCUS_04220 34355 34062 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_04220 35051 34539 gene locus_tag LOCUS_04230 35051 34539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890451.1 protein_id gnl|my_center|LOCUS_04230 35354 35052 gene locus_tag LOCUS_04240 35354 35052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890452.1 protein_id gnl|my_center|LOCUS_04240 35543 35731 gene locus_tag LOCUS_04250 35543 35731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 36183 36884 gene locus_tag LOCUS_04260 36183 36884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 36990 37217 gene locus_tag LOCUS_04270 36990 37217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 37201 37440 gene locus_tag LOCUS_04280 37201 37440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 37486 37857 gene locus_tag LOCUS_04290 37486 37857 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904050.1 protein_id gnl|my_center|LOCUS_04290 38293 38003 gene locus_tag LOCUS_04300 38293 38003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04300 39380 38277 gene locus_tag LOCUS_04310 39380 38277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 40024 39377 gene locus_tag LOCUS_04320 40024 39377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 40398 40021 gene locus_tag LOCUS_04330 40398 40021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 40588 40391 gene locus_tag LOCUS_04340 40588 40391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 41076 40585 gene locus_tag LOCUS_04350 41076 40585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 41289 41612 gene locus_tag LOCUS_04360 41289 41612 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008526012.1 protein_id gnl|my_center|LOCUS_04360 41887 41621 gene locus_tag LOCUS_04370 41887 41621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 42523 42723 gene locus_tag LOCUS_04380 42523 42723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 42887 42726 gene locus_tag LOCUS_04390 42887 42726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 43097 43312 gene locus_tag LOCUS_04400 43097 43312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 43527 44450 gene locus_tag LOCUS_04410 43527 44450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 44447 44689 gene locus_tag LOCUS_04420 44447 44689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 45861 44800 gene locus_tag LOCUS_04430 45861 44800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 46172 45948 gene locus_tag LOCUS_04440 46172 45948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 46366 46169 gene locus_tag LOCUS_04450 46366 46169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 46606 46367 gene locus_tag LOCUS_04460 46606 46367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 46923 46603 gene locus_tag LOCUS_04470 46923 46603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 47416 48060 gene locus_tag LOCUS_04480 47416 48060 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572360.1 protein_id gnl|my_center|LOCUS_04480 48488 48940 gene locus_tag LOCUS_04490 48488 48940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 50258 48942 gene locus_tag LOCUS_04500 50258 48942 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_04500 50964 50317 gene locus_tag LOCUS_04510 50964 50317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 51143 50952 gene locus_tag LOCUS_04520 51143 50952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 51765 51271 gene locus_tag LOCUS_04530 51765 51271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 53135 52491 gene locus_tag LOCUS_04540 53135 52491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 53406 54296 gene locus_tag LOCUS_04550 53406 54296 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904143.1 protein_id gnl|my_center|LOCUS_04550 54667 54449 gene locus_tag LOCUS_04560 54667 54449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 54834 54664 gene locus_tag LOCUS_04570 54834 54664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 54924 55295 gene locus_tag LOCUS_04580 54924 55295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 55665 55273 gene locus_tag LOCUS_04590 55665 55273 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903020.1 protein_id gnl|my_center|LOCUS_04590 57308 55869 gene locus_tag LOCUS_04600 57308 55869 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125187.1 protein_id gnl|my_center|LOCUS_04600 58314 57361 gene locus_tag LOCUS_04610 58314 57361 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903696.1 protein_id gnl|my_center|LOCUS_04610 58763 58359 gene locus_tag LOCUS_04620 58763 58359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 59947 58970 gene locus_tag LOCUS_04630 59947 58970 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904212.1 protein_id gnl|my_center|LOCUS_04630 63157 60176 gene locus_tag LOCUS_04640 63157 60176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 63885 63406 gene locus_tag LOCUS_04650 63885 63406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 64245 64063 gene locus_tag LOCUS_04660 64245 64063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 64636 64382 gene locus_tag LOCUS_04670 64636 64382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 64782 65009 gene locus_tag LOCUS_04680 64782 65009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 65328 65864 gene locus_tag LOCUS_04690 65328 65864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 >Feature sequence32 1304 1645 gene locus_tag LOCUS_04700 1304 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 2392 3453 gene locus_tag LOCUS_04710 2392 3453 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403481.1 protein_id gnl|my_center|LOCUS_04710 3924 5015 gene locus_tag LOCUS_04720 3924 5015 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972869.1 protein_id gnl|my_center|LOCUS_04720 5360 5575 gene locus_tag LOCUS_04730 5360 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 6248 6700 gene locus_tag LOCUS_04740 6248 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 7830 7090 gene locus_tag LOCUS_04750 7830 7090 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902932.1 protein_id gnl|my_center|LOCUS_04750 8063 8413 gene locus_tag LOCUS_04760 8063 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 8420 9106 gene locus_tag LOCUS_04770 8420 9106 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_04770 9230 10771 gene locus_tag LOCUS_04780 9230 10771 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902931.1 protein_id gnl|my_center|LOCUS_04780 12668 12117 gene locus_tag LOCUS_04790 12668 12117 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_04790 13771 13040 gene locus_tag LOCUS_04800 13771 13040 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289175.1 protein_id gnl|my_center|LOCUS_04800 14835 13825 gene locus_tag LOCUS_04810 14835 13825 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904121.1 protein_id gnl|my_center|LOCUS_04810 15620 14832 gene locus_tag LOCUS_04820 15620 14832 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904122.1 protein_id gnl|my_center|LOCUS_04820 16539 15628 gene locus_tag LOCUS_04830 16539 15628 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904123.1 protein_id gnl|my_center|LOCUS_04830 17626 18720 gene locus_tag LOCUS_04840 17626 18720 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903039.1 protein_id gnl|my_center|LOCUS_04840 19658 18975 gene locus_tag LOCUS_04850 19658 18975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 20007 20243 gene locus_tag LOCUS_04860 20007 20243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 20539 20336 gene locus_tag LOCUS_04870 20539 20336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 20994 21236 gene locus_tag LOCUS_04880 20994 21236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 21261 21569 gene locus_tag LOCUS_04890 21261 21569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 23009 21900 gene locus_tag LOCUS_04900 23009 21900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 24091 23006 gene locus_tag LOCUS_04910 24091 23006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 24598 24164 gene locus_tag LOCUS_04920 24598 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 25177 26508 gene locus_tag LOCUS_04930 25177 26508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 26786 27124 gene locus_tag LOCUS_04940 26786 27124 CDS product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405189.1 protein_id gnl|my_center|LOCUS_04940 27321 29924 gene locus_tag LOCUS_04950 gene mutS 27321 29924 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902083.1 protein_id gnl|my_center|LOCUS_04950 29972 33883 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcgaccccacaagggtccgtctgaaac 34216 34377 gene locus_tag LOCUS_04960 34216 34377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 34374 34766 gene locus_tag LOCUS_04970 34374 34766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 35166 34957 gene locus_tag LOCUS_04980 35166 34957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 35696 35163 gene locus_tag LOCUS_04990 35696 35163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 36077 36532 gene locus_tag LOCUS_05000 36077 36532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 37365 36622 gene locus_tag LOCUS_05010 gene nucS 37365 36622 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061145.1 protein_id gnl|my_center|LOCUS_05010 37502 38110 gene locus_tag LOCUS_05020 37502 38110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 38635 38150 gene locus_tag LOCUS_05030 38635 38150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 38996 40930 gene locus_tag LOCUS_05040 38996 40930 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902249.1 protein_id gnl|my_center|LOCUS_05040 42037 41234 gene locus_tag LOCUS_05050 42037 41234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 protein_id gnl|my_center|LOCUS_05050 42965 42030 gene locus_tag LOCUS_05060 42965 42030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_05060 44125 42968 gene locus_tag LOCUS_05070 44125 42968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_05070 45172 44150 gene locus_tag LOCUS_05080 45172 44150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 46220 45531 gene locus_tag LOCUS_05090 gene bluB 46220 45531 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992301.1 protein_id gnl|my_center|LOCUS_05090 47248 46418 gene locus_tag LOCUS_05100 47248 46418 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902247.1 protein_id gnl|my_center|LOCUS_05100 47760 47347 gene locus_tag LOCUS_05110 47760 47347 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902246.1 protein_id gnl|my_center|LOCUS_05110 48285 47992 gene locus_tag LOCUS_05120 48285 47992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 49698 48355 gene locus_tag LOCUS_05130 49698 48355 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_05130 50696 50166 gene locus_tag LOCUS_05140 50696 50166 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902148.1 protein_id gnl|my_center|LOCUS_05140 50901 51260 gene locus_tag LOCUS_05150 50901 51260 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902147.1 protein_id gnl|my_center|LOCUS_05150 51892 51257 gene locus_tag LOCUS_05160 51892 51257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902146.1 protein_id gnl|my_center|LOCUS_05160 52798 52205 gene locus_tag LOCUS_05170 gene rnhA 52798 52205 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902145.1 protein_id gnl|my_center|LOCUS_05170 52961 53923 gene locus_tag LOCUS_05180 52961 53923 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_05180 54670 54017 gene locus_tag LOCUS_05190 54670 54017 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902287.1 protein_id gnl|my_center|LOCUS_05190 55788 54667 gene locus_tag LOCUS_05200 55788 54667 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902286.1 protein_id gnl|my_center|LOCUS_05200 55951 57264 gene locus_tag LOCUS_05210 55951 57264 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902285.1 protein_id gnl|my_center|LOCUS_05210 57466 58146 gene locus_tag LOCUS_05220 57466 58146 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_05220 61020 58240 gene locus_tag LOCUS_05230 61020 58240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 61126 61722 gene locus_tag LOCUS_05240 61126 61722 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289340.1 protein_id gnl|my_center|LOCUS_05240 61987 61754 gene locus_tag LOCUS_05250 61987 61754 CDS product DUF5822 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289339.1 protein_id gnl|my_center|LOCUS_05250 62117 62929 gene locus_tag LOCUS_05260 gene panB 62117 62929 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903078.1 protein_id gnl|my_center|LOCUS_05260 63915 63124 gene locus_tag LOCUS_05270 63915 63124 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289338.1 protein_id gnl|my_center|LOCUS_05270 64153 64401 gene locus_tag LOCUS_05280 64153 64401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903074.1 protein_id gnl|my_center|LOCUS_05280 64398 66659 gene locus_tag LOCUS_05290 64398 66659 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903073.1 protein_id gnl|my_center|LOCUS_05290 67173 66700 gene locus_tag LOCUS_05300 67173 66700 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902865.1 protein_id gnl|my_center|LOCUS_05300 68237 67260 gene locus_tag LOCUS_05310 68237 67260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903072.1 protein_id gnl|my_center|LOCUS_05310 69409 68234 gene locus_tag LOCUS_05320 gene priS 69409 68234 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_05320 70158 69682 gene locus_tag LOCUS_05330 70158 69682 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892508.1 protein_id gnl|my_center|LOCUS_05330 70145 70804 gene locus_tag LOCUS_05340 70145 70804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 70929 71978 gene locus_tag LOCUS_05350 70929 71978 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903058.1 protein_id gnl|my_center|LOCUS_05350 72071 73537 gene locus_tag LOCUS_05360 72071 73537 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903057.1 protein_id gnl|my_center|LOCUS_05360 73840 73631 gene locus_tag LOCUS_05370 73840 73631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 73985 75043 gene locus_tag LOCUS_05380 gene moaA 73985 75043 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289091.1 protein_id gnl|my_center|LOCUS_05380 75225 75310 gene locus_tag LOCUS_t00030 75225 75310 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 75380 75904 gene locus_tag LOCUS_05390 75380 75904 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902812.1 protein_id gnl|my_center|LOCUS_05390 75904 76425 gene locus_tag LOCUS_05400 75904 76425 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902813.1 protein_id gnl|my_center|LOCUS_05400 76427 76816 gene locus_tag LOCUS_05410 76427 76816 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902814.1 protein_id gnl|my_center|LOCUS_05410 76820 77569 gene locus_tag LOCUS_05420 76820 77569 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902815.1 protein_id gnl|my_center|LOCUS_05420 77699 77783 gene locus_tag LOCUS_t00040 77699 77783 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 77937 78290 gene locus_tag LOCUS_05430 77937 78290 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902816.1 protein_id gnl|my_center|LOCUS_05430 78287 78736 gene locus_tag LOCUS_05440 78287 78736 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902817.1 protein_id gnl|my_center|LOCUS_05440 78730 79128 gene locus_tag LOCUS_05450 78730 79128 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902818.1 protein_id gnl|my_center|LOCUS_05450 79141 79335 gene locus_tag LOCUS_05460 79141 79335 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902819.1 protein_id gnl|my_center|LOCUS_05460 79338 79523 gene locus_tag LOCUS_05470 79338 79523 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902820.1 protein_id gnl|my_center|LOCUS_05470 79595 80725 gene locus_tag LOCUS_05480 79595 80725 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902821.1 protein_id gnl|my_center|LOCUS_05480 80722 81531 gene locus_tag LOCUS_05490 gene rpsB 80722 81531 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902822.1 protein_id gnl|my_center|LOCUS_05490 82637 81711 gene locus_tag LOCUS_05500 82637 81711 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251147.1 protein_id gnl|my_center|LOCUS_05500 82755 83741 gene locus_tag LOCUS_05510 gene mvk 82755 83741 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902824.1 protein_id gnl|my_center|LOCUS_05510 83738 84478 gene locus_tag LOCUS_05520 83738 84478 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902825.1 protein_id gnl|my_center|LOCUS_05520 86062 84518 gene locus_tag LOCUS_05530 86062 84518 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404995.1 protein_id gnl|my_center|LOCUS_05530 86275 86520 gene locus_tag LOCUS_05540 86275 86520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 86663 87349 gene locus_tag LOCUS_05550 86663 87349 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_05550 87462 89006 gene locus_tag LOCUS_05560 87462 89006 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902931.1 protein_id gnl|my_center|LOCUS_05560 89003 89206 gene locus_tag LOCUS_05570 89003 89206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 90593 89262 gene locus_tag LOCUS_05580 gene trkA 90593 89262 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404994.1 protein_id gnl|my_center|LOCUS_05580 91417 90950 gene locus_tag LOCUS_05590 91417 90950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 91443 92408 gene locus_tag LOCUS_05600 91443 92408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 92410 93462 gene locus_tag LOCUS_05610 92410 93462 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902827.1 protein_id gnl|my_center|LOCUS_05610 93560 95404 gene locus_tag LOCUS_05620 93560 95404 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902829.1 protein_id gnl|my_center|LOCUS_05620 95633 96658 gene locus_tag LOCUS_05630 95633 96658 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902103.1 protein_id gnl|my_center|LOCUS_05630 96843 96679 gene locus_tag LOCUS_05640 96843 96679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 97372 96887 gene locus_tag LOCUS_05650 97372 96887 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902830.1 protein_id gnl|my_center|LOCUS_05650 98202 97819 gene locus_tag LOCUS_05660 gene gcvH 98202 97819 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903167.1 protein_id gnl|my_center|LOCUS_05660 99341 98202 gene locus_tag LOCUS_05670 gene gcvT 99341 98202 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 protein_id gnl|my_center|LOCUS_05670 99543 101024 gene locus_tag LOCUS_05680 99543 101024 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903877.1 protein_id gnl|my_center|LOCUS_05680 102892 101282 gene locus_tag LOCUS_05690 102892 101282 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903921.1 protein_id gnl|my_center|LOCUS_05690 104931 103270 gene locus_tag LOCUS_05700 104931 103270 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903921.1 protein_id gnl|my_center|LOCUS_05700 105437 105222 gene locus_tag LOCUS_05710 105437 105222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 105318 105716 gene locus_tag LOCUS_05720 105318 105716 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289360.1 protein_id gnl|my_center|LOCUS_05720 106285 106013 gene locus_tag LOCUS_05730 106285 106013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 107853 106282 gene locus_tag LOCUS_05740 107853 106282 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902277.1 protein_id gnl|my_center|LOCUS_05740 108081 108929 gene locus_tag LOCUS_05750 108081 108929 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903172.1 protein_id gnl|my_center|LOCUS_05750 109111 109689 gene locus_tag LOCUS_05760 109111 109689 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903173.1 protein_id gnl|my_center|LOCUS_05760 110118 111455 gene locus_tag LOCUS_05770 gene hmgB 110118 111455 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_05770 112298 111507 gene locus_tag LOCUS_05780 112298 111507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 112715 112299 gene locus_tag LOCUS_05790 112715 112299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 112997 114199 gene locus_tag LOCUS_05800 112997 114199 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879296.1 protein_id gnl|my_center|LOCUS_05800 114423 115760 gene locus_tag LOCUS_05810 gene gcvPA 114423 115760 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903166.1 protein_id gnl|my_center|LOCUS_05810 115757 117268 gene locus_tag LOCUS_05820 gene gcvPB 115757 117268 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903165.1 protein_id gnl|my_center|LOCUS_05820 117477 118991 gene locus_tag LOCUS_05830 gene dhaS 117477 118991 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 protein_id gnl|my_center|LOCUS_05830 119229 119053 gene locus_tag LOCUS_05840 119229 119053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 119362 119895 gene locus_tag LOCUS_05850 119362 119895 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289350.1 protein_id gnl|my_center|LOCUS_05850 120533 120117 gene locus_tag LOCUS_05860 120533 120117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 120845 120920 gene locus_tag LOCUS_t00050 120845 120920 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 121754 121305 gene locus_tag LOCUS_05870 121754 121305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 122669 122205 gene locus_tag LOCUS_05880 122669 122205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 123436 122666 gene locus_tag LOCUS_05890 123436 122666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 123638 124540 gene locus_tag LOCUS_05900 123638 124540 CDS product DUF6293 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892517.1 protein_id gnl|my_center|LOCUS_05900 126510 125029 gene locus_tag LOCUS_05910 126510 125029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 128072 126951 gene locus_tag LOCUS_05920 128072 126951 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_05920 130819 128531 gene locus_tag LOCUS_05930 gene tmcA 130819 128531 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289283.1 protein_id gnl|my_center|LOCUS_05930 131125 132723 gene locus_tag LOCUS_05940 131125 132723 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084107.1 protein_id gnl|my_center|LOCUS_05940 132760 133026 gene locus_tag LOCUS_05950 132760 133026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 133043 133405 gene locus_tag LOCUS_05960 gene rpl7ae 133043 133405 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902832.1 protein_id gnl|my_center|LOCUS_05960 133417 133641 gene locus_tag LOCUS_05970 133417 133641 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902833.1 protein_id gnl|my_center|LOCUS_05970 133641 134015 gene locus_tag LOCUS_05980 133641 134015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 134012 134476 gene locus_tag LOCUS_05990 gene ndk 134012 134476 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902835.1 protein_id gnl|my_center|LOCUS_05990 134990 135397 gene locus_tag LOCUS_06000 134990 135397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 135606 136208 gene locus_tag LOCUS_06010 gene sod 135606 136208 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902966.1 protein_id gnl|my_center|LOCUS_06010 136872 136690 gene locus_tag LOCUS_06020 136872 136690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 137445 137891 gene locus_tag LOCUS_06030 137445 137891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 138398 138081 gene locus_tag LOCUS_06040 138398 138081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 139300 138614 gene locus_tag LOCUS_06050 139300 138614 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879429.1 protein_id gnl|my_center|LOCUS_06050 139395 140534 gene locus_tag LOCUS_06060 gene mthRnl 139395 140534 CDS product ATP-dependent RNA/DNA ligase MthRnl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060995.1 protein_id gnl|my_center|LOCUS_06060 142324 140582 gene locus_tag LOCUS_06070 142324 140582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 143598 142432 gene locus_tag LOCUS_06080 143598 142432 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902843.1 protein_id gnl|my_center|LOCUS_06080 143763 145124 gene locus_tag LOCUS_06090 143763 145124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 145270 145578 gene locus_tag LOCUS_06100 145270 145578 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902842.1 protein_id gnl|my_center|LOCUS_06100 145586 145942 gene locus_tag LOCUS_06110 145586 145942 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902841.1 protein_id gnl|my_center|LOCUS_06110 146202 147665 gene locus_tag LOCUS_06120 146202 147665 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404989.1 protein_id gnl|my_center|LOCUS_06120 147779 148375 gene locus_tag LOCUS_06130 147779 148375 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902840.1 protein_id gnl|my_center|LOCUS_06130 148549 149388 gene locus_tag LOCUS_06140 148549 149388 CDS product 16S ribosomal RNA methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902839.1 protein_id gnl|my_center|LOCUS_06140 149494 150654 gene locus_tag LOCUS_06150 149494 150654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 150651 151220 gene locus_tag LOCUS_06160 150651 151220 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902837.1 protein_id gnl|my_center|LOCUS_06160 151893 152900 gene locus_tag LOCUS_06170 151893 152900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902836.1 protein_id gnl|my_center|LOCUS_06170 152897 153973 gene locus_tag LOCUS_06180 152897 153973 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_06180 154175 154792 gene locus_tag LOCUS_06190 154175 154792 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267101.1 protein_id gnl|my_center|LOCUS_06190 154947 156068 gene locus_tag LOCUS_06200 154947 156068 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_06200 156130 157389 gene locus_tag LOCUS_06210 156130 157389 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903121.1 protein_id gnl|my_center|LOCUS_06210 157557 158597 gene locus_tag LOCUS_06220 157557 158597 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289630.1 protein_id gnl|my_center|LOCUS_06220 159155 158616 gene locus_tag LOCUS_06230 159155 158616 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419208.1 protein_id gnl|my_center|LOCUS_06230 159543 159848 gene locus_tag LOCUS_06240 159543 159848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 161418 159955 gene locus_tag LOCUS_06250 161418 159955 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022374.1 protein_id gnl|my_center|LOCUS_06250 161862 161488 gene locus_tag LOCUS_06260 161862 161488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence33 394 2322 gene locus_tag LOCUS_06270 gene dnaK 394 2322 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 protein_id gnl|my_center|LOCUS_06270 3122 4294 gene locus_tag LOCUS_06280 gene dnaJ 3122 4294 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902321.1 protein_id gnl|my_center|LOCUS_06280 4414 5007 gene locus_tag LOCUS_06290 4414 5007 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403206.1 protein_id gnl|my_center|LOCUS_06290 5090 5833 gene locus_tag LOCUS_06300 5090 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902320.1 protein_id gnl|my_center|LOCUS_06300 6025 5864 gene locus_tag LOCUS_06310 6025 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 6410 7063 gene locus_tag LOCUS_06320 6410 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 7176 7520 gene locus_tag LOCUS_06330 7176 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 7637 8560 gene locus_tag LOCUS_06340 7637 8560 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868260.1 protein_id gnl|my_center|LOCUS_06340 8683 9270 gene locus_tag LOCUS_06350 8683 9270 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902314.1 protein_id gnl|my_center|LOCUS_06350 9471 9304 gene locus_tag LOCUS_06360 9471 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 9588 9962 gene locus_tag LOCUS_06370 9588 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 10051 11733 gene locus_tag LOCUS_06380 10051 11733 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289163.1 protein_id gnl|my_center|LOCUS_06380 12117 12500 gene locus_tag LOCUS_06390 gene mce 12117 12500 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289162.1 protein_id gnl|my_center|LOCUS_06390 13442 12510 gene locus_tag LOCUS_06400 13442 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14382 13744 gene locus_tag LOCUS_06410 14382 13744 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902309.1 protein_id gnl|my_center|LOCUS_06410 14633 16411 gene locus_tag LOCUS_06420 14633 16411 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902308.1 protein_id gnl|my_center|LOCUS_06420 16411 17277 gene locus_tag LOCUS_06430 16411 17277 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902307.1 protein_id gnl|my_center|LOCUS_06430 17989 17324 gene locus_tag LOCUS_06440 17989 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 18140 19297 gene locus_tag LOCUS_06450 18140 19297 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902330.1 protein_id gnl|my_center|LOCUS_06450 19397 19750 gene locus_tag LOCUS_06460 19397 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06460 19747 20187 gene locus_tag LOCUS_06470 19747 20187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 21317 20241 gene locus_tag LOCUS_06480 21317 20241 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_06480 23160 21433 gene locus_tag LOCUS_06490 23160 21433 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140493.1 protein_id gnl|my_center|LOCUS_06490 23336 24763 gene locus_tag LOCUS_06500 23336 24763 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029761399.1 protein_id gnl|my_center|LOCUS_06500 24865 25725 gene locus_tag LOCUS_06510 24865 25725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 27488 25800 gene locus_tag LOCUS_06520 27488 25800 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_06520 27584 28444 gene locus_tag LOCUS_06530 27584 28444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 30652 29519 gene locus_tag LOCUS_06540 30652 29519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 31320 30652 gene locus_tag LOCUS_06550 31320 30652 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902929.1 protein_id gnl|my_center|LOCUS_06550 32974 31445 gene locus_tag LOCUS_06560 32974 31445 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903259.1 protein_id gnl|my_center|LOCUS_06560 33818 33081 gene locus_tag LOCUS_06570 33818 33081 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_06570 34242 33820 gene locus_tag LOCUS_06580 34242 33820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 34507 34247 gene locus_tag LOCUS_06590 34507 34247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 36730 35552 gene locus_tag LOCUS_06600 36730 35552 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902332.1 protein_id gnl|my_center|LOCUS_06600 37604 36873 gene locus_tag LOCUS_06610 37604 36873 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_06610 38461 37976 gene locus_tag LOCUS_06620 38461 37976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 39642 38944 gene locus_tag LOCUS_06630 39642 38944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 41155 40220 gene locus_tag LOCUS_06640 41155 40220 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903108.1 protein_id gnl|my_center|LOCUS_06640 41278 41601 gene locus_tag LOCUS_06650 41278 41601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289346.1 protein_id gnl|my_center|LOCUS_06650 43958 41982 gene locus_tag LOCUS_06660 43958 41982 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_06660 45056 44010 gene locus_tag LOCUS_06670 45056 44010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 45335 45832 gene locus_tag LOCUS_06680 45335 45832 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902543.1 protein_id gnl|my_center|LOCUS_06680 45930 46361 gene locus_tag LOCUS_06690 45930 46361 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902542.1 protein_id gnl|my_center|LOCUS_06690 46589 46431 gene locus_tag LOCUS_06700 46589 46431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 48430 46703 gene locus_tag LOCUS_06710 gene ilvD 48430 46703 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839606.1 protein_id gnl|my_center|LOCUS_06710 48762 49748 gene locus_tag LOCUS_06720 48762 49748 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249890.1 protein_id gnl|my_center|LOCUS_06720 49815 50168 gene locus_tag LOCUS_06730 49815 50168 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289371.1 protein_id gnl|my_center|LOCUS_06730 50210 50761 gene locus_tag LOCUS_06740 50210 50761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 50779 51399 gene locus_tag LOCUS_06750 50779 51399 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902033.1 protein_id gnl|my_center|LOCUS_06750 54123 51838 gene locus_tag LOCUS_06760 54123 51838 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902898.1 protein_id gnl|my_center|LOCUS_06760 54751 55482 gene locus_tag LOCUS_06770 54751 55482 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_06770 55561 56907 gene locus_tag LOCUS_06780 gene dinB 55561 56907 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289265.1 protein_id gnl|my_center|LOCUS_06780 57043 58272 gene locus_tag LOCUS_06790 57043 58272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 58356 58904 gene locus_tag LOCUS_06800 58356 58904 CDS product multiprotein-bridging factor 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903083.1 protein_id gnl|my_center|LOCUS_06800 59203 59433 gene locus_tag LOCUS_06810 59203 59433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 59584 60822 gene locus_tag LOCUS_06820 59584 60822 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_06820 60998 61651 gene locus_tag LOCUS_06830 gene eda 60998 61651 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_06830 61823 62911 gene locus_tag LOCUS_06840 61823 62911 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902123.1 protein_id gnl|my_center|LOCUS_06840 63091 63267 gene locus_tag LOCUS_06850 63091 63267 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902231.1 protein_id gnl|my_center|LOCUS_06850 63267 63704 gene locus_tag LOCUS_06860 63267 63704 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902230.1 protein_id gnl|my_center|LOCUS_06860 63958 64749 gene locus_tag LOCUS_06870 63958 64749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 65127 64840 gene locus_tag LOCUS_06880 65127 64840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 65390 66154 gene locus_tag LOCUS_06890 65390 66154 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892483.1 protein_id gnl|my_center|LOCUS_06890 66802 66293 gene locus_tag LOCUS_06900 66802 66293 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_06900 68564 66813 gene locus_tag LOCUS_06910 gene polX 68564 66813 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_06910 69004 68564 gene locus_tag LOCUS_06920 69004 68564 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289143.1 protein_id gnl|my_center|LOCUS_06920 69215 70165 gene locus_tag LOCUS_06930 69215 70165 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902221.1 protein_id gnl|my_center|LOCUS_06930 70211 71023 gene locus_tag LOCUS_06940 70211 71023 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902222.1 protein_id gnl|my_center|LOCUS_06940 71226 72167 gene locus_tag LOCUS_06950 71226 72167 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_06950 72769 72191 gene locus_tag LOCUS_06960 72769 72191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 73023 73718 gene locus_tag LOCUS_06970 73023 73718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 73699 74190 gene locus_tag LOCUS_06980 73699 74190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 74444 75928 gene locus_tag LOCUS_06990 74444 75928 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 protein_id gnl|my_center|LOCUS_06990 77644 76001 gene locus_tag LOCUS_07000 77644 76001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 78071 77986 gene locus_tag LOCUS_t00060 78071 77986 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 80891 78201 gene locus_tag LOCUS_07010 gene ppc 80891 78201 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_07010 82205 81276 gene locus_tag LOCUS_07020 82205 81276 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901998.1 protein_id gnl|my_center|LOCUS_07020 82408 82860 gene locus_tag LOCUS_07030 82408 82860 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_07030 84380 83121 gene locus_tag LOCUS_07040 84380 83121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 84775 84491 gene locus_tag LOCUS_07050 84775 84491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 85751 84768 gene locus_tag LOCUS_07060 85751 84768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 85919 86830 gene locus_tag LOCUS_07070 85919 86830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 87508 86876 gene locus_tag LOCUS_07080 87508 86876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903725.1 protein_id gnl|my_center|LOCUS_07080 88107 87505 gene locus_tag LOCUS_07090 88107 87505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903726.1 protein_id gnl|my_center|LOCUS_07090 88222 88827 gene locus_tag LOCUS_07100 88222 88827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902733.1 protein_id gnl|my_center|LOCUS_07100 89229 89155 gene locus_tag LOCUS_t00070 89229 89155 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 90565 89348 gene locus_tag LOCUS_07110 90565 89348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_07110 90917 90576 gene locus_tag LOCUS_07120 90917 90576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 90807 91331 gene locus_tag LOCUS_07130 90807 91331 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902963.1 protein_id gnl|my_center|LOCUS_07130 92213 91383 gene locus_tag LOCUS_07140 92213 91383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 92476 92210 gene locus_tag LOCUS_07150 92476 92210 CDS product DUF5827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902964.1 protein_id gnl|my_center|LOCUS_07150 93576 92581 gene locus_tag LOCUS_07160 93576 92581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 93722 94414 gene locus_tag LOCUS_07170 93722 94414 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401467.1 protein_id gnl|my_center|LOCUS_07170 94544 94978 gene locus_tag LOCUS_07180 94544 94978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 95513 95247 gene locus_tag LOCUS_07190 95513 95247 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289285.1 protein_id gnl|my_center|LOCUS_07190 95698 95519 gene locus_tag LOCUS_07200 95698 95519 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902845.1 protein_id gnl|my_center|LOCUS_07200 95989 97290 gene locus_tag LOCUS_07210 gene nreA 95989 97290 CDS product DNA repair protein NreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289141.1 protein_id gnl|my_center|LOCUS_07210 97542 98978 gene locus_tag LOCUS_07220 97542 98978 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903565.1 protein_id gnl|my_center|LOCUS_07220 100079 99006 gene locus_tag LOCUS_07230 100079 99006 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870691.1 protein_id gnl|my_center|LOCUS_07230 101007 100312 gene locus_tag LOCUS_07240 101007 100312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 101299 101012 gene locus_tag LOCUS_07250 101299 101012 CDS product DUF5789 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289142.1 protein_id gnl|my_center|LOCUS_07250 101442 102443 gene locus_tag LOCUS_07260 101442 102443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902219.1 protein_id gnl|my_center|LOCUS_07260 103011 102526 gene locus_tag LOCUS_07270 103011 102526 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289144.1 protein_id gnl|my_center|LOCUS_07270 103602 103090 gene locus_tag LOCUS_07280 103602 103090 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902226.1 protein_id gnl|my_center|LOCUS_07280 103758 104858 gene locus_tag LOCUS_07290 gene aspC 103758 104858 CDS product aspartate/prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227669.1 protein_id gnl|my_center|LOCUS_07290 104933 106288 gene locus_tag LOCUS_07300 104933 106288 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902224.1 protein_id gnl|my_center|LOCUS_07300 107871 106399 gene locus_tag LOCUS_07310 gene purF 107871 106399 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903090.1 protein_id gnl|my_center|LOCUS_07310 108151 109926 gene locus_tag LOCUS_07320 108151 109926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 110541 109951 gene locus_tag LOCUS_07330 110541 109951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 112265 110742 gene locus_tag LOCUS_07340 112265 110742 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_07340 113008 112562 gene locus_tag LOCUS_07350 113008 112562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 113837 113178 gene locus_tag LOCUS_07360 gene dps 113837 113178 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144276.1 protein_id gnl|my_center|LOCUS_07360 113972 115252 gene locus_tag LOCUS_07370 113972 115252 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902557.1 protein_id gnl|my_center|LOCUS_07370 115756 115322 gene locus_tag LOCUS_07380 115756 115322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 116210 115836 gene locus_tag LOCUS_07390 116210 115836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 116352 117125 gene locus_tag LOCUS_07400 116352 117125 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_07400 117241 118035 gene locus_tag LOCUS_07410 117241 118035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 118162 118476 gene locus_tag LOCUS_07420 118162 118476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 119520 118510 gene locus_tag LOCUS_07430 119520 118510 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903696.1 protein_id gnl|my_center|LOCUS_07430 119685 120752 gene locus_tag LOCUS_07440 119685 120752 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256753.1 protein_id gnl|my_center|LOCUS_07440 121701 121054 gene locus_tag LOCUS_07450 121701 121054 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289405.1 protein_id gnl|my_center|LOCUS_07450 121909 123336 gene locus_tag LOCUS_07460 121909 123336 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903558.1 protein_id gnl|my_center|LOCUS_07460 123456 123713 gene locus_tag LOCUS_07470 123456 123713 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903557.1 protein_id gnl|my_center|LOCUS_07470 123982 123785 gene locus_tag LOCUS_07480 123982 123785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 125000 124035 gene locus_tag LOCUS_07490 125000 124035 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289434.1 protein_id gnl|my_center|LOCUS_07490 125170 126477 gene locus_tag LOCUS_07500 125170 126477 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903554.1 protein_id gnl|my_center|LOCUS_07500 126768 126565 gene locus_tag LOCUS_07510 126768 126565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902797.1 protein_id gnl|my_center|LOCUS_07510 127914 127285 gene locus_tag LOCUS_07520 127914 127285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 127868 128980 gene locus_tag LOCUS_07530 127868 128980 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902798.1 protein_id gnl|my_center|LOCUS_07530 129114 130817 gene locus_tag LOCUS_07540 129114 130817 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903459.1 protein_id gnl|my_center|LOCUS_07540 130865 131653 gene locus_tag LOCUS_07550 130865 131653 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902800.1 protein_id gnl|my_center|LOCUS_07550 132106 131723 gene locus_tag LOCUS_07560 132106 131723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 132767 132456 gene locus_tag LOCUS_07570 132767 132456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289278.1 protein_id gnl|my_center|LOCUS_07570 133111 132764 gene locus_tag LOCUS_07580 133111 132764 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892503.1 protein_id gnl|my_center|LOCUS_07580 134107 133373 gene locus_tag LOCUS_07590 134107 133373 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_07590 134413 134577 gene locus_tag LOCUS_07600 134413 134577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 134976 136097 gene locus_tag LOCUS_07610 134976 136097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 136320 137438 gene locus_tag LOCUS_07620 136320 137438 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890429.1 protein_id gnl|my_center|LOCUS_07620 139330 137492 gene locus_tag LOCUS_07630 139330 137492 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006079023.1 protein_id gnl|my_center|LOCUS_07630 141234 139330 gene locus_tag LOCUS_07640 141234 139330 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_07640 142829 141234 gene locus_tag LOCUS_07650 142829 141234 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289183.1 protein_id gnl|my_center|LOCUS_07650 143199 142822 gene locus_tag LOCUS_07660 143199 142822 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902377.1 protein_id gnl|my_center|LOCUS_07660 143710 143192 gene locus_tag LOCUS_07670 143710 143192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 144249 143710 gene locus_tag LOCUS_07680 144249 143710 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902379.1 protein_id gnl|my_center|LOCUS_07680 144611 144246 gene locus_tag LOCUS_07690 gene mnhG 144611 144246 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_07690 144889 144608 gene locus_tag LOCUS_07700 144889 144608 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902381.1 protein_id gnl|my_center|LOCUS_07700 145953 144886 gene locus_tag LOCUS_07710 145953 144886 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902382.1 protein_id gnl|my_center|LOCUS_07710 146167 146352 gene locus_tag LOCUS_07720 146167 146352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 146352 147134 gene locus_tag LOCUS_07730 146352 147134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 147131 147463 gene locus_tag LOCUS_07740 147131 147463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 147550 148620 gene locus_tag LOCUS_07750 147550 148620 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903871.1 protein_id gnl|my_center|LOCUS_07750 148680 149990 gene locus_tag LOCUS_07760 148680 149990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 150194 150448 gene locus_tag LOCUS_07770 150194 150448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 151167 150928 gene locus_tag LOCUS_07780 151167 150928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 152712 151345 gene locus_tag LOCUS_07790 gene allB 152712 151345 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461638.1 protein_id gnl|my_center|LOCUS_07790 153230 152850 gene locus_tag LOCUS_07800 153230 152850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 153380 154369 gene locus_tag LOCUS_07810 153380 154369 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_07810 154972 155361 gene locus_tag LOCUS_07820 154972 155361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 155585 157324 gene locus_tag LOCUS_07830 155585 157324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 158041 157538 gene locus_tag LOCUS_07840 158041 157538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 159161 159493 gene locus_tag LOCUS_07850 159161 159493 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892503.1 protein_id gnl|my_center|LOCUS_07850 159714 159989 gene locus_tag LOCUS_07860 159714 159989 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_07860 160191 161177 gene locus_tag LOCUS_07870 160191 161177 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_07870 161933 161397 gene locus_tag LOCUS_07880 161933 161397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 162404 162994 gene locus_tag LOCUS_07890 162404 162994 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080944.1 protein_id gnl|my_center|LOCUS_07890 162991 164211 gene locus_tag LOCUS_07900 162991 164211 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_07900 164208 165233 gene locus_tag LOCUS_07910 164208 165233 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 protein_id gnl|my_center|LOCUS_07910 165233 166723 gene locus_tag LOCUS_07920 165233 166723 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence34 36 413 gene locus_tag LOCUS_07930 36 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 707 501 gene locus_tag LOCUS_07940 707 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1915 815 gene locus_tag LOCUS_07950 1915 815 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_07950 2078 3070 gene locus_tag LOCUS_07960 2078 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4139 3159 gene locus_tag LOCUS_07970 4139 3159 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_07970 5065 4136 gene locus_tag LOCUS_07980 5065 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 6177 5062 gene locus_tag LOCUS_07990 6177 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7219 6287 gene locus_tag LOCUS_08000 7219 6287 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073065.1 protein_id gnl|my_center|LOCUS_08000 7525 9081 gene locus_tag LOCUS_08010 7525 9081 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_08010 10476 9082 gene locus_tag LOCUS_08020 10476 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 11901 10594 gene locus_tag LOCUS_08030 11901 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 12261 14054 gene locus_tag LOCUS_08040 12261 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 14616 15566 gene locus_tag LOCUS_08050 14616 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 16018 15629 gene locus_tag LOCUS_08060 16018 15629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 18249 16183 gene locus_tag LOCUS_08070 18249 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 20044 18581 gene locus_tag LOCUS_08080 20044 18581 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_08080 21233 20079 gene locus_tag LOCUS_08090 21233 20079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 22391 21795 gene locus_tag LOCUS_08100 22391 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 23235 24194 gene locus_tag LOCUS_08110 23235 24194 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_08110 24375 24187 gene locus_tag LOCUS_08120 24375 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 24509 26419 gene locus_tag LOCUS_08130 24509 26419 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289321.1 protein_id gnl|my_center|LOCUS_08130 26575 28311 gene locus_tag LOCUS_08140 26575 28311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 29478 28357 gene locus_tag LOCUS_08150 29478 28357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 29721 31349 gene locus_tag LOCUS_08160 29721 31349 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_08160 31346 32356 gene locus_tag LOCUS_08170 31346 32356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence35 414 1739 gene locus_tag LOCUS_08180 gene glmM 414 1739 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 protein_id gnl|my_center|LOCUS_08180 4495 2684 gene locus_tag LOCUS_08190 gene glmS 4495 2684 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901947.1 protein_id gnl|my_center|LOCUS_08190 5122 5301 gene locus_tag LOCUS_08200 5122 5301 CDS product DUF5786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289220.1 protein_id gnl|my_center|LOCUS_08200 6246 5482 gene locus_tag LOCUS_08210 6246 5482 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_08210 9730 6503 gene locus_tag LOCUS_08220 9730 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 10285 9863 gene locus_tag LOCUS_08230 10285 9863 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_08230 11122 10439 gene locus_tag LOCUS_08240 11122 10439 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902064.1 protein_id gnl|my_center|LOCUS_08240 11714 11124 gene locus_tag LOCUS_08250 11714 11124 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289107.1 protein_id gnl|my_center|LOCUS_08250 12445 11717 gene locus_tag LOCUS_08260 12445 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 12646 13761 gene locus_tag LOCUS_08270 12646 13761 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902643.1 protein_id gnl|my_center|LOCUS_08270 15651 16856 gene locus_tag LOCUS_08280 gene orc4 15651 16856 CDS product DNA replication protein Orc4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006183330.1 protein_id gnl|my_center|LOCUS_08280 18215 17067 gene locus_tag LOCUS_08290 18215 17067 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902498.1 protein_id gnl|my_center|LOCUS_08290 18504 20222 gene locus_tag LOCUS_08300 18504 20222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 20225 21043 gene locus_tag LOCUS_08310 gene otsB 20225 21043 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730996.1 protein_id gnl|my_center|LOCUS_08310 21368 21721 gene locus_tag LOCUS_08320 21368 21721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903436.1 protein_id gnl|my_center|LOCUS_08320 22297 21941 gene locus_tag LOCUS_08330 22297 21941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 22531 22301 gene locus_tag LOCUS_08340 22531 22301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 22969 22616 gene locus_tag LOCUS_08350 22969 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 25218 23197 gene locus_tag LOCUS_08360 25218 23197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 25624 25367 gene locus_tag LOCUS_08370 25624 25367 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902385.1 protein_id gnl|my_center|LOCUS_08370 25930 26319 gene locus_tag LOCUS_08380 25930 26319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 27991 26408 gene locus_tag LOCUS_08390 27991 26408 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903150.1 protein_id gnl|my_center|LOCUS_08390 29648 28164 gene locus_tag LOCUS_08400 29648 28164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990833.1 protein_id gnl|my_center|LOCUS_08400 30337 29645 gene locus_tag LOCUS_08410 30337 29645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022197.1 protein_id gnl|my_center|LOCUS_08410 31215 30499 gene locus_tag LOCUS_08420 31215 30499 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892603.1 protein_id gnl|my_center|LOCUS_08420 31320 31679 gene locus_tag LOCUS_08430 31320 31679 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360906.1 protein_id gnl|my_center|LOCUS_08430 32955 31723 gene locus_tag LOCUS_08440 32955 31723 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421552.1 protein_id gnl|my_center|LOCUS_08440 33513 33088 gene locus_tag LOCUS_08450 33513 33088 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172874.1 protein_id gnl|my_center|LOCUS_08450 34632 33613 gene locus_tag LOCUS_08460 34632 33613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902755.1 protein_id gnl|my_center|LOCUS_08460 35473 34943 gene locus_tag LOCUS_08470 gene msrA 35473 34943 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902851.1 protein_id gnl|my_center|LOCUS_08470 37609 35558 gene locus_tag LOCUS_08480 gene ggt 37609 35558 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231470.1 protein_id gnl|my_center|LOCUS_08480 38275 37610 gene locus_tag LOCUS_08490 38275 37610 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902910.1 protein_id gnl|my_center|LOCUS_08490 38481 38669 gene locus_tag LOCUS_08500 38481 38669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 38792 39484 gene locus_tag LOCUS_08510 38792 39484 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_08510 39468 41879 gene locus_tag LOCUS_08520 gene ppk1 39468 41879 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_08520 42078 42305 gene locus_tag LOCUS_08530 42078 42305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 42549 43544 gene locus_tag LOCUS_08540 42549 43544 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_08540 43613 43768 gene locus_tag LOCUS_08550 43613 43768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 44147 43776 gene locus_tag LOCUS_08560 44147 43776 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903217.1 protein_id gnl|my_center|LOCUS_08560 45798 44344 gene locus_tag LOCUS_08570 45798 44344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 48058 45803 gene locus_tag LOCUS_08580 48058 45803 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903183.1 protein_id gnl|my_center|LOCUS_08580 48207 48674 gene locus_tag LOCUS_08590 48207 48674 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903012.1 protein_id gnl|my_center|LOCUS_08590 49148 48813 gene locus_tag LOCUS_08600 49148 48813 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903011.1 protein_id gnl|my_center|LOCUS_08600 49353 49526 gene locus_tag LOCUS_08610 49353 49526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 49622 49706 gene locus_tag LOCUS_t00080 49622 49706 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49914 50426 gene locus_tag LOCUS_08620 49914 50426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 50431 51177 gene locus_tag LOCUS_08630 50431 51177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 51407 51195 gene locus_tag LOCUS_08640 51407 51195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 51643 52044 gene locus_tag LOCUS_08650 51643 52044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 52153 52965 gene locus_tag LOCUS_08660 gene dacZ 52153 52965 CDS product diadenylate cyclase DacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903010.1 protein_id gnl|my_center|LOCUS_08660 52967 53734 gene locus_tag LOCUS_08670 52967 53734 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903009.1 protein_id gnl|my_center|LOCUS_08670 54568 53747 gene locus_tag LOCUS_08680 54568 53747 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902630.1 protein_id gnl|my_center|LOCUS_08680 54625 55152 gene locus_tag LOCUS_08690 54625 55152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 55549 55130 gene locus_tag LOCUS_08700 gene cdd 55549 55130 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902631.1 protein_id gnl|my_center|LOCUS_08700 56630 55584 gene locus_tag LOCUS_08710 56630 55584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902632.1 protein_id gnl|my_center|LOCUS_08710 57870 56623 gene locus_tag LOCUS_08720 57870 56623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902633.1 protein_id gnl|my_center|LOCUS_08720 59510 57867 gene locus_tag LOCUS_08730 59510 57867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902634.1 protein_id gnl|my_center|LOCUS_08730 60564 59515 gene locus_tag LOCUS_08740 60564 59515 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902635.1 protein_id gnl|my_center|LOCUS_08740 62087 60684 gene locus_tag LOCUS_08750 62087 60684 CDS product phosphopentomutase/phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902636.1 protein_id gnl|my_center|LOCUS_08750 62805 62167 gene locus_tag LOCUS_08760 62805 62167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 63057 63386 gene locus_tag LOCUS_08770 63057 63386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 63383 63868 gene locus_tag LOCUS_08780 63383 63868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 63932 64456 gene locus_tag LOCUS_08790 63932 64456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 64453 65808 gene locus_tag LOCUS_08800 64453 65808 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_08800 65927 66664 gene locus_tag LOCUS_08810 gene phbB 65927 66664 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 protein_id gnl|my_center|LOCUS_08810 66838 68307 gene locus_tag LOCUS_08820 66838 68307 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901950.1 protein_id gnl|my_center|LOCUS_08820 68475 69227 gene locus_tag LOCUS_08830 68475 69227 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_08830 70433 69333 gene locus_tag LOCUS_08840 70433 69333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 73279 72122 gene locus_tag LOCUS_08850 73279 72122 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902726.1 protein_id gnl|my_center|LOCUS_08850 73700 73281 gene locus_tag LOCUS_08860 73700 73281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 75063 74800 gene locus_tag LOCUS_08870 75063 74800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903452.1 protein_id gnl|my_center|LOCUS_08870 78170 75714 gene locus_tag LOCUS_08880 78170 75714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901946.1 protein_id gnl|my_center|LOCUS_08880 79104 78277 gene locus_tag LOCUS_08890 79104 78277 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761882.1 protein_id gnl|my_center|LOCUS_08890 80984 79182 gene locus_tag LOCUS_08900 gene glmS 80984 79182 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901947.1 protein_id gnl|my_center|LOCUS_08900 82084 80987 gene locus_tag LOCUS_08910 82084 80987 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901948.1 protein_id gnl|my_center|LOCUS_08910 82854 82348 gene locus_tag LOCUS_08920 gene moaC 82854 82348 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902923.1 protein_id gnl|my_center|LOCUS_08920 84256 82847 gene locus_tag LOCUS_08930 84256 82847 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289301.1 protein_id gnl|my_center|LOCUS_08930 84372 84869 gene locus_tag LOCUS_08940 84372 84869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 85415 85092 gene locus_tag LOCUS_08950 85415 85092 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_08950 85766 86896 gene locus_tag LOCUS_08960 85766 86896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 87814 86933 gene locus_tag LOCUS_08970 87814 86933 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902918.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence36 137 625 gene locus_tag LOCUS_08980 137 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1083 841 gene locus_tag LOCUS_08990 1083 841 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902916.1 protein_id gnl|my_center|LOCUS_08990 1545 1366 gene locus_tag LOCUS_09000 1545 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902914.1 protein_id gnl|my_center|LOCUS_09000 2636 1656 gene locus_tag LOCUS_09010 2636 1656 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_09010 3140 2853 gene locus_tag LOCUS_09020 3140 2853 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902913.1 protein_id gnl|my_center|LOCUS_09020 3340 4665 gene locus_tag LOCUS_09030 3340 4665 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902912.1 protein_id gnl|my_center|LOCUS_09030 4978 6600 gene locus_tag LOCUS_09040 4978 6600 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903076.1 protein_id gnl|my_center|LOCUS_09040 6604 9087 gene locus_tag LOCUS_09050 6604 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 11267 9654 gene locus_tag LOCUS_09060 11267 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 14365 11690 gene locus_tag LOCUS_09070 gene csg 14365 11690 CDS product HVO_2072 family ArtA-dependent S-layer glycoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289536.1 protein_id gnl|my_center|LOCUS_09070 15249 14635 gene locus_tag LOCUS_09080 15249 14635 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289535.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence37 344 2881 gene locus_tag LOCUS_09090 344 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3849 3040 gene locus_tag LOCUS_09100 3849 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3956 4351 gene locus_tag LOCUS_09110 3956 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 4764 4432 gene locus_tag LOCUS_09120 4764 4432 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902900.1 protein_id gnl|my_center|LOCUS_09120 5633 4761 gene locus_tag LOCUS_09130 5633 4761 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902901.1 protein_id gnl|my_center|LOCUS_09130 5966 5757 gene locus_tag LOCUS_09140 5966 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 6025 6456 gene locus_tag LOCUS_09150 6025 6456 CDS product DUF5796 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902902.1 protein_id gnl|my_center|LOCUS_09150 6456 6701 gene locus_tag LOCUS_09160 6456 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 6839 6705 gene locus_tag LOCUS_09170 6839 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 7827 6925 gene locus_tag LOCUS_09180 7827 6925 CDS product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_09180 7914 8552 gene locus_tag LOCUS_09190 7914 8552 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_09190 10036 9020 gene locus_tag LOCUS_09200 10036 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 13336 11105 gene locus_tag LOCUS_09210 13336 11105 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_09210 13454 13651 gene locus_tag LOCUS_09220 13454 13651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 14454 13885 gene locus_tag LOCUS_09230 14454 13885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence38 1068 880 gene locus_tag LOCUS_09240 1068 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2199 1495 gene locus_tag LOCUS_09250 2199 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 3207 2818 gene locus_tag LOCUS_09260 3207 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3945 5462 gene locus_tag LOCUS_09270 3945 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6378 5611 gene locus_tag LOCUS_09280 6378 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 6475 7206 gene locus_tag LOCUS_09290 gene radB 6475 7206 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903214.1 protein_id gnl|my_center|LOCUS_09290 8565 7408 gene locus_tag LOCUS_09300 8565 7408 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903212.1 protein_id gnl|my_center|LOCUS_09300 8671 8982 gene locus_tag LOCUS_09310 8671 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 9097 9840 gene locus_tag LOCUS_09320 9097 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 9960 10742 gene locus_tag LOCUS_09330 9960 10742 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_09330 10829 11668 gene locus_tag LOCUS_09340 10829 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 11783 11992 gene locus_tag LOCUS_09350 11783 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 12216 12141 gene locus_tag LOCUS_t00090 12216 12141 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12405 13421 gene locus_tag LOCUS_09360 gene trpD 12405 13421 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903202.1 protein_id gnl|my_center|LOCUS_09360 13418 14068 gene locus_tag LOCUS_09370 13418 14068 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_09370 14071 15759 gene locus_tag LOCUS_09380 gene trpE 14071 15759 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903200.1 protein_id gnl|my_center|LOCUS_09380 15756 16403 gene locus_tag LOCUS_09390 gene trpG 15756 16403 CDS product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903199.1 protein_id gnl|my_center|LOCUS_09390 16692 16507 gene locus_tag LOCUS_09400 16692 16507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 17108 20230 gene locus_tag LOCUS_09410 17108 20230 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903197.1 protein_id gnl|my_center|LOCUS_09410 20345 20521 gene locus_tag LOCUS_09420 20345 20521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 21269 20577 gene locus_tag LOCUS_09430 21269 20577 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903195.1 protein_id gnl|my_center|LOCUS_09430 21507 21591 gene locus_tag LOCUS_t00100 21507 21591 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22112 22675 gene locus_tag LOCUS_09440 22112 22675 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903089.1 protein_id gnl|my_center|LOCUS_09440 22923 22726 gene locus_tag LOCUS_09450 22923 22726 CDS product DUF5800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902336.1 protein_id gnl|my_center|LOCUS_09450 23072 23929 gene locus_tag LOCUS_09460 23072 23929 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902335.1 protein_id gnl|my_center|LOCUS_09460 24189 25055 gene locus_tag LOCUS_09470 24189 25055 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143353.1 protein_id gnl|my_center|LOCUS_09470 25057 26646 gene locus_tag LOCUS_09480 25057 26646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 26639 28312 gene locus_tag LOCUS_09490 26639 28312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 28314 28715 gene locus_tag LOCUS_09500 28314 28715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 28890 29471 gene locus_tag LOCUS_09510 28890 29471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 30209 29511 gene locus_tag LOCUS_09520 gene phoU 30209 29511 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_09520 30818 30312 gene locus_tag LOCUS_09530 30818 30312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 31835 30966 gene locus_tag LOCUS_09540 gene pstB 31835 30966 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902290.1 protein_id gnl|my_center|LOCUS_09540 32725 31838 gene locus_tag LOCUS_09550 gene pstA 32725 31838 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878855.1 protein_id gnl|my_center|LOCUS_09550 33654 32725 gene locus_tag LOCUS_09560 gene pstC 33654 32725 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902292.1 protein_id gnl|my_center|LOCUS_09560 34538 33651 gene locus_tag LOCUS_09570 34538 33651 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064375.1 protein_id gnl|my_center|LOCUS_09570 36083 35061 gene locus_tag LOCUS_09580 36083 35061 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064375.1 protein_id gnl|my_center|LOCUS_09580 36885 36166 gene locus_tag LOCUS_09590 gene phoU 36885 36166 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_09590 37817 36885 gene locus_tag LOCUS_09600 gene pstB 37817 36885 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903855.1 protein_id gnl|my_center|LOCUS_09600 39367 37814 gene locus_tag LOCUS_09610 gene pstA 39367 37814 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903856.1 protein_id gnl|my_center|LOCUS_09610 40440 39364 gene locus_tag LOCUS_09620 gene pstC 40440 39364 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903857.1 protein_id gnl|my_center|LOCUS_09620 41562 40471 gene locus_tag LOCUS_09630 41562 40471 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903858.1 protein_id gnl|my_center|LOCUS_09630 42083 43078 gene locus_tag LOCUS_09640 42083 43078 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_09640 43189 43851 gene locus_tag LOCUS_09650 43189 43851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 43991 44620 gene locus_tag LOCUS_09660 43991 44620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09660 44911 44657 gene locus_tag LOCUS_09670 44911 44657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 46127 45018 gene locus_tag LOCUS_09680 gene gdhB 46127 45018 CDS product glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902074.1 protein_id gnl|my_center|LOCUS_09680 49385 46389 gene locus_tag LOCUS_09690 49385 46389 CDS product bacterio-opsin activator domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289108.1 protein_id gnl|my_center|LOCUS_09690 49719 49546 gene locus_tag LOCUS_09700 49719 49546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 50144 49938 gene locus_tag LOCUS_09710 50144 49938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 50641 50243 gene locus_tag LOCUS_09720 gene msrB 50641 50243 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903021.1 protein_id gnl|my_center|LOCUS_09720 51121 52716 gene locus_tag LOCUS_09730 gene bat 51121 52716 CDS product bacterioopsin transcriptional activator Bat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903066.1 protein_id gnl|my_center|LOCUS_09730 52835 53788 gene locus_tag LOCUS_09740 52835 53788 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903227.1 protein_id gnl|my_center|LOCUS_09740 53858 54010 gene locus_tag LOCUS_09750 53858 54010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 54255 54043 gene locus_tag LOCUS_09760 54255 54043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 55303 54287 gene locus_tag LOCUS_09770 gene cruF 55303 54287 CDS product bisanhydrobacterioruberin hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903228.1 protein_id gnl|my_center|LOCUS_09770 56186 55296 gene locus_tag LOCUS_09780 56186 55296 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903229.1 protein_id gnl|my_center|LOCUS_09780 57767 56277 gene locus_tag LOCUS_09790 gene crtI 57767 56277 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903230.1 protein_id gnl|my_center|LOCUS_09790 57928 58626 gene locus_tag LOCUS_09800 57928 58626 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903275.1 protein_id gnl|my_center|LOCUS_09800 58895 59077 gene locus_tag LOCUS_09810 58895 59077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 59488 59204 gene locus_tag LOCUS_09820 59488 59204 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892515.1 protein_id gnl|my_center|LOCUS_09820 60102 59620 gene locus_tag LOCUS_09830 60102 59620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 61027 60266 gene locus_tag LOCUS_09840 61027 60266 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_09840 61721 61284 gene locus_tag LOCUS_09850 61721 61284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 62536 61748 gene locus_tag LOCUS_09860 gene cbiZ 62536 61748 CDS product adenosylcobinamide amidohydrolase CbiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903156.1 protein_id gnl|my_center|LOCUS_09860 63591 62533 gene locus_tag LOCUS_09870 gene cobD 63591 62533 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903155.1 protein_id gnl|my_center|LOCUS_09870 64615 63581 gene locus_tag LOCUS_09880 64615 63581 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289355.1 protein_id gnl|my_center|LOCUS_09880 65219 64617 gene locus_tag LOCUS_09890 65219 64617 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535909.1 protein_id gnl|my_center|LOCUS_09890 65962 65204 gene locus_tag LOCUS_09900 gene cobS 65962 65204 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289358.1 protein_id gnl|my_center|LOCUS_09900 66960 65959 gene locus_tag LOCUS_09910 66960 65959 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903152.1 protein_id gnl|my_center|LOCUS_09910 67647 67000 gene locus_tag LOCUS_09920 67647 67000 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892512.1 protein_id gnl|my_center|LOCUS_09920 67759 68271 gene locus_tag LOCUS_09930 67759 68271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 68943 68332 gene locus_tag LOCUS_09940 68943 68332 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_09940 69372 70325 gene locus_tag LOCUS_09950 69372 70325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 70733 70957 gene locus_tag LOCUS_09960 70733 70957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 71107 71649 gene locus_tag LOCUS_09970 71107 71649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 71729 72139 gene locus_tag LOCUS_09980 71729 72139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 72769 72419 gene locus_tag LOCUS_09990 72769 72419 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289111.1 protein_id gnl|my_center|LOCUS_09990 72993 73346 gene locus_tag LOCUS_10000 72993 73346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 73578 75155 gene locus_tag LOCUS_10010 gene glnA 73578 75155 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903540.1 protein_id gnl|my_center|LOCUS_10010 75382 75152 gene locus_tag LOCUS_10020 75382 75152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 75549 75851 gene locus_tag LOCUS_10030 75549 75851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904068.1 protein_id gnl|my_center|LOCUS_10030 76707 75880 gene locus_tag LOCUS_10040 76707 75880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 77626 76787 gene locus_tag LOCUS_10050 77626 76787 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902907.1 protein_id gnl|my_center|LOCUS_10050 79346 77637 gene locus_tag LOCUS_10060 79346 77637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 80617 79343 gene locus_tag LOCUS_10070 80617 79343 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289299.1 protein_id gnl|my_center|LOCUS_10070 80912 81976 gene locus_tag LOCUS_10080 80912 81976 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861586.1 protein_id gnl|my_center|LOCUS_10080 82235 84073 gene locus_tag LOCUS_10090 82235 84073 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_10090 84749 84141 gene locus_tag LOCUS_10100 84749 84141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 85002 85199 gene locus_tag LOCUS_10110 85002 85199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 85469 85233 gene locus_tag LOCUS_10120 85469 85233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 85758 85925 gene locus_tag LOCUS_10130 85758 85925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 87216 85969 gene locus_tag LOCUS_10140 87216 85969 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021002.1 protein_id gnl|my_center|LOCUS_10140 87290 87586 gene locus_tag LOCUS_10150 87290 87586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 87586 88572 gene locus_tag LOCUS_10160 87586 88572 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_10160 88735 89934 gene locus_tag LOCUS_10170 88735 89934 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903276.1 protein_id gnl|my_center|LOCUS_10170 92119 90161 gene locus_tag LOCUS_10180 92119 90161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 92355 94028 gene locus_tag LOCUS_10190 92355 94028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 94853 94059 gene locus_tag LOCUS_10200 94853 94059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 95091 96071 gene locus_tag LOCUS_10210 95091 96071 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289364.1 protein_id gnl|my_center|LOCUS_10210 96542 96144 gene locus_tag LOCUS_10220 gene pth2 96542 96144 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902135.1 protein_id gnl|my_center|LOCUS_10220 97357 96542 gene locus_tag LOCUS_10230 97357 96542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 97256 97561 gene locus_tag LOCUS_10240 97256 97561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 97577 98179 gene locus_tag LOCUS_10250 gene dcd 97577 98179 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902137.1 protein_id gnl|my_center|LOCUS_10250 99700 98387 gene locus_tag LOCUS_10260 99700 98387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 101070 99955 gene locus_tag LOCUS_10270 101070 99955 CDS product tRNA (guanine(26)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903537.1 protein_id gnl|my_center|LOCUS_10270 101143 101544 gene locus_tag LOCUS_10280 101143 101544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289430.1 protein_id gnl|my_center|LOCUS_10280 102090 101626 gene locus_tag LOCUS_10290 102090 101626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 102858 102196 gene locus_tag LOCUS_10300 gene hisH 102858 102196 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903536.1 protein_id gnl|my_center|LOCUS_10300 103558 102962 gene locus_tag LOCUS_10310 103558 102962 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903532.1 protein_id gnl|my_center|LOCUS_10310 104279 103707 gene locus_tag LOCUS_10320 104279 103707 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 protein_id gnl|my_center|LOCUS_10320 104459 104283 gene locus_tag LOCUS_10330 104459 104283 CDS product DUF5786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289220.1 protein_id gnl|my_center|LOCUS_10330 104667 105383 gene locus_tag LOCUS_10340 104667 105383 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903529.1 protein_id gnl|my_center|LOCUS_10340 105663 106463 gene locus_tag LOCUS_10350 gene hop 105663 106463 CDS product halorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902090.1 protein_id gnl|my_center|LOCUS_10350 107302 106793 gene locus_tag LOCUS_10360 107302 106793 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289427.1 protein_id gnl|my_center|LOCUS_10360 107461 108366 gene locus_tag LOCUS_10370 107461 108366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 108402 108758 gene locus_tag LOCUS_10380 108402 108758 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903524.1 protein_id gnl|my_center|LOCUS_10380 108905 110422 gene locus_tag LOCUS_10390 108905 110422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 110537 110770 gene locus_tag LOCUS_10400 110537 110770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 112169 110796 gene locus_tag LOCUS_10410 112169 110796 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902096.1 protein_id gnl|my_center|LOCUS_10410 112365 113069 gene locus_tag LOCUS_10420 112365 113069 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903563.1 protein_id gnl|my_center|LOCUS_10420 114262 113327 gene locus_tag LOCUS_10430 114262 113327 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903564.1 protein_id gnl|my_center|LOCUS_10430 115118 114396 gene locus_tag LOCUS_10440 gene ribB 115118 114396 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903567.1 protein_id gnl|my_center|LOCUS_10440 115822 115115 gene locus_tag LOCUS_10450 115822 115115 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289437.1 protein_id gnl|my_center|LOCUS_10450 116108 117271 gene locus_tag LOCUS_10460 116108 117271 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763188.1 protein_id gnl|my_center|LOCUS_10460 117268 117648 gene locus_tag LOCUS_10470 117268 117648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence39 <1 699 gene locus_tag LOCUS_10480 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583291.1:glycosyltransferase family 4 protein 732 1784 gene locus_tag LOCUS_10490 732 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1781 3268 gene locus_tag LOCUS_10500 1781 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 3336 4445 gene locus_tag LOCUS_10510 3336 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4442 5359 gene locus_tag LOCUS_10520 4442 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5818 5744 gene locus_tag LOCUS_t00110 5818 5744 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5973 6983 gene locus_tag LOCUS_10530 5973 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 7075 8484 gene locus_tag LOCUS_10540 7075 8484 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902756.1 protein_id gnl|my_center|LOCUS_10540 8584 10020 gene locus_tag LOCUS_10550 8584 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 10835 10017 gene locus_tag LOCUS_10560 10835 10017 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902515.1 protein_id gnl|my_center|LOCUS_10560 11951 10923 gene locus_tag LOCUS_10570 gene twy1 11951 10923 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903569.1 protein_id gnl|my_center|LOCUS_10570 12339 12004 gene locus_tag LOCUS_10580 12339 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 13829 12924 gene locus_tag LOCUS_10590 13829 12924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 14966 14379 gene locus_tag LOCUS_10600 14966 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 15736 15053 gene locus_tag LOCUS_10610 15736 15053 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902495.1 protein_id gnl|my_center|LOCUS_10610 16257 15871 gene locus_tag LOCUS_10620 16257 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 16719 17099 gene locus_tag LOCUS_10630 16719 17099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 17318 17494 gene locus_tag LOCUS_10640 17318 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 19203 18127 gene locus_tag LOCUS_10650 19203 18127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903445.1 protein_id gnl|my_center|LOCUS_10650 20747 19206 gene locus_tag LOCUS_10660 gene glpK 20747 19206 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903446.1 protein_id gnl|my_center|LOCUS_10660 21050 22759 gene locus_tag LOCUS_10670 gene glpA 21050 22759 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903447.1 protein_id gnl|my_center|LOCUS_10670 22760 24064 gene locus_tag LOCUS_10680 gene glpB 22760 24064 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903448.1 protein_id gnl|my_center|LOCUS_10680 24150 25478 gene locus_tag LOCUS_10690 24150 25478 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903449.1 protein_id gnl|my_center|LOCUS_10690 25478 26644 gene locus_tag LOCUS_10700 25478 26644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 26733 28808 gene locus_tag LOCUS_10710 26733 28808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903117.1 protein_id gnl|my_center|LOCUS_10710 32520 29608 gene locus_tag LOCUS_10720 32520 29608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 32687 33646 gene locus_tag LOCUS_10730 gene aglG 32687 33646 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_10730 34827 33661 gene locus_tag LOCUS_10740 34827 33661 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889300.1 protein_id gnl|my_center|LOCUS_10740 35382 36665 gene locus_tag LOCUS_10750 35382 36665 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902753.1 protein_id gnl|my_center|LOCUS_10750 37678 37857 gene locus_tag LOCUS_10760 37678 37857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 37964 38902 gene locus_tag LOCUS_10770 37964 38902 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_10770 39133 39867 gene locus_tag LOCUS_10780 gene aglF 39133 39867 CDS product UTP--glucose-1-phosphate uridylyltransferase AglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901983.1 protein_id gnl|my_center|LOCUS_10780 39966 41255 gene locus_tag LOCUS_10790 gene aglM 39966 41255 CDS product UDP-glucose 6-dehydrogenase AglM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901982.1 protein_id gnl|my_center|LOCUS_10790 41361 42368 gene locus_tag LOCUS_10800 gene aglJ 41361 42368 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902752.1 protein_id gnl|my_center|LOCUS_10800 42767 42438 gene locus_tag LOCUS_10810 42767 42438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902494.1 protein_id gnl|my_center|LOCUS_10810 42927 43136 gene locus_tag LOCUS_10820 42927 43136 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240443.1 protein_id gnl|my_center|LOCUS_10820 43783 43361 gene locus_tag LOCUS_10830 43783 43361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903839.1 protein_id gnl|my_center|LOCUS_10830 44541 43858 gene locus_tag LOCUS_10840 44541 43858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902751.1 protein_id gnl|my_center|LOCUS_10840 44697 45383 gene locus_tag LOCUS_10850 44697 45383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 45475 45798 gene locus_tag LOCUS_10860 45475 45798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 46142 45852 gene locus_tag LOCUS_10870 46142 45852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 46848 46393 gene locus_tag LOCUS_10880 46848 46393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 47314 48570 gene locus_tag LOCUS_10890 47314 48570 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_10890 48897 50702 gene locus_tag LOCUS_10900 48897 50702 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_10900 50699 51361 gene locus_tag LOCUS_10910 50699 51361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 51354 52409 gene locus_tag LOCUS_10920 gene ilvC 51354 52409 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_10920 52428 52712 gene locus_tag LOCUS_10930 52428 52712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 52709 54130 gene locus_tag LOCUS_10940 gene leuC 52709 54130 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404876.1 protein_id gnl|my_center|LOCUS_10940 54127 54762 gene locus_tag LOCUS_10950 gene leuD 54127 54762 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404878.1 protein_id gnl|my_center|LOCUS_10950 56508 56134 gene locus_tag LOCUS_10960 56508 56134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 57693 56716 gene locus_tag LOCUS_10970 57693 56716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 58665 57808 gene locus_tag LOCUS_10980 58665 57808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 59184 60164 gene locus_tag LOCUS_10990 gene leuB 59184 60164 CDS product bifunctional 3-isopropylmalate/3-methylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870225.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence40 360 1445 gene locus_tag LOCUS_11000 360 1445 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_11000 2309 1485 gene locus_tag LOCUS_11010 2309 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3160 2387 gene locus_tag LOCUS_11020 gene dph5 3160 2387 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289280.1 protein_id gnl|my_center|LOCUS_11020 3620 3231 gene locus_tag LOCUS_11030 3620 3231 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_11030 4169 3702 gene locus_tag LOCUS_11040 4169 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5172 4264 gene locus_tag LOCUS_11050 5172 4264 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903715.1 protein_id gnl|my_center|LOCUS_11050 6347 5169 gene locus_tag LOCUS_11060 6347 5169 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903914.1 protein_id gnl|my_center|LOCUS_11060 7537 6344 gene locus_tag LOCUS_11070 7537 6344 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903258.1 protein_id gnl|my_center|LOCUS_11070 8887 7757 gene locus_tag LOCUS_11080 8887 7757 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903913.1 protein_id gnl|my_center|LOCUS_11080 9397 10389 gene locus_tag LOCUS_11090 9397 10389 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902803.1 protein_id gnl|my_center|LOCUS_11090 10499 10572 gene locus_tag LOCUS_t00120 10499 10572 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11834 11541 gene locus_tag LOCUS_11100 11834 11541 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_11100 13228 12191 gene locus_tag LOCUS_11110 13228 12191 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115864200.1 protein_id gnl|my_center|LOCUS_11110 13584 13225 gene locus_tag LOCUS_11120 gene trxA 13584 13225 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890427.1 protein_id gnl|my_center|LOCUS_11120 14115 14498 gene locus_tag LOCUS_11130 14115 14498 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 protein_id gnl|my_center|LOCUS_11130 14990 14565 gene locus_tag LOCUS_11140 14990 14565 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_11140 16269 15121 gene locus_tag LOCUS_11150 16269 15121 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_11150 16584 16874 gene locus_tag LOCUS_11160 16584 16874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 17018 17467 gene locus_tag LOCUS_11170 17018 17467 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903180.1 protein_id gnl|my_center|LOCUS_11170 17867 17712 gene locus_tag LOCUS_11180 17867 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 18128 18772 gene locus_tag LOCUS_11190 18128 18772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 19228 18788 gene locus_tag LOCUS_11200 19228 18788 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_11200 19811 19392 gene locus_tag LOCUS_11210 19811 19392 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_11210 20288 19878 gene locus_tag LOCUS_11220 20288 19878 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289521.1 protein_id gnl|my_center|LOCUS_11220 20484 21365 gene locus_tag LOCUS_11230 20484 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 21965 21408 gene locus_tag LOCUS_11240 21965 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903725.1 protein_id gnl|my_center|LOCUS_11240 22128 23048 gene locus_tag LOCUS_11250 22128 23048 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061282.1 protein_id gnl|my_center|LOCUS_11250 23153 23578 gene locus_tag LOCUS_11260 23153 23578 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_11260 23765 24214 gene locus_tag LOCUS_11270 23765 24214 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_11270 24903 24307 gene locus_tag LOCUS_11280 24903 24307 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878134.1 protein_id gnl|my_center|LOCUS_11280 25193 24900 gene locus_tag LOCUS_11290 25193 24900 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_11290 25482 25964 gene locus_tag LOCUS_11300 25482 25964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 28688 26103 gene locus_tag LOCUS_11310 28688 26103 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 protein_id gnl|my_center|LOCUS_11310 28842 29915 gene locus_tag LOCUS_11320 28842 29915 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902333.1 protein_id gnl|my_center|LOCUS_11320 30061 31620 gene locus_tag LOCUS_11330 30061 31620 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_11330 32916 31657 gene locus_tag LOCUS_11340 32916 31657 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525270.1 protein_id gnl|my_center|LOCUS_11340 33159 33458 gene locus_tag LOCUS_11350 33159 33458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 34378 33470 gene locus_tag LOCUS_11360 34378 33470 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_11360 35363 34863 gene locus_tag LOCUS_11370 35363 34863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 36036 35356 gene locus_tag LOCUS_11380 36036 35356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 36520 36296 gene locus_tag LOCUS_11390 36520 36296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 36861 37121 gene locus_tag LOCUS_11400 36861 37121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 37291 37731 gene locus_tag LOCUS_11410 37291 37731 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902059.1 protein_id gnl|my_center|LOCUS_11410 37734 38294 gene locus_tag LOCUS_11420 37734 38294 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880943.1 protein_id gnl|my_center|LOCUS_11420 38584 38327 gene locus_tag LOCUS_11430 38584 38327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 39120 40148 gene locus_tag LOCUS_11440 39120 40148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 40145 40516 gene locus_tag LOCUS_11450 40145 40516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 41205 40903 gene locus_tag LOCUS_11460 41205 40903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 41398 42183 gene locus_tag LOCUS_11470 41398 42183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 42361 43257 gene locus_tag LOCUS_11480 42361 43257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 43693 43430 gene locus_tag LOCUS_11490 43693 43430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 43860 44072 gene locus_tag LOCUS_11500 43860 44072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11500 44883 44233 gene locus_tag LOCUS_11510 44883 44233 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624900.1 protein_id gnl|my_center|LOCUS_11510 45629 44880 gene locus_tag LOCUS_11520 45629 44880 CDS product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902790.1 protein_id gnl|my_center|LOCUS_11520 45697 46086 gene locus_tag LOCUS_11530 45697 46086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 46858 46463 gene locus_tag LOCUS_11540 46858 46463 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890426.1 protein_id gnl|my_center|LOCUS_11540 48016 46973 gene locus_tag LOCUS_11550 48016 46973 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890425.1 protein_id gnl|my_center|LOCUS_11550 48163 48017 gene locus_tag LOCUS_11560 48163 48017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 48524 49369 gene locus_tag LOCUS_11570 48524 49369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 50029 49763 gene locus_tag LOCUS_11580 50029 49763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 51030 50029 gene locus_tag LOCUS_11590 51030 50029 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890413.1 protein_id gnl|my_center|LOCUS_11590 52444 51023 gene locus_tag LOCUS_11600 52444 51023 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890412.1 protein_id gnl|my_center|LOCUS_11600 53810 52638 gene locus_tag LOCUS_11610 53810 52638 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890420.1 protein_id gnl|my_center|LOCUS_11610 54313 53855 gene locus_tag LOCUS_11620 54313 53855 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890418.1 protein_id gnl|my_center|LOCUS_11620 54870 54313 gene locus_tag LOCUS_11630 54870 54313 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890417.1 protein_id gnl|my_center|LOCUS_11630 56070 54877 gene locus_tag LOCUS_11640 56070 54877 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_11640 56313 56561 gene locus_tag LOCUS_11650 56313 56561 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890415.1 protein_id gnl|my_center|LOCUS_11650 56558 57136 gene locus_tag LOCUS_11660 56558 57136 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890414.1 protein_id gnl|my_center|LOCUS_11660 57365 58774 gene locus_tag LOCUS_11670 gene putP 57365 58774 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206579.1 protein_id gnl|my_center|LOCUS_11670 59448 60524 gene locus_tag LOCUS_11680 59448 60524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 60567 61253 gene locus_tag LOCUS_11690 60567 61253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_11690 62536 61289 gene locus_tag LOCUS_11700 62536 61289 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903232.1 protein_id gnl|my_center|LOCUS_11700 63606 62542 gene locus_tag LOCUS_11710 63606 62542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 65130 63787 gene locus_tag LOCUS_11720 65130 63787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 65559 67097 gene locus_tag LOCUS_11730 65559 67097 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065068.1 protein_id gnl|my_center|LOCUS_11730 67105 68055 gene locus_tag LOCUS_11740 67105 68055 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 protein_id gnl|my_center|LOCUS_11740 68052 68960 gene locus_tag LOCUS_11750 68052 68960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524048.1 protein_id gnl|my_center|LOCUS_11750 68969 71074 gene locus_tag LOCUS_11760 68969 71074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730244.1 protein_id gnl|my_center|LOCUS_11760 71257 72084 gene locus_tag LOCUS_11770 71257 72084 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289197.1 protein_id gnl|my_center|LOCUS_11770 72630 72115 gene locus_tag LOCUS_11780 72630 72115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 74197 72566 gene locus_tag LOCUS_11790 74197 72566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 74305 75027 gene locus_tag LOCUS_11800 74305 75027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 75523 75059 gene locus_tag LOCUS_11810 75523 75059 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902425.1 protein_id gnl|my_center|LOCUS_11810 77306 75552 gene locus_tag LOCUS_11820 77306 75552 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049952164.1 protein_id gnl|my_center|LOCUS_11820 79084 77312 gene locus_tag LOCUS_11830 79084 77312 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903116.1 protein_id gnl|my_center|LOCUS_11830 80223 79087 gene locus_tag LOCUS_11840 80223 79087 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878464.1 protein_id gnl|my_center|LOCUS_11840 81990 80308 gene locus_tag LOCUS_11850 gene acsA 81990 80308 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862052.1 protein_id gnl|my_center|LOCUS_11850 83576 82182 gene locus_tag LOCUS_11860 83576 82182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 85078 83573 gene locus_tag LOCUS_11870 85078 83573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 85650 85075 gene locus_tag LOCUS_11880 85650 85075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 87037 87789 gene locus_tag LOCUS_11890 87037 87789 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223802.1 protein_id gnl|my_center|LOCUS_11890 88803 88015 gene locus_tag LOCUS_11900 88803 88015 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_11900 90436 88880 gene locus_tag LOCUS_11910 90436 88880 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904147.1 protein_id gnl|my_center|LOCUS_11910 90662 91786 gene locus_tag LOCUS_11920 90662 91786 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903082.1 protein_id gnl|my_center|LOCUS_11920 92652 91789 gene locus_tag LOCUS_11930 92652 91789 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902470.1 protein_id gnl|my_center|LOCUS_11930 94526 92892 gene locus_tag LOCUS_11940 94526 92892 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817768.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence41 <1 1500 gene locus_tag LOCUS_11950 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289204.1:methylmalonyl-CoA mutase family protein 3291 1984 gene locus_tag LOCUS_11960 3291 1984 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_11960 3507 4379 gene locus_tag LOCUS_11970 3507 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4919 4599 gene locus_tag LOCUS_11980 4919 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5707 5069 gene locus_tag LOCUS_11990 5707 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5792 6730 gene locus_tag LOCUS_12000 gene paaG 5792 6730 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889012.1 protein_id gnl|my_center|LOCUS_12000 6735 7079 gene locus_tag LOCUS_12010 6735 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 7076 7912 gene locus_tag LOCUS_12020 gene paaC 7076 7912 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228337.1 protein_id gnl|my_center|LOCUS_12020 7915 8325 gene locus_tag LOCUS_12030 7915 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 8958 8497 gene locus_tag LOCUS_12040 8958 8497 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879802.1 protein_id gnl|my_center|LOCUS_12040 9489 10202 gene locus_tag LOCUS_12050 9489 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 13406 12852 gene locus_tag LOCUS_12060 13406 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 14287 13499 gene locus_tag LOCUS_12070 14287 13499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_12070 15120 14278 gene locus_tag LOCUS_12080 15120 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 16145 15117 gene locus_tag LOCUS_12090 16145 15117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 16547 16278 gene locus_tag LOCUS_12100 16547 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12100 17016 17501 gene locus_tag LOCUS_12110 17016 17501 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902612.1 protein_id gnl|my_center|LOCUS_12110 18212 20650 gene locus_tag LOCUS_12120 18212 20650 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903780.1 protein_id gnl|my_center|LOCUS_12120 20686 21678 gene locus_tag LOCUS_12130 20686 21678 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903779.1 protein_id gnl|my_center|LOCUS_12130 22321 22803 gene locus_tag LOCUS_12140 22321 22803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 23455 24267 gene locus_tag LOCUS_12150 23455 24267 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_12150 25647 24358 gene locus_tag LOCUS_12160 gene gdhB 25647 24358 CDS product glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902074.1 protein_id gnl|my_center|LOCUS_12160 27077 25767 gene locus_tag LOCUS_12170 27077 25767 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903110.1 protein_id gnl|my_center|LOCUS_12170 28560 30026 gene locus_tag LOCUS_12180 gene arcD 28560 30026 CDS product arginine/ornithine antiporter ArcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904158.1 protein_id gnl|my_center|LOCUS_12180 31867 30548 gene locus_tag LOCUS_12190 31867 30548 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903110.1 protein_id gnl|my_center|LOCUS_12190 32990 32037 gene locus_tag LOCUS_12200 gene rocF 32990 32037 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258791.1 protein_id gnl|my_center|LOCUS_12200 33011 33373 gene locus_tag LOCUS_12210 33011 33373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 34333 33533 gene locus_tag LOCUS_12220 34333 33533 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_12220 36008 34476 gene locus_tag LOCUS_12230 36008 34476 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 protein_id gnl|my_center|LOCUS_12230 36501 38183 gene locus_tag LOCUS_12240 36501 38183 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903459.1 protein_id gnl|my_center|LOCUS_12240 38377 40023 gene locus_tag LOCUS_12250 38377 40023 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_12250 41491 40979 gene locus_tag LOCUS_12260 41491 40979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902640.1 protein_id gnl|my_center|LOCUS_12260 43180 41492 gene locus_tag LOCUS_12270 43180 41492 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209000319.1 protein_id gnl|my_center|LOCUS_12270 43313 43170 gene locus_tag LOCUS_12280 43313 43170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 44342 43503 gene locus_tag LOCUS_12290 44342 43503 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903562.1 protein_id gnl|my_center|LOCUS_12290 45149 44412 gene locus_tag LOCUS_12300 45149 44412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 45430 45146 gene locus_tag LOCUS_12310 45430 45146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 45796 46575 gene locus_tag LOCUS_12320 gene allR 45796 46575 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_12320 47518 47994 gene locus_tag LOCUS_12330 47518 47994 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902978.1 protein_id gnl|my_center|LOCUS_12330 48944 48240 gene locus_tag LOCUS_12340 48944 48240 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289483.1 protein_id gnl|my_center|LOCUS_12340 49719 49015 gene locus_tag LOCUS_12350 49719 49015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903729.1 protein_id gnl|my_center|LOCUS_12350 50329 49745 gene locus_tag LOCUS_12360 50329 49745 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903728.1 protein_id gnl|my_center|LOCUS_12360 50758 55182 gene locus_tag LOCUS_12370 50758 55182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 55585 55295 gene locus_tag LOCUS_12380 55585 55295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902911.1 protein_id gnl|my_center|LOCUS_12380 55711 55854 gene locus_tag LOCUS_12390 55711 55854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 56372 55908 gene locus_tag LOCUS_12400 56372 55908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 56545 57021 gene locus_tag LOCUS_12410 56545 57021 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_12410 57576 57094 gene locus_tag LOCUS_12420 57576 57094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903888.1 protein_id gnl|my_center|LOCUS_12420 57658 60648 gene locus_tag LOCUS_12430 57658 60648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 60898 62499 gene locus_tag LOCUS_12440 60898 62499 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289523.1 protein_id gnl|my_center|LOCUS_12440 62552 63565 gene locus_tag LOCUS_12450 62552 63565 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903891.1 protein_id gnl|my_center|LOCUS_12450 63562 64479 gene locus_tag LOCUS_12460 63562 64479 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903892.1 protein_id gnl|my_center|LOCUS_12460 64466 64846 gene locus_tag LOCUS_12470 64466 64846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 65822 64884 gene locus_tag LOCUS_12480 65822 64884 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289348.1 protein_id gnl|my_center|LOCUS_12480 66991 65996 gene locus_tag LOCUS_12490 66991 65996 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903660.1 protein_id gnl|my_center|LOCUS_12490 67435 67268 gene locus_tag LOCUS_12500 67435 67268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 68420 67641 gene locus_tag LOCUS_12510 68420 67641 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902141.1 protein_id gnl|my_center|LOCUS_12510 69388 68561 gene locus_tag LOCUS_12520 69388 68561 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902142.1 protein_id gnl|my_center|LOCUS_12520 70983 69679 gene locus_tag LOCUS_12530 gene aspS 70983 69679 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_12530 71146 71940 gene locus_tag LOCUS_12540 gene cobB 71146 71940 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 protein_id gnl|my_center|LOCUS_12540 72612 71962 gene locus_tag LOCUS_12550 72612 71962 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_12550 73392 72691 gene locus_tag LOCUS_12560 73392 72691 CDS product putative phosphoglycerol geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902143.1 protein_id gnl|my_center|LOCUS_12560 75112 73922 gene locus_tag LOCUS_12570 75112 73922 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902360.1 protein_id gnl|my_center|LOCUS_12570 75663 75436 gene locus_tag LOCUS_12580 75663 75436 CDS product small nuclear ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289341.1 protein_id gnl|my_center|LOCUS_12580 76002 76373 gene locus_tag LOCUS_12590 76002 76373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 76457 77413 gene locus_tag LOCUS_12600 76457 77413 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903094.1 protein_id gnl|my_center|LOCUS_12600 77726 77505 gene locus_tag LOCUS_12610 77726 77505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 78130 77723 gene locus_tag LOCUS_12620 78130 77723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 78839 78231 gene locus_tag LOCUS_12630 78839 78231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289342.1 protein_id gnl|my_center|LOCUS_12630 78929 79183 gene locus_tag LOCUS_12640 78929 79183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 79752 79180 gene locus_tag LOCUS_12650 79752 79180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076580729.1 protein_id gnl|my_center|LOCUS_12650 80004 82724 gene locus_tag LOCUS_12660 80004 82724 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289343.1 protein_id gnl|my_center|LOCUS_12660 82810 82944 gene locus_tag LOCUS_12670 82810 82944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 83126 82929 gene locus_tag LOCUS_12680 83126 82929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 84295 83249 gene locus_tag LOCUS_12690 84295 83249 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_12690 85188 84502 gene locus_tag LOCUS_12700 85188 84502 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_12700 85313 86107 gene locus_tag LOCUS_12710 85313 86107 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_12710 87164 86163 gene locus_tag LOCUS_12720 87164 86163 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_12720 87338 88495 gene locus_tag LOCUS_12730 87338 88495 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289129.1 protein_id gnl|my_center|LOCUS_12730 89377 88601 gene locus_tag LOCUS_12740 89377 88601 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_12740 89488 89742 gene locus_tag LOCUS_12750 89488 89742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 89739 90467 gene locus_tag LOCUS_12760 89739 90467 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249013.1 protein_id gnl|my_center|LOCUS_12760 90662 91723 gene locus_tag LOCUS_12770 90662 91723 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_12770 92237 93304 gene locus_tag LOCUS_12780 92237 93304 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403481.1 protein_id gnl|my_center|LOCUS_12780 93270 93674 gene locus_tag LOCUS_12790 93270 93674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12790 >Feature sequence42 51 269 gene locus_tag LOCUS_12800 51 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 418 2370 gene locus_tag LOCUS_12810 418 2370 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902952.1 protein_id gnl|my_center|LOCUS_12810 3304 2780 gene locus_tag LOCUS_12820 3304 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4188 3334 gene locus_tag LOCUS_12830 4188 3334 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_12830 7236 4456 gene locus_tag LOCUS_12840 7236 4456 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_12840 7401 8558 gene locus_tag LOCUS_12850 7401 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 9635 9132 gene locus_tag LOCUS_12860 9635 9132 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904243.1 protein_id gnl|my_center|LOCUS_12860 10123 9638 gene locus_tag LOCUS_12870 10123 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 10780 10708 gene locus_tag LOCUS_t00130 10780 10708 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11777 10869 gene locus_tag LOCUS_12880 11777 10869 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289369.1 protein_id gnl|my_center|LOCUS_12880 12352 11777 gene locus_tag LOCUS_12890 12352 11777 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_12890 13417 12467 gene locus_tag LOCUS_12900 13417 12467 CDS product EMC3/TMCO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903262.1 protein_id gnl|my_center|LOCUS_12900 13790 15322 gene locus_tag LOCUS_12910 13790 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 15963 15328 gene locus_tag LOCUS_12920 15963 15328 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903261.1 protein_id gnl|my_center|LOCUS_12920 16023 16472 gene locus_tag LOCUS_12930 16023 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903260.1 protein_id gnl|my_center|LOCUS_12930 16891 17886 gene locus_tag LOCUS_12940 16891 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 17886 20375 gene locus_tag LOCUS_12950 17886 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 22423 20783 gene locus_tag LOCUS_12960 22423 20783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 22837 22550 gene locus_tag LOCUS_12970 22837 22550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 24334 22904 gene locus_tag LOCUS_12980 24334 22904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902642.1 protein_id gnl|my_center|LOCUS_12980 24417 24683 gene locus_tag LOCUS_12990 24417 24683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 25081 25284 gene locus_tag LOCUS_13000 25081 25284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 25248 25427 gene locus_tag LOCUS_13010 25248 25427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 25927 26544 gene locus_tag LOCUS_13020 25927 26544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 27151 26975 gene locus_tag LOCUS_13030 27151 26975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 27186 27488 gene locus_tag LOCUS_13040 27186 27488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 29495 28023 gene locus_tag LOCUS_13050 gene secY 29495 28023 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903257.1 protein_id gnl|my_center|LOCUS_13050 29987 29499 gene locus_tag LOCUS_13060 29987 29499 CDS product uL15m family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903256.1 protein_id gnl|my_center|LOCUS_13060 30457 29990 gene locus_tag LOCUS_13070 30457 29990 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117363797.1 protein_id gnl|my_center|LOCUS_13070 31113 30454 gene locus_tag LOCUS_13080 31113 30454 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903254.1 protein_id gnl|my_center|LOCUS_13080 31658 31110 gene locus_tag LOCUS_13090 31658 31110 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903253.1 protein_id gnl|my_center|LOCUS_13090 32107 31658 gene locus_tag LOCUS_13100 32107 31658 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903252.1 protein_id gnl|my_center|LOCUS_13100 32825 32100 gene locus_tag LOCUS_13110 32825 32100 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903251.1 protein_id gnl|my_center|LOCUS_13110 33362 32829 gene locus_tag LOCUS_13120 33362 32829 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903250.1 protein_id gnl|my_center|LOCUS_13120 33757 33365 gene locus_tag LOCUS_13130 33757 33365 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903249.1 protein_id gnl|my_center|LOCUS_13130 33944 33759 gene locus_tag LOCUS_13140 33944 33759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 34473 33937 gene locus_tag LOCUS_13150 34473 33937 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903247.1 protein_id gnl|my_center|LOCUS_13150 35164 34466 gene locus_tag LOCUS_13160 35164 34466 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903246.1 protein_id gnl|my_center|LOCUS_13160 35517 35161 gene locus_tag LOCUS_13170 gene rplX 35517 35161 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903245.1 protein_id gnl|my_center|LOCUS_13170 35918 35520 gene locus_tag LOCUS_13180 35918 35520 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903244.1 protein_id gnl|my_center|LOCUS_13180 36355 35918 gene locus_tag LOCUS_13190 36355 35918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 36864 36346 gene locus_tag LOCUS_13200 36864 36346 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903242.1 protein_id gnl|my_center|LOCUS_13200 37110 36880 gene locus_tag LOCUS_13210 gene rpmC 37110 36880 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903241.1 protein_id gnl|my_center|LOCUS_13210 38048 37110 gene locus_tag LOCUS_13220 38048 37110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 38527 38048 gene locus_tag LOCUS_13230 38527 38048 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903239.1 protein_id gnl|my_center|LOCUS_13230 38957 38535 gene locus_tag LOCUS_13240 38957 38535 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903238.1 protein_id gnl|my_center|LOCUS_13240 39676 38954 gene locus_tag LOCUS_13250 39676 38954 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903237.1 protein_id gnl|my_center|LOCUS_13250 39933 39679 gene locus_tag LOCUS_13260 39933 39679 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903236.1 protein_id gnl|my_center|LOCUS_13260 40682 39930 gene locus_tag LOCUS_13270 gene rpl4p 40682 39930 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903235.1 protein_id gnl|my_center|LOCUS_13270 41705 40686 gene locus_tag LOCUS_13280 41705 40686 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903234.1 protein_id gnl|my_center|LOCUS_13280 42615 41710 gene locus_tag LOCUS_13290 42615 41710 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903233.1 protein_id gnl|my_center|LOCUS_13290 42917 42988 gene locus_tag LOCUS_t00140 42917 42988 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 43412 43483 gene locus_tag LOCUS_t00150 43412 43483 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 44009 43575 gene locus_tag LOCUS_13300 44009 43575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 44121 44294 gene locus_tag LOCUS_13310 44121 44294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 44443 44796 gene locus_tag LOCUS_13320 44443 44796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 44957 45271 gene locus_tag LOCUS_13330 44957 45271 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903375.1 protein_id gnl|my_center|LOCUS_13330 45459 46391 gene locus_tag LOCUS_13340 gene mch 45459 46391 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903231.1 protein_id gnl|my_center|LOCUS_13340 46394 46927 gene locus_tag LOCUS_13350 46394 46927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 47411 47016 gene locus_tag LOCUS_13360 47411 47016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 48319 47771 gene locus_tag LOCUS_13370 48319 47771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 50007 48670 gene locus_tag LOCUS_13380 50007 48670 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_13380 50831 50004 gene locus_tag LOCUS_13390 50831 50004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 51600 50824 gene locus_tag LOCUS_13400 gene proC 51600 50824 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_13400 52485 51790 gene locus_tag LOCUS_13410 52485 51790 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289174.1 protein_id gnl|my_center|LOCUS_13410 54272 52671 gene locus_tag LOCUS_13420 54272 52671 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903224.1 protein_id gnl|my_center|LOCUS_13420 54459 54647 gene locus_tag LOCUS_13430 54459 54647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 54677 54976 gene locus_tag LOCUS_13440 54677 54976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 55945 55145 gene locus_tag LOCUS_13450 gene pyrF 55945 55145 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903220.1 protein_id gnl|my_center|LOCUS_13450 56522 56103 gene locus_tag LOCUS_13460 56522 56103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 57472 56672 gene locus_tag LOCUS_13470 57472 56672 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902591.1 protein_id gnl|my_center|LOCUS_13470 57622 57990 gene locus_tag LOCUS_13480 gene mgsA 57622 57990 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 protein_id gnl|my_center|LOCUS_13480 58093 58752 gene locus_tag LOCUS_13490 58093 58752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 59194 58802 gene locus_tag LOCUS_13500 59194 58802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903219.1 protein_id gnl|my_center|LOCUS_13500 59676 59218 gene locus_tag LOCUS_13510 59676 59218 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903218.1 protein_id gnl|my_center|LOCUS_13510 60394 59753 gene locus_tag LOCUS_13520 60394 59753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903184.1 protein_id gnl|my_center|LOCUS_13520 60670 61035 gene locus_tag LOCUS_13530 60670 61035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 62519 61212 gene locus_tag LOCUS_13540 62519 61212 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903232.1 protein_id gnl|my_center|LOCUS_13540 62798 63724 gene locus_tag LOCUS_13550 62798 63724 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289364.1 protein_id gnl|my_center|LOCUS_13550 64056 63784 gene locus_tag LOCUS_13560 64056 63784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 64401 64261 gene locus_tag LOCUS_13570 64401 64261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 64646 64398 gene locus_tag LOCUS_13580 64646 64398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 65781 65011 gene locus_tag LOCUS_13590 65781 65011 CDS product protein sorting system archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289470.1 protein_id gnl|my_center|LOCUS_13590 66027 67250 gene locus_tag LOCUS_13600 66027 67250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 70257 67417 gene locus_tag LOCUS_13610 70257 67417 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902906.1 protein_id gnl|my_center|LOCUS_13610 70912 70364 gene locus_tag LOCUS_13620 70912 70364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 72228 70999 gene locus_tag LOCUS_13630 72228 70999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 73529 72228 gene locus_tag LOCUS_13640 73529 72228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 74196 73501 gene locus_tag LOCUS_13650 74196 73501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_13650 74900 74604 gene locus_tag LOCUS_13660 74900 74604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 75182 74904 gene locus_tag LOCUS_13670 75182 74904 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_13670 75274 75498 gene locus_tag LOCUS_13680 75274 75498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 76412 75381 gene locus_tag LOCUS_13690 76412 75381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 78588 78445 gene locus_tag LOCUS_13700 78588 78445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 79066 78590 gene locus_tag LOCUS_13710 79066 78590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence43 605 438 gene locus_tag LOCUS_13720 605 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 948 874 gene locus_tag LOCUS_t00160 948 874 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1076 1690 gene locus_tag LOCUS_13730 1076 1690 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289117.1 protein_id gnl|my_center|LOCUS_13730 1886 2065 gene locus_tag LOCUS_13740 1886 2065 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902100.1 protein_id gnl|my_center|LOCUS_13740 2068 3255 gene locus_tag LOCUS_13750 gene ftsZ 2068 3255 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289116.1 protein_id gnl|my_center|LOCUS_13750 4525 3566 gene locus_tag LOCUS_13760 4525 3566 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902098.1 protein_id gnl|my_center|LOCUS_13760 5397 4678 gene locus_tag LOCUS_13770 5397 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902323.1 protein_id gnl|my_center|LOCUS_13770 5575 6273 gene locus_tag LOCUS_13780 5575 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289115.1 protein_id gnl|my_center|LOCUS_13780 7116 6328 gene locus_tag LOCUS_13790 7116 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 8077 7109 gene locus_tag LOCUS_13800 8077 7109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_13800 8837 8187 gene locus_tag LOCUS_13810 8837 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 9397 10008 gene locus_tag LOCUS_13820 9397 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 10015 10581 gene locus_tag LOCUS_13830 10015 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 10619 11443 gene locus_tag LOCUS_13840 10619 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 11440 11886 gene locus_tag LOCUS_13850 11440 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 12732 11935 gene locus_tag LOCUS_13860 12732 11935 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289114.1 protein_id gnl|my_center|LOCUS_13860 13738 12854 gene locus_tag LOCUS_13870 13738 12854 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902092.1 protein_id gnl|my_center|LOCUS_13870 13737 13925 gene locus_tag LOCUS_13880 13737 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 13935 14624 gene locus_tag LOCUS_13890 13935 14624 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902025.1 protein_id gnl|my_center|LOCUS_13890 15492 14656 gene locus_tag LOCUS_13900 15492 14656 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902091.1 protein_id gnl|my_center|LOCUS_13900 15960 16346 gene locus_tag LOCUS_13910 15960 16346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 16478 17386 gene locus_tag LOCUS_13920 16478 17386 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902089.1 protein_id gnl|my_center|LOCUS_13920 20567 19332 gene locus_tag LOCUS_13930 20567 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 21785 20577 gene locus_tag LOCUS_13940 21785 20577 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903232.1 protein_id gnl|my_center|LOCUS_13940 21948 22097 gene locus_tag LOCUS_13950 21948 22097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 23504 22398 gene locus_tag LOCUS_13960 23504 22398 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903913.1 protein_id gnl|my_center|LOCUS_13960 24530 23511 gene locus_tag LOCUS_13970 24530 23511 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903914.1 protein_id gnl|my_center|LOCUS_13970 24421 24720 gene locus_tag LOCUS_13980 24421 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 25711 24830 gene locus_tag LOCUS_13990 25711 24830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903915.1 protein_id gnl|my_center|LOCUS_13990 26012 25800 gene locus_tag LOCUS_14000 26012 25800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 25914 26360 gene locus_tag LOCUS_14010 25914 26360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 26586 27176 gene locus_tag LOCUS_14020 26586 27176 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902087.1 protein_id gnl|my_center|LOCUS_14020 27325 27759 gene locus_tag LOCUS_14030 27325 27759 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_14030 28286 27840 gene locus_tag LOCUS_14040 gene mamA 28286 27840 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903701.1 protein_id gnl|my_center|LOCUS_14040 29188 28478 gene locus_tag LOCUS_14050 29188 28478 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903559.1 protein_id gnl|my_center|LOCUS_14050 29670 30107 gene locus_tag LOCUS_14060 29670 30107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 32111 30165 gene locus_tag LOCUS_14070 gene thrS 32111 30165 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289388.1 protein_id gnl|my_center|LOCUS_14070 32787 33269 gene locus_tag LOCUS_14080 32787 33269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 33363 33536 gene locus_tag LOCUS_14090 33363 33536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 34095 33571 gene locus_tag LOCUS_14100 gene pyrE 34095 33571 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_14100 34258 35217 gene locus_tag LOCUS_14110 34258 35217 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_14110 35686 35477 gene locus_tag LOCUS_14120 35686 35477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 36573 36028 gene locus_tag LOCUS_14130 36573 36028 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289436.1 protein_id gnl|my_center|LOCUS_14130 36749 38056 gene locus_tag LOCUS_14140 gene gdhB 36749 38056 CDS product glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902074.1 protein_id gnl|my_center|LOCUS_14140 38136 38828 gene locus_tag LOCUS_14150 38136 38828 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903563.1 protein_id gnl|my_center|LOCUS_14150 39271 39498 gene locus_tag LOCUS_14160 39271 39498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 39596 40228 gene locus_tag LOCUS_14170 39596 40228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 40261 40698 gene locus_tag LOCUS_14180 40261 40698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 40938 41897 gene locus_tag LOCUS_14190 40938 41897 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903551.1 protein_id gnl|my_center|LOCUS_14190 41899 43053 gene locus_tag LOCUS_14200 41899 43053 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_14200 43213 43887 gene locus_tag LOCUS_14210 gene udk 43213 43887 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289294.1 protein_id gnl|my_center|LOCUS_14210 43963 45741 gene locus_tag LOCUS_14220 gene argS 43963 45741 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_14220 46351 45806 gene locus_tag LOCUS_14230 46351 45806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 47555 46650 gene locus_tag LOCUS_14240 47555 46650 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903571.1 protein_id gnl|my_center|LOCUS_14240 47736 48995 gene locus_tag LOCUS_14250 gene prf1 47736 48995 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289438.1 protein_id gnl|my_center|LOCUS_14250 50175 49084 gene locus_tag LOCUS_14260 50175 49084 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922099.1 protein_id gnl|my_center|LOCUS_14260 50297 51223 gene locus_tag LOCUS_14270 50297 51223 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902523.1 protein_id gnl|my_center|LOCUS_14270 51429 52526 gene locus_tag LOCUS_14280 51429 52526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 52541 53722 gene locus_tag LOCUS_14290 52541 53722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289248.1 protein_id gnl|my_center|LOCUS_14290 53762 54922 gene locus_tag LOCUS_14300 53762 54922 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902651.1 protein_id gnl|my_center|LOCUS_14300 54919 56532 gene locus_tag LOCUS_14310 54919 56532 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_14310 56529 58589 gene locus_tag LOCUS_14320 56529 58589 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902648.1 protein_id gnl|my_center|LOCUS_14320 59423 58668 gene locus_tag LOCUS_14330 59423 58668 CDS product dolichyl-phosphate hexose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902647.1 protein_id gnl|my_center|LOCUS_14330 61244 59595 gene locus_tag LOCUS_14340 61244 59595 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902740.1 protein_id gnl|my_center|LOCUS_14340 61759 61241 gene locus_tag LOCUS_14350 61759 61241 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902741.1 protein_id gnl|my_center|LOCUS_14350 62510 61809 gene locus_tag LOCUS_14360 62510 61809 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902474.1 protein_id gnl|my_center|LOCUS_14360 63078 62998 gene locus_tag LOCUS_t00170 63078 62998 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 63369 63106 gene locus_tag LOCUS_14370 63369 63106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 63763 63377 gene locus_tag LOCUS_14380 63763 63377 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903545.1 protein_id gnl|my_center|LOCUS_14380 65065 63854 gene locus_tag LOCUS_14390 gene ilvA 65065 63854 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903546.1 protein_id gnl|my_center|LOCUS_14390 64985 65239 gene locus_tag LOCUS_14400 64985 65239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 66645 65497 gene locus_tag LOCUS_14410 gene citZ 66645 65497 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_14410 67791 67132 gene locus_tag LOCUS_14420 67791 67132 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903087.1 protein_id gnl|my_center|LOCUS_14420 68514 68152 gene locus_tag LOCUS_14430 gene sepF 68514 68152 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903980.1 protein_id gnl|my_center|LOCUS_14430 68703 69467 gene locus_tag LOCUS_14440 68703 69467 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903981.1 protein_id gnl|my_center|LOCUS_14440 69926 69477 gene locus_tag LOCUS_14450 69926 69477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 70582 70103 gene locus_tag LOCUS_14460 70582 70103 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903982.1 protein_id gnl|my_center|LOCUS_14460 70720 71016 gene locus_tag LOCUS_14470 70720 71016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903983.1 protein_id gnl|my_center|LOCUS_14470 71811 71020 gene locus_tag LOCUS_14480 71811 71020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903774.1 protein_id gnl|my_center|LOCUS_14480 72716 71808 gene locus_tag LOCUS_14490 72716 71808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_14490 72858 74156 gene locus_tag LOCUS_14500 72858 74156 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903984.1 protein_id gnl|my_center|LOCUS_14500 74636 74349 gene locus_tag LOCUS_14510 74636 74349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 75320 74778 gene locus_tag LOCUS_14520 75320 74778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence44 1886 825 gene locus_tag LOCUS_14530 gene rtcA 1886 825 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289214.1 protein_id gnl|my_center|LOCUS_14530 4199 1983 gene locus_tag LOCUS_14540 gene mutL 4199 1983 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902072.1 protein_id gnl|my_center|LOCUS_14540 5105 4305 gene locus_tag LOCUS_14550 5105 4305 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_14550 5361 5555 gene locus_tag LOCUS_14560 5361 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 8601 5908 gene locus_tag LOCUS_14570 gene mutS 8601 5908 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902076.1 protein_id gnl|my_center|LOCUS_14570 9587 8865 gene locus_tag LOCUS_14580 9587 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 10007 9663 gene locus_tag LOCUS_14590 10007 9663 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724123.1 protein_id gnl|my_center|LOCUS_14590 10280 10035 gene locus_tag LOCUS_14600 10280 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 11135 10323 gene locus_tag LOCUS_14610 11135 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 12220 11132 gene locus_tag LOCUS_14620 12220 11132 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_14620 12382 13134 gene locus_tag LOCUS_14630 12382 13134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 13957 13208 gene locus_tag LOCUS_14640 13957 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 15375 13954 gene locus_tag LOCUS_14650 15375 13954 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404986.1 protein_id gnl|my_center|LOCUS_14650 16466 15471 gene locus_tag LOCUS_14660 16466 15471 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113303.1 protein_id gnl|my_center|LOCUS_14660 17824 16463 gene locus_tag LOCUS_14670 gene thiD 17824 16463 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903947.1 protein_id gnl|my_center|LOCUS_14670 19005 17947 gene locus_tag LOCUS_14680 19005 17947 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289639.1 protein_id gnl|my_center|LOCUS_14680 19521 20666 gene locus_tag LOCUS_14690 19521 20666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 20666 20797 gene locus_tag LOCUS_14700 20666 20797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 20790 21269 gene locus_tag LOCUS_14710 20790 21269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289420.1 protein_id gnl|my_center|LOCUS_14710 21370 22500 gene locus_tag LOCUS_14720 21370 22500 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183240.1 protein_id gnl|my_center|LOCUS_14720 23074 22523 gene locus_tag LOCUS_14730 gene rdgB 23074 22523 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903503.1 protein_id gnl|my_center|LOCUS_14730 23181 23510 gene locus_tag LOCUS_14740 23181 23510 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061672.1 protein_id gnl|my_center|LOCUS_14740 24185 23535 gene locus_tag LOCUS_14750 24185 23535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 24269 25939 gene locus_tag LOCUS_14760 24269 25939 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_14760 26302 26018 gene locus_tag LOCUS_14770 26302 26018 CDS product DUF5808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903504.1 protein_id gnl|my_center|LOCUS_14770 28021 26390 gene locus_tag LOCUS_14780 28021 26390 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903505.1 protein_id gnl|my_center|LOCUS_14780 28227 28093 gene locus_tag LOCUS_14790 28227 28093 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903506.1 protein_id gnl|my_center|LOCUS_14790 28537 28229 gene locus_tag LOCUS_14800 28537 28229 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903507.1 protein_id gnl|my_center|LOCUS_14800 28752 29927 gene locus_tag LOCUS_14810 28752 29927 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158206491.1 protein_id gnl|my_center|LOCUS_14810 29930 30715 gene locus_tag LOCUS_14820 29930 30715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 31776 30730 gene locus_tag LOCUS_14830 31776 30730 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825317.1 protein_id gnl|my_center|LOCUS_14830 32989 31877 gene locus_tag LOCUS_14840 32989 31877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 33520 33206 gene locus_tag LOCUS_14850 33520 33206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 33894 33697 gene locus_tag LOCUS_14860 33894 33697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 34601 34251 gene locus_tag LOCUS_14870 34601 34251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 35001 35342 gene locus_tag LOCUS_14880 35001 35342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 35524 35354 gene locus_tag LOCUS_14890 35524 35354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 35961 35668 gene locus_tag LOCUS_14900 35961 35668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 36998 36606 gene locus_tag LOCUS_14910 36998 36606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 38029 38229 gene locus_tag LOCUS_14920 38029 38229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 40284 39313 gene locus_tag LOCUS_14930 40284 39313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 40876 41262 gene locus_tag LOCUS_14940 40876 41262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 41262 42017 gene locus_tag LOCUS_14950 41262 42017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 42022 43197 gene locus_tag LOCUS_14960 42022 43197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 43194 43781 gene locus_tag LOCUS_14970 43194 43781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 43778 44344 gene locus_tag LOCUS_14980 43778 44344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 44569 44751 gene locus_tag LOCUS_14990 44569 44751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 45480 44827 gene locus_tag LOCUS_15000 45480 44827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 45808 46083 gene locus_tag LOCUS_15010 45808 46083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 46084 46575 gene locus_tag LOCUS_15020 46084 46575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 46575 47312 gene locus_tag LOCUS_15030 46575 47312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 47319 47561 gene locus_tag LOCUS_15040 47319 47561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 47621 48412 gene locus_tag LOCUS_15050 47621 48412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 48414 48632 gene locus_tag LOCUS_15060 48414 48632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 48629 49105 gene locus_tag LOCUS_15070 48629 49105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 49102 50094 gene locus_tag LOCUS_15080 49102 50094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 50097 50792 gene locus_tag LOCUS_15090 50097 50792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 51139 50798 gene locus_tag LOCUS_15100 51139 50798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 51787 51326 gene locus_tag LOCUS_15110 51787 51326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 52340 51909 gene locus_tag LOCUS_15120 52340 51909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 52588 52517 gene locus_tag LOCUS_t00180 52588 52517 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 53384 52779 gene locus_tag LOCUS_15130 53384 52779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 54017 53709 gene locus_tag LOCUS_15140 gene rpsJ 54017 53709 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903985.1 protein_id gnl|my_center|LOCUS_15140 55280 54018 gene locus_tag LOCUS_15150 gene tuf 55280 54018 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903986.1 protein_id gnl|my_center|LOCUS_15150 62663 55791 gene locus_tag LOCUS_15160 62663 55791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 62956 67347 gene locus_tag LOCUS_15170 62956 67347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 67435 69405 gene locus_tag LOCUS_15180 67435 69405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 69380 69739 gene locus_tag LOCUS_15190 69380 69739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 70237 69755 gene locus_tag LOCUS_15200 70237 69755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 71492 70368 gene locus_tag LOCUS_15210 71492 70368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 72603 71893 gene locus_tag LOCUS_15220 72603 71893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 73006 72581 gene locus_tag LOCUS_15230 73006 72581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 73380 73024 gene locus_tag LOCUS_15240 73380 73024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 74775 73603 gene locus_tag LOCUS_15250 74775 73603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 74840 75181 gene locus_tag LOCUS_15260 74840 75181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 75463 75197 gene locus_tag LOCUS_15270 75463 75197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 75921 75553 gene locus_tag LOCUS_15280 75921 75553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 76047 76310 gene locus_tag LOCUS_15290 76047 76310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 76645 76328 gene locus_tag LOCUS_15300 76645 76328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 77635 76667 gene locus_tag LOCUS_15310 77635 76667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 78144 77632 gene locus_tag LOCUS_15320 78144 77632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 78385 81495 gene locus_tag LOCUS_15330 78385 81495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 82143 81622 gene locus_tag LOCUS_15340 82143 81622 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889480.1 protein_id gnl|my_center|LOCUS_15340 82502 82801 gene locus_tag LOCUS_15350 82502 82801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 83489 82866 gene locus_tag LOCUS_15360 83489 82866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 83668 83982 gene locus_tag LOCUS_15370 83668 83982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 84576 84172 gene locus_tag LOCUS_15380 84576 84172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 85684 84737 gene locus_tag LOCUS_15390 85684 84737 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903987.1 protein_id gnl|my_center|LOCUS_15390 86253 85684 gene locus_tag LOCUS_15400 86253 85684 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361009.1 protein_id gnl|my_center|LOCUS_15400 86772 86407 gene locus_tag LOCUS_15410 86772 86407 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903966.1 protein_id gnl|my_center|LOCUS_15410 88341 86833 gene locus_tag LOCUS_15420 88341 86833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 89369 88392 gene locus_tag LOCUS_15430 89369 88392 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903967.1 protein_id gnl|my_center|LOCUS_15430 89517 89951 gene locus_tag LOCUS_15440 89517 89951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 90472 90008 gene locus_tag LOCUS_15450 90472 90008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 91051 90596 gene locus_tag LOCUS_15460 91051 90596 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289215.1 protein_id gnl|my_center|LOCUS_15460 91166 91906 gene locus_tag LOCUS_15470 91166 91906 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903969.1 protein_id gnl|my_center|LOCUS_15470 91962 92654 gene locus_tag LOCUS_15480 91962 92654 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903274.1 protein_id gnl|my_center|LOCUS_15480 92869 93666 gene locus_tag LOCUS_15490 92869 93666 CDS product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902790.1 protein_id gnl|my_center|LOCUS_15490 93612 94262 gene locus_tag LOCUS_15500 93612 94262 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902791.1 protein_id gnl|my_center|LOCUS_15500 94360 94827 gene locus_tag LOCUS_15510 94360 94827 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903012.1 protein_id gnl|my_center|LOCUS_15510 94897 95307 gene locus_tag LOCUS_15520 94897 95307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 95784 95341 gene locus_tag LOCUS_15530 95784 95341 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_15530 96658 95861 gene locus_tag LOCUS_15540 96658 95861 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902664.1 protein_id gnl|my_center|LOCUS_15540 96825 98465 gene locus_tag LOCUS_15550 96825 98465 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838674.1 protein_id gnl|my_center|LOCUS_15550 99739 98495 gene locus_tag LOCUS_15560 99739 98495 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902302.1 protein_id gnl|my_center|LOCUS_15560 100570 100118 gene locus_tag LOCUS_15570 100570 100118 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_15570 101457 100666 gene locus_tag LOCUS_15580 101457 100666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 <102151 101573 gene locus_tag LOCUS_15590 <102151 101573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528780.1:copper-containing nitrite reductase >Feature sequence45 1647 718 gene locus_tag LOCUS_15600 1647 718 CDS product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_15600 2270 1767 gene locus_tag LOCUS_15610 2270 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2380 3027 gene locus_tag LOCUS_15620 2380 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4416 3400 gene locus_tag LOCUS_15630 4416 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4658 6130 gene locus_tag LOCUS_15640 4658 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15640 6710 6144 gene locus_tag LOCUS_15650 6710 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 7024 6707 gene locus_tag LOCUS_15660 7024 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 7146 7562 gene locus_tag LOCUS_15670 7146 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 7619 8008 gene locus_tag LOCUS_15680 7619 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 8558 8154 gene locus_tag LOCUS_15690 8558 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 9819 9613 gene locus_tag LOCUS_15700 9819 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15700 10784 9756 gene locus_tag LOCUS_15710 10784 9756 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405273.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15710 11371 13614 gene locus_tag LOCUS_15720 11371 13614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 13607 14638 gene locus_tag LOCUS_15730 13607 14638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 14631 18311 gene locus_tag LOCUS_15740 14631 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 21071 18486 gene locus_tag LOCUS_15750 gene folP 21071 18486 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902259.1 protein_id gnl|my_center|LOCUS_15750 21275 21646 gene locus_tag LOCUS_15760 21275 21646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 21793 22749 gene locus_tag LOCUS_15770 21793 22749 CDS product DUF5602 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020850.1 protein_id gnl|my_center|LOCUS_15770 23181 23360 gene locus_tag LOCUS_15780 23181 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892499.1 protein_id gnl|my_center|LOCUS_15780 23824 23582 gene locus_tag LOCUS_15790 23824 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 24804 24022 gene locus_tag LOCUS_15800 24804 24022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904169.1 protein_id gnl|my_center|LOCUS_15800 25040 26707 gene locus_tag LOCUS_15810 25040 26707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903388.1 protein_id gnl|my_center|LOCUS_15810 27101 26919 gene locus_tag LOCUS_15820 27101 26919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 30441 27265 gene locus_tag LOCUS_15830 gene carB 30441 27265 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903325.1 protein_id gnl|my_center|LOCUS_15830 30707 33064 gene locus_tag LOCUS_15840 30707 33064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 33316 33813 gene locus_tag LOCUS_15850 33316 33813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 33836 34741 gene locus_tag LOCUS_15860 33836 34741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 35085 34750 gene locus_tag LOCUS_15870 35085 34750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 35896 35333 gene locus_tag LOCUS_15880 35896 35333 CDS product DUF5815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903323.1 protein_id gnl|my_center|LOCUS_15880 36467 36057 gene locus_tag LOCUS_15890 36467 36057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903322.1 protein_id gnl|my_center|LOCUS_15890 36800 36552 gene locus_tag LOCUS_15900 36800 36552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 38215 36977 gene locus_tag LOCUS_15910 38215 36977 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903320.1 protein_id gnl|my_center|LOCUS_15910 38520 39089 gene locus_tag LOCUS_15920 38520 39089 CDS product DUF6149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903316.1 protein_id gnl|my_center|LOCUS_15920 39260 40540 gene locus_tag LOCUS_15930 39260 40540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 40613 41884 gene locus_tag LOCUS_15940 40613 41884 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_15940 41992 41774 gene locus_tag LOCUS_15950 41992 41774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 43492 42242 gene locus_tag LOCUS_15960 43492 42242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 43852 46923 gene locus_tag LOCUS_15970 43852 46923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 47042 47929 gene locus_tag LOCUS_15980 47042 47929 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903313.1 protein_id gnl|my_center|LOCUS_15980 47935 48285 gene locus_tag LOCUS_15990 47935 48285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 49566 48658 gene locus_tag LOCUS_16000 gene pdxS 49566 48658 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903311.1 protein_id gnl|my_center|LOCUS_16000 50426 49674 gene locus_tag LOCUS_16010 50426 49674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 50519 51229 gene locus_tag LOCUS_16020 50519 51229 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903310.1 protein_id gnl|my_center|LOCUS_16020 53950 51284 gene locus_tag LOCUS_16030 gene valS 53950 51284 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_16030 55205 54300 gene locus_tag LOCUS_16040 55205 54300 CDS product DUF6293 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892517.1 protein_id gnl|my_center|LOCUS_16040 55597 55370 gene locus_tag LOCUS_16050 55597 55370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 56290 55646 gene locus_tag LOCUS_16060 56290 55646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 57829 56342 gene locus_tag LOCUS_16070 57829 56342 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 protein_id gnl|my_center|LOCUS_16070 58113 57826 gene locus_tag LOCUS_16080 58113 57826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 58290 59180 gene locus_tag LOCUS_16090 58290 59180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence46 28 1164 gene locus_tag LOCUS_16100 28 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 1232 1435 gene locus_tag LOCUS_16110 1232 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2900 1575 gene locus_tag LOCUS_16120 2900 1575 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289378.1 protein_id gnl|my_center|LOCUS_16120 3035 3667 gene locus_tag LOCUS_16130 3035 3667 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289377.1 protein_id gnl|my_center|LOCUS_16130 4059 3664 gene locus_tag LOCUS_16140 4059 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 5143 4211 gene locus_tag LOCUS_16150 gene uppS 5143 4211 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903300.1 protein_id gnl|my_center|LOCUS_16150 5320 5736 gene locus_tag LOCUS_16160 5320 5736 CDS product DUF5778 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903299.1 protein_id gnl|my_center|LOCUS_16160 5862 6944 gene locus_tag LOCUS_16170 5862 6944 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903298.1 protein_id gnl|my_center|LOCUS_16170 6974 7630 gene locus_tag LOCUS_16180 6974 7630 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903297.1 protein_id gnl|my_center|LOCUS_16180 7630 8976 gene locus_tag LOCUS_16190 gene hemA 7630 8976 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903296.1 protein_id gnl|my_center|LOCUS_16190 9369 9127 gene locus_tag LOCUS_16200 9369 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 9944 9747 gene locus_tag LOCUS_16210 9944 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 10736 10101 gene locus_tag LOCUS_16220 10736 10101 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903294.1 protein_id gnl|my_center|LOCUS_16220 11275 10871 gene locus_tag LOCUS_16230 11275 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 11588 11307 gene locus_tag LOCUS_16240 11588 11307 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903295.1 protein_id gnl|my_center|LOCUS_16240 12343 11675 gene locus_tag LOCUS_16250 12343 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 12468 12605 gene locus_tag LOCUS_16260 12468 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 12663 14003 gene locus_tag LOCUS_16270 12663 14003 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_16270 14536 14354 gene locus_tag LOCUS_16280 14536 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 15997 14567 gene locus_tag LOCUS_16290 15997 14567 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421525.1 protein_id gnl|my_center|LOCUS_16290 16106 16684 gene locus_tag LOCUS_16300 16106 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 17758 16673 gene locus_tag LOCUS_16310 17758 16673 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289531.1 protein_id gnl|my_center|LOCUS_16310 17801 18007 gene locus_tag LOCUS_16320 17801 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 18458 18099 gene locus_tag LOCUS_16330 18458 18099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 18650 20041 gene locus_tag LOCUS_16340 18650 20041 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903279.1 protein_id gnl|my_center|LOCUS_16340 20612 20043 gene locus_tag LOCUS_16350 20612 20043 CDS product DUF359 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289421.1 protein_id gnl|my_center|LOCUS_16350 20815 20618 gene locus_tag LOCUS_16360 20815 20618 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903509.1 protein_id gnl|my_center|LOCUS_16360 21387 20818 gene locus_tag LOCUS_16370 21387 20818 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903510.1 protein_id gnl|my_center|LOCUS_16370 21780 21388 gene locus_tag LOCUS_16380 21780 21388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903511.1 protein_id gnl|my_center|LOCUS_16380 23017 21785 gene locus_tag LOCUS_16390 23017 21785 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903512.1 protein_id gnl|my_center|LOCUS_16390 23317 24336 gene locus_tag LOCUS_16400 23317 24336 CDS product DUF5787 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892531.1 protein_id gnl|my_center|LOCUS_16400 25195 24371 gene locus_tag LOCUS_16410 25195 24371 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903514.1 protein_id gnl|my_center|LOCUS_16410 25606 25277 gene locus_tag LOCUS_16420 25606 25277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 26058 25663 gene locus_tag LOCUS_16430 26058 25663 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404838.1 protein_id gnl|my_center|LOCUS_16430 27575 26160 gene locus_tag LOCUS_16440 27575 26160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289423.1 protein_id gnl|my_center|LOCUS_16440 27723 28094 gene locus_tag LOCUS_16450 27723 28094 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289522.1 protein_id gnl|my_center|LOCUS_16450 28097 28693 gene locus_tag LOCUS_16460 28097 28693 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903885.1 protein_id gnl|my_center|LOCUS_16460 29173 28715 gene locus_tag LOCUS_16470 29173 28715 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903884.1 protein_id gnl|my_center|LOCUS_16470 29290 29757 gene locus_tag LOCUS_16480 29290 29757 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289521.1 protein_id gnl|my_center|LOCUS_16480 29928 31124 gene locus_tag LOCUS_16490 29928 31124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903882.1 protein_id gnl|my_center|LOCUS_16490 32342 31605 gene locus_tag LOCUS_16500 32342 31605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 32602 33519 gene locus_tag LOCUS_16510 32602 33519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 34566 34126 gene locus_tag LOCUS_16520 34566 34126 CDS product DUF5807 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289520.1 protein_id gnl|my_center|LOCUS_16520 34865 35365 gene locus_tag LOCUS_16530 gene gvpE 34865 35365 CDS product gas vesicle transcriptional activator GvpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890521.1 protein_id gnl|my_center|LOCUS_16530 35881 35444 gene locus_tag LOCUS_16540 35881 35444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902511.1 protein_id gnl|my_center|LOCUS_16540 36334 35909 gene locus_tag LOCUS_16550 36334 35909 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903878.1 protein_id gnl|my_center|LOCUS_16550 36591 36869 gene locus_tag LOCUS_16560 36591 36869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 36923 37267 gene locus_tag LOCUS_16570 36923 37267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 37347 37763 gene locus_tag LOCUS_16580 37347 37763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 37977 38522 gene locus_tag LOCUS_16590 37977 38522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904216.1 protein_id gnl|my_center|LOCUS_16590 38526 39035 gene locus_tag LOCUS_16600 38526 39035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 39464 39165 gene locus_tag LOCUS_16610 39464 39165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 39535 40797 gene locus_tag LOCUS_16620 39535 40797 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903876.1 protein_id gnl|my_center|LOCUS_16620 42188 40893 gene locus_tag LOCUS_16630 42188 40893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 43360 42212 gene locus_tag LOCUS_16640 43360 42212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 44089 43544 gene locus_tag LOCUS_16650 44089 43544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 44631 44104 gene locus_tag LOCUS_16660 44631 44104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 45149 45817 gene locus_tag LOCUS_16670 45149 45817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 45906 46481 gene locus_tag LOCUS_16680 45906 46481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 47513 46590 gene locus_tag LOCUS_16690 47513 46590 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_16690 48715 47684 gene locus_tag LOCUS_16700 48715 47684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16700 49636 48728 gene locus_tag LOCUS_16710 49636 48728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16710 49921 50403 gene locus_tag LOCUS_16720 49921 50403 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903920.1 protein_id gnl|my_center|LOCUS_16720 50483 51037 gene locus_tag LOCUS_16730 50483 51037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 51197 51661 gene locus_tag LOCUS_16740 51197 51661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 51757 52191 gene locus_tag LOCUS_16750 51757 52191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 52288 53187 gene locus_tag LOCUS_16760 52288 53187 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903908.1 protein_id gnl|my_center|LOCUS_16760 53355 53660 gene locus_tag LOCUS_16770 53355 53660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 54207 55433 gene locus_tag LOCUS_16780 54207 55433 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289079.1 protein_id gnl|my_center|LOCUS_16780 55444 55707 gene locus_tag LOCUS_16790 55444 55707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 56402 55968 gene locus_tag LOCUS_16800 56402 55968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 57105 57899 gene locus_tag LOCUS_16810 57105 57899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 58232 58936 gene locus_tag LOCUS_16820 58232 58936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 59640 59197 gene locus_tag LOCUS_16830 59640 59197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 59991 60248 gene locus_tag LOCUS_16840 59991 60248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 60729 60286 gene locus_tag LOCUS_16850 60729 60286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 61046 61330 gene locus_tag LOCUS_16860 61046 61330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 61975 61574 gene locus_tag LOCUS_16870 61975 61574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128906461.1 protein_id gnl|my_center|LOCUS_16870 62325 61972 gene locus_tag LOCUS_16880 62325 61972 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890542.1 protein_id gnl|my_center|LOCUS_16880 63711 62452 gene locus_tag LOCUS_16890 63711 62452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 64100 63708 gene locus_tag LOCUS_16900 64100 63708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 64223 64726 gene locus_tag LOCUS_16910 64223 64726 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_16910 <65729 64743 gene locus_tag LOCUS_16920 <65729 64743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903632.1:heavy metal translocating P-type ATPase >Feature sequence47 2842 1592 gene locus_tag LOCUS_16930 2842 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3542 2934 gene locus_tag LOCUS_16940 3542 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3419 3425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3952 3656 gene locus_tag LOCUS_16950 3952 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 5608 4115 gene locus_tag LOCUS_16960 5608 4115 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902756.1 protein_id gnl|my_center|LOCUS_16960 6870 5965 gene locus_tag LOCUS_16970 6870 5965 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289431.1 protein_id gnl|my_center|LOCUS_16970 7424 7155 gene locus_tag LOCUS_16980 7424 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 7332 8315 gene locus_tag LOCUS_16990 7332 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 8495 9646 gene locus_tag LOCUS_17000 gene trpB 8495 9646 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_17000 10105 9695 gene locus_tag LOCUS_17010 10105 9695 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903622.1 protein_id gnl|my_center|LOCUS_17010 11249 10188 gene locus_tag LOCUS_17020 11249 10188 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902258.1 protein_id gnl|my_center|LOCUS_17020 11408 13219 gene locus_tag LOCUS_17030 11408 13219 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_17030 13316 14287 gene locus_tag LOCUS_17040 13316 14287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_17040 14284 15120 gene locus_tag LOCUS_17050 14284 15120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903774.1 protein_id gnl|my_center|LOCUS_17050 16225 15167 gene locus_tag LOCUS_17060 16225 15167 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902254.1 protein_id gnl|my_center|LOCUS_17060 16389 17465 gene locus_tag LOCUS_17070 16389 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 18461 17472 gene locus_tag LOCUS_17080 18461 17472 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_17080 18623 19627 gene locus_tag LOCUS_17090 18623 19627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 20459 19773 gene locus_tag LOCUS_17100 20459 19773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 20923 21336 gene locus_tag LOCUS_17110 20923 21336 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902479.1 protein_id gnl|my_center|LOCUS_17110 21418 22023 gene locus_tag LOCUS_17120 21418 22023 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 protein_id gnl|my_center|LOCUS_17120 23393 22587 gene locus_tag LOCUS_17130 23393 22587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 24274 23438 gene locus_tag LOCUS_17140 24274 23438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 29229 24766 gene locus_tag LOCUS_17150 gene gltB 29229 24766 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421590.1 protein_id gnl|my_center|LOCUS_17150 31218 29737 gene locus_tag LOCUS_17160 gene proS 31218 29737 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902251.1 protein_id gnl|my_center|LOCUS_17160 31399 32373 gene locus_tag LOCUS_17170 31399 32373 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479639.1 protein_id gnl|my_center|LOCUS_17170 32916 32416 gene locus_tag LOCUS_17180 32916 32416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 34020 33133 gene locus_tag LOCUS_17190 gene speB 34020 33133 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903289.1 protein_id gnl|my_center|LOCUS_17190 34394 34020 gene locus_tag LOCUS_17200 34394 34020 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903290.1 protein_id gnl|my_center|LOCUS_17200 35755 34646 gene locus_tag LOCUS_17210 35755 34646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 37553 35880 gene locus_tag LOCUS_17220 37553 35880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 39287 37641 gene locus_tag LOCUS_17230 39287 37641 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_17230 39725 39354 gene locus_tag LOCUS_17240 39725 39354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 39928 41250 gene locus_tag LOCUS_17250 39928 41250 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151112700.1 protein_id gnl|my_center|LOCUS_17250 42509 41382 gene locus_tag LOCUS_17260 42509 41382 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918144.1 protein_id gnl|my_center|LOCUS_17260 42620 44506 gene locus_tag LOCUS_17270 42620 44506 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902014.1 protein_id gnl|my_center|LOCUS_17270 44662 45663 gene locus_tag LOCUS_17280 44662 45663 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_17280 45660 46076 gene locus_tag LOCUS_17290 45660 46076 CDS product desampylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903329.1 protein_id gnl|my_center|LOCUS_17290 46530 46090 gene locus_tag LOCUS_17300 46530 46090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 47390 48205 gene locus_tag LOCUS_17310 47390 48205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 48209 49123 gene locus_tag LOCUS_17320 48209 49123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 50751 49273 gene locus_tag LOCUS_17330 50751 49273 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_17330 51313 51140 gene locus_tag LOCUS_17340 51313 51140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 53167 51869 gene locus_tag LOCUS_17350 gene hisS 53167 51869 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_17350 53909 53319 gene locus_tag LOCUS_17360 53909 53319 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903477.1 protein_id gnl|my_center|LOCUS_17360 54280 53909 gene locus_tag LOCUS_17370 54280 53909 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903478.1 protein_id gnl|my_center|LOCUS_17370 54810 54355 gene locus_tag LOCUS_17380 54810 54355 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903479.1 protein_id gnl|my_center|LOCUS_17380 54908 55786 gene locus_tag LOCUS_17390 gene thiL 54908 55786 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903480.1 protein_id gnl|my_center|LOCUS_17390 56991 55831 gene locus_tag LOCUS_17400 56991 55831 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 protein_id gnl|my_center|LOCUS_17400 57479 57240 gene locus_tag LOCUS_17410 57479 57240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903482.1 protein_id gnl|my_center|LOCUS_17410 58575 57736 gene locus_tag LOCUS_17420 58575 57736 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289090.1 protein_id gnl|my_center|LOCUS_17420 58677 59738 gene locus_tag LOCUS_17430 58677 59738 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_17430 59939 60664 gene locus_tag LOCUS_17440 gene pyrH 59939 60664 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903483.1 protein_id gnl|my_center|LOCUS_17440 60661 62376 gene locus_tag LOCUS_17450 gene lysS 60661 62376 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903484.1 protein_id gnl|my_center|LOCUS_17450 62441 64285 gene locus_tag LOCUS_17460 62441 64285 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903485.1 protein_id gnl|my_center|LOCUS_17460 64833 64306 gene locus_tag LOCUS_17470 64833 64306 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903486.1 protein_id gnl|my_center|LOCUS_17470 65001 66485 gene locus_tag LOCUS_17480 65001 66485 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903487.1 protein_id gnl|my_center|LOCUS_17480 66590 67921 gene locus_tag LOCUS_17490 66590 67921 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892719.1 protein_id gnl|my_center|LOCUS_17490 68161 67973 gene locus_tag LOCUS_17500 68161 67973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 68746 68363 gene locus_tag LOCUS_17510 68746 68363 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903979.1 protein_id gnl|my_center|LOCUS_17510 70036 68957 gene locus_tag LOCUS_17520 70036 68957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903978.1 protein_id gnl|my_center|LOCUS_17520 70228 70524 gene locus_tag LOCUS_17530 70228 70524 CDS product DUF6432 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903977.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence48 55 573 gene locus_tag LOCUS_17540 55 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1434 619 gene locus_tag LOCUS_17550 1434 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1793 2767 gene locus_tag LOCUS_17560 1793 2767 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903042.1 protein_id gnl|my_center|LOCUS_17560 2903 3397 gene locus_tag LOCUS_17570 2903 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4029 3511 gene locus_tag LOCUS_17580 4029 3511 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021158.1 protein_id gnl|my_center|LOCUS_17580 4222 5067 gene locus_tag LOCUS_17590 4222 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 5457 5188 gene locus_tag LOCUS_17600 5457 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 6030 5566 gene locus_tag LOCUS_17610 6030 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17610 7094 6123 gene locus_tag LOCUS_17620 7094 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17620 7221 7682 gene locus_tag LOCUS_17630 gene lrp 7221 7682 CDS product HTH-type transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903541.1 protein_id gnl|my_center|LOCUS_17630 9671 8001 gene locus_tag LOCUS_17640 gene thsB 9671 8001 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361694.1 protein_id gnl|my_center|LOCUS_17640 10059 10868 gene locus_tag LOCUS_17650 10059 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 11183 10869 gene locus_tag LOCUS_17660 11183 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 11729 11394 gene locus_tag LOCUS_17670 11729 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 12026 12787 gene locus_tag LOCUS_17680 12026 12787 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903934.1 protein_id gnl|my_center|LOCUS_17680 12784 13029 gene locus_tag LOCUS_17690 12784 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 14444 13365 gene locus_tag LOCUS_17700 gene carA 14444 13365 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903326.1 protein_id gnl|my_center|LOCUS_17700 14547 14960 gene locus_tag LOCUS_17710 14547 14960 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903327.1 protein_id gnl|my_center|LOCUS_17710 15967 15092 gene locus_tag LOCUS_17720 15967 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 15857 16828 gene locus_tag LOCUS_17730 15857 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 16904 17464 gene locus_tag LOCUS_17740 16904 17464 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289385.1 protein_id gnl|my_center|LOCUS_17740 17697 19064 gene locus_tag LOCUS_17750 17697 19064 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_17750 19066 19788 gene locus_tag LOCUS_17760 19066 19788 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_17760 19932 20846 gene locus_tag LOCUS_17770 19932 20846 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_17770 21781 21140 gene locus_tag LOCUS_17780 gene ycaC 21781 21140 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943220.1 protein_id gnl|my_center|LOCUS_17780 22196 21768 gene locus_tag LOCUS_17790 22196 21768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 22547 22275 gene locus_tag LOCUS_17800 22547 22275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 22821 22555 gene locus_tag LOCUS_17810 22821 22555 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008526012.1 protein_id gnl|my_center|LOCUS_17810 23306 23058 gene locus_tag LOCUS_17820 23306 23058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 23662 24057 gene locus_tag LOCUS_17830 23662 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 24520 24161 gene locus_tag LOCUS_17840 24520 24161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 26641 25004 gene locus_tag LOCUS_17850 26641 25004 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902572.1 protein_id gnl|my_center|LOCUS_17850 <27774 26740 gene locus_tag LOCUS_17860 <27774 26740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903921.1:S8 family peptidase >Feature sequence49 2042 672 gene locus_tag LOCUS_17870 2042 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3710 2052 gene locus_tag LOCUS_17880 3710 2052 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902571.1 protein_id gnl|my_center|LOCUS_17880 5682 3880 gene locus_tag LOCUS_17890 5682 3880 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902570.1 protein_id gnl|my_center|LOCUS_17890 7210 6044 gene locus_tag LOCUS_17900 gene ugpC 7210 6044 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_17900 7337 8914 gene locus_tag LOCUS_17910 7337 8914 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_17910 9863 8988 gene locus_tag LOCUS_17920 9863 8988 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174518.1 protein_id gnl|my_center|LOCUS_17920 10846 9860 gene locus_tag LOCUS_17930 10846 9860 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 protein_id gnl|my_center|LOCUS_17930 12205 10898 gene locus_tag LOCUS_17940 12205 10898 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_17940 12481 13632 gene locus_tag LOCUS_17950 gene dgoD 12481 13632 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_17950 14676 13978 gene locus_tag LOCUS_17960 gene bshB1 14676 13978 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_17960 15517 14756 gene locus_tag LOCUS_17970 15517 14756 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_17970 15630 16844 gene locus_tag LOCUS_17980 gene dgaE 15630 16844 CDS product D-glucosaminate-6-phosphate ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188469.1 protein_id gnl|my_center|LOCUS_17980 16903 17283 gene locus_tag LOCUS_17990 16903 17283 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_17990 17280 18341 gene locus_tag LOCUS_18000 17280 18341 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902286.1 protein_id gnl|my_center|LOCUS_18000 19751 19008 gene locus_tag LOCUS_18010 19751 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 20821 19748 gene locus_tag LOCUS_18020 20821 19748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903431.1 protein_id gnl|my_center|LOCUS_18020 21043 21360 gene locus_tag LOCUS_18030 21043 21360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 21712 21428 gene locus_tag LOCUS_18040 21712 21428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 22843 21818 gene locus_tag LOCUS_18050 22843 21818 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_18050 23078 23641 gene locus_tag LOCUS_18060 23078 23641 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903332.1 protein_id gnl|my_center|LOCUS_18060 23619 24386 gene locus_tag LOCUS_18070 23619 24386 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_18070 25207 24875 gene locus_tag LOCUS_18080 25207 24875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903335.1 protein_id gnl|my_center|LOCUS_18080 26121 25204 gene locus_tag LOCUS_18090 gene guaA 26121 25204 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903336.1 protein_id gnl|my_center|LOCUS_18090 27806 26121 gene locus_tag LOCUS_18100 27806 26121 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903337.1 protein_id gnl|my_center|LOCUS_18100 28111 27896 gene locus_tag LOCUS_18110 28111 27896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 29993 28194 gene locus_tag LOCUS_18120 gene infB 29993 28194 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903469.1 protein_id gnl|my_center|LOCUS_18120 30242 30487 gene locus_tag LOCUS_18130 30242 30487 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903468.1 protein_id gnl|my_center|LOCUS_18130 30492 30950 gene locus_tag LOCUS_18140 30492 30950 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289414.1 protein_id gnl|my_center|LOCUS_18140 32132 31011 gene locus_tag LOCUS_18150 32132 31011 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903466.1 protein_id gnl|my_center|LOCUS_18150 33530 32235 gene locus_tag LOCUS_18160 33530 32235 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903465.1 protein_id gnl|my_center|LOCUS_18160 33681 34154 gene locus_tag LOCUS_18170 33681 34154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 34302 35174 gene locus_tag LOCUS_18180 gene secF 34302 35174 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903462.1 protein_id gnl|my_center|LOCUS_18180 35171 36811 gene locus_tag LOCUS_18190 35171 36811 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903461.1 protein_id gnl|my_center|LOCUS_18190 38019 37123 gene locus_tag LOCUS_18200 38019 37123 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903490.1 protein_id gnl|my_center|LOCUS_18200 38358 38143 gene locus_tag LOCUS_18210 38358 38143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 38387 39538 gene locus_tag LOCUS_18220 38387 39538 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_18220 39821 39573 gene locus_tag LOCUS_18230 39821 39573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 40443 41432 gene locus_tag LOCUS_18240 40443 41432 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144000.1 protein_id gnl|my_center|LOCUS_18240 41568 42032 gene locus_tag LOCUS_18250 41568 42032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 43525 42086 gene locus_tag LOCUS_18260 43525 42086 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903965.1 protein_id gnl|my_center|LOCUS_18260 44054 43608 gene locus_tag LOCUS_18270 44054 43608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 44246 45202 gene locus_tag LOCUS_18280 44246 45202 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289530.1 protein_id gnl|my_center|LOCUS_18280 45916 45311 gene locus_tag LOCUS_18290 45916 45311 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289529.1 protein_id gnl|my_center|LOCUS_18290 46031 46285 gene locus_tag LOCUS_18300 46031 46285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 47439 46291 gene locus_tag LOCUS_18310 47439 46291 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903961.1 protein_id gnl|my_center|LOCUS_18310 49313 47436 gene locus_tag LOCUS_18320 49313 47436 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903960.1 protein_id gnl|my_center|LOCUS_18320 49535 49377 gene locus_tag LOCUS_18330 49535 49377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177170774.1 protein_id gnl|my_center|LOCUS_18330 50050 50886 gene locus_tag LOCUS_18340 gene moeB 50050 50886 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902012.1 protein_id gnl|my_center|LOCUS_18340 51818 50922 gene locus_tag LOCUS_18350 51818 50922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 52920 51949 gene locus_tag LOCUS_18360 52920 51949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 53852 53067 gene locus_tag LOCUS_18370 53852 53067 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903597.1 protein_id gnl|my_center|LOCUS_18370 54458 54000 gene locus_tag LOCUS_18380 54458 54000 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_18380 54931 54578 gene locus_tag LOCUS_18390 54931 54578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 56033 55041 gene locus_tag LOCUS_18400 56033 55041 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902489.1 protein_id gnl|my_center|LOCUS_18400 56632 56156 gene locus_tag LOCUS_18410 56632 56156 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289446.1 protein_id gnl|my_center|LOCUS_18410 56839 57630 gene locus_tag LOCUS_18420 56839 57630 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903589.1 protein_id gnl|my_center|LOCUS_18420 57627 58583 gene locus_tag LOCUS_18430 57627 58583 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903590.1 protein_id gnl|my_center|LOCUS_18430 58608 58862 gene locus_tag LOCUS_18440 58608 58862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 59004 60275 gene locus_tag LOCUS_18450 59004 60275 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_18450 60275 62824 gene locus_tag LOCUS_18460 gene htr6 60275 62824 CDS product chemotaxis signal transducer protein Htr6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902553.1 protein_id gnl|my_center|LOCUS_18460 62882 63724 gene locus_tag LOCUS_18470 62882 63724 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903592.1 protein_id gnl|my_center|LOCUS_18470 64882 63770 gene locus_tag LOCUS_18480 64882 63770 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903593.1 protein_id gnl|my_center|LOCUS_18480 65637 65215 gene locus_tag LOCUS_18490 65637 65215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 65763 66758 gene locus_tag LOCUS_18500 65763 66758 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289444.1 protein_id gnl|my_center|LOCUS_18500 66999 67727 gene locus_tag LOCUS_18510 66999 67727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 69123 67828 gene locus_tag LOCUS_18520 69123 67828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_18520 69293 70516 gene locus_tag LOCUS_18530 69293 70516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 70714 71139 gene locus_tag LOCUS_18540 70714 71139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289443.1 protein_id gnl|my_center|LOCUS_18540 71779 71156 gene locus_tag LOCUS_18550 71779 71156 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289442.1 protein_id gnl|my_center|LOCUS_18550 71938 72270 gene locus_tag LOCUS_18560 gene ahaH 71938 72270 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903585.1 protein_id gnl|my_center|LOCUS_18560 72257 74521 gene locus_tag LOCUS_18570 72257 74521 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903584.1 protein_id gnl|my_center|LOCUS_18570 74725 75030 gene locus_tag LOCUS_18580 74725 75030 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289441.1 protein_id gnl|my_center|LOCUS_18580 75057 75638 gene locus_tag LOCUS_18590 75057 75638 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903582.1 protein_id gnl|my_center|LOCUS_18590 75635 76687 gene locus_tag LOCUS_18600 75635 76687 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903581.1 protein_id gnl|my_center|LOCUS_18600 76684 77016 gene locus_tag LOCUS_18610 76684 77016 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903580.1 protein_id gnl|my_center|LOCUS_18610 77020 78783 gene locus_tag LOCUS_18620 77020 78783 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903579.1 protein_id gnl|my_center|LOCUS_18620 78786 80198 gene locus_tag LOCUS_18630 78786 80198 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903578.1 protein_id gnl|my_center|LOCUS_18630 80716 81234 gene locus_tag LOCUS_18640 80716 81234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 81755 81546 gene locus_tag LOCUS_18650 81755 81546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 81792 82937 gene locus_tag LOCUS_18660 81792 82937 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104766.1 protein_id gnl|my_center|LOCUS_18660 82944 83867 gene locus_tag LOCUS_18670 82944 83867 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191802.1 protein_id gnl|my_center|LOCUS_18670 83869 84816 gene locus_tag LOCUS_18680 83869 84816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 84899 85918 gene locus_tag LOCUS_18690 84899 85918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903790.1 protein_id gnl|my_center|LOCUS_18690 86265 85957 gene locus_tag LOCUS_18700 86265 85957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 86330 86533 gene locus_tag LOCUS_18710 86330 86533 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223929.1 protein_id gnl|my_center|LOCUS_18710 86644 87372 gene locus_tag LOCUS_18720 86644 87372 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903575.1 protein_id gnl|my_center|LOCUS_18720 87427 87852 gene locus_tag LOCUS_18730 87427 87852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 88307 87909 gene locus_tag LOCUS_18740 88307 87909 CDS product DUF5811 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903470.1 protein_id gnl|my_center|LOCUS_18740 88847 88362 gene locus_tag LOCUS_18750 88847 88362 CDS product pyruvoyl-dependent arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903471.1 protein_id gnl|my_center|LOCUS_18750 90186 88954 gene locus_tag LOCUS_18760 90186 88954 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903472.1 protein_id gnl|my_center|LOCUS_18760 92143 90341 gene locus_tag LOCUS_18770 gene pepF 92143 90341 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289415.1 protein_id gnl|my_center|LOCUS_18770 92300 92857 gene locus_tag LOCUS_18780 gene hpt 92300 92857 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902373.1 protein_id gnl|my_center|LOCUS_18780 93053 94438 gene locus_tag LOCUS_18790 93053 94438 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_18790 94859 94623 gene locus_tag LOCUS_18800 94859 94623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 95809 94946 gene locus_tag LOCUS_18810 gene truA 95809 94946 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903475.1 protein_id gnl|my_center|LOCUS_18810 96845 95880 gene locus_tag LOCUS_18820 gene htpX 96845 95880 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_18820 97404 96931 gene locus_tag LOCUS_18830 97404 96931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 99104 97572 gene locus_tag LOCUS_18840 99104 97572 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903957.1 protein_id gnl|my_center|LOCUS_18840 100471 99368 gene locus_tag LOCUS_18850 100471 99368 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404946.1 protein_id gnl|my_center|LOCUS_18850 102196 100553 gene locus_tag LOCUS_18860 gene hemAT 102196 100553 CDS product heme-containing aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903098.1 protein_id gnl|my_center|LOCUS_18860 102356 104230 gene locus_tag LOCUS_18870 102356 104230 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903956.1 protein_id gnl|my_center|LOCUS_18870 104445 105938 gene locus_tag LOCUS_18880 104445 105938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 107270 106209 gene locus_tag LOCUS_18890 107270 106209 CDS product Brp/Blh family beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289439.1 protein_id gnl|my_center|LOCUS_18890 108042 107260 gene locus_tag LOCUS_18900 gene crtY 108042 107260 CDS product lycopene beta-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289440.1 protein_id gnl|my_center|LOCUS_18900 109067 108453 gene locus_tag LOCUS_18910 109067 108453 CDS product bacteriorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903069.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18910 109345 109947 gene locus_tag LOCUS_18920 109345 109947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 110214 111131 gene locus_tag LOCUS_18930 110214 111131 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867289.1 protein_id gnl|my_center|LOCUS_18930 111609 111196 gene locus_tag LOCUS_18940 111609 111196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 111951 111655 gene locus_tag LOCUS_18950 111951 111655 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903955.1 protein_id gnl|my_center|LOCUS_18950 113839 112190 gene locus_tag LOCUS_18960 113839 112190 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289110.1 protein_id gnl|my_center|LOCUS_18960 115220 113997 gene locus_tag LOCUS_18970 115220 113997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 116499 115321 gene locus_tag LOCUS_18980 116499 115321 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064526.1 protein_id gnl|my_center|LOCUS_18980 117797 116664 gene locus_tag LOCUS_18990 117797 116664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 118514 117888 gene locus_tag LOCUS_19000 118514 117888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 118864 118595 gene locus_tag LOCUS_19010 118864 118595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 119115 121685 gene locus_tag LOCUS_19020 119115 121685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 121946 122518 gene locus_tag LOCUS_19030 121946 122518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005553844.1 protein_id gnl|my_center|LOCUS_19030 122522 123568 gene locus_tag LOCUS_19040 122522 123568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 123686 124003 gene locus_tag LOCUS_19050 123686 124003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903954.1 protein_id gnl|my_center|LOCUS_19050 124005 125819 gene locus_tag LOCUS_19060 124005 125819 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903953.1 protein_id gnl|my_center|LOCUS_19060 126586 125879 gene locus_tag LOCUS_19070 126586 125879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 126470 126844 gene locus_tag LOCUS_19080 126470 126844 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903950.1 protein_id gnl|my_center|LOCUS_19080 127008 127889 gene locus_tag LOCUS_19090 127008 127889 CDS product TIGR01548 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903949.1 protein_id gnl|my_center|LOCUS_19090 128445 127906 gene locus_tag LOCUS_19100 128445 127906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 128575 128820 gene locus_tag LOCUS_19110 128575 128820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 128874 130559 gene locus_tag LOCUS_19120 128874 130559 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534776.1 protein_id gnl|my_center|LOCUS_19120 130657 131079 gene locus_tag LOCUS_19130 130657 131079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 131900 131340 gene locus_tag LOCUS_19140 131900 131340 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065597847.1 protein_id gnl|my_center|LOCUS_19140 132346 132717 gene locus_tag LOCUS_19150 132346 132717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 133306 132800 gene locus_tag LOCUS_19160 133306 132800 CDS product DUF2391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903792.1 protein_id gnl|my_center|LOCUS_19160 134134 133394 gene locus_tag LOCUS_19170 134134 133394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 135572 134184 gene locus_tag LOCUS_19180 135572 134184 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877762.1 protein_id gnl|my_center|LOCUS_19180 136302 135637 gene locus_tag LOCUS_19190 136302 135637 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289172.1 protein_id gnl|my_center|LOCUS_19190 136510 136971 gene locus_tag LOCUS_19200 136510 136971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 137960 138754 gene locus_tag LOCUS_19210 137960 138754 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_19210 138935 140704 gene locus_tag LOCUS_19220 138935 140704 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903566.1 protein_id gnl|my_center|LOCUS_19220 140824 141831 gene locus_tag LOCUS_19230 140824 141831 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138879.1 protein_id gnl|my_center|LOCUS_19230 143731 142418 gene locus_tag LOCUS_19240 143731 142418 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061441.1 protein_id gnl|my_center|LOCUS_19240 144183 144806 gene locus_tag LOCUS_19250 144183 144806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 145528 144860 gene locus_tag LOCUS_19260 145528 144860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289217.1 protein_id gnl|my_center|LOCUS_19260 146993 146133 gene locus_tag LOCUS_19270 146993 146133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 147892 147122 gene locus_tag LOCUS_19280 147892 147122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 148197 147889 gene locus_tag LOCUS_19290 148197 147889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 149274 148264 gene locus_tag LOCUS_19300 149274 148264 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041807480.1 protein_id gnl|my_center|LOCUS_19300 150866 149469 gene locus_tag LOCUS_19310 150866 149469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 151671 151012 gene locus_tag LOCUS_19320 151671 151012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 151745 152473 gene locus_tag LOCUS_19330 151745 152473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 153483 152482 gene locus_tag LOCUS_19340 153483 152482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 154126 153530 gene locus_tag LOCUS_19350 154126 153530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 154185 154889 gene locus_tag LOCUS_19360 154185 154889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 154972 155505 gene locus_tag LOCUS_19370 154972 155505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 155502 156434 gene locus_tag LOCUS_19380 155502 156434 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860263.1 protein_id gnl|my_center|LOCUS_19380 156926 156597 gene locus_tag LOCUS_19390 156926 156597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 157537 157154 gene locus_tag LOCUS_19400 157537 157154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 158120 159688 gene locus_tag LOCUS_19410 158120 159688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 160017 160388 gene locus_tag LOCUS_19420 160017 160388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 160920 161456 gene locus_tag LOCUS_19430 160920 161456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 161500 161946 gene locus_tag LOCUS_19440 161500 161946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 161988 163109 gene locus_tag LOCUS_19450 161988 163109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 164087 163308 gene locus_tag LOCUS_19460 164087 163308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 164576 164184 gene locus_tag LOCUS_19470 164576 164184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 165740 165525 gene locus_tag LOCUS_19480 165740 165525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 166301 166140 gene locus_tag LOCUS_19490 166301 166140 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903942.1 protein_id gnl|my_center|LOCUS_19490 166420 166689 gene locus_tag LOCUS_19500 gene trxA 166420 166689 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903943.1 protein_id gnl|my_center|LOCUS_19500 167559 166879 gene locus_tag LOCUS_19510 gene npdG 167559 166879 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903948.1 protein_id gnl|my_center|LOCUS_19510 168154 167726 gene locus_tag LOCUS_19520 168154 167726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 168301 170769 gene locus_tag LOCUS_19530 168301 170769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 170875 171642 gene locus_tag LOCUS_19540 170875 171642 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903288.1 protein_id gnl|my_center|LOCUS_19540 171896 173083 gene locus_tag LOCUS_19550 171896 173083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 173342 173962 gene locus_tag LOCUS_19560 173342 173962 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903223.1 protein_id gnl|my_center|LOCUS_19560 174442 173993 gene locus_tag LOCUS_19570 174442 173993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 174418 175101 gene locus_tag LOCUS_19580 gene pdxT 174418 175101 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903941.1 protein_id gnl|my_center|LOCUS_19580 176144 175038 gene locus_tag LOCUS_19590 176144 175038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 177387 176212 gene locus_tag LOCUS_19600 177387 176212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 178440 177397 gene locus_tag LOCUS_19610 178440 177397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 179467 178433 gene locus_tag LOCUS_19620 179467 178433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 180570 179470 gene locus_tag LOCUS_19630 180570 179470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 180679 183129 gene locus_tag LOCUS_19640 180679 183129 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_19640 183251 183718 gene locus_tag LOCUS_19650 183251 183718 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903940.1 protein_id gnl|my_center|LOCUS_19650 183719 184003 gene locus_tag LOCUS_19660 gene hisE 183719 184003 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903939.1 protein_id gnl|my_center|LOCUS_19660 184179 186605 gene locus_tag LOCUS_19670 184179 186605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 186602 187465 gene locus_tag LOCUS_19680 186602 187465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 187462 188913 gene locus_tag LOCUS_19690 187462 188913 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_19690 188914 190362 gene locus_tag LOCUS_19700 188914 190362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 190444 191565 gene locus_tag LOCUS_19710 190444 191565 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_19710 191653 192000 gene locus_tag LOCUS_19720 191653 192000 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_19720 193196 192063 gene locus_tag LOCUS_19730 gene citZ 193196 192063 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_19730 194938 193433 gene locus_tag LOCUS_19740 194938 193433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 195313 194942 gene locus_tag LOCUS_19750 195313 194942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 195455 196453 gene locus_tag LOCUS_19760 195455 196453 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903937.1 protein_id gnl|my_center|LOCUS_19760 197837 196536 gene locus_tag LOCUS_19770 197837 196536 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_19770 197978 198601 gene locus_tag LOCUS_19780 gene engB 197978 198601 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903933.1 protein_id gnl|my_center|LOCUS_19780 199776 198910 gene locus_tag LOCUS_19790 199776 198910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 200199 200948 gene locus_tag LOCUS_19800 200199 200948 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903805.1 protein_id gnl|my_center|LOCUS_19800 202395 200980 gene locus_tag LOCUS_19810 202395 200980 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838397.1 protein_id gnl|my_center|LOCUS_19810 202394 202894 gene locus_tag LOCUS_19820 202394 202894 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897761.1 protein_id gnl|my_center|LOCUS_19820 202971 203516 gene locus_tag LOCUS_19830 202971 203516 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879241.1 protein_id gnl|my_center|LOCUS_19830 203721 204926 gene locus_tag LOCUS_19840 203721 204926 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_19840 204938 207013 gene locus_tag LOCUS_19850 204938 207013 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421608.1 protein_id gnl|my_center|LOCUS_19850 207010 208635 gene locus_tag LOCUS_19860 207010 208635 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141226.1 protein_id gnl|my_center|LOCUS_19860 208628 209353 gene locus_tag LOCUS_19870 208628 209353 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_19870 209480 210250 gene locus_tag LOCUS_19880 209480 210250 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903932.1 protein_id gnl|my_center|LOCUS_19880 210247 211266 gene locus_tag LOCUS_19890 gene mer 210247 211266 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_19890 211483 211289 gene locus_tag LOCUS_19900 211483 211289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 211568 211807 gene locus_tag LOCUS_19910 211568 211807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 211909 212103 gene locus_tag LOCUS_19920 211909 212103 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_19920 212362 213339 gene locus_tag LOCUS_19930 212362 213339 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_19930 213336 214412 gene locus_tag LOCUS_19940 213336 214412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 214409 216718 gene locus_tag LOCUS_19950 214409 216718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 216883 217176 gene locus_tag LOCUS_19960 gene yciH 216883 217176 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_19960 217681 217316 gene locus_tag LOCUS_19970 217681 217316 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903929.1 protein_id gnl|my_center|LOCUS_19970 217838 218089 gene locus_tag LOCUS_19980 217838 218089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 218712 218134 gene locus_tag LOCUS_19990 218712 218134 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903927.1 protein_id gnl|my_center|LOCUS_19990 219222 218803 gene locus_tag LOCUS_20000 219222 218803 CDS product DUF5809 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903925.1 protein_id gnl|my_center|LOCUS_20000 219712 219248 gene locus_tag LOCUS_20010 219712 219248 CDS product DUF5810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903924.1 protein_id gnl|my_center|LOCUS_20010 220230 219757 gene locus_tag LOCUS_20020 gene rimI 220230 219757 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289526.1 protein_id gnl|my_center|LOCUS_20020 220679 220512 gene locus_tag LOCUS_20030 220679 220512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 221233 221373 gene locus_tag LOCUS_20040 221233 221373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 221431 222126 gene locus_tag LOCUS_20050 221431 222126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 222207 222281 gene locus_tag LOCUS_t00190 222207 222281 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 223532 224095 gene locus_tag LOCUS_20060 223532 224095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20060 224760 224684 gene locus_tag LOCUS_t00200 224760 224684 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 224999 224889 gene locus_tag LOCUS_r00010 224999 224889 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence50 580 507 gene locus_tag LOCUS_t00210 580 507 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence51 1820 2197 gene locus_tag LOCUS_20070 1820 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2194 2490 gene locus_tag LOCUS_20080 2194 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4104 2638 gene locus_tag LOCUS_20090 gene lpdA 4104 2638 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_20090 6386 4173 gene locus_tag LOCUS_20100 6386 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 8357 6390 gene locus_tag LOCUS_20110 8357 6390 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941654.1 protein_id gnl|my_center|LOCUS_20110 11570 8406 gene locus_tag LOCUS_20120 11570 8406 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941653.1 protein_id gnl|my_center|LOCUS_20120 11965 11567 gene locus_tag LOCUS_20130 11965 11567 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_20130 12259 11969 gene locus_tag LOCUS_20140 12259 11969 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941651.1 protein_id gnl|my_center|LOCUS_20140 13008 12271 gene locus_tag LOCUS_20150 13008 12271 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_20150 14012 13005 gene locus_tag LOCUS_20160 14012 13005 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941649.1 protein_id gnl|my_center|LOCUS_20160 14689 14015 gene locus_tag LOCUS_20170 14689 14015 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_20170 14965 14690 gene locus_tag LOCUS_20180 14965 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 22189 21254 gene locus_tag LOCUS_20190 22189 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 22711 22196 gene locus_tag LOCUS_20200 22711 22196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 23872 22904 gene locus_tag LOCUS_20210 23872 22904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 24703 23876 gene locus_tag LOCUS_20220 24703 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 25124 24720 gene locus_tag LOCUS_20230 25124 24720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 25262 27382 gene locus_tag LOCUS_20240 25262 27382 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_20240 27515 28126 gene locus_tag LOCUS_20250 27515 28126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 29229 28168 gene locus_tag LOCUS_20260 29229 28168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 30082 29627 gene locus_tag LOCUS_20270 30082 29627 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_20270 30340 30131 gene locus_tag LOCUS_20280 30340 30131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 30945 30385 gene locus_tag LOCUS_20290 30945 30385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 31561 31103 gene locus_tag LOCUS_20300 31561 31103 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_20300 33352 31616 gene locus_tag LOCUS_20310 33352 31616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 33682 34923 gene locus_tag LOCUS_20320 33682 34923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 36641 34986 gene locus_tag LOCUS_20330 36641 34986 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903647.1 protein_id gnl|my_center|LOCUS_20330 37632 36643 gene locus_tag LOCUS_20340 37632 36643 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_20340 38803 37637 gene locus_tag LOCUS_20350 gene pdhA 38803 37637 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_20350 39963 38986 gene locus_tag LOCUS_20360 gene lipA 39963 38986 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_20360 42011 40929 gene locus_tag LOCUS_20370 42011 40929 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_20370 42485 43600 gene locus_tag LOCUS_20380 42485 43600 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903324.1 protein_id gnl|my_center|LOCUS_20380 43810 44019 gene locus_tag LOCUS_20390 43810 44019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 44169 47348 gene locus_tag LOCUS_20400 44169 47348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 47602 48117 gene locus_tag LOCUS_20410 47602 48117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 48228 48827 gene locus_tag LOCUS_20420 48228 48827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 48881 51247 gene locus_tag LOCUS_20430 48881 51247 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903642.1 protein_id gnl|my_center|LOCUS_20430 51960 51310 gene locus_tag LOCUS_20440 51960 51310 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258011.1 protein_id gnl|my_center|LOCUS_20440 52746 52348 gene locus_tag LOCUS_20450 52746 52348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 52645 53016 gene locus_tag LOCUS_20460 52645 53016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 53322 53200 gene locus_tag LOCUS_20470 53322 53200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 53873 54358 gene locus_tag LOCUS_20480 53873 54358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 54379 54750 gene locus_tag LOCUS_20490 54379 54750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 55026 55376 gene locus_tag LOCUS_20500 55026 55376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 55557 56684 gene locus_tag LOCUS_20510 55557 56684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_20510 56869 57561 gene locus_tag LOCUS_20520 56869 57561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 57803 58033 gene locus_tag LOCUS_20530 57803 58033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 58235 58540 gene locus_tag LOCUS_20540 58235 58540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 58793 59569 gene locus_tag LOCUS_20550 58793 59569 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903641.1 protein_id gnl|my_center|LOCUS_20550 59688 60764 gene locus_tag LOCUS_20560 gene endA 59688 60764 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903640.1 protein_id gnl|my_center|LOCUS_20560 60876 62012 gene locus_tag LOCUS_20570 60876 62012 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904119.1 protein_id gnl|my_center|LOCUS_20570 62175 63770 gene locus_tag LOCUS_20580 62175 63770 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903639.1 protein_id gnl|my_center|LOCUS_20580 63886 65250 gene locus_tag LOCUS_20590 63886 65250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 65617 67143 gene locus_tag LOCUS_20600 65617 67143 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903869.1 protein_id gnl|my_center|LOCUS_20600 67143 68906 gene locus_tag LOCUS_20610 gene pheT 67143 68906 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903870.1 protein_id gnl|my_center|LOCUS_20610 71743 68942 gene locus_tag LOCUS_20620 71743 68942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 72198 72001 gene locus_tag LOCUS_20630 72198 72001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 72434 72742 gene locus_tag LOCUS_20640 72434 72742 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903872.1 protein_id gnl|my_center|LOCUS_20640 73210 74022 gene locus_tag LOCUS_20650 gene pheA 73210 74022 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903649.1 protein_id gnl|my_center|LOCUS_20650 74183 74782 gene locus_tag LOCUS_20660 74183 74782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 74845 75264 gene locus_tag LOCUS_20670 74845 75264 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_20670 75440 76228 gene locus_tag LOCUS_20680 75440 76228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 77023 76253 gene locus_tag LOCUS_20690 77023 76253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267485.1 protein_id gnl|my_center|LOCUS_20690 77476 77075 gene locus_tag LOCUS_20700 77476 77075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 77848 78531 gene locus_tag LOCUS_20710 77848 78531 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_20710 78570 80072 gene locus_tag LOCUS_20720 78570 80072 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902931.1 protein_id gnl|my_center|LOCUS_20720 80069 80308 gene locus_tag LOCUS_20730 80069 80308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 82906 80417 gene locus_tag LOCUS_20740 82906 80417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 83688 86336 gene locus_tag LOCUS_20750 gene leuS 83688 86336 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903650.1 protein_id gnl|my_center|LOCUS_20750 86513 87199 gene locus_tag LOCUS_20760 86513 87199 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903274.1 protein_id gnl|my_center|LOCUS_20760 87380 88813 gene locus_tag LOCUS_20770 87380 88813 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_20770 89819 88875 gene locus_tag LOCUS_20780 89819 88875 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289464.1 protein_id gnl|my_center|LOCUS_20780 92040 90361 gene locus_tag LOCUS_20790 gene thsA 92040 90361 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892611.1 protein_id gnl|my_center|LOCUS_20790 92958 92305 gene locus_tag LOCUS_20800 92958 92305 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903653.1 protein_id gnl|my_center|LOCUS_20800 94192 93296 gene locus_tag LOCUS_20810 94192 93296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 95016 94786 gene locus_tag LOCUS_20820 95016 94786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 96002 95127 gene locus_tag LOCUS_20830 gene rio1 96002 95127 CDS product serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289466.1 protein_id gnl|my_center|LOCUS_20830 96164 96529 gene locus_tag LOCUS_20840 96164 96529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 96591 98003 gene locus_tag LOCUS_20850 96591 98003 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 protein_id gnl|my_center|LOCUS_20850 98000 98401 gene locus_tag LOCUS_20860 98000 98401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 98708 99070 gene locus_tag LOCUS_20870 98708 99070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 101053 99119 gene locus_tag LOCUS_20880 101053 99119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 102140 101130 gene locus_tag LOCUS_20890 102140 101130 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964920.1 protein_id gnl|my_center|LOCUS_20890 103030 102203 gene locus_tag LOCUS_20900 103030 102203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 103944 103027 gene locus_tag LOCUS_20910 103944 103027 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024091.1 protein_id gnl|my_center|LOCUS_20910 105177 104050 gene locus_tag LOCUS_20920 105177 104050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 105403 108249 gene locus_tag LOCUS_20930 gene leuS 105403 108249 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_20930 109134 108325 gene locus_tag LOCUS_20940 109134 108325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 109671 111746 gene locus_tag LOCUS_20950 gene ligA 109671 111746 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403650.1 protein_id gnl|my_center|LOCUS_20950 112225 112037 gene locus_tag LOCUS_20960 112225 112037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 113286 112282 gene locus_tag LOCUS_20970 113286 112282 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_20970 114340 113381 gene locus_tag LOCUS_20980 114340 113381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 115263 114337 gene locus_tag LOCUS_20990 115263 114337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_20990 115658 115389 gene locus_tag LOCUS_21000 115658 115389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903776.1 protein_id gnl|my_center|LOCUS_21000 115784 116500 gene locus_tag LOCUS_21010 115784 116500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 116527 118386 gene locus_tag LOCUS_21020 116527 118386 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903778.1 protein_id gnl|my_center|LOCUS_21020 118479 119069 gene locus_tag LOCUS_21030 118479 119069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 119152 119448 gene locus_tag LOCUS_21040 gene yciH 119152 119448 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_21040 119599 120078 gene locus_tag LOCUS_21050 119599 120078 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222818.1 protein_id gnl|my_center|LOCUS_21050 120205 120687 gene locus_tag LOCUS_21060 120205 120687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21060 120889 122205 gene locus_tag LOCUS_21070 gene nrfD 120889 122205 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902582.1 protein_id gnl|my_center|LOCUS_21070 122459 123688 gene locus_tag LOCUS_21080 122459 123688 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020013.1 protein_id gnl|my_center|LOCUS_21080 124346 124861 gene locus_tag LOCUS_21090 124346 124861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 124861 125565 gene locus_tag LOCUS_21100 124861 125565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 125638 126276 gene locus_tag LOCUS_21110 125638 126276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 128454 126400 gene locus_tag LOCUS_21120 gene uvrB 128454 126400 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903784.1 protein_id gnl|my_center|LOCUS_21120 129293 128580 gene locus_tag LOCUS_21130 129293 128580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 129580 129849 gene locus_tag LOCUS_21140 129580 129849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 131060 129930 gene locus_tag LOCUS_21150 131060 129930 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903688.1 protein_id gnl|my_center|LOCUS_21150 131188 131439 gene locus_tag LOCUS_21160 131188 131439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 132316 131621 gene locus_tag LOCUS_21170 132316 131621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 132519 133316 gene locus_tag LOCUS_21180 132519 133316 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902721.1 protein_id gnl|my_center|LOCUS_21180 133321 134385 gene locus_tag LOCUS_21190 133321 134385 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902730.1 protein_id gnl|my_center|LOCUS_21190 134483 134860 gene locus_tag LOCUS_21200 134483 134860 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404257.1 protein_id gnl|my_center|LOCUS_21200 134865 135953 gene locus_tag LOCUS_21210 134865 135953 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405378.1 protein_id gnl|my_center|LOCUS_21210 135994 136917 gene locus_tag LOCUS_21220 135994 136917 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404256.1 protein_id gnl|my_center|LOCUS_21220 136983 137237 gene locus_tag LOCUS_21230 136983 137237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 139349 137262 gene locus_tag LOCUS_21240 139349 137262 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903687.1 protein_id gnl|my_center|LOCUS_21240 139590 140549 gene locus_tag LOCUS_21250 139590 140549 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902767.1 protein_id gnl|my_center|LOCUS_21250 140810 140586 gene locus_tag LOCUS_21260 140810 140586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 140891 141247 gene locus_tag LOCUS_21270 140891 141247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 141597 141313 gene locus_tag LOCUS_21280 141597 141313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 142109 141792 gene locus_tag LOCUS_21290 142109 141792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 143059 142091 gene locus_tag LOCUS_21300 143059 142091 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361592.1 protein_id gnl|my_center|LOCUS_21300 143180 145531 gene locus_tag LOCUS_21310 gene tatC 143180 145531 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903685.1 protein_id gnl|my_center|LOCUS_21310 145726 145902 gene locus_tag LOCUS_21320 145726 145902 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903684.1 protein_id gnl|my_center|LOCUS_21320 146038 146742 gene locus_tag LOCUS_21330 146038 146742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 147587 146814 gene locus_tag LOCUS_21340 147587 146814 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903682.1 protein_id gnl|my_center|LOCUS_21340 148748 147747 gene locus_tag LOCUS_21350 148748 147747 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105579.1 protein_id gnl|my_center|LOCUS_21350 149010 149780 gene locus_tag LOCUS_21360 149010 149780 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903677.1 protein_id gnl|my_center|LOCUS_21360 150000 153902 gene locus_tag LOCUS_21370 150000 153902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 154078 154371 gene locus_tag LOCUS_21380 154078 154371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 155283 154414 gene locus_tag LOCUS_21390 155283 154414 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_21390 155504 156589 gene locus_tag LOCUS_21400 gene priL 155504 156589 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_21400 156922 156653 gene locus_tag LOCUS_21410 156922 156653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 157197 157739 gene locus_tag LOCUS_21420 157197 157739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 158295 157777 gene locus_tag LOCUS_21430 gene hjc 158295 157777 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903673.1 protein_id gnl|my_center|LOCUS_21430 159164 158352 gene locus_tag LOCUS_21440 159164 158352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 163713 159244 gene locus_tag LOCUS_21450 163713 159244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 163962 164264 gene locus_tag LOCUS_21460 163962 164264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 164416 165159 gene locus_tag LOCUS_21470 164416 165159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 165413 165901 gene locus_tag LOCUS_21480 165413 165901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 167330 166041 gene locus_tag LOCUS_21490 167330 166041 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903672.1 protein_id gnl|my_center|LOCUS_21490 168302 167580 gene locus_tag LOCUS_21500 168302 167580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 169795 168497 gene locus_tag LOCUS_21510 169795 168497 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903671.1 protein_id gnl|my_center|LOCUS_21510 169897 170568 gene locus_tag LOCUS_21520 169897 170568 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066526.1 protein_id gnl|my_center|LOCUS_21520 170683 171510 gene locus_tag LOCUS_21530 170683 171510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 174212 171612 gene locus_tag LOCUS_21540 174212 171612 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902482.1 protein_id gnl|my_center|LOCUS_21540 174887 174297 gene locus_tag LOCUS_21550 174887 174297 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289287.1 protein_id gnl|my_center|LOCUS_21550 175014 175211 gene locus_tag LOCUS_21560 175014 175211 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_21560 176723 175326 gene locus_tag LOCUS_21570 176723 175326 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414924.1 protein_id gnl|my_center|LOCUS_21570 177179 177547 gene locus_tag LOCUS_21580 177179 177547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 177827 178687 gene locus_tag LOCUS_21590 gene hisG 177827 178687 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903669.1 protein_id gnl|my_center|LOCUS_21590 179024 178749 gene locus_tag LOCUS_21600 179024 178749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 180080 179520 gene locus_tag LOCUS_21610 180080 179520 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_21610 180278 181372 gene locus_tag LOCUS_21620 180278 181372 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289469.1 protein_id gnl|my_center|LOCUS_21620 181604 181858 gene locus_tag LOCUS_21630 181604 181858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 181860 182324 gene locus_tag LOCUS_21640 181860 182324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 182790 182353 gene locus_tag LOCUS_21650 182790 182353 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903814.1 protein_id gnl|my_center|LOCUS_21650 183376 182915 gene locus_tag LOCUS_21660 183376 182915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 184400 183396 gene locus_tag LOCUS_21670 184400 183396 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903663.1 protein_id gnl|my_center|LOCUS_21670 185573 184440 gene locus_tag LOCUS_21680 185573 184440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 185920 186864 gene locus_tag LOCUS_21690 gene rnz 185920 186864 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903662.1 protein_id gnl|my_center|LOCUS_21690 186965 188938 gene locus_tag LOCUS_21700 186965 188938 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903661.1 protein_id gnl|my_center|LOCUS_21700 189208 188948 gene locus_tag LOCUS_21710 189208 188948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 189453 189274 gene locus_tag LOCUS_21720 189453 189274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 189587 189877 gene locus_tag LOCUS_21730 gene eif1A 189587 189877 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903658.1 protein_id gnl|my_center|LOCUS_21730 191092 189980 gene locus_tag LOCUS_21740 191092 189980 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963343.1 protein_id gnl|my_center|LOCUS_21740 191975 191502 gene locus_tag LOCUS_21750 191975 191502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 193388 192087 gene locus_tag LOCUS_21760 193388 192087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903808.1 protein_id gnl|my_center|LOCUS_21760 193950 195359 gene locus_tag LOCUS_21770 193950 195359 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903810.1 protein_id gnl|my_center|LOCUS_21770 195356 196561 gene locus_tag LOCUS_21780 gene metX 195356 196561 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289504.1 protein_id gnl|my_center|LOCUS_21780 197136 196759 gene locus_tag LOCUS_21790 197136 196759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 197980 197336 gene locus_tag LOCUS_21800 gene serB 197980 197336 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360913.1 protein_id gnl|my_center|LOCUS_21800 198099 198788 gene locus_tag LOCUS_21810 198099 198788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 198884 200377 gene locus_tag LOCUS_21820 198884 200377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 200865 200410 gene locus_tag LOCUS_21830 200865 200410 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902409.1 protein_id gnl|my_center|LOCUS_21830 201066 202676 gene locus_tag LOCUS_21840 gene serA 201066 202676 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903813.1 protein_id gnl|my_center|LOCUS_21840 202885 203253 gene locus_tag LOCUS_21850 gene hisI 202885 203253 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903699.1 protein_id gnl|my_center|LOCUS_21850 203255 204436 gene locus_tag LOCUS_21860 203255 204436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903638.1 protein_id gnl|my_center|LOCUS_21860 204610 204765 gene locus_tag LOCUS_21870 204610 204765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 206165 204789 gene locus_tag LOCUS_21880 gene glmM 206165 204789 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903637.1 protein_id gnl|my_center|LOCUS_21880 206268 207122 gene locus_tag LOCUS_21890 206268 207122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903635.1 protein_id gnl|my_center|LOCUS_21890 207579 208436 gene locus_tag LOCUS_21900 207579 208436 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903634.1 protein_id gnl|my_center|LOCUS_21900 208540 209079 gene locus_tag LOCUS_21910 208540 209079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 211283 209187 gene locus_tag LOCUS_21920 211283 209187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 214766 211560 gene locus_tag LOCUS_21930 gene ileS 214766 211560 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903625.1 protein_id gnl|my_center|LOCUS_21930 215189 214959 gene locus_tag LOCUS_21940 215189 214959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 215306 216025 gene locus_tag LOCUS_21950 215306 216025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 216217 216636 gene locus_tag LOCUS_21960 216217 216636 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903622.1 protein_id gnl|my_center|LOCUS_21960 216764 216994 gene locus_tag LOCUS_21970 216764 216994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 217083 218093 gene locus_tag LOCUS_21980 217083 218093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904167.1 protein_id gnl|my_center|LOCUS_21980 218487 218236 gene locus_tag LOCUS_21990 218487 218236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 218809 219135 gene locus_tag LOCUS_22000 218809 219135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 220230 219205 gene locus_tag LOCUS_22010 220230 219205 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289477.1 protein_id gnl|my_center|LOCUS_22010 220397 220909 gene locus_tag LOCUS_22020 220397 220909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 221339 220881 gene locus_tag LOCUS_22030 221339 220881 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890456.1 protein_id gnl|my_center|LOCUS_22030 221970 222374 gene locus_tag LOCUS_22040 221970 222374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 222379 222885 gene locus_tag LOCUS_22050 222379 222885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 222885 223820 gene locus_tag LOCUS_22060 222885 223820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 223813 225864 gene locus_tag LOCUS_22070 223813 225864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 226476 226087 gene locus_tag LOCUS_22080 gene fer2 226476 226087 CDS product ferredoxin Fer2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903707.1 protein_id gnl|my_center|LOCUS_22080 228184 227003 gene locus_tag LOCUS_22090 228184 227003 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_22090 228735 228310 gene locus_tag LOCUS_22100 228735 228310 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_22100 230068 228890 gene locus_tag LOCUS_22110 230068 228890 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_22110 230569 230186 gene locus_tag LOCUS_22120 230569 230186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 230907 231659 gene locus_tag LOCUS_22130 gene hisA 230907 231659 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903708.1 protein_id gnl|my_center|LOCUS_22130 232211 231945 gene locus_tag LOCUS_22140 232211 231945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 232476 233063 gene locus_tag LOCUS_22150 gene hisB 232476 233063 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903709.1 protein_id gnl|my_center|LOCUS_22150 233922 233131 gene locus_tag LOCUS_22160 233922 233131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 234048 234551 gene locus_tag LOCUS_22170 234048 234551 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289478.1 protein_id gnl|my_center|LOCUS_22170 234966 234559 gene locus_tag LOCUS_22180 234966 234559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 235164 235781 gene locus_tag LOCUS_22190 235164 235781 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903713.1 protein_id gnl|my_center|LOCUS_22190 236042 235824 gene locus_tag LOCUS_22200 236042 235824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 236114 238222 gene locus_tag LOCUS_22210 236114 238222 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903716.1 protein_id gnl|my_center|LOCUS_22210 238354 238560 gene locus_tag LOCUS_22220 238354 238560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 239770 239063 gene locus_tag LOCUS_22230 gene upp 239770 239063 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903718.1 protein_id gnl|my_center|LOCUS_22230 240015 240692 gene locus_tag LOCUS_22240 240015 240692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 240819 241541 gene locus_tag LOCUS_22250 240819 241541 CDS product DUF5828 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903719.1 protein_id gnl|my_center|LOCUS_22250 243270 242221 gene locus_tag LOCUS_22260 243270 242221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 244108 243263 gene locus_tag LOCUS_22270 244108 243263 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_22270 244968 244105 gene locus_tag LOCUS_22280 244968 244105 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_22280 245819 244983 gene locus_tag LOCUS_22290 245819 244983 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_22290 245999 247195 gene locus_tag LOCUS_22300 245999 247195 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903720.1 protein_id gnl|my_center|LOCUS_22300 247245 247985 gene locus_tag LOCUS_22310 247245 247985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 249394 247991 gene locus_tag LOCUS_22320 249394 247991 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_22320 249450 249812 gene locus_tag LOCUS_22330 249450 249812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 249812 250327 gene locus_tag LOCUS_22340 249812 250327 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903723.1 protein_id gnl|my_center|LOCUS_22340 250382 250969 gene locus_tag LOCUS_22350 250382 250969 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_22350 251084 251296 gene locus_tag LOCUS_22360 251084 251296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 252008 251322 gene locus_tag LOCUS_22370 252008 251322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289480.1 protein_id gnl|my_center|LOCUS_22370 252780 252190 gene locus_tag LOCUS_22380 252780 252190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289482.1 protein_id gnl|my_center|LOCUS_22380 252962 255166 gene locus_tag LOCUS_22390 252962 255166 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_22390 255686 255246 gene locus_tag LOCUS_22400 255686 255246 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902004.1 protein_id gnl|my_center|LOCUS_22400 255961 255683 gene locus_tag LOCUS_22410 255961 255683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289087.1 protein_id gnl|my_center|LOCUS_22410 256821 256084 gene locus_tag LOCUS_22420 256821 256084 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903867.1 protein_id gnl|my_center|LOCUS_22420 258223 256982 gene locus_tag LOCUS_22430 258223 256982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 259318 258533 gene locus_tag LOCUS_22440 gene pcaD 259318 258533 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_22440 259542 260735 gene locus_tag LOCUS_22450 259542 260735 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405030.1 protein_id gnl|my_center|LOCUS_22450 263584 260807 gene locus_tag LOCUS_22460 gene alaS 263584 260807 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903698.1 protein_id gnl|my_center|LOCUS_22460 264129 264347 gene locus_tag LOCUS_22470 264129 264347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 264465 266558 gene locus_tag LOCUS_22480 264465 266558 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902645.1 protein_id gnl|my_center|LOCUS_22480 267616 266624 gene locus_tag LOCUS_22490 267616 266624 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903695.1 protein_id gnl|my_center|LOCUS_22490 267779 268873 gene locus_tag LOCUS_22500 267779 268873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 protein_id gnl|my_center|LOCUS_22500 268933 269184 gene locus_tag LOCUS_22510 268933 269184 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289475.1 protein_id gnl|my_center|LOCUS_22510 269479 269907 gene locus_tag LOCUS_22520 269479 269907 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903693.1 protein_id gnl|my_center|LOCUS_22520 269980 270342 gene locus_tag LOCUS_22530 269980 270342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 271745 270366 gene locus_tag LOCUS_22540 271745 270366 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289493.1 protein_id gnl|my_center|LOCUS_22540 272166 271918 gene locus_tag LOCUS_22550 272166 271918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 273521 272343 gene locus_tag LOCUS_22560 273521 272343 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903772.1 protein_id gnl|my_center|LOCUS_22560 273734 274171 gene locus_tag LOCUS_22570 273734 274171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 <275461 274349 gene locus_tag LOCUS_22580 <275461 274349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289503.1:DNA-directed DNA polymerase II small subunit >Feature sequence52 471 1388 gene locus_tag LOCUS_22590 471 1388 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903805.1 protein_id gnl|my_center|LOCUS_22590 1453 2400 gene locus_tag LOCUS_22600 1453 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 4438 2654 gene locus_tag LOCUS_22610 gene orc7 4438 2654 CDS product DNA replication protein Orc7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903800.1 protein_id gnl|my_center|LOCUS_22610 5097 5300 gene locus_tag LOCUS_22620 5097 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 5820 6458 gene locus_tag LOCUS_22630 5820 6458 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289501.1 protein_id gnl|my_center|LOCUS_22630 6465 6866 gene locus_tag LOCUS_22640 6465 6866 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289500.1 protein_id gnl|my_center|LOCUS_22640 6866 7840 gene locus_tag LOCUS_22650 6866 7840 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903797.1 protein_id gnl|my_center|LOCUS_22650 8030 8254 gene locus_tag LOCUS_22660 8030 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 8254 9036 gene locus_tag LOCUS_22670 8254 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903794.1 protein_id gnl|my_center|LOCUS_22670 9728 9150 gene locus_tag LOCUS_22680 9728 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289498.1 protein_id gnl|my_center|LOCUS_22680 10081 10761 gene locus_tag LOCUS_22690 10081 10761 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289497.1 protein_id gnl|my_center|LOCUS_22690 11474 10899 gene locus_tag LOCUS_22700 11474 10899 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902507.1 protein_id gnl|my_center|LOCUS_22700 11847 11611 gene locus_tag LOCUS_22710 11847 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 11967 14339 gene locus_tag LOCUS_22720 11967 14339 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903005.1 protein_id gnl|my_center|LOCUS_22720 14851 14354 gene locus_tag LOCUS_22730 14851 14354 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902542.1 protein_id gnl|my_center|LOCUS_22730 15156 14848 gene locus_tag LOCUS_22740 15156 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903804.1 protein_id gnl|my_center|LOCUS_22740 15396 17324 gene locus_tag LOCUS_22750 15396 17324 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 protein_id gnl|my_center|LOCUS_22750 17778 17479 gene locus_tag LOCUS_22760 17778 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 18911 17862 gene locus_tag LOCUS_22770 18911 17862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903790.1 protein_id gnl|my_center|LOCUS_22770 20656 18908 gene locus_tag LOCUS_22780 20656 18908 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903789.1 protein_id gnl|my_center|LOCUS_22780 20543 20818 gene locus_tag LOCUS_22790 20543 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 21905 20826 gene locus_tag LOCUS_22800 21905 20826 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903788.1 protein_id gnl|my_center|LOCUS_22800 22014 23135 gene locus_tag LOCUS_22810 22014 23135 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250113.1 protein_id gnl|my_center|LOCUS_22810 23594 23250 gene locus_tag LOCUS_22820 23594 23250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 23865 24077 gene locus_tag LOCUS_22830 23865 24077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 25689 24085 gene locus_tag LOCUS_22840 25689 24085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903388.1 protein_id gnl|my_center|LOCUS_22840 25897 25703 gene locus_tag LOCUS_22850 25897 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 26177 26779 gene locus_tag LOCUS_22860 26177 26779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 28126 26819 gene locus_tag LOCUS_22870 28126 26819 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065859.1 protein_id gnl|my_center|LOCUS_22870 28929 28123 gene locus_tag LOCUS_22880 28929 28123 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_22880 29344 29030 gene locus_tag LOCUS_22890 29344 29030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 29703 30641 gene locus_tag LOCUS_22900 29703 30641 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_22900 30638 31480 gene locus_tag LOCUS_22910 30638 31480 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967625.1 protein_id gnl|my_center|LOCUS_22910 31568 32275 gene locus_tag LOCUS_22920 gene rpiA 31568 32275 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903689.1 protein_id gnl|my_center|LOCUS_22920 32747 32295 gene locus_tag LOCUS_22930 32747 32295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 32882 33943 gene locus_tag LOCUS_22940 gene fni 32882 33943 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904022.1 protein_id gnl|my_center|LOCUS_22940 34218 34051 gene locus_tag LOCUS_22950 34218 34051 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903690.1 protein_id gnl|my_center|LOCUS_22950 34965 35213 gene locus_tag LOCUS_22960 34965 35213 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_22960 35308 36243 gene locus_tag LOCUS_22970 35308 36243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 36320 37714 gene locus_tag LOCUS_22980 36320 37714 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903692.1 protein_id gnl|my_center|LOCUS_22980 38522 38007 gene locus_tag LOCUS_22990 gene cysE 38522 38007 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903081.1 protein_id gnl|my_center|LOCUS_22990 39389 38721 gene locus_tag LOCUS_23000 39389 38721 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903770.1 protein_id gnl|my_center|LOCUS_23000 40093 39503 gene locus_tag LOCUS_23010 gene purO 40093 39503 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903769.1 protein_id gnl|my_center|LOCUS_23010 40349 40422 gene locus_tag LOCUS_t00220 40349 40422 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 40552 41301 gene locus_tag LOCUS_23020 40552 41301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 42673 41303 gene locus_tag LOCUS_23030 42673 41303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 43120 42770 gene locus_tag LOCUS_23040 43120 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 43780 43274 gene locus_tag LOCUS_23050 gene cgi121 43780 43274 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903768.1 protein_id gnl|my_center|LOCUS_23050 46140 43780 gene locus_tag LOCUS_23060 46140 43780 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903767.1 protein_id gnl|my_center|LOCUS_23060 46294 46731 gene locus_tag LOCUS_23070 46294 46731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 47966 46758 gene locus_tag LOCUS_23080 47966 46758 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904113.1 protein_id gnl|my_center|LOCUS_23080 48884 48069 gene locus_tag LOCUS_23090 48884 48069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 48999 49244 gene locus_tag LOCUS_23100 48999 49244 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903766.1 protein_id gnl|my_center|LOCUS_23100 50291 49377 gene locus_tag LOCUS_23110 gene mdh 50291 49377 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903765.1 protein_id gnl|my_center|LOCUS_23110 50508 50999 gene locus_tag LOCUS_23120 50508 50999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 51075 51818 gene locus_tag LOCUS_23130 51075 51818 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903764.1 protein_id gnl|my_center|LOCUS_23130 52222 51923 gene locus_tag LOCUS_23140 52222 51923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 52216 53067 gene locus_tag LOCUS_23150 52216 53067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 55595 53136 gene locus_tag LOCUS_23160 55595 53136 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903758.1 protein_id gnl|my_center|LOCUS_23160 56069 56575 gene locus_tag LOCUS_23170 56069 56575 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_23170 57214 56621 gene locus_tag LOCUS_23180 57214 56621 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289491.1 protein_id gnl|my_center|LOCUS_23180 59189 57405 gene locus_tag LOCUS_23190 gene glyS 59189 57405 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903756.1 protein_id gnl|my_center|LOCUS_23190 60036 59182 gene locus_tag LOCUS_23200 60036 59182 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903755.1 protein_id gnl|my_center|LOCUS_23200 60169 60330 gene locus_tag LOCUS_23210 60169 60330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 60496 61011 gene locus_tag LOCUS_23220 60496 61011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 61397 62029 gene locus_tag LOCUS_23230 61397 62029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 63841 62507 gene locus_tag LOCUS_23240 63841 62507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 65000 63834 gene locus_tag LOCUS_23250 65000 63834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_23250 66034 65003 gene locus_tag LOCUS_23260 66034 65003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_23260 67038 66037 gene locus_tag LOCUS_23270 67038 66037 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810095.1 protein_id gnl|my_center|LOCUS_23270 68736 67153 gene locus_tag LOCUS_23280 68736 67153 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_23280 68992 69411 gene locus_tag LOCUS_23290 68992 69411 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903746.1 protein_id gnl|my_center|LOCUS_23290 69413 73063 gene locus_tag LOCUS_23300 69413 73063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 74285 73374 gene locus_tag LOCUS_23310 74285 73374 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812528.1 protein_id gnl|my_center|LOCUS_23310 74691 75029 gene locus_tag LOCUS_23320 74691 75029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 75133 75426 gene locus_tag LOCUS_23330 75133 75426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 75957 78431 gene locus_tag LOCUS_23340 gene csg 75957 78431 CDS product HVO_2072 family ArtA-dependent S-layer glycoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289536.1 protein_id gnl|my_center|LOCUS_23340 78658 79566 gene locus_tag LOCUS_23350 78658 79566 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902504.1 protein_id gnl|my_center|LOCUS_23350 80100 79690 gene locus_tag LOCUS_23360 80100 79690 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903744.1 protein_id gnl|my_center|LOCUS_23360 80451 80134 gene locus_tag LOCUS_23370 80451 80134 CDS product DUF5783 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289487.1 protein_id gnl|my_center|LOCUS_23370 80672 81064 gene locus_tag LOCUS_23380 80672 81064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 81895 81095 gene locus_tag LOCUS_23390 81895 81095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 82824 81892 gene locus_tag LOCUS_23400 82824 81892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 83867 84622 gene locus_tag LOCUS_23410 83867 84622 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101294608.1 protein_id gnl|my_center|LOCUS_23410 86183 84699 gene locus_tag LOCUS_23420 86183 84699 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903741.1 protein_id gnl|my_center|LOCUS_23420 86362 87234 gene locus_tag LOCUS_23430 86362 87234 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892525.1 protein_id gnl|my_center|LOCUS_23430 87238 87915 gene locus_tag LOCUS_23440 87238 87915 CDS product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227829.1 protein_id gnl|my_center|LOCUS_23440 87912 88931 gene locus_tag LOCUS_23450 87912 88931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 89353 89051 gene locus_tag LOCUS_23460 89353 89051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 90224 89481 gene locus_tag LOCUS_23470 90224 89481 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903740.1 protein_id gnl|my_center|LOCUS_23470 91025 90228 gene locus_tag LOCUS_23480 gene cobA 91025 90228 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903739.1 protein_id gnl|my_center|LOCUS_23480 92161 91040 gene locus_tag LOCUS_23490 gene hemC 92161 91040 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903738.1 protein_id gnl|my_center|LOCUS_23490 92387 92752 gene locus_tag LOCUS_23500 92387 92752 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_23500 92968 95256 gene locus_tag LOCUS_23510 92968 95256 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444167.1 protein_id gnl|my_center|LOCUS_23510 96849 95395 gene locus_tag LOCUS_23520 96849 95395 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903735.1 protein_id gnl|my_center|LOCUS_23520 98766 97066 gene locus_tag LOCUS_23530 98766 97066 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256890.1 protein_id gnl|my_center|LOCUS_23530 100272 99259 gene locus_tag LOCUS_23540 gene hemB 100272 99259 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903732.1 protein_id gnl|my_center|LOCUS_23540 100498 100821 gene locus_tag LOCUS_23550 100498 100821 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903863.1 protein_id gnl|my_center|LOCUS_23550 101026 100838 gene locus_tag LOCUS_23560 101026 100838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 101838 101059 gene locus_tag LOCUS_23570 101838 101059 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903861.1 protein_id gnl|my_center|LOCUS_23570 101997 102284 gene locus_tag LOCUS_23580 101997 102284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360936.1 protein_id gnl|my_center|LOCUS_23580 103399 102338 gene locus_tag LOCUS_23590 103399 102338 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403481.1 protein_id gnl|my_center|LOCUS_23590 104341 103490 gene locus_tag LOCUS_23600 104341 103490 CDS product DUF5784 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289319.1 protein_id gnl|my_center|LOCUS_23600 104676 104843 gene locus_tag LOCUS_23610 104676 104843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 105577 104840 gene locus_tag LOCUS_23620 105577 104840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903860.1 protein_id gnl|my_center|LOCUS_23620 106527 105574 gene locus_tag LOCUS_23630 106527 105574 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903859.1 protein_id gnl|my_center|LOCUS_23630 107538 106558 gene locus_tag LOCUS_23640 107538 106558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 107661 107906 gene locus_tag LOCUS_23650 107661 107906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289513.1 protein_id gnl|my_center|LOCUS_23650 108371 110236 gene locus_tag LOCUS_23660 108371 110236 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289512.1 protein_id gnl|my_center|LOCUS_23660 111772 110525 gene locus_tag LOCUS_23670 111772 110525 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903851.1 protein_id gnl|my_center|LOCUS_23670 112889 111765 gene locus_tag LOCUS_23680 112889 111765 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903850.1 protein_id gnl|my_center|LOCUS_23680 113871 113185 gene locus_tag LOCUS_23690 113871 113185 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_23690 114687 114220 gene locus_tag LOCUS_23700 114687 114220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 115013 114684 gene locus_tag LOCUS_23710 115013 114684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 115367 115131 gene locus_tag LOCUS_23720 115367 115131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 115976 115623 gene locus_tag LOCUS_23730 115976 115623 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_23730 116256 115984 gene locus_tag LOCUS_23740 116256 115984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 116539 116303 gene locus_tag LOCUS_23750 116539 116303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 116904 116683 gene locus_tag LOCUS_23760 116904 116683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 117181 117366 gene locus_tag LOCUS_23770 117181 117366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 117487 118380 gene locus_tag LOCUS_23780 gene htpX 117487 118380 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_23780 118405 119115 gene locus_tag LOCUS_23790 118405 119115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_23790 119041 119045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 119108 120316 gene locus_tag LOCUS_23800 119108 120316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 120457 121488 gene locus_tag LOCUS_23810 gene radA 120457 121488 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289511.1 protein_id gnl|my_center|LOCUS_23810 121976 123349 gene locus_tag LOCUS_23820 121976 123349 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_23820 123346 124944 gene locus_tag LOCUS_23830 123346 124944 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904086.1 protein_id gnl|my_center|LOCUS_23830 124941 126833 gene locus_tag LOCUS_23840 124941 126833 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904087.1 protein_id gnl|my_center|LOCUS_23840 126830 127492 gene locus_tag LOCUS_23850 126830 127492 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904088.1 protein_id gnl|my_center|LOCUS_23850 127489 128961 gene locus_tag LOCUS_23860 127489 128961 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904089.1 protein_id gnl|my_center|LOCUS_23860 128965 130848 gene locus_tag LOCUS_23870 128965 130848 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904090.1 protein_id gnl|my_center|LOCUS_23870 131364 130942 gene locus_tag LOCUS_23880 131364 130942 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903848.1 protein_id gnl|my_center|LOCUS_23880 132242 131610 gene locus_tag LOCUS_23890 132242 131610 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_23890 132815 132363 gene locus_tag LOCUS_23900 132815 132363 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_23900 133266 133469 gene locus_tag LOCUS_23910 133266 133469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 133566 133934 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctacaagggtccttctgaaacc 135430 134183 gene locus_tag LOCUS_23920 135430 134183 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903847.1 protein_id gnl|my_center|LOCUS_23920 135607 136119 gene locus_tag LOCUS_23930 135607 136119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 136432 136139 gene locus_tag LOCUS_23940 136432 136139 CDS product DUF424 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903846.1 protein_id gnl|my_center|LOCUS_23940 137387 136437 gene locus_tag LOCUS_23950 137387 136437 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903845.1 protein_id gnl|my_center|LOCUS_23950 139103 137478 gene locus_tag LOCUS_23960 139103 137478 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 protein_id gnl|my_center|LOCUS_23960 139350 139096 gene locus_tag LOCUS_23970 139350 139096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 139234 139791 gene locus_tag LOCUS_23980 gene thpR 139234 139791 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_23980 140084 140932 gene locus_tag LOCUS_23990 140084 140932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 141912 140998 gene locus_tag LOCUS_24000 gene htpX 141912 140998 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_24000 142361 142639 gene locus_tag LOCUS_24010 142361 142639 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903843.1 protein_id gnl|my_center|LOCUS_24010 142642 143307 gene locus_tag LOCUS_24020 142642 143307 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903842.1 protein_id gnl|my_center|LOCUS_24020 143887 143576 gene locus_tag LOCUS_24030 143887 143576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 144040 144216 gene locus_tag LOCUS_24040 144040 144216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 144213 144659 gene locus_tag LOCUS_24050 144213 144659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 144685 146301 gene locus_tag LOCUS_24060 144685 146301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 146382 147017 gene locus_tag LOCUS_24070 146382 147017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 147350 149035 gene locus_tag LOCUS_24080 147350 149035 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119621.1 protein_id gnl|my_center|LOCUS_24080 149025 150680 gene locus_tag LOCUS_24090 149025 150680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 150902 150579 gene locus_tag LOCUS_24100 150902 150579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 151146 151751 gene locus_tag LOCUS_24110 151146 151751 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929042.1 protein_id gnl|my_center|LOCUS_24110 152463 151774 gene locus_tag LOCUS_24120 152463 151774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 152586 153251 gene locus_tag LOCUS_24130 gene thiE 152586 153251 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_24130 153248 154078 gene locus_tag LOCUS_24140 gene thiM 153248 154078 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256281.1 protein_id gnl|my_center|LOCUS_24140 154182 154454 gene locus_tag LOCUS_24150 154182 154454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 155144 154509 gene locus_tag LOCUS_24160 155144 154509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903785.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence53 1147 281 gene locus_tag LOCUS_24170 1147 281 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289496.1 protein_id gnl|my_center|LOCUS_24170 1427 2236 gene locus_tag LOCUS_24180 1427 2236 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903787.1 protein_id gnl|my_center|LOCUS_24180 2525 2304 gene locus_tag LOCUS_24190 2525 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2702 4096 gene locus_tag LOCUS_24200 2702 4096 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903838.1 protein_id gnl|my_center|LOCUS_24200 4256 5266 gene locus_tag LOCUS_24210 4256 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 6206 5271 gene locus_tag LOCUS_24220 6206 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 6717 6304 gene locus_tag LOCUS_24230 6717 6304 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903834.1 protein_id gnl|my_center|LOCUS_24230 7298 6714 gene locus_tag LOCUS_24240 7298 6714 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903833.1 protein_id gnl|my_center|LOCUS_24240 8093 8167 gene locus_tag LOCUS_t00230 8093 8167 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8370 11492 gene locus_tag LOCUS_24250 8370 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 11627 12235 gene locus_tag LOCUS_24260 11627 12235 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227885.1 protein_id gnl|my_center|LOCUS_24260 12284 12907 gene locus_tag LOCUS_24270 12284 12907 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902402.1 protein_id gnl|my_center|LOCUS_24270 12904 13554 gene locus_tag LOCUS_24280 12904 13554 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_24280 14087 13593 gene locus_tag LOCUS_24290 14087 13593 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904081.1 protein_id gnl|my_center|LOCUS_24290 15272 14178 gene locus_tag LOCUS_24300 15272 14178 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903831.1 protein_id gnl|my_center|LOCUS_24300 16322 15357 gene locus_tag LOCUS_24310 16322 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 16772 16626 gene locus_tag LOCUS_24320 16772 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 17737 17162 gene locus_tag LOCUS_24330 17737 17162 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289508.1 protein_id gnl|my_center|LOCUS_24330 17895 18839 gene locus_tag LOCUS_24340 17895 18839 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_24340 19268 18858 gene locus_tag LOCUS_24350 19268 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 19414 21585 gene locus_tag LOCUS_24360 19414 21585 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903824.1 protein_id gnl|my_center|LOCUS_24360 22098 21598 gene locus_tag LOCUS_24370 22098 21598 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289507.1 protein_id gnl|my_center|LOCUS_24370 22360 22166 gene locus_tag LOCUS_24380 22360 22166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 22447 23571 gene locus_tag LOCUS_24390 22447 23571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_24390 23912 25150 gene locus_tag LOCUS_24400 23912 25150 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903821.1 protein_id gnl|my_center|LOCUS_24400 25378 26691 gene locus_tag LOCUS_24410 gene argH 25378 26691 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903820.1 protein_id gnl|my_center|LOCUS_24410 26920 27084 gene locus_tag LOCUS_24420 gene lysW 26920 27084 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_24420 27081 27962 gene locus_tag LOCUS_24430 gene lysX 27081 27962 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_24430 27962 29038 gene locus_tag LOCUS_24440 gene argC 27962 29038 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_24440 29040 29897 gene locus_tag LOCUS_24450 29040 29897 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_24450 29894 31048 gene locus_tag LOCUS_24460 29894 31048 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_24460 31045 32154 gene locus_tag LOCUS_24470 31045 32154 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257089.1 protein_id gnl|my_center|LOCUS_24470 32207 33127 gene locus_tag LOCUS_24480 gene argF 32207 33127 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence54 432 659 gene locus_tag LOCUS_24490 432 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 716 1975 gene locus_tag LOCUS_24500 gene thrC 716 1975 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903816.1 protein_id gnl|my_center|LOCUS_24500 2066 2404 gene locus_tag LOCUS_24510 2066 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2508 3407 gene locus_tag LOCUS_24520 2508 3407 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903620.1 protein_id gnl|my_center|LOCUS_24520 9014 3570 gene locus_tag LOCUS_24530 9014 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 10338 10266 gene locus_tag LOCUS_t00240 10338 10266 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10422 10676 gene locus_tag LOCUS_24540 10422 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 11389 10697 gene locus_tag LOCUS_24550 11389 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 11270 11527 gene locus_tag LOCUS_24560 11270 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 13596 11524 gene locus_tag LOCUS_24570 13596 11524 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289450.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence55 156 476 gene locus_tag LOCUS_24580 156 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1529 492 gene locus_tag LOCUS_24590 1529 492 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903905.1 protein_id gnl|my_center|LOCUS_24590 1808 1623 gene locus_tag LOCUS_24600 1808 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2248 1805 gene locus_tag LOCUS_24610 2248 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24610 2380 2772 gene locus_tag LOCUS_24620 2380 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 3669 2812 gene locus_tag LOCUS_24630 3669 2812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903907.1 protein_id gnl|my_center|LOCUS_24630 4775 3669 gene locus_tag LOCUS_24640 4775 3669 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903913.1 protein_id gnl|my_center|LOCUS_24640 5265 4900 gene locus_tag LOCUS_24650 5265 4900 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_24650 5599 5375 gene locus_tag LOCUS_24660 5599 5375 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_24660 5876 5658 gene locus_tag LOCUS_24670 5876 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 5960 6421 gene locus_tag LOCUS_24680 5960 6421 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902895.1 protein_id gnl|my_center|LOCUS_24680 6720 8216 gene locus_tag LOCUS_24690 6720 8216 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404786.1 protein_id gnl|my_center|LOCUS_24690 8206 10656 gene locus_tag LOCUS_24700 8206 10656 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404785.1 protein_id gnl|my_center|LOCUS_24700 11391 10672 gene locus_tag LOCUS_24710 11391 10672 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892495.1 protein_id gnl|my_center|LOCUS_24710 11525 12541 gene locus_tag LOCUS_24720 11525 12541 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 protein_id gnl|my_center|LOCUS_24720 12664 13470 gene locus_tag LOCUS_24730 12664 13470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 14081 13596 gene locus_tag LOCUS_24740 14081 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 14944 14141 gene locus_tag LOCUS_24750 14944 14141 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_24750 15957 14944 gene locus_tag LOCUS_24760 15957 14944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_24760 17214 16039 gene locus_tag LOCUS_24770 17214 16039 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903606.1 protein_id gnl|my_center|LOCUS_24770 17468 17701 gene locus_tag LOCUS_24780 17468 17701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 17805 18335 gene locus_tag LOCUS_24790 17805 18335 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902023.1 protein_id gnl|my_center|LOCUS_24790 18614 19483 gene locus_tag LOCUS_24800 18614 19483 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902022.1 protein_id gnl|my_center|LOCUS_24800 19914 19513 gene locus_tag LOCUS_24810 19914 19513 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902021.1 protein_id gnl|my_center|LOCUS_24810 21075 20059 gene locus_tag LOCUS_24820 21075 20059 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902020.1 protein_id gnl|my_center|LOCUS_24820 21306 22262 gene locus_tag LOCUS_24830 21306 22262 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902019.1 protein_id gnl|my_center|LOCUS_24830 22394 22975 gene locus_tag LOCUS_24840 22394 22975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903971.1 protein_id gnl|my_center|LOCUS_24840 23033 23686 gene locus_tag LOCUS_24850 23033 23686 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902018.1 protein_id gnl|my_center|LOCUS_24850 23779 24408 gene locus_tag LOCUS_24860 23779 24408 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_24860 24463 25233 gene locus_tag LOCUS_24870 24463 25233 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902016.1 protein_id gnl|my_center|LOCUS_24870 27724 25598 gene locus_tag LOCUS_24880 27724 25598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 28191 28118 gene locus_tag LOCUS_t00250 28191 28118 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28268 28195 gene locus_tag LOCUS_t00260 28268 28195 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28717 28644 gene locus_tag LOCUS_t00270 28717 28644 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28794 28721 gene locus_tag LOCUS_t00280 28794 28721 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 29118 29345 gene locus_tag LOCUS_24890 29118 29345 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876674.1 protein_id gnl|my_center|LOCUS_24890 29346 30926 gene locus_tag LOCUS_24900 29346 30926 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_24900 30930 32759 gene locus_tag LOCUS_24910 gene rpoB 30930 32759 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903997.1 protein_id gnl|my_center|LOCUS_24910 32763 35690 gene locus_tag LOCUS_24920 32763 35690 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903996.1 protein_id gnl|my_center|LOCUS_24920 35683 36879 gene locus_tag LOCUS_24930 gene rpoA2 35683 36879 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903995.1 protein_id gnl|my_center|LOCUS_24930 36883 37308 gene locus_tag LOCUS_24940 36883 37308 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903994.1 protein_id gnl|my_center|LOCUS_24940 37642 39153 gene locus_tag LOCUS_24950 37642 39153 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903877.1 protein_id gnl|my_center|LOCUS_24950 39861 39208 gene locus_tag LOCUS_24960 39861 39208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 40073 40501 gene locus_tag LOCUS_24970 40073 40501 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903993.1 protein_id gnl|my_center|LOCUS_24970 40504 41112 gene locus_tag LOCUS_24980 40504 41112 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903992.1 protein_id gnl|my_center|LOCUS_24980 42130 41375 gene locus_tag LOCUS_24990 42130 41375 CDS product DUF5781 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903991.1 protein_id gnl|my_center|LOCUS_24990 42392 44578 gene locus_tag LOCUS_25000 42392 44578 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903990.1 protein_id gnl|my_center|LOCUS_25000 45103 46638 gene locus_tag LOCUS_25010 45103 46638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 47112 46966 gene locus_tag LOCUS_25020 47112 46966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 48618 47239 gene locus_tag LOCUS_25030 gene serS 48618 47239 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903523.1 protein_id gnl|my_center|LOCUS_25030 48743 49951 gene locus_tag LOCUS_25040 48743 49951 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903549.1 protein_id gnl|my_center|LOCUS_25040 50709 50128 gene locus_tag LOCUS_25050 50709 50128 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903836.1 protein_id gnl|my_center|LOCUS_25050 51284 50709 gene locus_tag LOCUS_25060 51284 50709 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903837.1 protein_id gnl|my_center|LOCUS_25060 51850 51422 gene locus_tag LOCUS_25070 51850 51422 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903408.1 protein_id gnl|my_center|LOCUS_25070 52254 51847 gene locus_tag LOCUS_25080 52254 51847 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903409.1 protein_id gnl|my_center|LOCUS_25080 52403 53416 gene locus_tag LOCUS_25090 52403 53416 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903363.1 protein_id gnl|my_center|LOCUS_25090 54632 53469 gene locus_tag LOCUS_25100 54632 53469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 54781 55704 gene locus_tag LOCUS_25110 54781 55704 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_25110 55901 57925 gene locus_tag LOCUS_25120 55901 57925 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903521.1 protein_id gnl|my_center|LOCUS_25120 58113 60017 gene locus_tag LOCUS_25130 58113 60017 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289426.1 protein_id gnl|my_center|LOCUS_25130 60661 60248 gene locus_tag LOCUS_25140 60661 60248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 60995 60699 gene locus_tag LOCUS_25150 60995 60699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 61019 61324 gene locus_tag LOCUS_25160 61019 61324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 61693 61376 gene locus_tag LOCUS_25170 61693 61376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 63077 61941 gene locus_tag LOCUS_25180 63077 61941 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289424.1 protein_id gnl|my_center|LOCUS_25180 63268 65220 gene locus_tag LOCUS_25190 63268 65220 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878320.1 protein_id gnl|my_center|LOCUS_25190 65311 65967 gene locus_tag LOCUS_25200 65311 65967 CDS product DUF5806 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903887.1 protein_id gnl|my_center|LOCUS_25200 66147 66575 gene locus_tag LOCUS_25210 66147 66575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 66891 66806 gene locus_tag LOCUS_t00290 66891 66806 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 67307 66969 gene locus_tag LOCUS_25220 67307 66969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903405.1 protein_id gnl|my_center|LOCUS_25220 68328 67378 gene locus_tag LOCUS_25230 68328 67378 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_25230 68977 68372 gene locus_tag LOCUS_25240 68977 68372 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289404.1 protein_id gnl|my_center|LOCUS_25240 69629 69111 gene locus_tag LOCUS_25250 69629 69111 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289404.1 protein_id gnl|my_center|LOCUS_25250 69858 70829 gene locus_tag LOCUS_25260 69858 70829 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261387.1 protein_id gnl|my_center|LOCUS_25260 71613 70855 gene locus_tag LOCUS_25270 71613 70855 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence56 2516 1215 gene locus_tag LOCUS_25280 2516 1215 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_25280 3978 2815 gene locus_tag LOCUS_25290 3978 2815 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_25290 4994 4062 gene locus_tag LOCUS_25300 4994 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 6144 5347 gene locus_tag LOCUS_25310 6144 5347 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902271.1 protein_id gnl|my_center|LOCUS_25310 7530 6442 gene locus_tag LOCUS_25320 7530 6442 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903403.1 protein_id gnl|my_center|LOCUS_25320 7948 10239 gene locus_tag LOCUS_25330 7948 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 10365 11369 gene locus_tag LOCUS_25340 10365 11369 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_25340 13224 11407 gene locus_tag LOCUS_25350 13224 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 14659 13316 gene locus_tag LOCUS_25360 14659 13316 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_25360 14890 15804 gene locus_tag LOCUS_25370 14890 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 17402 15855 gene locus_tag LOCUS_25380 gene hfsF 17402 15855 CDS product polysaccharide biosynthesis protein HsfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920284.1 protein_id gnl|my_center|LOCUS_25380 18606 17422 gene locus_tag LOCUS_25390 18606 17422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 18906 20090 gene locus_tag LOCUS_25400 18906 20090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 20176 21255 gene locus_tag LOCUS_25410 gene wecB 20176 21255 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_25410 21322 22239 gene locus_tag LOCUS_25420 21322 22239 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461825.1 protein_id gnl|my_center|LOCUS_25420 22226 23572 gene locus_tag LOCUS_25430 22226 23572 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869927.1 protein_id gnl|my_center|LOCUS_25430 23692 24921 gene locus_tag LOCUS_25440 23692 24921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 25678 25025 gene locus_tag LOCUS_25450 25678 25025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 26781 25747 gene locus_tag LOCUS_25460 26781 25747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 27794 26778 gene locus_tag LOCUS_25470 27794 26778 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_25470 28788 27781 gene locus_tag LOCUS_25480 28788 27781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_25480 29958 28792 gene locus_tag LOCUS_25490 29958 28792 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_25490 30141 30290 gene locus_tag LOCUS_25500 30141 30290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 30373 31911 gene locus_tag LOCUS_25510 30373 31911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 31908 32573 gene locus_tag LOCUS_25520 31908 32573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 32573 33448 gene locus_tag LOCUS_25530 32573 33448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 <34383 33482 gene locus_tag LOCUS_25540 <34383 33482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976721.1:MoxR family ATPase >Feature sequence57 1276 104 gene locus_tag LOCUS_25550 1276 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1551 1273 gene locus_tag LOCUS_25560 1551 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2458 3498 gene locus_tag LOCUS_25570 2458 3498 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 protein_id gnl|my_center|LOCUS_25570 5317 4064 gene locus_tag LOCUS_25580 gene orc4 5317 4064 CDS product DNA replication protein Orc4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006183330.1 protein_id gnl|my_center|LOCUS_25580 9173 6099 gene locus_tag LOCUS_25590 9173 6099 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_25590 10397 9540 gene locus_tag LOCUS_25600 10397 9540 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083218.1 protein_id gnl|my_center|LOCUS_25600 10666 11049 gene locus_tag LOCUS_25610 10666 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 11103 12245 gene locus_tag LOCUS_25620 11103 12245 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289424.1 protein_id gnl|my_center|LOCUS_25620 13496 12357 gene locus_tag LOCUS_25630 13496 12357 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_25630 15182 13629 gene locus_tag LOCUS_25640 15182 13629 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_25640 17470 15287 gene locus_tag LOCUS_25650 17470 15287 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064637.1 protein_id gnl|my_center|LOCUS_25650 18567 17479 gene locus_tag LOCUS_25660 18567 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 18797 19960 gene locus_tag LOCUS_25670 18797 19960 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_25670 20137 20901 gene locus_tag LOCUS_25680 gene kdgR 20137 20901 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164952.1 protein_id gnl|my_center|LOCUS_25680 21483 21863 gene locus_tag LOCUS_25690 21483 21863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 22107 22466 gene locus_tag LOCUS_25700 22107 22466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 23574 23501 gene locus_tag LOCUS_t00300 23574 23501 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 24247 23654 gene locus_tag LOCUS_25710 gene fxsA 24247 23654 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903399.1 protein_id gnl|my_center|LOCUS_25710 24380 26023 gene locus_tag LOCUS_25720 24380 26023 CDS product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289401.1 protein_id gnl|my_center|LOCUS_25720 26078 26908 gene locus_tag LOCUS_25730 26078 26908 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903396.1 protein_id gnl|my_center|LOCUS_25730 27831 26905 gene locus_tag LOCUS_25740 gene mptA 27831 26905 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903394.1 protein_id gnl|my_center|LOCUS_25740 28252 28665 gene locus_tag LOCUS_25750 28252 28665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 29211 30140 gene locus_tag LOCUS_25760 29211 30140 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105094.1 protein_id gnl|my_center|LOCUS_25760 30302 31120 gene locus_tag LOCUS_25770 30302 31120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902080.1 protein_id gnl|my_center|LOCUS_25770 32165 31329 gene locus_tag LOCUS_25780 32165 31329 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903393.1 protein_id gnl|my_center|LOCUS_25780 32489 32728 gene locus_tag LOCUS_25790 32489 32728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 32730 33092 gene locus_tag LOCUS_25800 32730 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 33171 33599 gene locus_tag LOCUS_25810 33171 33599 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903278.1 protein_id gnl|my_center|LOCUS_25810 33713 35218 gene locus_tag LOCUS_25820 33713 35218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 35327 36292 gene locus_tag LOCUS_25830 35327 36292 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_25830 36605 37288 gene locus_tag LOCUS_25840 36605 37288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 37446 37376 gene locus_tag LOCUS_t00310 37446 37376 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37847 38641 gene locus_tag LOCUS_25850 37847 38641 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903494.1 protein_id gnl|my_center|LOCUS_25850 39168 38638 gene locus_tag LOCUS_25860 39168 38638 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903528.1 protein_id gnl|my_center|LOCUS_25860 39972 39268 gene locus_tag LOCUS_25870 39972 39268 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903495.1 protein_id gnl|my_center|LOCUS_25870 40033 40800 gene locus_tag LOCUS_25880 40033 40800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289417.1 protein_id gnl|my_center|LOCUS_25880 40899 40970 gene locus_tag LOCUS_t00320 40899 40970 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 41248 42675 gene locus_tag LOCUS_25890 41248 42675 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903113.1 protein_id gnl|my_center|LOCUS_25890 44030 42960 gene locus_tag LOCUS_25900 44030 42960 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479977.1 protein_id gnl|my_center|LOCUS_25900 44236 45369 gene locus_tag LOCUS_25910 gene nadA 44236 45369 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903378.1 protein_id gnl|my_center|LOCUS_25910 45372 46910 gene locus_tag LOCUS_25920 45372 46910 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903379.1 protein_id gnl|my_center|LOCUS_25920 46912 47727 gene locus_tag LOCUS_25930 gene nadC 46912 47727 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903380.1 protein_id gnl|my_center|LOCUS_25930 48300 47734 gene locus_tag LOCUS_25940 48300 47734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 49013 48459 gene locus_tag LOCUS_25950 49013 48459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 49812 49105 gene locus_tag LOCUS_25960 49812 49105 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903895.1 protein_id gnl|my_center|LOCUS_25960 49869 50783 gene locus_tag LOCUS_25970 49869 50783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903896.1 protein_id gnl|my_center|LOCUS_25970 50869 51339 gene locus_tag LOCUS_25980 50869 51339 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902968.1 protein_id gnl|my_center|LOCUS_25980 51800 51636 gene locus_tag LOCUS_25990 51800 51636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 52106 51942 gene locus_tag LOCUS_26000 52106 51942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 52810 52238 gene locus_tag LOCUS_26010 52810 52238 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903898.1 protein_id gnl|my_center|LOCUS_26010 53989 55695 gene locus_tag LOCUS_26020 53989 55695 CDS product Hvo_1808 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903899.1 protein_id gnl|my_center|LOCUS_26020 55747 57309 gene locus_tag LOCUS_26030 55747 57309 CDS product Hvo_1808 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903899.1 protein_id gnl|my_center|LOCUS_26030 57340 58500 gene locus_tag LOCUS_26040 57340 58500 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903900.1 protein_id gnl|my_center|LOCUS_26040 58584 58844 gene locus_tag LOCUS_26050 58584 58844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 59499 58900 gene locus_tag LOCUS_26060 59499 58900 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903901.1 protein_id gnl|my_center|LOCUS_26060 60415 59639 gene locus_tag LOCUS_26070 60415 59639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 61351 61746 gene locus_tag LOCUS_26080 61351 61746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 62132 62060 gene locus_tag LOCUS_t00330 62132 62060 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62380 63867 gene locus_tag LOCUS_26090 62380 63867 CDS product single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902049.1 protein_id gnl|my_center|LOCUS_26090 63934 64365 gene locus_tag LOCUS_26100 63934 64365 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902050.1 protein_id gnl|my_center|LOCUS_26100 64370 65401 gene locus_tag LOCUS_26110 64370 65401 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902051.1 protein_id gnl|my_center|LOCUS_26110 66853 65408 gene locus_tag LOCUS_26120 gene cca 66853 65408 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902052.1 protein_id gnl|my_center|LOCUS_26120 66949 67022 gene locus_tag LOCUS_t00340 66949 67022 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 67166 67753 gene locus_tag LOCUS_26130 67166 67753 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903332.1 protein_id gnl|my_center|LOCUS_26130 67852 68157 gene locus_tag LOCUS_26140 67852 68157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 68150 68458 gene locus_tag LOCUS_26150 68150 68458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26150 68613 68380 gene locus_tag LOCUS_26160 68613 68380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence58 280 380 gene locus_tag LOCUS_r00020 280 380 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 379 457 gene locus_tag LOCUS_r00030 379 457 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 66 percent of the 5S ribosomal RNA 539 651 gene locus_tag LOCUS_r00040 539 651 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1734 775 gene locus_tag LOCUS_26170 1734 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1760 2224 gene locus_tag LOCUS_26180 1760 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 3043 2768 gene locus_tag LOCUS_26190 3043 2768 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289582.1 protein_id gnl|my_center|LOCUS_26190 3689 3495 gene locus_tag LOCUS_26200 3689 3495 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_26200 4134 4859 gene locus_tag LOCUS_26210 4134 4859 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903683.1 protein_id gnl|my_center|LOCUS_26210 4953 6050 gene locus_tag LOCUS_26220 4953 6050 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903903.1 protein_id gnl|my_center|LOCUS_26220 6212 6826 gene locus_tag LOCUS_26230 6212 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902048.1 protein_id gnl|my_center|LOCUS_26230 6927 7700 gene locus_tag LOCUS_26240 gene azf 6927 7700 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_26240 7800 8771 gene locus_tag LOCUS_26250 7800 8771 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_26250 8957 9316 gene locus_tag LOCUS_26260 8957 9316 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902044.1 protein_id gnl|my_center|LOCUS_26260 9523 10116 gene locus_tag LOCUS_26270 9523 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 10896 10159 gene locus_tag LOCUS_26280 10896 10159 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_26280 11027 12055 gene locus_tag LOCUS_26290 11027 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 12042 12386 gene locus_tag LOCUS_26300 12042 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 14429 12432 gene locus_tag LOCUS_26310 14429 12432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_26310 15121 14462 gene locus_tag LOCUS_26320 15121 14462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 15169 15243 gene locus_tag LOCUS_t00350 15169 15243 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16045 15599 gene locus_tag LOCUS_26330 16045 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 16266 16339 gene locus_tag LOCUS_t00360 16266 16339 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 17103 16597 gene locus_tag LOCUS_26340 17103 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393268.1 protein_id gnl|my_center|LOCUS_26340 17352 17185 gene locus_tag LOCUS_26350 17352 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 17491 17898 gene locus_tag LOCUS_26360 17491 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 18140 17931 gene locus_tag LOCUS_26370 18140 17931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 18656 18183 gene locus_tag LOCUS_26380 18656 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 18790 19038 gene locus_tag LOCUS_26390 18790 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 19388 19807 gene locus_tag LOCUS_26400 19388 19807 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902700.1 protein_id gnl|my_center|LOCUS_26400 19814 20089 gene locus_tag LOCUS_26410 19814 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 20136 20684 gene locus_tag LOCUS_26420 20136 20684 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890481.1 protein_id gnl|my_center|LOCUS_26420 21407 20685 gene locus_tag LOCUS_26430 21407 20685 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902031.1 protein_id gnl|my_center|LOCUS_26430 24375 21400 gene locus_tag LOCUS_26440 24375 21400 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018258731.1 protein_id gnl|my_center|LOCUS_26440 25735 24368 gene locus_tag LOCUS_26450 25735 24368 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902029.1 protein_id gnl|my_center|LOCUS_26450 27239 25728 gene locus_tag LOCUS_26460 27239 25728 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902028.1 protein_id gnl|my_center|LOCUS_26460 27952 27356 gene locus_tag LOCUS_26470 27952 27356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 29391 28126 gene locus_tag LOCUS_26480 29391 28126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 29842 29363 gene locus_tag LOCUS_26490 29842 29363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 30279 29902 gene locus_tag LOCUS_26500 30279 29902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 31379 31035 gene locus_tag LOCUS_26510 31379 31035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 31528 32028 gene locus_tag LOCUS_26520 31528 32028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 32458 32048 gene locus_tag LOCUS_26530 32458 32048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 32934 32554 gene locus_tag LOCUS_26540 32934 32554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 33006 33170 gene locus_tag LOCUS_26550 33006 33170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 33312 33175 gene locus_tag LOCUS_26560 33312 33175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 33593 33372 gene locus_tag LOCUS_26570 33593 33372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 33771 33619 gene locus_tag LOCUS_26580 33771 33619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 34798 33779 gene locus_tag LOCUS_26590 34798 33779 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_26590 34816 34905 gene locus_tag LOCUS_t00370 34816 34905 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35573 35890 gene locus_tag LOCUS_26600 35573 35890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 35887 37365 gene locus_tag LOCUS_26610 35887 37365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 37885 37376 gene locus_tag LOCUS_26620 37885 37376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 38788 39342 gene locus_tag LOCUS_26630 38788 39342 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902033.1 protein_id gnl|my_center|LOCUS_26630 39582 40346 gene locus_tag LOCUS_26640 39582 40346 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_26640 40554 41237 gene locus_tag LOCUS_26650 40554 41237 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902033.1 protein_id gnl|my_center|LOCUS_26650 41363 42343 gene locus_tag LOCUS_26660 41363 42343 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_26660 42494 43354 gene locus_tag LOCUS_26670 42494 43354 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731494.1 protein_id gnl|my_center|LOCUS_26670 43792 44640 gene locus_tag LOCUS_26680 43792 44640 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484627.1 protein_id gnl|my_center|LOCUS_26680 45038 44676 gene locus_tag LOCUS_26690 45038 44676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 45255 45182 gene locus_tag LOCUS_t00380 45255 45182 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 45387 45887 gene locus_tag LOCUS_26700 45387 45887 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289448.1 protein_id gnl|my_center|LOCUS_26700 46466 46053 gene locus_tag LOCUS_26710 46466 46053 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903601.1 protein_id gnl|my_center|LOCUS_26710 46607 47569 gene locus_tag LOCUS_26720 46607 47569 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412739.1 protein_id gnl|my_center|LOCUS_26720 47587 47949 gene locus_tag LOCUS_26730 47587 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26730 48947 48303 gene locus_tag LOCUS_26740 48947 48303 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903600.1 protein_id gnl|my_center|LOCUS_26740 49878 48949 gene locus_tag LOCUS_26750 49878 48949 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289447.1 protein_id gnl|my_center|LOCUS_26750 50196 50507 gene locus_tag LOCUS_26760 50196 50507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 50817 50608 gene locus_tag LOCUS_26770 50817 50608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 52563 50818 gene locus_tag LOCUS_26780 52563 50818 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_26780 53347 52556 gene locus_tag LOCUS_26790 53347 52556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 53703 53344 gene locus_tag LOCUS_26800 53703 53344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 53648 53863 gene locus_tag LOCUS_26810 53648 53863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 53876 54724 gene locus_tag LOCUS_26820 53876 54724 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070807659.1 protein_id gnl|my_center|LOCUS_26820 54726 57170 gene locus_tag LOCUS_26830 54726 57170 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_26830 57425 57192 gene locus_tag LOCUS_26840 57425 57192 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015098.1 protein_id gnl|my_center|LOCUS_26840 57623 57913 gene locus_tag LOCUS_26850 57623 57913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 58326 59510 gene locus_tag LOCUS_26860 58326 59510 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049926525.1 protein_id gnl|my_center|LOCUS_26860 59985 59512 gene locus_tag LOCUS_26870 59985 59512 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902163.1 protein_id gnl|my_center|LOCUS_26870 60350 60192 gene locus_tag LOCUS_26880 60350 60192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 60523 62250 gene locus_tag LOCUS_26890 60523 62250 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902165.1 protein_id gnl|my_center|LOCUS_26890 62351 62764 gene locus_tag LOCUS_26900 62351 62764 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902168.1 protein_id gnl|my_center|LOCUS_26900 63692 63018 gene locus_tag LOCUS_26910 63692 63018 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902169.1 protein_id gnl|my_center|LOCUS_26910 64565 63723 gene locus_tag LOCUS_26920 64565 63723 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902170.1 protein_id gnl|my_center|LOCUS_26920 64943 64662 gene locus_tag LOCUS_26930 64943 64662 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902171.1 protein_id gnl|my_center|LOCUS_26930 65167 65874 gene locus_tag LOCUS_26940 65167 65874 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289133.1 protein_id gnl|my_center|LOCUS_26940 65928 66827 gene locus_tag LOCUS_26950 65928 66827 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902173.1 protein_id gnl|my_center|LOCUS_26950 68006 67023 gene locus_tag LOCUS_26960 68006 67023 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_26960 69839 68166 gene locus_tag LOCUS_26970 69839 68166 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903377.1 protein_id gnl|my_center|LOCUS_26970 69946 70335 gene locus_tag LOCUS_26980 69946 70335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 70418 71644 gene locus_tag LOCUS_26990 gene hmgA 70418 71644 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903374.1 protein_id gnl|my_center|LOCUS_26990 72133 71768 gene locus_tag LOCUS_27000 72133 71768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 72710 72186 gene locus_tag LOCUS_27010 72710 72186 CDS product DUF5817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903373.1 protein_id gnl|my_center|LOCUS_27010 72709 73152 gene locus_tag LOCUS_27020 72709 73152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 73213 74589 gene locus_tag LOCUS_27030 73213 74589 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407872.1 protein_id gnl|my_center|LOCUS_27030 75357 74920 gene locus_tag LOCUS_27040 75357 74920 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903016.1 protein_id gnl|my_center|LOCUS_27040 76859 75597 gene locus_tag LOCUS_27050 gene icd 76859 75597 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903372.1 protein_id gnl|my_center|LOCUS_27050 77650 78549 gene locus_tag LOCUS_27060 gene map 77650 78549 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903366.1 protein_id gnl|my_center|LOCUS_27060 79087 78887 gene locus_tag LOCUS_27070 79087 78887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903365.1 protein_id gnl|my_center|LOCUS_27070 79342 79881 gene locus_tag LOCUS_27080 79342 79881 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903364.1 protein_id gnl|my_center|LOCUS_27080 80023 80748 gene locus_tag LOCUS_27090 80023 80748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 81225 80860 gene locus_tag LOCUS_27100 81225 80860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 82776 81319 gene locus_tag LOCUS_27110 82776 81319 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903362.1 protein_id gnl|my_center|LOCUS_27110 83135 82773 gene locus_tag LOCUS_27120 83135 82773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 84961 83204 gene locus_tag LOCUS_27130 gene pyk 84961 83204 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902196.1 protein_id gnl|my_center|LOCUS_27130 85094 85381 gene locus_tag LOCUS_27140 85094 85381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 86218 85454 gene locus_tag LOCUS_27150 86218 85454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 88443 86338 gene locus_tag LOCUS_27160 gene metG 88443 86338 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902197.1 protein_id gnl|my_center|LOCUS_27160 89003 90022 gene locus_tag LOCUS_27170 89003 90022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 90025 90555 gene locus_tag LOCUS_27180 90025 90555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 90555 91124 gene locus_tag LOCUS_27190 90555 91124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 91130 91624 gene locus_tag LOCUS_27200 91130 91624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 91621 92265 gene locus_tag LOCUS_27210 91621 92265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 92169 92507 gene locus_tag LOCUS_27220 92169 92507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 93866 92781 gene locus_tag LOCUS_27230 gene mfnA 93866 92781 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902198.1 protein_id gnl|my_center|LOCUS_27230 94077 95369 gene locus_tag LOCUS_27240 94077 95369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 95456 96715 gene locus_tag LOCUS_27250 gene gatD 95456 96715 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903349.1 protein_id gnl|my_center|LOCUS_27250 96810 97757 gene locus_tag LOCUS_27260 96810 97757 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289391.1 protein_id gnl|my_center|LOCUS_27260 98090 97809 gene locus_tag LOCUS_27270 98090 97809 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289392.1 protein_id gnl|my_center|LOCUS_27270 99372 98122 gene locus_tag LOCUS_27280 99372 98122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 100696 99422 gene locus_tag LOCUS_27290 100696 99422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 100954 101373 gene locus_tag LOCUS_27300 100954 101373 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_27300 101458 102642 gene locus_tag LOCUS_27310 101458 102642 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289393.1 protein_id gnl|my_center|LOCUS_27310 104073 102646 gene locus_tag LOCUS_27320 104073 102646 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892520.1 protein_id gnl|my_center|LOCUS_27320 104433 104191 gene locus_tag LOCUS_27330 104433 104191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 105197 104562 gene locus_tag LOCUS_27340 gene deoC 105197 104562 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903361.1 protein_id gnl|my_center|LOCUS_27340 105427 106422 gene locus_tag LOCUS_27350 105427 106422 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903358.1 protein_id gnl|my_center|LOCUS_27350 106540 107361 gene locus_tag LOCUS_27360 106540 107361 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903357.1 protein_id gnl|my_center|LOCUS_27360 107435 108319 gene locus_tag LOCUS_27370 107435 108319 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903356.1 protein_id gnl|my_center|LOCUS_27370 108460 108762 gene locus_tag LOCUS_27380 108460 108762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 108885 109613 gene locus_tag LOCUS_27390 108885 109613 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903355.1 protein_id gnl|my_center|LOCUS_27390 110538 109735 gene locus_tag LOCUS_27400 110538 109735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 110656 111375 gene locus_tag LOCUS_27410 110656 111375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 112136 111399 gene locus_tag LOCUS_27420 112136 111399 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361490.1 protein_id gnl|my_center|LOCUS_27420 112254 113273 gene locus_tag LOCUS_27430 112254 113273 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384035.1 protein_id gnl|my_center|LOCUS_27430 113817 113290 gene locus_tag LOCUS_27440 113817 113290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 114347 114006 gene locus_tag LOCUS_27450 114347 114006 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174327.1 protein_id gnl|my_center|LOCUS_27450 114520 114879 gene locus_tag LOCUS_27460 114520 114879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 115021 115986 gene locus_tag LOCUS_27470 115021 115986 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_27470 117357 115975 gene locus_tag LOCUS_27480 117357 115975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 118700 117354 gene locus_tag LOCUS_27490 118700 117354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 119371 118697 gene locus_tag LOCUS_27500 119371 118697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 121011 119368 gene locus_tag LOCUS_27510 121011 119368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 122096 121008 gene locus_tag LOCUS_27520 122096 121008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 122354 122965 gene locus_tag LOCUS_27530 122354 122965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 123038 124207 gene locus_tag LOCUS_27540 123038 124207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27540 124131 124304 gene locus_tag LOCUS_27550 124131 124304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 124485 125102 gene locus_tag LOCUS_27560 124485 125102 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902192.1 protein_id gnl|my_center|LOCUS_27560 125786 125130 gene locus_tag LOCUS_27570 125786 125130 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902025.1 protein_id gnl|my_center|LOCUS_27570 126134 125901 gene locus_tag LOCUS_27580 126134 125901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902191.1 protein_id gnl|my_center|LOCUS_27580 126886 126362 gene locus_tag LOCUS_27590 126886 126362 CDS product DUF84 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869966.1 protein_id gnl|my_center|LOCUS_27590 127106 128086 gene locus_tag LOCUS_27600 127106 128086 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_27600 128158 128832 gene locus_tag LOCUS_27610 128158 128832 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289139.1 protein_id gnl|my_center|LOCUS_27610 128893 129330 gene locus_tag LOCUS_27620 128893 129330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 <129856 129354 gene locus_tag LOCUS_27630 <129856 129354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902185.1:3-dehydroquinate synthase II >Feature sequence59 755 576 gene locus_tag LOCUS_27640 755 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 681 1196 gene locus_tag LOCUS_27650 681 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 2098 1232 gene locus_tag LOCUS_27660 2098 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2324 3004 gene locus_tag LOCUS_27670 2324 3004 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478741.1 protein_id gnl|my_center|LOCUS_27670 3586 3047 gene locus_tag LOCUS_27680 3586 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 4077 5030 gene locus_tag LOCUS_27690 4077 5030 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 protein_id gnl|my_center|LOCUS_27690 5831 5103 gene locus_tag LOCUS_27700 5831 5103 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902183.1 protein_id gnl|my_center|LOCUS_27700 6848 5943 gene locus_tag LOCUS_27710 gene trpA 6848 5943 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902182.1 protein_id gnl|my_center|LOCUS_27710 8164 6845 gene locus_tag LOCUS_27720 gene trpB 8164 6845 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902181.1 protein_id gnl|my_center|LOCUS_27720 8997 8161 gene locus_tag LOCUS_27730 gene trpC 8997 8161 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902180.1 protein_id gnl|my_center|LOCUS_27730 9733 9203 gene locus_tag LOCUS_27740 9733 9203 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902583.1 protein_id gnl|my_center|LOCUS_27740 11102 9726 gene locus_tag LOCUS_27750 gene nrfD 11102 9726 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902582.1 protein_id gnl|my_center|LOCUS_27750 11836 11099 gene locus_tag LOCUS_27760 11836 11099 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902581.1 protein_id gnl|my_center|LOCUS_27760 14325 11836 gene locus_tag LOCUS_27770 14325 11836 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902580.1 protein_id gnl|my_center|LOCUS_27770 14578 14318 gene locus_tag LOCUS_27780 14578 14318 CDS product 4Fe-4S ferredoxin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902579.1 protein_id gnl|my_center|LOCUS_27780 15322 14705 gene locus_tag LOCUS_27790 15322 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 15533 16003 gene locus_tag LOCUS_27800 15533 16003 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289136.1 protein_id gnl|my_center|LOCUS_27800 17159 16017 gene locus_tag LOCUS_27810 17159 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 18328 17186 gene locus_tag LOCUS_27820 18328 17186 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902157.1 protein_id gnl|my_center|LOCUS_27820 18478 18648 gene locus_tag LOCUS_27830 18478 18648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 20042 18852 gene locus_tag LOCUS_27840 20042 18852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 21082 20192 gene locus_tag LOCUS_27850 21082 20192 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_27850 21666 21241 gene locus_tag LOCUS_27860 21666 21241 CDS product DUF5791 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289128.1 protein_id gnl|my_center|LOCUS_27860 23282 21807 gene locus_tag LOCUS_27870 23282 21807 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903565.1 protein_id gnl|my_center|LOCUS_27870 25421 23847 gene locus_tag LOCUS_27880 gene hutH 25421 23847 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289292.1 protein_id gnl|my_center|LOCUS_27880 26631 25414 gene locus_tag LOCUS_27890 gene hutI 26631 25414 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902875.1 protein_id gnl|my_center|LOCUS_27890 27542 26628 gene locus_tag LOCUS_27900 gene hutG 27542 26628 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902874.1 protein_id gnl|my_center|LOCUS_27900 29269 27539 gene locus_tag LOCUS_27910 gene hutU 29269 27539 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902873.1 protein_id gnl|my_center|LOCUS_27910 29357 30001 gene locus_tag LOCUS_27920 29357 30001 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902872.1 protein_id gnl|my_center|LOCUS_27920 30083 31174 gene locus_tag LOCUS_27930 30083 31174 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902152.1 protein_id gnl|my_center|LOCUS_27930 31591 32472 gene locus_tag LOCUS_27940 31591 32472 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902245.1 protein_id gnl|my_center|LOCUS_27940 32677 33111 gene locus_tag LOCUS_27950 32677 33111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 33175 34569 gene locus_tag LOCUS_27960 33175 34569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 35735 34935 gene locus_tag LOCUS_27970 35735 34935 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070807659.1 protein_id gnl|my_center|LOCUS_27970 38137 35942 gene locus_tag LOCUS_27980 38137 35942 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_27980 38165 38389 gene locus_tag LOCUS_27990 38165 38389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 38711 39715 gene locus_tag LOCUS_28000 38711 39715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 39766 41193 gene locus_tag LOCUS_28010 39766 41193 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902244.1 protein_id gnl|my_center|LOCUS_28010 41243 41968 gene locus_tag LOCUS_28020 41243 41968 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902243.1 protein_id gnl|my_center|LOCUS_28020 43048 42074 gene locus_tag LOCUS_28030 43048 42074 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289150.1 protein_id gnl|my_center|LOCUS_28030 43198 43488 gene locus_tag LOCUS_28040 43198 43488 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902241.1 protein_id gnl|my_center|LOCUS_28040 43676 44044 gene locus_tag LOCUS_28050 43676 44044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 44508 44041 gene locus_tag LOCUS_28060 44508 44041 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902240.1 protein_id gnl|my_center|LOCUS_28060 45483 44605 gene locus_tag LOCUS_28070 45483 44605 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902239.1 protein_id gnl|my_center|LOCUS_28070 45617 45976 gene locus_tag LOCUS_28080 45617 45976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 45977 46306 gene locus_tag LOCUS_28090 45977 46306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 46332 47012 gene locus_tag LOCUS_28100 46332 47012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 47526 48089 gene locus_tag LOCUS_28110 47526 48089 CDS product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 protein_id gnl|my_center|LOCUS_28110 48544 48353 gene locus_tag LOCUS_28120 48544 48353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 48528 48746 gene locus_tag LOCUS_28130 48528 48746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 49471 48791 gene locus_tag LOCUS_28140 49471 48791 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902238.1 protein_id gnl|my_center|LOCUS_28140 51020 49464 gene locus_tag LOCUS_28150 gene pabB 51020 49464 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902237.1 protein_id gnl|my_center|LOCUS_28150 51505 51185 gene locus_tag LOCUS_28160 51505 51185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 51627 51893 gene locus_tag LOCUS_28170 51627 51893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 52761 51952 gene locus_tag LOCUS_28180 52761 51952 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902235.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence60 <1 735 gene locus_tag LOCUS_28190 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902234.1:calcium/sodium antiporter 1049 2383 gene locus_tag LOCUS_28200 1049 2383 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892484.1 protein_id gnl|my_center|LOCUS_28200 2544 3716 gene locus_tag LOCUS_28210 gene ftsZ 2544 3716 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902232.1 protein_id gnl|my_center|LOCUS_28210 4460 3828 gene locus_tag LOCUS_28220 4460 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902282.1 protein_id gnl|my_center|LOCUS_28220 4549 5772 gene locus_tag LOCUS_28230 4549 5772 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_28230 6186 5851 gene locus_tag LOCUS_28240 6186 5851 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902280.1 protein_id gnl|my_center|LOCUS_28240 6642 6274 gene locus_tag LOCUS_28250 6642 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 6835 8238 gene locus_tag LOCUS_28260 6835 8238 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902279.1 protein_id gnl|my_center|LOCUS_28260 8772 8930 gene locus_tag LOCUS_28270 8772 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 10233 8998 gene locus_tag LOCUS_28280 10233 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 12417 11140 gene locus_tag LOCUS_28290 12417 11140 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902278.1 protein_id gnl|my_center|LOCUS_28290 12818 12483 gene locus_tag LOCUS_28300 12818 12483 CDS product uS10/mL48 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902275.1 protein_id gnl|my_center|LOCUS_28300 13003 13443 gene locus_tag LOCUS_28310 13003 13443 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902274.1 protein_id gnl|my_center|LOCUS_28310 13627 14679 gene locus_tag LOCUS_28320 13627 14679 CDS product DUF5787 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289155.1 protein_id gnl|my_center|LOCUS_28320 15199 14696 gene locus_tag LOCUS_28330 15199 14696 CDS product DUF5797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902272.1 protein_id gnl|my_center|LOCUS_28330 16620 15331 gene locus_tag LOCUS_28340 16620 15331 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839155.1 protein_id gnl|my_center|LOCUS_28340 17072 17350 gene locus_tag LOCUS_28350 17072 17350 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902269.1 protein_id gnl|my_center|LOCUS_28350 18430 17630 gene locus_tag LOCUS_28360 18430 17630 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902268.1 protein_id gnl|my_center|LOCUS_28360 18810 18427 gene locus_tag LOCUS_28370 18810 18427 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902267.1 protein_id gnl|my_center|LOCUS_28370 19801 18944 gene locus_tag LOCUS_28380 19801 18944 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877239.1 protein_id gnl|my_center|LOCUS_28380 20403 20478 gene locus_tag LOCUS_t00390 20403 20478 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21015 20527 gene locus_tag LOCUS_28390 21015 20527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902265.1 protein_id gnl|my_center|LOCUS_28390 21208 21396 gene locus_tag LOCUS_28400 21208 21396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 22032 21535 gene locus_tag LOCUS_28410 22032 21535 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_28410 22931 22107 gene locus_tag LOCUS_28420 22931 22107 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289100.1 protein_id gnl|my_center|LOCUS_28420 23274 24200 gene locus_tag LOCUS_28430 gene dapA 23274 24200 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_28430 24197 24964 gene locus_tag LOCUS_28440 gene dapB 24197 24964 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496490.1 protein_id gnl|my_center|LOCUS_28440 24961 25797 gene locus_tag LOCUS_28450 gene dapD 24961 25797 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632504.1 protein_id gnl|my_center|LOCUS_28450 26619 25849 gene locus_tag LOCUS_28460 26619 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 26788 28128 gene locus_tag LOCUS_28470 gene lysA 26788 28128 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_28470 28316 28963 gene locus_tag LOCUS_28480 28316 28963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 28960 30153 gene locus_tag LOCUS_28490 28960 30153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 30282 31184 gene locus_tag LOCUS_28500 30282 31184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 32014 31235 gene locus_tag LOCUS_28510 32014 31235 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902216.1 protein_id gnl|my_center|LOCUS_28510 33474 32089 gene locus_tag LOCUS_28520 gene purB 33474 32089 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289153.1 protein_id gnl|my_center|LOCUS_28520 33652 35283 gene locus_tag LOCUS_28530 33652 35283 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289152.1 protein_id gnl|my_center|LOCUS_28530 35871 35428 gene locus_tag LOCUS_28540 35871 35428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 36050 37393 gene locus_tag LOCUS_28550 36050 37393 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_28550 38290 37430 gene locus_tag LOCUS_28560 38290 37430 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902174.1 protein_id gnl|my_center|LOCUS_28560 38418 39995 gene locus_tag LOCUS_28570 gene thsA 38418 39995 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892611.1 protein_id gnl|my_center|LOCUS_28570 40113 40484 gene locus_tag LOCUS_28580 40113 40484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 41342 40524 gene locus_tag LOCUS_28590 41342 40524 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289134.1 protein_id gnl|my_center|LOCUS_28590 41887 41426 gene locus_tag LOCUS_28600 41887 41426 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902177.1 protein_id gnl|my_center|LOCUS_28600 41819 42073 gene locus_tag LOCUS_28610 41819 42073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 42239 44395 gene locus_tag LOCUS_28620 gene lonB 42239 44395 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902178.1 protein_id gnl|my_center|LOCUS_28620 44396 45370 gene locus_tag LOCUS_28630 44396 45370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 45889 45557 gene locus_tag LOCUS_28640 45889 45557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 46145 45882 gene locus_tag LOCUS_28650 46145 45882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 46317 46499 gene locus_tag LOCUS_28660 46317 46499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892499.1 protein_id gnl|my_center|LOCUS_28660 46885 47229 gene locus_tag LOCUS_28670 46885 47229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 47438 47265 gene locus_tag LOCUS_28680 47438 47265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 47865 47431 gene locus_tag LOCUS_28690 47865 47431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28690 47450 47455 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence61 1887 538 gene locus_tag LOCUS_28700 1887 538 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903457.1 protein_id gnl|my_center|LOCUS_28700 2010 3149 gene locus_tag LOCUS_28710 2010 3149 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902123.1 protein_id gnl|my_center|LOCUS_28710 3442 3633 gene locus_tag LOCUS_28720 3442 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 3641 3829 gene locus_tag LOCUS_28730 3641 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 4473 5039 gene locus_tag LOCUS_28740 4473 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 5388 5071 gene locus_tag LOCUS_28750 5388 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 5516 6118 gene locus_tag LOCUS_28760 gene trmY 5516 6118 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903455.1 protein_id gnl|my_center|LOCUS_28760 6222 6295 gene locus_tag LOCUS_t00400 6222 6295 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6632 7879 gene locus_tag LOCUS_28770 6632 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 7986 8381 gene locus_tag LOCUS_28780 7986 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 8746 8537 gene locus_tag LOCUS_28790 8746 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 10999 8885 gene locus_tag LOCUS_28800 10999 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 11878 11483 gene locus_tag LOCUS_28810 11878 11483 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230404.1 protein_id gnl|my_center|LOCUS_28810 12052 12336 gene locus_tag LOCUS_28820 12052 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 12408 13136 gene locus_tag LOCUS_28830 12408 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 13298 13552 gene locus_tag LOCUS_28840 13298 13552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 13907 13632 gene locus_tag LOCUS_28850 13907 13632 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_28850 14094 14657 gene locus_tag LOCUS_28860 14094 14657 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903441.1 protein_id gnl|my_center|LOCUS_28860 16025 14721 gene locus_tag LOCUS_28870 16025 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 16605 16414 gene locus_tag LOCUS_28880 16605 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 16710 18602 gene locus_tag LOCUS_28890 gene bat 16710 18602 CDS product bacterioopsin transcriptional activator Bat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903066.1 protein_id gnl|my_center|LOCUS_28890 18713 18898 gene locus_tag LOCUS_28900 18713 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 19114 21039 gene locus_tag LOCUS_28910 19114 21039 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_28910 21287 21883 gene locus_tag LOCUS_28920 21287 21883 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066031.1 protein_id gnl|my_center|LOCUS_28920 22413 22027 gene locus_tag LOCUS_28930 22413 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 22658 23317 gene locus_tag LOCUS_28940 22658 23317 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903087.1 protein_id gnl|my_center|LOCUS_28940 24122 23670 gene locus_tag LOCUS_28950 24122 23670 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903086.1 protein_id gnl|my_center|LOCUS_28950 24561 24232 gene locus_tag LOCUS_28960 24561 24232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 24881 24621 gene locus_tag LOCUS_28970 24881 24621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 25260 24943 gene locus_tag LOCUS_28980 25260 24943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 26104 25253 gene locus_tag LOCUS_28990 26104 25253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 26347 26138 gene locus_tag LOCUS_29000 26347 26138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 26693 26415 gene locus_tag LOCUS_29010 26693 26415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 27087 26857 gene locus_tag LOCUS_29020 27087 26857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892499.1 protein_id gnl|my_center|LOCUS_29020 27271 27429 gene locus_tag LOCUS_29030 27271 27429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 27608 27420 gene locus_tag LOCUS_29040 27608 27420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 28030 27617 gene locus_tag LOCUS_29050 28030 27617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 28434 28096 gene locus_tag LOCUS_29060 28434 28096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 28907 28521 gene locus_tag LOCUS_29070 28907 28521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 29976 29119 gene locus_tag LOCUS_29080 29976 29119 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_29080 30492 30217 gene locus_tag LOCUS_29090 30492 30217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 31324 31115 gene locus_tag LOCUS_29100 31324 31115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 34643 33672 gene locus_tag LOCUS_29110 34643 33672 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903590.1 protein_id gnl|my_center|LOCUS_29110 35452 34640 gene locus_tag LOCUS_29120 35452 34640 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903589.1 protein_id gnl|my_center|LOCUS_29120 35612 36418 gene locus_tag LOCUS_29130 35612 36418 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902183.1 protein_id gnl|my_center|LOCUS_29130 36907 36563 gene locus_tag LOCUS_29140 36907 36563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 37106 38260 gene locus_tag LOCUS_29150 37106 38260 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_29150 40410 38917 gene locus_tag LOCUS_29160 40410 38917 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250519.1 protein_id gnl|my_center|LOCUS_29160 42332 40749 gene locus_tag LOCUS_29170 42332 40749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 42382 43401 gene locus_tag LOCUS_29180 42382 43401 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878281.1 protein_id gnl|my_center|LOCUS_29180 43498 44658 gene locus_tag LOCUS_29190 43498 44658 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_29190 44836 45627 gene locus_tag LOCUS_29200 44836 45627 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903597.1 protein_id gnl|my_center|LOCUS_29200 47232 46447 gene locus_tag LOCUS_29210 47232 46447 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_29210 49787 50089 gene locus_tag LOCUS_29220 49787 50089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 50973 51437 gene locus_tag LOCUS_29230 50973 51437 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_29230 51434 53125 gene locus_tag LOCUS_29240 51434 53125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 54157 53138 gene locus_tag LOCUS_29250 54157 53138 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902656.1 protein_id gnl|my_center|LOCUS_29250 54303 54848 gene locus_tag LOCUS_29260 gene dpsA 54303 54848 CDS product DNA starvation/stationary phase protection protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903826.1 protein_id gnl|my_center|LOCUS_29260 55265 54888 gene locus_tag LOCUS_29270 55265 54888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 56591 55641 gene locus_tag LOCUS_29280 56591 55641 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903430.1 protein_id gnl|my_center|LOCUS_29280 56896 57147 gene locus_tag LOCUS_29290 gene purS 56896 57147 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903429.1 protein_id gnl|my_center|LOCUS_29290 57148 57825 gene locus_tag LOCUS_29300 gene purQ 57148 57825 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903428.1 protein_id gnl|my_center|LOCUS_29300 57957 61148 gene locus_tag LOCUS_29310 57957 61148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 62487 61387 gene locus_tag LOCUS_29320 62487 61387 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903425.1 protein_id gnl|my_center|LOCUS_29320 62705 64180 gene locus_tag LOCUS_29330 gene tgtA 62705 64180 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903439.1 protein_id gnl|my_center|LOCUS_29330 64525 64253 gene locus_tag LOCUS_29340 64525 64253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 64635 65093 gene locus_tag LOCUS_29350 64635 65093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 67193 65247 gene locus_tag LOCUS_29360 67193 65247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 67438 69189 gene locus_tag LOCUS_29370 gene arcS 67438 69189 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903438.1 protein_id gnl|my_center|LOCUS_29370 69482 70105 gene locus_tag LOCUS_29380 69482 70105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 70394 70224 gene locus_tag LOCUS_29390 70394 70224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 71303 71097 gene locus_tag LOCUS_29400 71303 71097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 72452 71433 gene locus_tag LOCUS_29410 72452 71433 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289411.1 protein_id gnl|my_center|LOCUS_29410 72806 74185 gene locus_tag LOCUS_29420 gene cofH 72806 74185 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903422.1 protein_id gnl|my_center|LOCUS_29420 75315 74407 gene locus_tag LOCUS_29430 75315 74407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 76159 75518 gene locus_tag LOCUS_29440 76159 75518 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902513.1 protein_id gnl|my_center|LOCUS_29440 76426 76740 gene locus_tag LOCUS_29450 76426 76740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 76878 77360 gene locus_tag LOCUS_29460 76878 77360 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_29460 77611 77784 gene locus_tag LOCUS_29470 77611 77784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 79128 77878 gene locus_tag LOCUS_29480 gene cofG 79128 77878 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892527.1 protein_id gnl|my_center|LOCUS_29480 79835 79125 gene locus_tag LOCUS_29490 gene cofC 79835 79125 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903420.1 protein_id gnl|my_center|LOCUS_29490 81170 79989 gene locus_tag LOCUS_29500 81170 79989 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_29500 82322 81402 gene locus_tag LOCUS_29510 82322 81402 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892525.1 protein_id gnl|my_center|LOCUS_29510 82433 83038 gene locus_tag LOCUS_29520 gene tmk 82433 83038 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903416.1 protein_id gnl|my_center|LOCUS_29520 83145 83375 gene locus_tag LOCUS_29530 83145 83375 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289406.1 protein_id gnl|my_center|LOCUS_29530 83539 84315 gene locus_tag LOCUS_29540 83539 84315 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289405.1 protein_id gnl|my_center|LOCUS_29540 84315 84545 gene locus_tag LOCUS_29550 84315 84545 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903411.1 protein_id gnl|my_center|LOCUS_29550 85486 84962 gene locus_tag LOCUS_29560 85486 84962 CDS product DUF5813 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903410.1 protein_id gnl|my_center|LOCUS_29560 86220 85831 gene locus_tag LOCUS_29570 86220 85831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 87594 86302 gene locus_tag LOCUS_29580 87594 86302 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903810.1 protein_id gnl|my_center|LOCUS_29580 88718 87711 gene locus_tag LOCUS_29590 88718 87711 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903678.1 protein_id gnl|my_center|LOCUS_29590 89741 88980 gene locus_tag LOCUS_29600 89741 88980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 92363 89745 gene locus_tag LOCUS_29610 92363 89745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 93041 92619 gene locus_tag LOCUS_29620 93041 92619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 94691 93171 gene locus_tag LOCUS_29630 gene gpmI 94691 93171 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903383.1 protein_id gnl|my_center|LOCUS_29630 96362 94809 gene locus_tag LOCUS_29640 96362 94809 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_29640 96853 96575 gene locus_tag LOCUS_29650 96853 96575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903384.1 protein_id gnl|my_center|LOCUS_29650 96979 99597 gene locus_tag LOCUS_29660 96979 99597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 99766 100560 gene locus_tag LOCUS_29670 99766 100560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 100617 102500 gene locus_tag LOCUS_29680 100617 102500 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903390.1 protein_id gnl|my_center|LOCUS_29680 103131 102517 gene locus_tag LOCUS_29690 103131 102517 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903340.1 protein_id gnl|my_center|LOCUS_29690 104799 103285 gene locus_tag LOCUS_29700 104799 103285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 105038 105703 gene locus_tag LOCUS_29710 105038 105703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 105805 106350 gene locus_tag LOCUS_29720 105805 106350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 106418 107254 gene locus_tag LOCUS_29730 106418 107254 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_29730 107472 107819 gene locus_tag LOCUS_29740 107472 107819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 108379 107879 gene locus_tag LOCUS_29750 108379 107879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 108597 109646 gene locus_tag LOCUS_29760 108597 109646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 109736 110764 gene locus_tag LOCUS_29770 109736 110764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 110906 111220 gene locus_tag LOCUS_29780 110906 111220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 111298 111579 gene locus_tag LOCUS_29790 111298 111579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 111626 112735 gene locus_tag LOCUS_29800 111626 112735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 112732 113769 gene locus_tag LOCUS_29810 112732 113769 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_29810 114786 113872 gene locus_tag LOCUS_29820 114786 113872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 115367 114783 gene locus_tag LOCUS_29830 115367 114783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 116923 115364 gene locus_tag LOCUS_29840 116923 115364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 117166 119187 gene locus_tag LOCUS_29850 117166 119187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 119434 120477 gene locus_tag LOCUS_29860 119434 120477 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_29860 121937 120681 gene locus_tag LOCUS_29870 121937 120681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 123151 121937 gene locus_tag LOCUS_29880 123151 121937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 123570 123148 gene locus_tag LOCUS_29890 123570 123148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 125734 124019 gene locus_tag LOCUS_29900 125734 124019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 127033 125891 gene locus_tag LOCUS_29910 127033 125891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 127471 127743 gene locus_tag LOCUS_29920 127471 127743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 128157 127879 gene locus_tag LOCUS_29930 128157 127879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 128687 128286 gene locus_tag LOCUS_29940 128687 128286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 129241 128834 gene locus_tag LOCUS_29950 129241 128834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 130075 129650 gene locus_tag LOCUS_29960 130075 129650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 131061 130747 gene locus_tag LOCUS_29970 131061 130747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 131311 131009 gene locus_tag LOCUS_29980 131311 131009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 131934 132083 gene locus_tag LOCUS_29990 131934 132083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 133250 134146 gene locus_tag LOCUS_30000 133250 134146 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877829.1 protein_id gnl|my_center|LOCUS_30000 134143 135081 gene locus_tag LOCUS_30010 134143 135081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 135158 136297 gene locus_tag LOCUS_30020 135158 136297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 136318 137652 gene locus_tag LOCUS_30030 136318 137652 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_30030 137656 138819 gene locus_tag LOCUS_30040 137656 138819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 139812 138841 gene locus_tag LOCUS_30050 139812 138841 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941284.1 protein_id gnl|my_center|LOCUS_30050 140147 140938 gene locus_tag LOCUS_30060 140147 140938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 141029 141364 gene locus_tag LOCUS_30070 141029 141364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 142937 143185 gene locus_tag LOCUS_30080 142937 143185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 143601 144605 gene locus_tag LOCUS_30090 143601 144605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 146195 146665 gene locus_tag LOCUS_30100 146195 146665 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877830.1 protein_id gnl|my_center|LOCUS_30100 146669 147742 gene locus_tag LOCUS_30110 146669 147742 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868292.1 protein_id gnl|my_center|LOCUS_30110 147745 147924 gene locus_tag LOCUS_30120 147745 147924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 148811 147921 gene locus_tag LOCUS_30130 gene rfbD 148811 147921 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_30130 148864 149790 gene locus_tag LOCUS_30140 gene rfbB 148864 149790 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_30140 149790 150242 gene locus_tag LOCUS_30150 149790 150242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 150958 151899 gene locus_tag LOCUS_30160 150958 151899 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_30160 153478 152384 gene locus_tag LOCUS_30170 153478 152384 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_30170 154352 154723 gene locus_tag LOCUS_30180 154352 154723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 154853 155416 gene locus_tag LOCUS_30190 154853 155416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 155782 156030 gene locus_tag LOCUS_30200 155782 156030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 157861 156992 gene locus_tag LOCUS_30210 157861 156992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 159022 157970 gene locus_tag LOCUS_30220 159022 157970 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_30220 160043 159024 gene locus_tag LOCUS_30230 160043 159024 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_30230 160243 160410 gene locus_tag LOCUS_30240 160243 160410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 160439 161875 gene locus_tag LOCUS_30250 160439 161875 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_30250 161877 162302 gene locus_tag LOCUS_30260 161877 162302 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902960.1 protein_id gnl|my_center|LOCUS_30260 162397 162966 gene locus_tag LOCUS_30270 162397 162966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 163060 164232 gene locus_tag LOCUS_30280 gene coaBC 163060 164232 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902383.1 protein_id gnl|my_center|LOCUS_30280 164348 164986 gene locus_tag LOCUS_30290 164348 164986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005553844.1 protein_id gnl|my_center|LOCUS_30290 165154 165723 gene locus_tag LOCUS_30300 gene hpt 165154 165723 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902373.1 protein_id gnl|my_center|LOCUS_30300 165905 167476 gene locus_tag LOCUS_30310 165905 167476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 167488 168435 gene locus_tag LOCUS_30320 167488 168435 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_30320 168438 169589 gene locus_tag LOCUS_30330 168438 169589 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384741.1 protein_id gnl|my_center|LOCUS_30330 169589 170692 gene locus_tag LOCUS_30340 169589 170692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_30340 170689 172029 gene locus_tag LOCUS_30350 170689 172029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 172102 172629 gene locus_tag LOCUS_30360 172102 172629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 172879 172803 gene locus_tag LOCUS_t00410 172879 172803 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 173391 172945 gene locus_tag LOCUS_30370 173391 172945 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903519.1 protein_id gnl|my_center|LOCUS_30370 173830 173552 gene locus_tag LOCUS_30380 173830 173552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289181.1 protein_id gnl|my_center|LOCUS_30380 173977 174258 gene locus_tag LOCUS_30390 173977 174258 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289179.1 protein_id gnl|my_center|LOCUS_30390 174264 174437 gene locus_tag LOCUS_30400 174264 174437 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902367.1 protein_id gnl|my_center|LOCUS_30400 174434 175234 gene locus_tag LOCUS_30410 174434 175234 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902366.1 protein_id gnl|my_center|LOCUS_30410 175234 175413 gene locus_tag LOCUS_30420 175234 175413 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902365.1 protein_id gnl|my_center|LOCUS_30420 175420 176187 gene locus_tag LOCUS_30430 175420 176187 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902364.1 protein_id gnl|my_center|LOCUS_30430 177064 176285 gene locus_tag LOCUS_30440 177064 176285 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903130.1 protein_id gnl|my_center|LOCUS_30440 177255 178265 gene locus_tag LOCUS_30450 gene artA 177255 178265 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904000.1 protein_id gnl|my_center|LOCUS_30450 178258 178974 gene locus_tag LOCUS_30460 178258 178974 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892488.1 protein_id gnl|my_center|LOCUS_30460 179239 178907 gene locus_tag LOCUS_30470 179239 178907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 180750 179395 gene locus_tag LOCUS_30480 180750 179395 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289176.1 protein_id gnl|my_center|LOCUS_30480 181917 180889 gene locus_tag LOCUS_30490 181917 180889 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902489.1 protein_id gnl|my_center|LOCUS_30490 182121 182642 gene locus_tag LOCUS_30500 182121 182642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 183329 182745 gene locus_tag LOCUS_30510 183329 182745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 184949 183453 gene locus_tag LOCUS_30520 gene gatB 184949 183453 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902210.1 protein_id gnl|my_center|LOCUS_30520 185063 185308 gene locus_tag LOCUS_30530 185063 185308 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904200.1 protein_id gnl|my_center|LOCUS_30530 185538 185353 gene locus_tag LOCUS_30540 185538 185353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 185563 185742 gene locus_tag LOCUS_30550 185563 185742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30550 187818 185743 gene locus_tag LOCUS_30560 187818 185743 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_30560 187981 190632 gene locus_tag LOCUS_30570 187981 190632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 190757 191098 gene locus_tag LOCUS_30580 190757 191098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902209.1 protein_id gnl|my_center|LOCUS_30580 191185 194757 gene locus_tag LOCUS_30590 gene smc 191185 194757 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902208.1 protein_id gnl|my_center|LOCUS_30590 194750 195859 gene locus_tag LOCUS_30600 194750 195859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 196049 196786 gene locus_tag LOCUS_30610 196049 196786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 197291 197485 gene locus_tag LOCUS_30620 197291 197485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 198436 197504 gene locus_tag LOCUS_30630 198436 197504 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289389.1 protein_id gnl|my_center|LOCUS_30630 198888 198466 gene locus_tag LOCUS_30640 198888 198466 CDS product DUF5802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289390.1 protein_id gnl|my_center|LOCUS_30640 199226 200380 gene locus_tag LOCUS_30650 199226 200380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 200457 201116 gene locus_tag LOCUS_30660 200457 201116 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903348.1 protein_id gnl|my_center|LOCUS_30660 201756 201124 gene locus_tag LOCUS_30670 201756 201124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 204277 201935 gene locus_tag LOCUS_30680 gene ppsA 204277 201935 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902200.1 protein_id gnl|my_center|LOCUS_30680 205312 204413 gene locus_tag LOCUS_30690 205312 204413 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902202.1 protein_id gnl|my_center|LOCUS_30690 206708 205416 gene locus_tag LOCUS_30700 gene estD 206708 205416 CDS product esterase EstD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083104.1 protein_id gnl|my_center|LOCUS_30700 206935 207204 gene locus_tag LOCUS_30710 206935 207204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 207272 208360 gene locus_tag LOCUS_30720 207272 208360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 208457 208963 gene locus_tag LOCUS_30730 208457 208963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 210752 209307 gene locus_tag LOCUS_30740 gene thiC 210752 209307 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902492.1 protein_id gnl|my_center|LOCUS_30740 210887 211585 gene locus_tag LOCUS_30750 210887 211585 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902203.1 protein_id gnl|my_center|LOCUS_30750 211724 212452 gene locus_tag LOCUS_30760 211724 212452 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486596.1 protein_id gnl|my_center|LOCUS_30760 212579 213433 gene locus_tag LOCUS_30770 gene mtnP 212579 213433 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259453.1 protein_id gnl|my_center|LOCUS_30770 213579 214100 gene locus_tag LOCUS_30780 213579 214100 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289184.1 protein_id gnl|my_center|LOCUS_30780 214340 215677 gene locus_tag LOCUS_30790 gene trkA 214340 215677 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404994.1 protein_id gnl|my_center|LOCUS_30790 216746 215661 gene locus_tag LOCUS_30800 216746 215661 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405564.1 protein_id gnl|my_center|LOCUS_30800 217558 216824 gene locus_tag LOCUS_30810 217558 216824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 217695 218474 gene locus_tag LOCUS_30820 217695 218474 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902893.1 protein_id gnl|my_center|LOCUS_30820 218471 220021 gene locus_tag LOCUS_30830 218471 220021 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902894.1 protein_id gnl|my_center|LOCUS_30830 220073 220894 gene locus_tag LOCUS_30840 gene surE 220073 220894 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_30840 221210 221602 gene locus_tag LOCUS_30850 221210 221602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 221885 222010 gene locus_tag LOCUS_30860 221885 222010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 222400 222074 gene locus_tag LOCUS_30870 222400 222074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 223255 222872 gene locus_tag LOCUS_30880 223255 222872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 224910 223411 gene locus_tag LOCUS_30890 224910 223411 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902444.1 protein_id gnl|my_center|LOCUS_30890 226495 224957 gene locus_tag LOCUS_30900 226495 224957 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289203.1 protein_id gnl|my_center|LOCUS_30900 228015 226495 gene locus_tag LOCUS_30910 228015 226495 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902442.1 protein_id gnl|my_center|LOCUS_30910 230060 228015 gene locus_tag LOCUS_30920 gene nuoL 230060 228015 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902441.1 protein_id gnl|my_center|LOCUS_30920 230367 230062 gene locus_tag LOCUS_30930 gene nuoK 230367 230062 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902440.1 protein_id gnl|my_center|LOCUS_30930 230801 230364 gene locus_tag LOCUS_30940 230801 230364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 231070 230798 gene locus_tag LOCUS_30950 231070 230798 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902438.1 protein_id gnl|my_center|LOCUS_30950 231571 231110 gene locus_tag LOCUS_30960 231571 231110 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902437.1 protein_id gnl|my_center|LOCUS_30960 232689 231568 gene locus_tag LOCUS_30970 232689 231568 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289200.1 protein_id gnl|my_center|LOCUS_30970 234346 232691 gene locus_tag LOCUS_30980 234346 232691 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_30980 235050 234343 gene locus_tag LOCUS_30990 235050 234343 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902434.1 protein_id gnl|my_center|LOCUS_30990 235487 235047 gene locus_tag LOCUS_31000 235487 235047 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902433.1 protein_id gnl|my_center|LOCUS_31000 236376 235738 gene locus_tag LOCUS_31010 gene purE 236376 235738 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902432.1 protein_id gnl|my_center|LOCUS_31010 237552 236452 gene locus_tag LOCUS_31020 237552 236452 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892490.1 protein_id gnl|my_center|LOCUS_31020 237810 238331 gene locus_tag LOCUS_31030 gene ribH 237810 238331 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902429.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence62 <1 859 gene locus_tag LOCUS_31040 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902428.1:pyridoxal phosphate-dependent aminotransferase 1235 1307 gene locus_tag LOCUS_t00420 1235 1307 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1837 2145 gene locus_tag LOCUS_31050 1837 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 2148 3017 gene locus_tag LOCUS_31060 2148 3017 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265901.1 protein_id gnl|my_center|LOCUS_31060 3001 3288 gene locus_tag LOCUS_31070 3001 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3288 3836 gene locus_tag LOCUS_31080 3288 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 4372 3833 gene locus_tag LOCUS_31090 4372 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 4704 4375 gene locus_tag LOCUS_31100 4704 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 5355 5113 gene locus_tag LOCUS_31110 5355 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 6115 7323 gene locus_tag LOCUS_31120 6115 7323 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904113.1 protein_id gnl|my_center|LOCUS_31120 7653 7324 gene locus_tag LOCUS_31130 7653 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 8357 9694 gene locus_tag LOCUS_31140 gene glmM 8357 9694 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 protein_id gnl|my_center|LOCUS_31140 9969 11654 gene locus_tag LOCUS_31150 9969 11654 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_31150 11691 12425 gene locus_tag LOCUS_31160 11691 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 12864 14372 gene locus_tag LOCUS_31170 12864 14372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 14543 16165 gene locus_tag LOCUS_31180 14543 16165 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_31180 17330 16272 gene locus_tag LOCUS_31190 17330 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 17647 18621 gene locus_tag LOCUS_31200 17647 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 20032 18704 gene locus_tag LOCUS_31210 20032 18704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 20244 21956 gene locus_tag LOCUS_31220 20244 21956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 22167 22562 gene locus_tag LOCUS_31230 22167 22562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 23227 22616 gene locus_tag LOCUS_31240 23227 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 23618 24607 gene locus_tag LOCUS_31250 23618 24607 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_31250 24608 25192 gene locus_tag LOCUS_31260 24608 25192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 27488 25512 gene locus_tag LOCUS_31270 27488 25512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 28440 27478 gene locus_tag LOCUS_31280 28440 27478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 29510 28440 gene locus_tag LOCUS_31290 29510 28440 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_31290 31034 29628 gene locus_tag LOCUS_31300 31034 29628 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_31300 31385 32032 gene locus_tag LOCUS_31310 31385 32032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 32563 34374 gene locus_tag LOCUS_31320 gene glmS 32563 34374 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901947.1 protein_id gnl|my_center|LOCUS_31320 35854 34880 gene locus_tag LOCUS_31330 35854 34880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 36460 36921 gene locus_tag LOCUS_31340 36460 36921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 37935 36961 gene locus_tag LOCUS_31350 37935 36961 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_31350 38829 38053 gene locus_tag LOCUS_31360 38829 38053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 39046 41808 gene locus_tag LOCUS_31370 gene leuS 39046 41808 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903650.1 protein_id gnl|my_center|LOCUS_31370 41827 42219 gene locus_tag LOCUS_31380 41827 42219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 42380 42985 gene locus_tag LOCUS_31390 42380 42985 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902461.1 protein_id gnl|my_center|LOCUS_31390 43124 44023 gene locus_tag LOCUS_31400 43124 44023 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902138.1 protein_id gnl|my_center|LOCUS_31400 44046 44705 gene locus_tag LOCUS_31410 44046 44705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence63 1123 356 gene locus_tag LOCUS_31420 1123 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 1795 2553 gene locus_tag LOCUS_31430 1795 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904163.1 protein_id gnl|my_center|LOCUS_31430 2550 4337 gene locus_tag LOCUS_31440 2550 4337 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904164.1 protein_id gnl|my_center|LOCUS_31440 4492 4710 gene locus_tag LOCUS_31450 4492 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 5146 6042 gene locus_tag LOCUS_31460 5146 6042 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902584.1 protein_id gnl|my_center|LOCUS_31460 6164 6850 gene locus_tag LOCUS_31470 6164 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 7062 8525 gene locus_tag LOCUS_31480 gene secY 7062 8525 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903257.1 protein_id gnl|my_center|LOCUS_31480 10283 9354 gene locus_tag LOCUS_31490 10283 9354 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_31490 10527 10339 gene locus_tag LOCUS_31500 10527 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 10650 13130 gene locus_tag LOCUS_31510 10650 13130 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902213.1 protein_id gnl|my_center|LOCUS_31510 13812 13192 gene locus_tag LOCUS_31520 13812 13192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 14180 14353 gene locus_tag LOCUS_31530 14180 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 14460 15140 gene locus_tag LOCUS_31540 14460 15140 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978110.1 protein_id gnl|my_center|LOCUS_31540 15849 15175 gene locus_tag LOCUS_31550 15849 15175 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289173.1 protein_id gnl|my_center|LOCUS_31550 16079 16495 gene locus_tag LOCUS_31560 16079 16495 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902462.1 protein_id gnl|my_center|LOCUS_31560 16492 17589 gene locus_tag LOCUS_31570 gene meaB 16492 17589 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902463.1 protein_id gnl|my_center|LOCUS_31570 17751 17975 gene locus_tag LOCUS_31580 17751 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 18046 18990 gene locus_tag LOCUS_31590 18046 18990 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902464.1 protein_id gnl|my_center|LOCUS_31590 19441 19052 gene locus_tag LOCUS_31600 19441 19052 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902465.1 protein_id gnl|my_center|LOCUS_31600 20604 19438 gene locus_tag LOCUS_31610 20604 19438 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902466.1 protein_id gnl|my_center|LOCUS_31610 20784 21851 gene locus_tag LOCUS_31620 20784 21851 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763164.1 protein_id gnl|my_center|LOCUS_31620 22030 22275 gene locus_tag LOCUS_31630 22030 22275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 22429 24048 gene locus_tag LOCUS_31640 22429 24048 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427574.1 protein_id gnl|my_center|LOCUS_31640 25641 24220 gene locus_tag LOCUS_31650 gene cyoE 25641 24220 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902456.1 protein_id gnl|my_center|LOCUS_31650 26114 25884 gene locus_tag LOCUS_31660 26114 25884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 26438 26142 gene locus_tag LOCUS_31670 26438 26142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902467.1 protein_id gnl|my_center|LOCUS_31670 26545 27447 gene locus_tag LOCUS_31680 26545 27447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 27485 27778 gene locus_tag LOCUS_31690 27485 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 27979 27818 gene locus_tag LOCUS_31700 27979 27818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 29246 28101 gene locus_tag LOCUS_31710 29246 28101 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289209.1 protein_id gnl|my_center|LOCUS_31710 31120 29447 gene locus_tag LOCUS_31720 31120 29447 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_31720 32038 31391 gene locus_tag LOCUS_31730 32038 31391 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 protein_id gnl|my_center|LOCUS_31730 32190 33236 gene locus_tag LOCUS_31740 32190 33236 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289210.1 protein_id gnl|my_center|LOCUS_31740 33298 33717 gene locus_tag LOCUS_31750 33298 33717 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_31750 35057 33768 gene locus_tag LOCUS_31760 35057 33768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 35157 35318 gene locus_tag LOCUS_31770 35157 35318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 35315 36076 gene locus_tag LOCUS_31780 35315 36076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 36337 37131 gene locus_tag LOCUS_31790 gene fba1 36337 37131 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 protein_id gnl|my_center|LOCUS_31790 37133 38002 gene locus_tag LOCUS_31800 37133 38002 CDS product class 1 fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902473.1 protein_id gnl|my_center|LOCUS_31800 38277 38062 gene locus_tag LOCUS_31810 38277 38062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 39584 38334 gene locus_tag LOCUS_31820 39584 38334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 39883 40080 gene locus_tag LOCUS_31830 39883 40080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 40198 40548 gene locus_tag LOCUS_31840 40198 40548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 41210 40578 gene locus_tag LOCUS_31850 41210 40578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 41817 41188 gene locus_tag LOCUS_31860 41817 41188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 42041 41817 gene locus_tag LOCUS_31870 42041 41817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 42545 42757 gene locus_tag LOCUS_31880 42545 42757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 44267 42981 gene locus_tag LOCUS_31890 gene orc4 44267 42981 CDS product DNA replication protein Orc4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006183330.1 protein_id gnl|my_center|LOCUS_31890 44539 45204 gene locus_tag LOCUS_31900 44539 45204 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_31900 45725 46981 gene locus_tag LOCUS_31910 gene gdhA1 45725 46981 CDS product NADP-specific glutamate dehydrogenase GdhA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289198.1 protein_id gnl|my_center|LOCUS_31910 47066 47929 gene locus_tag LOCUS_31920 47066 47929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 49276 48017 gene locus_tag LOCUS_31930 49276 48017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 49431 50240 gene locus_tag LOCUS_31940 49431 50240 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289221.1 protein_id gnl|my_center|LOCUS_31940 50655 50416 gene locus_tag LOCUS_31950 50655 50416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 51062 52243 gene locus_tag LOCUS_31960 51062 52243 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901949.1 protein_id gnl|my_center|LOCUS_31960 52419 52595 gene locus_tag LOCUS_31970 52419 52595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 53488 52634 gene locus_tag LOCUS_31980 53488 52634 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_31980 53950 53516 gene locus_tag LOCUS_31990 53950 53516 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902538.1 protein_id gnl|my_center|LOCUS_31990 54298 54074 gene locus_tag LOCUS_32000 54298 54074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902537.1 protein_id gnl|my_center|LOCUS_32000 54597 54412 gene locus_tag LOCUS_32010 54597 54412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 55743 54712 gene locus_tag LOCUS_32020 55743 54712 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902535.1 protein_id gnl|my_center|LOCUS_32020 57074 55896 gene locus_tag LOCUS_32030 57074 55896 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902533.1 protein_id gnl|my_center|LOCUS_32030 57227 57361 gene locus_tag LOCUS_32040 57227 57361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 58059 57358 gene locus_tag LOCUS_32050 58059 57358 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902530.1 protein_id gnl|my_center|LOCUS_32050 58247 58603 gene locus_tag LOCUS_32060 58247 58603 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902668.1 protein_id gnl|my_center|LOCUS_32060 58858 59325 gene locus_tag LOCUS_32070 58858 59325 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904153.1 protein_id gnl|my_center|LOCUS_32070 59327 60121 gene locus_tag LOCUS_32080 59327 60121 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_32080 60157 60891 gene locus_tag LOCUS_32090 gene queC 60157 60891 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904151.1 protein_id gnl|my_center|LOCUS_32090 61722 61090 gene locus_tag LOCUS_32100 61722 61090 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902576.1 protein_id gnl|my_center|LOCUS_32100 62680 61781 gene locus_tag LOCUS_32110 62680 61781 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_32110 63372 62737 gene locus_tag LOCUS_32120 63372 62737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 63944 63465 gene locus_tag LOCUS_32130 63944 63465 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902805.1 protein_id gnl|my_center|LOCUS_32130 64452 64024 gene locus_tag LOCUS_32140 gene lrpA1 64452 64024 CDS product HTH-type transcriptional regulator LrpA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902807.1 protein_id gnl|my_center|LOCUS_32140 64606 64920 gene locus_tag LOCUS_32150 64606 64920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 65097 66263 gene locus_tag LOCUS_32160 65097 66263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 67372 66437 gene locus_tag LOCUS_32170 67372 66437 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902808.1 protein_id gnl|my_center|LOCUS_32170 69280 67376 gene locus_tag LOCUS_32180 69280 67376 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289282.1 protein_id gnl|my_center|LOCUS_32180 69434 69700 gene locus_tag LOCUS_32190 69434 69700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 71378 70227 gene locus_tag LOCUS_32200 gene aroC 71378 70227 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902889.1 protein_id gnl|my_center|LOCUS_32200 71982 71614 gene locus_tag LOCUS_32210 71982 71614 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904078.1 protein_id gnl|my_center|LOCUS_32210 72156 72479 gene locus_tag LOCUS_32220 72156 72479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 72575 73555 gene locus_tag LOCUS_32230 72575 73555 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056996568.1 protein_id gnl|my_center|LOCUS_32230 73998 73588 gene locus_tag LOCUS_32240 73998 73588 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902412.1 protein_id gnl|my_center|LOCUS_32240 74711 74079 gene locus_tag LOCUS_32250 74711 74079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902413.1 protein_id gnl|my_center|LOCUS_32250 75738 74884 gene locus_tag LOCUS_32260 75738 74884 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902414.1 protein_id gnl|my_center|LOCUS_32260 76077 75895 gene locus_tag LOCUS_32270 76077 75895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 76227 76301 gene locus_tag LOCUS_t00430 76227 76301 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 76476 76718 gene locus_tag LOCUS_32280 76476 76718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 77038 77427 gene locus_tag LOCUS_32290 77038 77427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32290 77656 78723 gene locus_tag LOCUS_32300 77656 78723 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140387.1 protein_id gnl|my_center|LOCUS_32300 79176 78922 gene locus_tag LOCUS_32310 79176 78922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 80179 79544 gene locus_tag LOCUS_32320 80179 79544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 81241 80816 gene locus_tag LOCUS_32330 81241 80816 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_32330 82224 82373 gene locus_tag LOCUS_32340 82224 82373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 83115 86201 gene locus_tag LOCUS_32350 83115 86201 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890482.1 protein_id gnl|my_center|LOCUS_32350 86365 86715 gene locus_tag LOCUS_32360 86365 86715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 87192 88070 gene locus_tag LOCUS_32370 87192 88070 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289610.1 protein_id gnl|my_center|LOCUS_32370 88070 88513 gene locus_tag LOCUS_32380 88070 88513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 89018 88572 gene locus_tag LOCUS_32390 89018 88572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 89212 89403 gene locus_tag LOCUS_32400 89212 89403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 89306 89638 gene locus_tag LOCUS_32410 89306 89638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 89723 90073 gene locus_tag LOCUS_32420 89723 90073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 90134 90613 gene locus_tag LOCUS_32430 90134 90613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 91384 91611 gene locus_tag LOCUS_32440 91384 91611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 92617 91868 gene locus_tag LOCUS_32450 92617 91868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 92931 93272 gene locus_tag LOCUS_32460 92931 93272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 93274 93600 gene locus_tag LOCUS_32470 93274 93600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 93597 93902 gene locus_tag LOCUS_32480 93597 93902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 94236 93997 gene locus_tag LOCUS_32490 94236 93997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 94965 94276 gene locus_tag LOCUS_32500 94965 94276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 95254 94955 gene locus_tag LOCUS_32510 95254 94955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 95900 95445 gene locus_tag LOCUS_32520 95900 95445 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903086.1 protein_id gnl|my_center|LOCUS_32520 96209 96490 gene locus_tag LOCUS_32530 96209 96490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 96847 98019 gene locus_tag LOCUS_32540 96847 98019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 98258 98416 gene locus_tag LOCUS_32550 98258 98416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 98688 98413 gene locus_tag LOCUS_32560 98688 98413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 99303 99464 gene locus_tag LOCUS_32570 99303 99464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 99526 99768 gene locus_tag LOCUS_32580 99526 99768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 101425 99914 gene locus_tag LOCUS_32590 101425 99914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32590 102023 102424 gene locus_tag LOCUS_32600 102023 102424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32600 102597 103439 gene locus_tag LOCUS_32610 102597 103439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32610 103978 104517 gene locus_tag LOCUS_32620 103978 104517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890498.1 protein_id gnl|my_center|LOCUS_32620 104521 104979 gene locus_tag LOCUS_32630 104521 104979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 104976 106409 gene locus_tag LOCUS_32640 104976 106409 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890501.1 protein_id gnl|my_center|LOCUS_32640 106735 106574 gene locus_tag LOCUS_32650 106735 106574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 106873 106754 gene locus_tag LOCUS_32660 106873 106754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 107112 106894 gene locus_tag LOCUS_32670 107112 106894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 107347 107195 gene locus_tag LOCUS_32680 107347 107195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 107958 110264 gene locus_tag LOCUS_32690 107958 110264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 110943 110770 gene locus_tag LOCUS_32700 110943 110770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32700 111403 111702 gene locus_tag LOCUS_32710 111403 111702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 112853 112500 gene locus_tag LOCUS_32720 112853 112500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 113362 112838 gene locus_tag LOCUS_32730 113362 112838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 113471 113731 gene locus_tag LOCUS_32740 113471 113731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 113739 113921 gene locus_tag LOCUS_32750 113739 113921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 114888 114013 gene locus_tag LOCUS_32760 114888 114013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 115458 115877 gene locus_tag LOCUS_32770 115458 115877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 115906 117639 gene locus_tag LOCUS_32780 115906 117639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890505.1 protein_id gnl|my_center|LOCUS_32780 117636 118466 gene locus_tag LOCUS_32790 117636 118466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 118469 119530 gene locus_tag LOCUS_32800 118469 119530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 119537 120658 gene locus_tag LOCUS_32810 119537 120658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904034.1 protein_id gnl|my_center|LOCUS_32810 120651 122876 gene locus_tag LOCUS_32820 120651 122876 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289607.1 protein_id gnl|my_center|LOCUS_32820 122869 126693 gene locus_tag LOCUS_32830 122869 126693 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904032.1 protein_id gnl|my_center|LOCUS_32830 126690 127574 gene locus_tag LOCUS_32840 126690 127574 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904031.1 protein_id gnl|my_center|LOCUS_32840 127571 129094 gene locus_tag LOCUS_32850 127571 129094 CDS product primase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890461.1 protein_id gnl|my_center|LOCUS_32850 129107 130345 gene locus_tag LOCUS_32860 129107 130345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 130987 131394 gene locus_tag LOCUS_32870 130987 131394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890455.1 protein_id gnl|my_center|LOCUS_32870 131577 132212 gene locus_tag LOCUS_32880 131577 132212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904232.1 protein_id gnl|my_center|LOCUS_32880 132286 132576 gene locus_tag LOCUS_32890 132286 132576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289727.1 protein_id gnl|my_center|LOCUS_32890 132576 132911 gene locus_tag LOCUS_32900 132576 132911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892774.1 protein_id gnl|my_center|LOCUS_32900 133060 133659 gene locus_tag LOCUS_32910 133060 133659 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289745.1 protein_id gnl|my_center|LOCUS_32910 133656 133922 gene locus_tag LOCUS_32920 133656 133922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32920 134031 134165 gene locus_tag LOCUS_32930 134031 134165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32930 134625 134458 gene locus_tag LOCUS_32940 134625 134458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 134951 135850 gene locus_tag LOCUS_32950 134951 135850 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904220.1 protein_id gnl|my_center|LOCUS_32950 136077 137048 gene locus_tag LOCUS_32960 136077 137048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 138321 137416 gene locus_tag LOCUS_32970 138321 137416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 139598 138324 gene locus_tag LOCUS_32980 139598 138324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 139968 139729 gene locus_tag LOCUS_32990 139968 139729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 140351 141655 gene locus_tag LOCUS_33000 140351 141655 CDS product IS4-like element ISH8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890532.1 protein_id gnl|my_center|LOCUS_33000 142158 141694 gene locus_tag LOCUS_33010 142158 141694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 142317 143294 gene locus_tag LOCUS_33020 142317 143294 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904212.1 protein_id gnl|my_center|LOCUS_33020 143368 144270 gene locus_tag LOCUS_33030 143368 144270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 144367 144597 gene locus_tag LOCUS_33040 144367 144597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 144689 145069 gene locus_tag LOCUS_33050 144689 145069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 145137 145799 gene locus_tag LOCUS_33060 145137 145799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 147175 146147 gene locus_tag LOCUS_33070 147175 146147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 148620 147832 gene locus_tag LOCUS_33080 148620 147832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 148890 149381 gene locus_tag LOCUS_33090 148890 149381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 149384 149749 gene locus_tag LOCUS_33100 149384 149749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 150020 150313 gene locus_tag LOCUS_33110 150020 150313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 151226 150336 gene locus_tag LOCUS_33120 151226 150336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 151407 151979 gene locus_tag LOCUS_33130 151407 151979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 152843 152061 gene locus_tag LOCUS_33140 152843 152061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 152984 153271 gene locus_tag LOCUS_33150 152984 153271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 154652 153288 gene locus_tag LOCUS_33160 154652 153288 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289743.1 protein_id gnl|my_center|LOCUS_33160 155140 156054 gene locus_tag LOCUS_33170 155140 156054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 156116 156277 gene locus_tag LOCUS_33180 156116 156277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 157813 156446 gene locus_tag LOCUS_33190 157813 156446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 158226 157945 gene locus_tag LOCUS_33200 158226 157945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 159823 158330 gene locus_tag LOCUS_33210 159823 158330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 159950 160852 gene locus_tag LOCUS_33220 159950 160852 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_33220 161649 162266 gene locus_tag LOCUS_33230 161649 162266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 162266 162397 gene locus_tag LOCUS_33240 162266 162397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 163141 164502 gene locus_tag LOCUS_33250 163141 164502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 164872 164997 gene locus_tag LOCUS_33260 164872 164997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 165396 165629 gene locus_tag LOCUS_33270 165396 165629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 166321 165716 gene locus_tag LOCUS_33280 166321 165716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33280 166430 167152 gene locus_tag LOCUS_33290 166430 167152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 167162 167692 gene locus_tag LOCUS_33300 167162 167692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289744.1 protein_id gnl|my_center|LOCUS_33300 167776 168069 gene locus_tag LOCUS_33310 167776 168069 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890479.1 protein_id gnl|my_center|LOCUS_33310 168259 168531 gene locus_tag LOCUS_33320 168259 168531 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_33320 169506 169297 gene locus_tag LOCUS_33330 169506 169297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 169663 170421 gene locus_tag LOCUS_33340 169663 170421 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289724.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33340 171258 172136 gene locus_tag LOCUS_33350 171258 172136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 172467 172718 gene locus_tag LOCUS_33360 172467 172718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 172715 172978 gene locus_tag LOCUS_33370 172715 172978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 172975 173181 gene locus_tag LOCUS_33380 172975 173181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 173425 173772 gene locus_tag LOCUS_33390 173425 173772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 173779 174144 gene locus_tag LOCUS_33400 173779 174144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 174201 174776 gene locus_tag LOCUS_33410 174201 174776 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_33410 174900 175127 gene locus_tag LOCUS_33420 174900 175127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 175926 175219 gene locus_tag LOCUS_33430 175926 175219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33430 175831 176049 gene locus_tag LOCUS_33440 175831 176049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 179181 176773 gene locus_tag LOCUS_33450 179181 176773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 179669 179487 gene locus_tag LOCUS_33460 179669 179487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 180240 180052 gene locus_tag LOCUS_33470 180240 180052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 182098 181376 gene locus_tag LOCUS_33480 182098 181376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 182625 181984 gene locus_tag LOCUS_33490 182625 181984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 182819 182622 gene locus_tag LOCUS_33500 182819 182622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892499.1 protein_id gnl|my_center|LOCUS_33500 183026 183232 gene locus_tag LOCUS_33510 183026 183232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904137.1 protein_id gnl|my_center|LOCUS_33510 183229 183600 gene locus_tag LOCUS_33520 183229 183600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 183593 183916 gene locus_tag LOCUS_33530 183593 183916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 183987 184178 gene locus_tag LOCUS_33540 183987 184178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 184314 184580 gene locus_tag LOCUS_33550 184314 184580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33550 184741 185748 gene locus_tag LOCUS_33560 184741 185748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 186252 185833 gene locus_tag LOCUS_33570 186252 185833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 186527 186874 gene locus_tag LOCUS_33580 186527 186874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 187045 187986 gene locus_tag LOCUS_33590 187045 187986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 188074 188430 gene locus_tag LOCUS_33600 188074 188430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 188531 188899 gene locus_tag LOCUS_33610 188531 188899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 189216 189067 gene locus_tag LOCUS_33620 189216 189067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 190224 189304 gene locus_tag LOCUS_33630 190224 189304 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289741.1 protein_id gnl|my_center|LOCUS_33630 190363 190686 gene locus_tag LOCUS_33640 190363 190686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904196.1 protein_id gnl|my_center|LOCUS_33640 192635 191289 gene locus_tag LOCUS_33650 192635 191289 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173362416.1 protein_id gnl|my_center|LOCUS_33650 193699 193418 gene locus_tag LOCUS_33660 193699 193418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33660 194213 193731 gene locus_tag LOCUS_33670 194213 193731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33670 194464 194108 gene locus_tag LOCUS_33680 194464 194108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33680 195602 194409 gene locus_tag LOCUS_33690 195602 194409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33690 197814 195931 gene locus_tag LOCUS_33700 197814 195931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 198688 198365 gene locus_tag LOCUS_33710 198688 198365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 199044 198691 gene locus_tag LOCUS_33720 199044 198691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 200710 199334 gene locus_tag LOCUS_33730 200710 199334 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365322.1 protein_id gnl|my_center|LOCUS_33730 202593 200758 gene locus_tag LOCUS_33740 202593 200758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33740 203709 202618 gene locus_tag LOCUS_33750 203709 202618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33750 204153 203752 gene locus_tag LOCUS_33760 204153 203752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 204488 204967 gene locus_tag LOCUS_33770 204488 204967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 205136 205447 gene locus_tag LOCUS_33780 205136 205447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 209614 205466 gene locus_tag LOCUS_33790 209614 205466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence64 2018 57 gene locus_tag LOCUS_33800 2018 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 5840 2025 gene locus_tag LOCUS_33810 5840 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 8581 5846 gene locus_tag LOCUS_33820 8581 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 9188 11428 gene locus_tag LOCUS_33830 9188 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 11994 11569 gene locus_tag LOCUS_33840 11994 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 12503 12336 gene locus_tag LOCUS_33850 12503 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33850 >Feature sequence65 >Feature sequence66 >Feature sequence67 421 630 gene locus_tag LOCUS_33860 421 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence68 330 608 gene locus_tag LOCUS_33870 330 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 605 871 gene locus_tag LOCUS_33880 605 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 >Feature sequence69 >Feature sequence70 >Feature sequence71 >Feature sequence72 >Feature sequence73 335 210 gene locus_tag LOCUS_33890 335 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 937 347 gene locus_tag LOCUS_33900 937 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 >Feature sequence74 >Feature sequence75 >Feature sequence76 >Feature sequence77 >Feature sequence78 >Feature sequence79 763 1029 gene locus_tag LOCUS_33910 763 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 1947 1318 gene locus_tag LOCUS_33920 1947 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 2214 3287 gene locus_tag LOCUS_33930 2214 3287 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225886.1 protein_id gnl|my_center|LOCUS_33930 3284 4126 gene locus_tag LOCUS_33940 3284 4126 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229377.1 protein_id gnl|my_center|LOCUS_33940 4191 4412 gene locus_tag LOCUS_33950 4191 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 4456 5754 gene locus_tag LOCUS_33960 gene hisD 4456 5754 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903049.1 protein_id gnl|my_center|LOCUS_33960 5840 6049 gene locus_tag LOCUS_33970 5840 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 6155 6529 gene locus_tag LOCUS_33980 gene erpA 6155 6529 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255939.1 protein_id gnl|my_center|LOCUS_33980 6873 6673 gene locus_tag LOCUS_33990 6873 6673 CDS product dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289329.1 protein_id gnl|my_center|LOCUS_33990 7619 6960 gene locus_tag LOCUS_34000 7619 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903725.1 protein_id gnl|my_center|LOCUS_34000 8229 7612 gene locus_tag LOCUS_34010 8229 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903726.1 protein_id gnl|my_center|LOCUS_34010 9274 8285 gene locus_tag LOCUS_34020 9274 8285 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903051.1 protein_id gnl|my_center|LOCUS_34020 9469 10680 gene locus_tag LOCUS_34030 9469 10680 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261142.1 protein_id gnl|my_center|LOCUS_34030 11041 10718 gene locus_tag LOCUS_34040 11041 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 11501 11262 gene locus_tag LOCUS_34050 11501 11262 CDS product DUF5816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903052.1 protein_id gnl|my_center|LOCUS_34050 11680 12090 gene locus_tag LOCUS_34060 11680 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 12681 12238 gene locus_tag LOCUS_34070 12681 12238 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_34070 13763 12762 gene locus_tag LOCUS_34080 13763 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 13903 14967 gene locus_tag LOCUS_34090 gene trmB 13903 14967 CDS product transcriptional regulator TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892507.1 protein_id gnl|my_center|LOCUS_34090 15427 16749 gene locus_tag LOCUS_34100 15427 16749 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972955.1 protein_id gnl|my_center|LOCUS_34100 16739 17782 gene locus_tag LOCUS_34110 16739 17782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 17782 18816 gene locus_tag LOCUS_34120 17782 18816 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_34120 18821 20008 gene locus_tag LOCUS_34130 gene ugpC 18821 20008 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_34130 20172 21239 gene locus_tag LOCUS_34140 20172 21239 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_34140 21316 22281 gene locus_tag LOCUS_34150 21316 22281 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_34150 23711 22302 gene locus_tag LOCUS_34160 23711 22302 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289312.1 protein_id gnl|my_center|LOCUS_34160 24026 25186 gene locus_tag LOCUS_34170 24026 25186 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_34170 26265 25564 gene locus_tag LOCUS_34180 26265 25564 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902974.1 protein_id gnl|my_center|LOCUS_34180 27719 26526 gene locus_tag LOCUS_34190 27719 26526 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289314.1 protein_id gnl|my_center|LOCUS_34190 29146 27917 gene locus_tag LOCUS_34200 gene orc4 29146 27917 CDS product DNA replication protein Orc4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006183330.1 protein_id gnl|my_center|LOCUS_34200 30040 30801 gene locus_tag LOCUS_34210 30040 30801 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289315.1 protein_id gnl|my_center|LOCUS_34210 30911 31966 gene locus_tag LOCUS_34220 30911 31966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 32742 32086 gene locus_tag LOCUS_34230 32742 32086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 33810 32863 gene locus_tag LOCUS_34240 33810 32863 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902979.1 protein_id gnl|my_center|LOCUS_34240 33991 34473 gene locus_tag LOCUS_34250 33991 34473 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902980.1 protein_id gnl|my_center|LOCUS_34250 36375 34507 gene locus_tag LOCUS_34260 gene gatE 36375 34507 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902981.1 protein_id gnl|my_center|LOCUS_34260 36974 36519 gene locus_tag LOCUS_34270 36974 36519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 38561 37224 gene locus_tag LOCUS_34280 38561 37224 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902995.1 protein_id gnl|my_center|LOCUS_34280 39655 38558 gene locus_tag LOCUS_34290 gene btuC 39655 38558 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902994.1 protein_id gnl|my_center|LOCUS_34290 39714 40784 gene locus_tag LOCUS_34300 39714 40784 CDS product PGF-CTERM-anchored ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902993.1 protein_id gnl|my_center|LOCUS_34300 40883 41164 gene locus_tag LOCUS_34310 gene srp19 40883 41164 CDS product signal recognition particle subunit SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902992.1 protein_id gnl|my_center|LOCUS_34310 41166 41426 gene locus_tag LOCUS_34320 41166 41426 CDS product H/ACA ribonucleoprotein complex subunit GAR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902991.1 protein_id gnl|my_center|LOCUS_34320 41525 42595 gene locus_tag LOCUS_34330 41525 42595 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902990.1 protein_id gnl|my_center|LOCUS_34330 43414 42668 gene locus_tag LOCUS_34340 43414 42668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 44586 43453 gene locus_tag LOCUS_34350 44586 43453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 46201 44681 gene locus_tag LOCUS_34360 gene cysS 46201 44681 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902789.1 protein_id gnl|my_center|LOCUS_34360 46970 46350 gene locus_tag LOCUS_34370 46970 46350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 47069 47473 gene locus_tag LOCUS_34380 47069 47473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 48049 47525 gene locus_tag LOCUS_34390 48049 47525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 48181 48507 gene locus_tag LOCUS_34400 48181 48507 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903744.1 protein_id gnl|my_center|LOCUS_34400 48674 48946 gene locus_tag LOCUS_34410 48674 48946 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902985.1 protein_id gnl|my_center|LOCUS_34410 49056 49523 gene locus_tag LOCUS_34420 49056 49523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 49525 51129 gene locus_tag LOCUS_34430 49525 51129 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902982.1 protein_id gnl|my_center|LOCUS_34430 51332 51655 gene locus_tag LOCUS_34440 51332 51655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 51791 53206 gene locus_tag LOCUS_34450 51791 53206 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_34450 53717 53379 gene locus_tag LOCUS_34460 53717 53379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34460 54454 53669 gene locus_tag LOCUS_34470 54454 53669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34470 54756 54989 gene locus_tag LOCUS_34480 54756 54989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 55817 55086 gene locus_tag LOCUS_34490 55817 55086 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902515.1 protein_id gnl|my_center|LOCUS_34490 56185 55823 gene locus_tag LOCUS_34500 56185 55823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 56604 57092 gene locus_tag LOCUS_34510 56604 57092 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 protein_id gnl|my_center|LOCUS_34510 57089 58672 gene locus_tag LOCUS_34520 57089 58672 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902982.1 protein_id gnl|my_center|LOCUS_34520 59624 58749 gene locus_tag LOCUS_34530 59624 58749 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172783.1 protein_id gnl|my_center|LOCUS_34530 60931 61326 gene locus_tag LOCUS_34540 60931 61326 CDS product DUF5805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289235.1 protein_id gnl|my_center|LOCUS_34540 61316 62362 gene locus_tag LOCUS_34550 61316 62362 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902588.1 protein_id gnl|my_center|LOCUS_34550 63628 62744 gene locus_tag LOCUS_34560 63628 62744 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_34560 64955 64029 gene locus_tag LOCUS_34570 64955 64029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902593.1 protein_id gnl|my_center|LOCUS_34570 67068 65035 gene locus_tag LOCUS_34580 67068 65035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902594.1 protein_id gnl|my_center|LOCUS_34580 67963 67127 gene locus_tag LOCUS_34590 67963 67127 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892496.1 protein_id gnl|my_center|LOCUS_34590 68591 68184 gene locus_tag LOCUS_34600 68591 68184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 69900 68851 gene locus_tag LOCUS_34610 gene dph2 69900 68851 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902598.1 protein_id gnl|my_center|LOCUS_34610 70132 71058 gene locus_tag LOCUS_34620 70132 71058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 71156 72187 gene locus_tag LOCUS_34630 71156 72187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 72430 72248 gene locus_tag LOCUS_34640 72430 72248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 72583 72993 gene locus_tag LOCUS_34650 72583 72993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 72995 73642 gene locus_tag LOCUS_34660 72995 73642 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902599.1 protein_id gnl|my_center|LOCUS_34660 74178 73639 gene locus_tag LOCUS_34670 74178 73639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 76085 74241 gene locus_tag LOCUS_34680 76085 74241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 76187 76471 gene locus_tag LOCUS_34690 76187 76471 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902601.1 protein_id gnl|my_center|LOCUS_34690 77446 76565 gene locus_tag LOCUS_34700 77446 76565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 78357 77542 gene locus_tag LOCUS_34710 gene hisF 78357 77542 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902602.1 protein_id gnl|my_center|LOCUS_34710 79789 78443 gene locus_tag LOCUS_34720 79789 78443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 80493 79786 gene locus_tag LOCUS_34730 80493 79786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 80611 80799 gene locus_tag LOCUS_34740 80611 80799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 81028 80801 gene locus_tag LOCUS_34750 81028 80801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902778.1 protein_id gnl|my_center|LOCUS_34750 81473 81174 gene locus_tag LOCUS_34760 81473 81174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 81762 82358 gene locus_tag LOCUS_34770 81762 82358 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902777.1 protein_id gnl|my_center|LOCUS_34770 82414 83757 gene locus_tag LOCUS_34780 82414 83757 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902776.1 protein_id gnl|my_center|LOCUS_34780 83770 85590 gene locus_tag LOCUS_34790 gene menD 83770 85590 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_34790 86618 85593 gene locus_tag LOCUS_34800 86618 85593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 87533 87201 gene locus_tag LOCUS_34810 gene hsmR 87533 87201 CDS product multidrug efflux SMR transporter protein HsmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903382.1 protein_id gnl|my_center|LOCUS_34810 87617 88405 gene locus_tag LOCUS_34820 87617 88405 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903381.1 protein_id gnl|my_center|LOCUS_34820 89054 88848 gene locus_tag LOCUS_34830 89054 88848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 89973 89188 gene locus_tag LOCUS_34840 89973 89188 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902620.1 protein_id gnl|my_center|LOCUS_34840 90111 90581 gene locus_tag LOCUS_34850 90111 90581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 91286 91104 gene locus_tag LOCUS_34860 91286 91104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 92308 93819 gene locus_tag LOCUS_34870 92308 93819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 93951 94142 gene locus_tag LOCUS_34880 93951 94142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 94202 94504 gene locus_tag LOCUS_34890 94202 94504 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_34890 94601 95089 gene locus_tag LOCUS_34900 94601 95089 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902796.1 protein_id gnl|my_center|LOCUS_34900 95922 95314 gene locus_tag LOCUS_34910 95922 95314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 96195 96827 gene locus_tag LOCUS_34920 96195 96827 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902795.1 protein_id gnl|my_center|LOCUS_34920 96829 97869 gene locus_tag LOCUS_34930 96829 97869 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902794.1 protein_id gnl|my_center|LOCUS_34930 97888 98235 gene locus_tag LOCUS_34940 97888 98235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 98388 99626 gene locus_tag LOCUS_34950 98388 99626 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902792.1 protein_id gnl|my_center|LOCUS_34950 100478 99648 gene locus_tag LOCUS_34960 100478 99648 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903881.1 protein_id gnl|my_center|LOCUS_34960 100607 101725 gene locus_tag LOCUS_34970 100607 101725 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902659.1 protein_id gnl|my_center|LOCUS_34970 102577 101777 gene locus_tag LOCUS_34980 gene yfaU 102577 101777 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992992.1 protein_id gnl|my_center|LOCUS_34980 103243 102644 gene locus_tag LOCUS_34990 103243 102644 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902490.1 protein_id gnl|my_center|LOCUS_34990 103505 103281 gene locus_tag LOCUS_35000 103505 103281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 103624 104307 gene locus_tag LOCUS_35010 103624 104307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 104562 105047 gene locus_tag LOCUS_35020 104562 105047 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_35020 105050 106207 gene locus_tag LOCUS_35030 105050 106207 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459619.1 protein_id gnl|my_center|LOCUS_35030 106417 107649 gene locus_tag LOCUS_35040 106417 107649 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807909.1 protein_id gnl|my_center|LOCUS_35040 107883 109736 gene locus_tag LOCUS_35050 107883 109736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 110325 109738 gene locus_tag LOCUS_35060 110325 109738 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_35060 112641 110491 gene locus_tag LOCUS_35070 gene purL 112641 110491 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902605.1 protein_id gnl|my_center|LOCUS_35070 112763 113224 gene locus_tag LOCUS_35080 112763 113224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 113324 114013 gene locus_tag LOCUS_35090 113324 114013 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_35090 114010 115140 gene locus_tag LOCUS_35100 114010 115140 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902607.1 protein_id gnl|my_center|LOCUS_35100 115395 115156 gene locus_tag LOCUS_35110 115395 115156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 116641 115550 gene locus_tag LOCUS_35120 116641 115550 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902811.1 protein_id gnl|my_center|LOCUS_35120 117100 116792 gene locus_tag LOCUS_35130 117100 116792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 118449 117097 gene locus_tag LOCUS_35140 gene nrfD 118449 117097 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902582.1 protein_id gnl|my_center|LOCUS_35140 120107 118446 gene locus_tag LOCUS_35150 120107 118446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 121020 120346 gene locus_tag LOCUS_35160 121020 120346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 121156 121383 gene locus_tag LOCUS_35170 121156 121383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 121449 121682 gene locus_tag LOCUS_35180 121449 121682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 121758 122021 gene locus_tag LOCUS_35190 121758 122021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 124051 122294 gene locus_tag LOCUS_35200 124051 122294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 124577 124134 gene locus_tag LOCUS_35210 124577 124134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 125626 124718 gene locus_tag LOCUS_35220 125626 124718 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_35220 >Feature sequence80 1588 599 gene locus_tag LOCUS_35230 1588 599 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_35230 1778 2056 gene locus_tag LOCUS_35240 gene gatC 1778 2056 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289242.1 protein_id gnl|my_center|LOCUS_35240 2053 3327 gene locus_tag LOCUS_35250 gene gatA 2053 3327 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902611.1 protein_id gnl|my_center|LOCUS_35250 3456 3869 gene locus_tag LOCUS_35260 3456 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 3974 4762 gene locus_tag LOCUS_35270 3974 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 5200 4841 gene locus_tag LOCUS_35280 5200 4841 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902769.1 protein_id gnl|my_center|LOCUS_35280 6067 5264 gene locus_tag LOCUS_35290 6067 5264 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328055.1 protein_id gnl|my_center|LOCUS_35290 7768 6146 gene locus_tag LOCUS_35300 7768 6146 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902770.1 protein_id gnl|my_center|LOCUS_35300 8862 7765 gene locus_tag LOCUS_35310 8862 7765 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_35310 9758 8859 gene locus_tag LOCUS_35320 9758 8859 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_35320 11075 9870 gene locus_tag LOCUS_35330 11075 9870 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902643.1 protein_id gnl|my_center|LOCUS_35330 12278 11118 gene locus_tag LOCUS_35340 12278 11118 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902774.1 protein_id gnl|my_center|LOCUS_35340 13972 13049 gene locus_tag LOCUS_35350 13972 13049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 14217 13969 gene locus_tag LOCUS_35360 14217 13969 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902408.1 protein_id gnl|my_center|LOCUS_35360 14592 14314 gene locus_tag LOCUS_35370 14592 14314 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902407.1 protein_id gnl|my_center|LOCUS_35370 14802 16601 gene locus_tag LOCUS_35380 14802 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 16607 17461 gene locus_tag LOCUS_35390 16607 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 17684 19390 gene locus_tag LOCUS_35400 17684 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 19856 19482 gene locus_tag LOCUS_35410 19856 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902404.1 protein_id gnl|my_center|LOCUS_35410 19993 20679 gene locus_tag LOCUS_35420 19993 20679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 21617 20742 gene locus_tag LOCUS_35430 21617 20742 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289189.1 protein_id gnl|my_center|LOCUS_35430 21713 22057 gene locus_tag LOCUS_35440 21713 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence81 28 1188 gene locus_tag LOCUS_35450 28 1188 CDS product DR2241 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902784.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence82 443 249 gene locus_tag LOCUS_35460 443 249 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902783.1 protein_id gnl|my_center|LOCUS_35460 1933 569 gene locus_tag LOCUS_35470 1933 569 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902782.1 protein_id gnl|my_center|LOCUS_35470 2329 2634 gene locus_tag LOCUS_35480 2329 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_35480 5600 2877 gene locus_tag LOCUS_35490 5600 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 5927 5649 gene locus_tag LOCUS_35500 5927 5649 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902779.1 protein_id gnl|my_center|LOCUS_35500 6632 5997 gene locus_tag LOCUS_35510 6632 5997 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249693.1 protein_id gnl|my_center|LOCUS_35510 7907 6741 gene locus_tag LOCUS_35520 7907 6741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902649.1 protein_id gnl|my_center|LOCUS_35520 8478 8008 gene locus_tag LOCUS_35530 8478 8008 CDS product DUF5793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902637.1 protein_id gnl|my_center|LOCUS_35530 8792 9256 gene locus_tag LOCUS_35540 8792 9256 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902552.1 protein_id gnl|my_center|LOCUS_35540 9263 10468 gene locus_tag LOCUS_35550 9263 10468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902551.1 protein_id gnl|my_center|LOCUS_35550 10465 10800 gene locus_tag LOCUS_35560 10465 10800 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289224.1 protein_id gnl|my_center|LOCUS_35560 10793 11431 gene locus_tag LOCUS_35570 10793 11431 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902549.1 protein_id gnl|my_center|LOCUS_35570 12054 11623 gene locus_tag LOCUS_35580 12054 11623 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902548.1 protein_id gnl|my_center|LOCUS_35580 12162 12887 gene locus_tag LOCUS_35590 12162 12887 CDS product protein sorting system archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902547.1 protein_id gnl|my_center|LOCUS_35590 12954 14294 gene locus_tag LOCUS_35600 12954 14294 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902546.1 protein_id gnl|my_center|LOCUS_35600 14412 16214 gene locus_tag LOCUS_35610 14412 16214 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361675.1 protein_id gnl|my_center|LOCUS_35610 16409 16098 gene locus_tag LOCUS_35620 16409 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 16939 16505 gene locus_tag LOCUS_35630 16939 16505 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902351.1 protein_id gnl|my_center|LOCUS_35630 17567 17073 gene locus_tag LOCUS_35640 17567 17073 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892592.1 protein_id gnl|my_center|LOCUS_35640 18878 17658 gene locus_tag LOCUS_35650 gene sufD 18878 17658 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902349.1 protein_id gnl|my_center|LOCUS_35650 20310 18880 gene locus_tag LOCUS_35660 gene sufB 20310 18880 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902348.1 protein_id gnl|my_center|LOCUS_35660 21282 20371 gene locus_tag LOCUS_35670 21282 20371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902347.1 protein_id gnl|my_center|LOCUS_35670 24237 21508 gene locus_tag LOCUS_35680 24237 21508 CDS product DNA polymerase elongation subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902345.1 protein_id gnl|my_center|LOCUS_35680 24371 24556 gene locus_tag LOCUS_35690 24371 24556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 24609 25130 gene locus_tag LOCUS_35700 24609 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 25127 25588 gene locus_tag LOCUS_35710 25127 25588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 28312 25631 gene locus_tag LOCUS_35720 gene rad50 28312 25631 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902341.1 protein_id gnl|my_center|LOCUS_35720 28557 28309 gene locus_tag LOCUS_35730 28557 28309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 29702 28548 gene locus_tag LOCUS_35740 gene mre11 29702 28548 CDS product DNA double-strand break repair protein Mre11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902340.1 protein_id gnl|my_center|LOCUS_35740 30335 30066 gene locus_tag LOCUS_35750 30335 30066 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902339.1 protein_id gnl|my_center|LOCUS_35750 30414 31679 gene locus_tag LOCUS_35760 30414 31679 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_35760 32040 31903 gene locus_tag LOCUS_35770 32040 31903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 32229 32783 gene locus_tag LOCUS_35780 32229 32783 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902125.1 protein_id gnl|my_center|LOCUS_35780 32890 33396 gene locus_tag LOCUS_35790 32890 33396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 33398 35716 gene locus_tag LOCUS_35800 33398 35716 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904206.1 protein_id gnl|my_center|LOCUS_35800 36018 35770 gene locus_tag LOCUS_35810 36018 35770 CDS product DUF3194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902128.1 protein_id gnl|my_center|LOCUS_35810 36414 36019 gene locus_tag LOCUS_35820 36414 36019 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902129.1 protein_id gnl|my_center|LOCUS_35820 36665 36480 gene locus_tag LOCUS_35830 36665 36480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 36826 36662 gene locus_tag LOCUS_35840 36826 36662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 37132 36866 gene locus_tag LOCUS_35850 37132 36866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 37566 37291 gene locus_tag LOCUS_35860 37566 37291 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289127.1 protein_id gnl|my_center|LOCUS_35860 37860 37654 gene locus_tag LOCUS_35870 37860 37654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 38779 38018 gene locus_tag LOCUS_35880 38779 38018 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902133.1 protein_id gnl|my_center|LOCUS_35880 40487 38877 gene locus_tag LOCUS_35890 40487 38877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 42685 40490 gene locus_tag LOCUS_35900 42685 40490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 44527 42689 gene locus_tag LOCUS_35910 44527 42689 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289232.1 protein_id gnl|my_center|LOCUS_35910 45532 44609 gene locus_tag LOCUS_35920 gene surE 45532 44609 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_35920 46166 45840 gene locus_tag LOCUS_35930 46166 45840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 46465 46169 gene locus_tag LOCUS_35940 46465 46169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 47990 46611 gene locus_tag LOCUS_35950 gene truD 47990 46611 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902134.1 protein_id gnl|my_center|LOCUS_35950 >Feature sequence83 1370 372 gene locus_tag LOCUS_35960 1370 372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902458.1 protein_id gnl|my_center|LOCUS_35960 1789 2745 gene locus_tag LOCUS_35970 1789 2745 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_35970 2865 3434 gene locus_tag LOCUS_35980 2865 3434 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209000318.1 protein_id gnl|my_center|LOCUS_35980 5099 3471 gene locus_tag LOCUS_35990 5099 3471 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902419.1 protein_id gnl|my_center|LOCUS_35990 5497 6513 gene locus_tag LOCUS_36000 5497 6513 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903186.1 protein_id gnl|my_center|LOCUS_36000 6631 7077 gene locus_tag LOCUS_36010 6631 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 8453 7257 gene locus_tag LOCUS_36020 8453 7257 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_36020 8557 9228 gene locus_tag LOCUS_36030 8557 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence84 242 51 gene locus_tag LOCUS_36040 242 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 1663 239 gene locus_tag LOCUS_36050 1663 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 1776 2624 gene locus_tag LOCUS_36060 1776 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 2621 3418 gene locus_tag LOCUS_36070 2621 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 3548 6736 gene locus_tag LOCUS_36080 3548 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 6729 10364 gene locus_tag LOCUS_36090 gene addA 6729 10364 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674519.1 protein_id gnl|my_center|LOCUS_36090 10723 11580 gene locus_tag LOCUS_36100 10723 11580 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890515.1 protein_id gnl|my_center|LOCUS_36100 11577 11984 gene locus_tag LOCUS_36110 11577 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 12203 12748 gene locus_tag LOCUS_36120 12203 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 13182 14597 gene locus_tag LOCUS_36130 13182 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 15032 16282 gene locus_tag LOCUS_36140 15032 16282 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890501.1 protein_id gnl|my_center|LOCUS_36140 17059 16292 gene locus_tag LOCUS_36150 17059 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 17178 18164 gene locus_tag LOCUS_36160 17178 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 18492 18289 gene locus_tag LOCUS_36170 18492 18289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 18379 20004 gene locus_tag LOCUS_36180 18379 20004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 21191 20265 gene locus_tag LOCUS_36190 21191 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 21081 21308 gene locus_tag LOCUS_36200 21081 21308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 22639 21554 gene locus_tag LOCUS_36210 22639 21554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 22939 22640 gene locus_tag LOCUS_36220 22939 22640 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904014.1 protein_id gnl|my_center|LOCUS_36220 23076 23243 gene locus_tag LOCUS_36230 23076 23243 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289549.1 protein_id gnl|my_center|LOCUS_36230 23318 24370 gene locus_tag LOCUS_36240 23318 24370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 24373 24555 gene locus_tag LOCUS_36250 24373 24555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 24759 25037 gene locus_tag LOCUS_36260 24759 25037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 25218 25463 gene locus_tag LOCUS_36270 25218 25463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 25491 27227 gene locus_tag LOCUS_36280 25491 27227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890505.1 protein_id gnl|my_center|LOCUS_36280 27224 28081 gene locus_tag LOCUS_36290 27224 28081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 28084 29145 gene locus_tag LOCUS_36300 28084 29145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 29152 30273 gene locus_tag LOCUS_36310 29152 30273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904034.1 protein_id gnl|my_center|LOCUS_36310 30266 32572 gene locus_tag LOCUS_36320 30266 32572 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289607.1 protein_id gnl|my_center|LOCUS_36320 32565 36386 gene locus_tag LOCUS_36330 32565 36386 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904032.1 protein_id gnl|my_center|LOCUS_36330 36383 37351 gene locus_tag LOCUS_36340 36383 37351 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904031.1 protein_id gnl|my_center|LOCUS_36340 37359 38882 gene locus_tag LOCUS_36350 37359 38882 CDS product primase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890461.1 protein_id gnl|my_center|LOCUS_36350 40755 38983 gene locus_tag LOCUS_36360 40755 38983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 41503 41856 gene locus_tag LOCUS_36370 41503 41856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890455.1 protein_id gnl|my_center|LOCUS_36370 42039 42581 gene locus_tag LOCUS_36380 42039 42581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904232.1 protein_id gnl|my_center|LOCUS_36380 42559 42681 gene locus_tag LOCUS_36390 42559 42681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 42755 43045 gene locus_tag LOCUS_36400 42755 43045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289727.1 protein_id gnl|my_center|LOCUS_36400 43045 43380 gene locus_tag LOCUS_36410 43045 43380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892774.1 protein_id gnl|my_center|LOCUS_36410 43557 44156 gene locus_tag LOCUS_36420 43557 44156 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289745.1 protein_id gnl|my_center|LOCUS_36420 44153 44662 gene locus_tag LOCUS_36430 44153 44662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289744.1 protein_id gnl|my_center|LOCUS_36430 44925 44665 gene locus_tag LOCUS_36440 44925 44665 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008526012.1 protein_id gnl|my_center|LOCUS_36440 45047 45307 gene locus_tag LOCUS_36450 45047 45307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904202.1 protein_id gnl|my_center|LOCUS_36450 46001 46867 gene locus_tag LOCUS_36460 46001 46867 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289724.1 protein_id gnl|my_center|LOCUS_36460 47696 46971 gene locus_tag LOCUS_36470 47696 46971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 47806 48567 gene locus_tag LOCUS_36480 47806 48567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 49152 48571 gene locus_tag LOCUS_36490 49152 48571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 49270 50196 gene locus_tag LOCUS_36500 49270 50196 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904212.1 protein_id gnl|my_center|LOCUS_36500 50270 51154 gene locus_tag LOCUS_36510 50270 51154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 51310 51498 gene locus_tag LOCUS_36520 51310 51498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 51590 51970 gene locus_tag LOCUS_36530 51590 51970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 52640 52119 gene locus_tag LOCUS_36540 52640 52119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 53788 54210 gene locus_tag LOCUS_36550 53788 54210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 54315 54806 gene locus_tag LOCUS_36560 54315 54806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 54810 55175 gene locus_tag LOCUS_36570 54810 55175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 55449 55742 gene locus_tag LOCUS_36580 55449 55742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 55849 56394 gene locus_tag LOCUS_36590 55849 56394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 56469 57041 gene locus_tag LOCUS_36600 56469 57041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 57470 57129 gene locus_tag LOCUS_36610 57470 57129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 59187 57820 gene locus_tag LOCUS_36620 59187 57820 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289743.1 protein_id gnl|my_center|LOCUS_36620 59387 60055 gene locus_tag LOCUS_36630 59387 60055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 60055 60186 gene locus_tag LOCUS_36640 60055 60186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 60183 60848 gene locus_tag LOCUS_36650 60183 60848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 60836 61387 gene locus_tag LOCUS_36660 60836 61387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 61514 62719 gene locus_tag LOCUS_36670 61514 62719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 62816 63127 gene locus_tag LOCUS_36680 62816 63127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 63268 63489 gene locus_tag LOCUS_36690 63268 63489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 63548 64615 gene locus_tag LOCUS_36700 63548 64615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 64686 65033 gene locus_tag LOCUS_36710 64686 65033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 65201 66127 gene locus_tag LOCUS_36720 65201 66127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 66517 66140 gene locus_tag LOCUS_36730 66517 66140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 66687 67595 gene locus_tag LOCUS_36740 66687 67595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 68412 67609 gene locus_tag LOCUS_36750 68412 67609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 69335 68409 gene locus_tag LOCUS_36760 69335 68409 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289741.1 protein_id gnl|my_center|LOCUS_36760 69475 69798 gene locus_tag LOCUS_36770 69475 69798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904068.1 protein_id gnl|my_center|LOCUS_36770 71648 70359 gene locus_tag LOCUS_36780 71648 70359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 72929 71802 gene locus_tag LOCUS_36790 72929 71802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 74067 72874 gene locus_tag LOCUS_36800 74067 72874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 74369 74064 gene locus_tag LOCUS_36810 74369 74064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 75211 74372 gene locus_tag LOCUS_36820 75211 74372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 75589 76179 gene locus_tag LOCUS_36830 75589 76179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 76375 77454 gene locus_tag LOCUS_36840 76375 77454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 77678 78364 gene locus_tag LOCUS_36850 77678 78364 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289554.1 protein_id gnl|my_center|LOCUS_36850 79411 78383 gene locus_tag LOCUS_36860 79411 78383 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289552.1 protein_id gnl|my_center|LOCUS_36860 83229 79591 gene locus_tag LOCUS_36870 83229 79591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 86084 83229 gene locus_tag LOCUS_36880 86084 83229 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228378.1 protein_id gnl|my_center|LOCUS_36880 86710 86093 gene locus_tag LOCUS_36890 86710 86093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 90000 86707 gene locus_tag LOCUS_36900 90000 86707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 90131 89997 gene locus_tag LOCUS_36910 90131 89997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 90350 90913 gene locus_tag LOCUS_36920 90350 90913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 92148 90931 gene locus_tag LOCUS_36930 92148 90931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021016.1 protein_id gnl|my_center|LOCUS_36930 >Feature sequence85 312 605 gene locus_tag LOCUS_36940 312 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 726 2030 gene locus_tag LOCUS_36950 gene aroA 726 2030 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289296.1 protein_id gnl|my_center|LOCUS_36950 4240 4572 gene locus_tag LOCUS_36960 4240 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 5576 5127 gene locus_tag LOCUS_36970 5576 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361701.1 protein_id gnl|my_center|LOCUS_36970 6474 7289 gene locus_tag LOCUS_36980 6474 7289 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_36980 7530 7354 gene locus_tag LOCUS_36990 7530 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 7813 7523 gene locus_tag LOCUS_37000 7813 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 8163 8091 gene locus_tag LOCUS_t00440 8163 8091 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8848 9534 gene locus_tag LOCUS_37010 8848 9534 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_37010 9833 10777 gene locus_tag LOCUS_37020 9833 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 10942 11012 gene locus_tag LOCUS_t00450 10942 11012 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11449 11297 gene locus_tag LOCUS_37030 11449 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 >Feature sequence86 266 820 gene locus_tag LOCUS_37040 266 820 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289316.1 protein_id gnl|my_center|LOCUS_37040 1737 877 gene locus_tag LOCUS_37050 1737 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 3085 1727 gene locus_tag LOCUS_37060 3085 1727 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089864262.1 protein_id gnl|my_center|LOCUS_37060 3240 4217 gene locus_tag LOCUS_37070 gene fen 3240 4217 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902986.1 protein_id gnl|my_center|LOCUS_37070 5253 4270 gene locus_tag LOCUS_37080 gene mvaD 5253 4270 CDS product phosphomevalonate decarboxylase MvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289187.1 protein_id gnl|my_center|LOCUS_37080 5458 6141 gene locus_tag LOCUS_37090 gene nth 5458 6141 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902399.1 protein_id gnl|my_center|LOCUS_37090 6242 6502 gene locus_tag LOCUS_37100 6242 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 7382 6585 gene locus_tag LOCUS_37110 7382 6585 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849919.1 protein_id gnl|my_center|LOCUS_37110 8771 7461 gene locus_tag LOCUS_37120 8771 7461 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902386.1 protein_id gnl|my_center|LOCUS_37120 8910 9974 gene locus_tag LOCUS_37130 8910 9974 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920597.1 protein_id gnl|my_center|LOCUS_37130 10109 10525 gene locus_tag LOCUS_37140 10109 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 10575 10823 gene locus_tag LOCUS_37150 10575 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 12060 11320 gene locus_tag LOCUS_37160 12060 11320 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 protein_id gnl|my_center|LOCUS_37160 12994 12167 gene locus_tag LOCUS_37170 12994 12167 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902445.1 protein_id gnl|my_center|LOCUS_37170 13833 13414 gene locus_tag LOCUS_37180 13833 13414 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942959.1 protein_id gnl|my_center|LOCUS_37180 13952 14872 gene locus_tag LOCUS_37190 13952 14872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902476.1 protein_id gnl|my_center|LOCUS_37190 14869 16725 gene locus_tag LOCUS_37200 14869 16725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902477.1 protein_id gnl|my_center|LOCUS_37200 16715 17869 gene locus_tag LOCUS_37210 16715 17869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892491.1 protein_id gnl|my_center|LOCUS_37210 17952 19814 gene locus_tag LOCUS_37220 17952 19814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 20126 19905 gene locus_tag LOCUS_37230 20126 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 20265 20921 gene locus_tag LOCUS_37240 20265 20921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 21796 21554 gene locus_tag LOCUS_37250 21796 21554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 22579 21902 gene locus_tag LOCUS_37260 gene tenA 22579 21902 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_37260 23238 22699 gene locus_tag LOCUS_37270 23238 22699 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902616.1 protein_id gnl|my_center|LOCUS_37270 23886 23422 gene locus_tag LOCUS_37280 23886 23422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 24083 24253 gene locus_tag LOCUS_37290 24083 24253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 24421 25152 gene locus_tag LOCUS_37300 gene psmB 24421 25152 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289244.1 protein_id gnl|my_center|LOCUS_37300 26458 25277 gene locus_tag LOCUS_37310 26458 25277 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_37310 26729 27439 gene locus_tag LOCUS_37320 26729 27439 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_37320 28741 27449 gene locus_tag LOCUS_37330 28741 27449 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021940.1 protein_id gnl|my_center|LOCUS_37330 29698 28847 gene locus_tag LOCUS_37340 29698 28847 CDS product translation initiation factor eIF-2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903055.1 protein_id gnl|my_center|LOCUS_37340 29902 30222 gene locus_tag LOCUS_37350 29902 30222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289331.1 protein_id gnl|my_center|LOCUS_37350 30535 31770 gene locus_tag LOCUS_37360 30535 31770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 31774 32715 gene locus_tag LOCUS_37370 31774 32715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 32857 33933 gene locus_tag LOCUS_37380 32857 33933 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902811.1 protein_id gnl|my_center|LOCUS_37380 33930 34205 gene locus_tag LOCUS_37390 33930 34205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 34279 34920 gene locus_tag LOCUS_37400 34279 34920 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902887.1 protein_id gnl|my_center|LOCUS_37400 35168 34950 gene locus_tag LOCUS_37410 35168 34950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 35280 36020 gene locus_tag LOCUS_37420 35280 36020 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902885.1 protein_id gnl|my_center|LOCUS_37420 36062 36146 gene locus_tag LOCUS_t00460 36062 36146 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37879 36452 gene locus_tag LOCUS_37430 37879 36452 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_37430 39309 38266 gene locus_tag LOCUS_37440 39309 38266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 40428 39361 gene locus_tag LOCUS_37450 40428 39361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 41698 40421 gene locus_tag LOCUS_37460 41698 40421 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903703.1 protein_id gnl|my_center|LOCUS_37460 43144 41699 gene locus_tag LOCUS_37470 43144 41699 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903702.1 protein_id gnl|my_center|LOCUS_37470 43608 43153 gene locus_tag LOCUS_37480 gene mamA 43608 43153 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903701.1 protein_id gnl|my_center|LOCUS_37480 43774 44946 gene locus_tag LOCUS_37490 43774 44946 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063669.1 protein_id gnl|my_center|LOCUS_37490 45101 49306 gene locus_tag LOCUS_37500 45101 49306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 50169 50387 gene locus_tag LOCUS_37510 50169 50387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 50753 51382 gene locus_tag LOCUS_37520 50753 51382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 51952 51791 gene locus_tag LOCUS_37530 51952 51791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 52438 52259 gene locus_tag LOCUS_37540 52438 52259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 52879 54678 gene locus_tag LOCUS_37550 52879 54678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 54789 55973 gene locus_tag LOCUS_37560 54789 55973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013446627.1 protein_id gnl|my_center|LOCUS_37560 56177 58495 gene locus_tag LOCUS_37570 56177 58495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 58501 58854 gene locus_tag LOCUS_37580 58501 58854 CDS product DUF5785 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902883.1 protein_id gnl|my_center|LOCUS_37580 58919 59689 gene locus_tag LOCUS_37590 58919 59689 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902721.1 protein_id gnl|my_center|LOCUS_37590 59775 60383 gene locus_tag LOCUS_37600 59775 60383 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878350.1 protein_id gnl|my_center|LOCUS_37600 60485 61708 gene locus_tag LOCUS_37610 gene pgk 60485 61708 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902880.1 protein_id gnl|my_center|LOCUS_37610 61677 62192 gene locus_tag LOCUS_37620 61677 62192 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902879.1 protein_id gnl|my_center|LOCUS_37620 62205 62278 gene locus_tag LOCUS_t00470 62205 62278 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 62912 62652 gene locus_tag LOCUS_37630 62912 62652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 63204 64217 gene locus_tag LOCUS_37640 63204 64217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 64277 65473 gene locus_tag LOCUS_37650 64277 65473 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903258.1 protein_id gnl|my_center|LOCUS_37650 65679 66536 gene locus_tag LOCUS_37660 65679 66536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 67871 67701 gene locus_tag LOCUS_37670 67871 67701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 68891 68271 gene locus_tag LOCUS_37680 68891 68271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 69078 70646 gene locus_tag LOCUS_37690 69078 70646 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_37690 70646 71446 gene locus_tag LOCUS_37700 70646 71446 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_37700 72150 71650 gene locus_tag LOCUS_37710 72150 71650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 72237 72905 gene locus_tag LOCUS_37720 72237 72905 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902491.1 protein_id gnl|my_center|LOCUS_37720 73303 72890 gene locus_tag LOCUS_37730 73303 72890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 76941 73498 gene locus_tag LOCUS_37740 76941 73498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 77453 77001 gene locus_tag LOCUS_37750 77453 77001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 77683 78114 gene locus_tag LOCUS_37760 77683 78114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 78993 78181 gene locus_tag LOCUS_37770 78993 78181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 79709 80485 gene locus_tag LOCUS_37780 79709 80485 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_37780 80552 80977 gene locus_tag LOCUS_37790 80552 80977 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289104.1 protein_id gnl|my_center|LOCUS_37790 82245 81094 gene locus_tag LOCUS_37800 82245 81094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 83272 82301 gene locus_tag LOCUS_37810 83272 82301 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096549.1 protein_id gnl|my_center|LOCUS_37810 83447 84532 gene locus_tag LOCUS_37820 83447 84532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 86044 84575 gene locus_tag LOCUS_37830 86044 84575 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902663.1 protein_id gnl|my_center|LOCUS_37830 86250 86795 gene locus_tag LOCUS_37840 gene dpsA 86250 86795 CDS product DNA starvation/stationary phase protection protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903826.1 protein_id gnl|my_center|LOCUS_37840 87098 86931 gene locus_tag LOCUS_37850 87098 86931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 87337 87660 gene locus_tag LOCUS_37860 87337 87660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 87717 88250 gene locus_tag LOCUS_37870 87717 88250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 89689 88694 gene locus_tag LOCUS_37880 gene purM 89689 88694 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902615.1 protein_id gnl|my_center|LOCUS_37880 90410 89778 gene locus_tag LOCUS_37890 90410 89778 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902614.1 protein_id gnl|my_center|LOCUS_37890 92176 90407 gene locus_tag LOCUS_37900 92176 90407 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902613.1 protein_id gnl|my_center|LOCUS_37900 92330 92779 gene locus_tag LOCUS_37910 92330 92779 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903814.1 protein_id gnl|my_center|LOCUS_37910 93048 93398 gene locus_tag LOCUS_37920 93048 93398 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903020.1 protein_id gnl|my_center|LOCUS_37920 93741 94010 gene locus_tag LOCUS_37930 93741 94010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 94993 94148 gene locus_tag LOCUS_37940 94993 94148 CDS product IS630-like element ISSod10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072286.1 protein_id gnl|my_center|LOCUS_37940 95654 95208 gene locus_tag LOCUS_37950 95654 95208 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903018.1 protein_id gnl|my_center|LOCUS_37950 96180 95749 gene locus_tag LOCUS_37960 96180 95749 CDS product DUF5820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903019.1 protein_id gnl|my_center|LOCUS_37960 96569 96787 gene locus_tag LOCUS_37970 96569 96787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 96792 98864 gene locus_tag LOCUS_37980 96792 98864 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902520.1 protein_id gnl|my_center|LOCUS_37980 98891 101176 gene locus_tag LOCUS_37990 98891 101176 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902519.1 protein_id gnl|my_center|LOCUS_37990 101167 102495 gene locus_tag LOCUS_38000 101167 102495 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902518.1 protein_id gnl|my_center|LOCUS_38000 102488 104506 gene locus_tag LOCUS_38010 102488 104506 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902517.1 protein_id gnl|my_center|LOCUS_38010 104604 105638 gene locus_tag LOCUS_38020 104604 105638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 105666 106091 gene locus_tag LOCUS_38030 105666 106091 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_38030 106878 106213 gene locus_tag LOCUS_38040 106878 106213 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903351.1 protein_id gnl|my_center|LOCUS_38040 107057 107503 gene locus_tag LOCUS_38050 107057 107503 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 protein_id gnl|my_center|LOCUS_38050 107503 108306 gene locus_tag LOCUS_38060 107503 108306 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903123.1 protein_id gnl|my_center|LOCUS_38060 109613 108360 gene locus_tag LOCUS_38070 109613 108360 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903112.1 protein_id gnl|my_center|LOCUS_38070 109864 111414 gene locus_tag LOCUS_38080 109864 111414 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_38080 111419 111748 gene locus_tag LOCUS_38090 111419 111748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903115.1 protein_id gnl|my_center|LOCUS_38090 112063 111812 gene locus_tag LOCUS_38100 112063 111812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 113057 111969 gene locus_tag LOCUS_38110 113057 111969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 113247 115082 gene locus_tag LOCUS_38120 113247 115082 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903116.1 protein_id gnl|my_center|LOCUS_38120 116334 115201 gene locus_tag LOCUS_38130 116334 115201 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_38130 116481 116840 gene locus_tag LOCUS_38140 116481 116840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 116837 118045 gene locus_tag LOCUS_38150 116837 118045 CDS product TIGR04347 family pseudo-SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902854.1 protein_id gnl|my_center|LOCUS_38150 118166 118810 gene locus_tag LOCUS_38160 118166 118810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 119116 118814 gene locus_tag LOCUS_38170 119116 118814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 119662 119210 gene locus_tag LOCUS_38180 119662 119210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 119756 121138 gene locus_tag LOCUS_38190 119756 121138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 121113 121307 gene locus_tag LOCUS_38200 121113 121307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 122532 121315 gene locus_tag LOCUS_38210 122532 121315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 123184 122540 gene locus_tag LOCUS_38220 123184 122540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 123329 123712 gene locus_tag LOCUS_38230 123329 123712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 124164 123724 gene locus_tag LOCUS_38240 124164 123724 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 protein_id gnl|my_center|LOCUS_38240 124957 124205 gene locus_tag LOCUS_38250 124957 124205 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289293.1 protein_id gnl|my_center|LOCUS_38250 125743 125084 gene locus_tag LOCUS_38260 125743 125084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 125879 126655 gene locus_tag LOCUS_38270 125879 126655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 127187 126687 gene locus_tag LOCUS_38280 127187 126687 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902658.1 protein_id gnl|my_center|LOCUS_38280 128344 127184 gene locus_tag LOCUS_38290 128344 127184 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_38290 129041 128592 gene locus_tag LOCUS_38300 129041 128592 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902658.1 protein_id gnl|my_center|LOCUS_38300 130165 129038 gene locus_tag LOCUS_38310 130165 129038 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_38310 131623 130319 gene locus_tag LOCUS_38320 gene hflX 131623 130319 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902924.1 protein_id gnl|my_center|LOCUS_38320 131952 132269 gene locus_tag LOCUS_38330 131952 132269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 133028 132303 gene locus_tag LOCUS_38340 133028 132303 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902925.1 protein_id gnl|my_center|LOCUS_38340 134000 133230 gene locus_tag LOCUS_38350 gene psmA 134000 133230 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902078.1 protein_id gnl|my_center|LOCUS_38350 134490 134005 gene locus_tag LOCUS_38360 134490 134005 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902926.1 protein_id gnl|my_center|LOCUS_38360 135119 134487 gene locus_tag LOCUS_38370 135119 134487 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902927.1 protein_id gnl|my_center|LOCUS_38370 135807 135103 gene locus_tag LOCUS_38380 135807 135103 CDS product RNase P subunit p30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289302.1 protein_id gnl|my_center|LOCUS_38380 136207 135884 gene locus_tag LOCUS_38390 136207 135884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 137007 136267 gene locus_tag LOCUS_38400 137007 136267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 138734 137862 gene locus_tag LOCUS_38410 138734 137862 CDS product DUF5821 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289323.1 protein_id gnl|my_center|LOCUS_38410 141265 139088 gene locus_tag LOCUS_38420 141265 139088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289324.1 protein_id gnl|my_center|LOCUS_38420 141508 142788 gene locus_tag LOCUS_38430 141508 142788 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289325.1 protein_id gnl|my_center|LOCUS_38430 142987 143799 gene locus_tag LOCUS_38440 142987 143799 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_38440 143895 144788 gene locus_tag LOCUS_38450 143895 144788 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903030.1 protein_id gnl|my_center|LOCUS_38450 145221 144856 gene locus_tag LOCUS_38460 145221 144856 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904126.1 protein_id gnl|my_center|LOCUS_38460 147238 145256 gene locus_tag LOCUS_38470 147238 145256 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_38470 147678 147511 gene locus_tag LOCUS_38480 147678 147511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 147694 147882 gene locus_tag LOCUS_38490 147694 147882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 147959 148474 gene locus_tag LOCUS_38500 147959 148474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 148568 149197 gene locus_tag LOCUS_38510 148568 149197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 149587 149733 gene locus_tag LOCUS_38520 149587 149733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 150182 150457 gene locus_tag LOCUS_38530 150182 150457 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_38530 150566 151873 gene locus_tag LOCUS_38540 150566 151873 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361690.1 protein_id gnl|my_center|LOCUS_38540 153353 152043 gene locus_tag LOCUS_38550 153353 152043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 154785 153493 gene locus_tag LOCUS_38560 gene purD 154785 153493 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902946.1 protein_id gnl|my_center|LOCUS_38560 154955 155800 gene locus_tag LOCUS_38570 154955 155800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 155869 156210 gene locus_tag LOCUS_38580 155869 156210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 156213 156545 gene locus_tag LOCUS_38590 156213 156545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 156646 157650 gene locus_tag LOCUS_38600 156646 157650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 158071 157943 gene locus_tag LOCUS_38610 158071 157943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 158415 158146 gene locus_tag LOCUS_38620 158415 158146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 158365 159381 gene locus_tag LOCUS_38630 158365 159381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 159378 159935 gene locus_tag LOCUS_38640 159378 159935 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403191.1 protein_id gnl|my_center|LOCUS_38640 160563 161042 gene locus_tag LOCUS_38650 160563 161042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 161152 163350 gene locus_tag LOCUS_38660 161152 163350 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289305.1 protein_id gnl|my_center|LOCUS_38660 163909 163433 gene locus_tag LOCUS_38670 163909 163433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 164235 163906 gene locus_tag LOCUS_38680 164235 163906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 164426 165409 gene locus_tag LOCUS_38690 164426 165409 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902943.1 protein_id gnl|my_center|LOCUS_38690 165582 166223 gene locus_tag LOCUS_38700 165582 166223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 166889 166284 gene locus_tag LOCUS_38710 166889 166284 CDS product DUF5804 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289303.1 protein_id gnl|my_center|LOCUS_38710 168254 167076 gene locus_tag LOCUS_38720 168254 167076 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902941.1 protein_id gnl|my_center|LOCUS_38720 169549 168326 gene locus_tag LOCUS_38730 169549 168326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902270.1 protein_id gnl|my_center|LOCUS_38730 171850 170645 gene locus_tag LOCUS_38740 171850 170645 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902940.1 protein_id gnl|my_center|LOCUS_38740 172488 171943 gene locus_tag LOCUS_38750 gene cyaB 172488 171943 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902939.1 protein_id gnl|my_center|LOCUS_38750 172577 173536 gene locus_tag LOCUS_38760 172577 173536 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902937.1 protein_id gnl|my_center|LOCUS_38760 174437 173811 gene locus_tag LOCUS_38770 174437 173811 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878668.1 protein_id gnl|my_center|LOCUS_38770 175271 174921 gene locus_tag LOCUS_38780 175271 174921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 175516 175710 gene locus_tag LOCUS_38790 175516 175710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 177198 176083 gene locus_tag LOCUS_38800 177198 176083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 177680 178624 gene locus_tag LOCUS_38810 gene pyrB 177680 178624 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289640.1 protein_id gnl|my_center|LOCUS_38810 178617 179105 gene locus_tag LOCUS_38820 gene pyrI 178617 179105 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289641.1 protein_id gnl|my_center|LOCUS_38820 179355 180200 gene locus_tag LOCUS_38830 179355 180200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902935.1 protein_id gnl|my_center|LOCUS_38830 180466 181671 gene locus_tag LOCUS_38840 180466 181671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 182219 181824 gene locus_tag LOCUS_38850 182219 181824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 183073 182309 gene locus_tag LOCUS_38860 183073 182309 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_38860 183930 183262 gene locus_tag LOCUS_38870 183930 183262 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_38870 184934 184062 gene locus_tag LOCUS_38880 184934 184062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 186010 184931 gene locus_tag LOCUS_38890 186010 184931 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903163.1 protein_id gnl|my_center|LOCUS_38890 186571 186023 gene locus_tag LOCUS_38900 186571 186023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 188112 186811 gene locus_tag LOCUS_38910 gene hemA 188112 186811 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903296.1 protein_id gnl|my_center|LOCUS_38910 189337 188117 gene locus_tag LOCUS_38920 189337 188117 CDS product TIGR04347 family pseudo-SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902854.1 protein_id gnl|my_center|LOCUS_38920 190464 189334 gene locus_tag LOCUS_38930 190464 189334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 191603 190461 gene locus_tag LOCUS_38940 191603 190461 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087474.1 protein_id gnl|my_center|LOCUS_38940 193462 191630 gene locus_tag LOCUS_38950 193462 191630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 193756 194142 gene locus_tag LOCUS_38960 193756 194142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 194436 194155 gene locus_tag LOCUS_38970 194436 194155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 195184 194786 gene locus_tag LOCUS_38980 195184 194786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 196034 195960 gene locus_tag LOCUS_t00480 196034 195960 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 196199 197659 gene locus_tag LOCUS_38990 196199 197659 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902698.1 protein_id gnl|my_center|LOCUS_38990 197973 197680 gene locus_tag LOCUS_39000 197973 197680 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902697.1 protein_id gnl|my_center|LOCUS_39000 198255 198103 gene locus_tag LOCUS_39010 198255 198103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 199141 198311 gene locus_tag LOCUS_39020 199141 198311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 201249 199138 gene locus_tag LOCUS_39030 201249 199138 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902665.1 protein_id gnl|my_center|LOCUS_39030 202491 201472 gene locus_tag LOCUS_39040 202491 201472 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904121.1 protein_id gnl|my_center|LOCUS_39040 203228 202491 gene locus_tag LOCUS_39050 203228 202491 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904122.1 protein_id gnl|my_center|LOCUS_39050 204304 203225 gene locus_tag LOCUS_39060 204304 203225 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287342.1 protein_id gnl|my_center|LOCUS_39060 204945 204523 gene locus_tag LOCUS_39070 204945 204523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903493.1 protein_id gnl|my_center|LOCUS_39070 205181 205555 gene locus_tag LOCUS_39080 205181 205555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 205695 206120 gene locus_tag LOCUS_39090 205695 206120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 206205 207356 gene locus_tag LOCUS_39100 206205 207356 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289146.1 protein_id gnl|my_center|LOCUS_39100 207545 208309 gene locus_tag LOCUS_39110 207545 208309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 >Feature sequence87 87 1064 gene locus_tag LOCUS_39120 87 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 1621 1049 gene locus_tag LOCUS_39130 1621 1049 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902509.1 protein_id gnl|my_center|LOCUS_39130 3879 1906 gene locus_tag LOCUS_39140 3879 1906 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902952.1 protein_id gnl|my_center|LOCUS_39140 3995 5140 gene locus_tag LOCUS_39150 3995 5140 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_39150 5302 6051 gene locus_tag LOCUS_39160 5302 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 6117 8576 gene locus_tag LOCUS_39170 6117 8576 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902063.1 protein_id gnl|my_center|LOCUS_39170 8857 10737 gene locus_tag LOCUS_39180 8857 10737 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405161.1 protein_id gnl|my_center|LOCUS_39180 10804 11394 gene locus_tag LOCUS_39190 10804 11394 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902951.1 protein_id gnl|my_center|LOCUS_39190 11625 12899 gene locus_tag LOCUS_39200 11625 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 15134 12996 gene locus_tag LOCUS_39210 gene katG 15134 12996 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904144.1 protein_id gnl|my_center|LOCUS_39210 15694 15425 gene locus_tag LOCUS_39220 15694 15425 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903468.1 protein_id gnl|my_center|LOCUS_39220 17131 15785 gene locus_tag LOCUS_39230 17131 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 18686 17217 gene locus_tag LOCUS_39240 18686 17217 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048165814.1 protein_id gnl|my_center|LOCUS_39240 19802 19050 gene locus_tag LOCUS_39250 19802 19050 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902448.1 protein_id gnl|my_center|LOCUS_39250 19985 21079 gene locus_tag LOCUS_39260 19985 21079 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227959.1 protein_id gnl|my_center|LOCUS_39260 21242 21673 gene locus_tag LOCUS_39270 gene sdhC 21242 21673 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289306.1 protein_id gnl|my_center|LOCUS_39270 21673 22038 gene locus_tag LOCUS_39280 21673 22038 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902949.1 protein_id gnl|my_center|LOCUS_39280 22040 22912 gene locus_tag LOCUS_39290 22040 22912 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902948.1 protein_id gnl|my_center|LOCUS_39290 22915 24753 gene locus_tag LOCUS_39300 22915 24753 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902947.1 protein_id gnl|my_center|LOCUS_39300 24835 26139 gene locus_tag LOCUS_39310 24835 26139 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902871.1 protein_id gnl|my_center|LOCUS_39310 26493 26717 gene locus_tag LOCUS_39320 26493 26717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 27620 26805 gene locus_tag LOCUS_39330 27620 26805 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_39330 28165 27686 gene locus_tag LOCUS_39340 28165 27686 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_39340 28446 28772 gene locus_tag LOCUS_39350 28446 28772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 28788 28860 gene locus_tag LOCUS_t00490 28788 28860 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30527 29286 gene locus_tag LOCUS_39360 30527 29286 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_39360 31459 30692 gene locus_tag LOCUS_39370 31459 30692 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967206.1 protein_id gnl|my_center|LOCUS_39370 31646 35548 gene locus_tag LOCUS_39380 31646 35548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 35545 37611 gene locus_tag LOCUS_39390 35545 37611 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_39390 37730 38140 gene locus_tag LOCUS_39400 37730 38140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 38145 38765 gene locus_tag LOCUS_39410 38145 38765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 38759 40135 gene locus_tag LOCUS_39420 38759 40135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 40322 40837 gene locus_tag LOCUS_39430 40322 40837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 40834 41613 gene locus_tag LOCUS_39440 40834 41613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 43004 41715 gene locus_tag LOCUS_39450 43004 41715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 44032 43124 gene locus_tag LOCUS_39460 gene cheR 44032 43124 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289253.1 protein_id gnl|my_center|LOCUS_39460 44544 44029 gene locus_tag LOCUS_39470 gene cheD 44544 44029 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 protein_id gnl|my_center|LOCUS_39470 45809 44541 gene locus_tag LOCUS_39480 45809 44541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 46411 45806 gene locus_tag LOCUS_39490 46411 45806 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902689.1 protein_id gnl|my_center|LOCUS_39490 49949 46446 gene locus_tag LOCUS_39500 49949 46446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 51123 49942 gene locus_tag LOCUS_39510 gene cheB 51123 49942 CDS product protein-glutamate methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902691.1 protein_id gnl|my_center|LOCUS_39510 51518 51156 gene locus_tag LOCUS_39520 gene cheY 51518 51156 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902692.1 protein_id gnl|my_center|LOCUS_39520 52442 51654 gene locus_tag LOCUS_39530 52442 51654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 52674 53129 gene locus_tag LOCUS_39540 52674 53129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 54046 53276 gene locus_tag LOCUS_39550 54046 53276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 54728 54048 gene locus_tag LOCUS_39560 54728 54048 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902528.1 protein_id gnl|my_center|LOCUS_39560 55252 54728 gene locus_tag LOCUS_39570 55252 54728 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289219.1 protein_id gnl|my_center|LOCUS_39570 55500 56510 gene locus_tag LOCUS_39580 55500 56510 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_39580 58109 56532 gene locus_tag LOCUS_39590 58109 56532 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902970.1 protein_id gnl|my_center|LOCUS_39590 58241 58897 gene locus_tag LOCUS_39600 58241 58897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 59474 58908 gene locus_tag LOCUS_39610 59474 58908 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289218.1 protein_id gnl|my_center|LOCUS_39610 59612 60088 gene locus_tag LOCUS_39620 59612 60088 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337074.1 protein_id gnl|my_center|LOCUS_39620 60182 60502 gene locus_tag LOCUS_39630 60182 60502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 61130 60630 gene locus_tag LOCUS_39640 61130 60630 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903209.1 protein_id gnl|my_center|LOCUS_39640 62775 61102 gene locus_tag LOCUS_39650 62775 61102 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941186.1 protein_id gnl|my_center|LOCUS_39650 63158 62772 gene locus_tag LOCUS_39660 63158 62772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 65260 63281 gene locus_tag LOCUS_39670 gene acs 65260 63281 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902710.1 protein_id gnl|my_center|LOCUS_39670 67742 65529 gene locus_tag LOCUS_39680 67742 65529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 69873 67873 gene locus_tag LOCUS_39690 gene acs 69873 67873 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902710.1 protein_id gnl|my_center|LOCUS_39690 70476 69976 gene locus_tag LOCUS_39700 70476 69976 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849921.1 protein_id gnl|my_center|LOCUS_39700 70955 70527 gene locus_tag LOCUS_39710 70955 70527 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289521.1 protein_id gnl|my_center|LOCUS_39710 71939 71157 gene locus_tag LOCUS_39720 71939 71157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 72807 72004 gene locus_tag LOCUS_39730 72807 72004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 73528 72857 gene locus_tag LOCUS_39740 73528 72857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_39740 74482 73565 gene locus_tag LOCUS_39750 74482 73565 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943338.1 protein_id gnl|my_center|LOCUS_39750 74833 74543 gene locus_tag LOCUS_39760 74833 74543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 75316 74942 gene locus_tag LOCUS_39770 75316 74942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 76696 75422 gene locus_tag LOCUS_39780 76696 75422 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903141.1 protein_id gnl|my_center|LOCUS_39780 77070 76699 gene locus_tag LOCUS_39790 77070 76699 CDS product DUF3209 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903140.1 protein_id gnl|my_center|LOCUS_39790 78345 77113 gene locus_tag LOCUS_39800 78345 77113 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289353.1 protein_id gnl|my_center|LOCUS_39800 79068 78376 gene locus_tag LOCUS_39810 79068 78376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903138.1 protein_id gnl|my_center|LOCUS_39810 79331 79065 gene locus_tag LOCUS_39820 79331 79065 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903137.1 protein_id gnl|my_center|LOCUS_39820 80403 79369 gene locus_tag LOCUS_39830 gene cobJ 80403 79369 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903136.1 protein_id gnl|my_center|LOCUS_39830 81317 80421 gene locus_tag LOCUS_39840 81317 80421 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903135.1 protein_id gnl|my_center|LOCUS_39840 82303 81314 gene locus_tag LOCUS_39850 gene cbiG 82303 81314 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_39850 83227 82307 gene locus_tag LOCUS_39860 83227 82307 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903133.1 protein_id gnl|my_center|LOCUS_39860 84030 83224 gene locus_tag LOCUS_39870 84030 83224 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903132.1 protein_id gnl|my_center|LOCUS_39870 84632 84027 gene locus_tag LOCUS_39880 gene cbiT 84632 84027 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903131.1 protein_id gnl|my_center|LOCUS_39880 86299 84818 gene locus_tag LOCUS_39890 86299 84818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 86213 86530 gene locus_tag LOCUS_39900 86213 86530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 87399 86617 gene locus_tag LOCUS_39910 gene fabG 87399 86617 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257346.1 protein_id gnl|my_center|LOCUS_39910 88803 87439 gene locus_tag LOCUS_39920 88803 87439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 90232 88925 gene locus_tag LOCUS_39930 90232 88925 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289356.1 protein_id gnl|my_center|LOCUS_39930 90545 91114 gene locus_tag LOCUS_39940 90545 91114 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903176.1 protein_id gnl|my_center|LOCUS_39940 91111 92118 gene locus_tag LOCUS_39950 91111 92118 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530136.1 protein_id gnl|my_center|LOCUS_39950 92210 93088 gene locus_tag LOCUS_39960 92210 93088 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_39960 93179 93346 gene locus_tag LOCUS_39970 93179 93346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 93464 93685 gene locus_tag LOCUS_39980 93464 93685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 94599 93760 gene locus_tag LOCUS_39990 94599 93760 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903145.1 protein_id gnl|my_center|LOCUS_39990 95342 94596 gene locus_tag LOCUS_40000 95342 94596 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903144.1 protein_id gnl|my_center|LOCUS_40000 98567 95412 gene locus_tag LOCUS_40010 gene cobN 98567 95412 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289354.1 protein_id gnl|my_center|LOCUS_40010 99254 98979 gene locus_tag LOCUS_40020 99254 98979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40020 99289 101508 gene locus_tag LOCUS_40030 99289 101508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 101574 103157 gene locus_tag LOCUS_40040 101574 103157 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869171.1 protein_id gnl|my_center|LOCUS_40040 103257 104084 gene locus_tag LOCUS_40050 103257 104084 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_40050 >Feature sequence88 336 464 gene locus_tag LOCUS_40060 336 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060