COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..59567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(205..924) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646226.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1249..1791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1807..1995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(1996..2448) product hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene ohrR CDS 2628..3110 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114194.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 3337..4281 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207934.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene gshB CDS 4535..5632 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene murG CDS 5646..7091 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene murC CDS 7131..8057 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 8062..8919 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 8985..10247 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207932.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene ftsA CDS 10513..11688 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121912.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene ftsZ CDS 11855..12757 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121967.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene lpxC CDS complement(12856..13296) product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121887.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 13403..14086 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121983.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 14283..17009 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207931.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene aceE CDS 17012..18979 product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207930.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 19119..19400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 19662..20237 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(20341..22464) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207927.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 22686..23492 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207926.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 23617..23982 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 24122..25588 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene guaB CDS 25715..27052 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207925.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene glmM CDS 27065..27721 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene pdxH CDS 27722..29422 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene recJ CDS complement(29470..30390) product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078653.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(30655..31437) product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078653.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 32050..32943 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121932.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene prfB CDS 33177..33521 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121891.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 33577..34641 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207922.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 34771..36090 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207921.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 36087..36797 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207920.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(36777..37766) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 38215..40173 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene acs CDS complement(40258..41364) product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene sfnG CDS complement(41388..42128) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene msuE CDS 42479..43132 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(43252..44172) product porin Omp33-36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene omp33-36 CDS 45025..45720 product OXA-213 family carbapenem-hydrolyzing class D beta-lactamase OXA-642 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene blaOXA CDS 46050..47771 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207907.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 47825..49588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(49612..52443) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene uvrA CDS 52700..53272 product DUF2939 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640516.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 53328..53681 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(53834..54508) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066884.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene tenA CDS 54681..55763 product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121988.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 55895..57259 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 57311..57892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 58036..59406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 59403..59564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 sequence002 source 1..88141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 358..684 product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114963.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(714..1937) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(2022..4115) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene pnp CDS complement(4363..4632) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene rpsO CDS 4647..4889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 4870..6168 product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(6871..8616) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208245.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene recD CDS complement(8716..12429) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(12433..16083) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 16289..16789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208241.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 16972..18303 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268262.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(18333..19751) product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065911.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 19957..20664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208240.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 20856..21797 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene ubiE CDS 21808..22476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 22489..24108 product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208238.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 24413..25792 product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 25879..26787 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 26799..27596 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 27807..29123 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208237.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 29149..29529 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 29621..30388 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene hisIE CDS 30398..31906 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 32021..33403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 33650..36493 product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208232.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 36495..36863 product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115033.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 36863..38674 product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208231.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 38674..39201 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208230.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 39198..39473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 39485..39850 product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208229.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(40114..40257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(40283..41041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(41313..41654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(41660..42001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(42293..42691) product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114836.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(42691..45393) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114697.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene infB CDS complement(45404..46888) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115134.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene nusA CDS complement(46926..47450) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114922.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene rimP tRNA complement(47656..47732) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(47820..47896) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(47940..48024) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(48086..48415) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115012.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene secG CDS complement(48428..49219) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene tpiA CDS 49595..51310 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene pilB CDS 51335..52561 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 52561..53421 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208225.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 53423..54028 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene coaE CDS complement(54025..54816) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(54976..55722) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079348.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene rlmB CDS complement(55831..56157) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 56491..58152 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208222.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene recN CDS 58267..58821 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 58814..59257 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115066.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene ruvX CDS complement(59259..60260) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114928.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(60327..60533) product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115096.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(60526..62619) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208221.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 63054..63821 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(64059..64655) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene pgsA CDS complement(64749..65546) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(65652..67451) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene uvrC CDS complement(67612..68526) product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000673.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(68693..69712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 70172..72325 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208211.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene fadB CDS 72338..73510 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene fadA CDS complement(73559..76471) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208210.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(76601..77116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208209.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 77418..78119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(78198..80003) product SAV1866 family putative multidrug efflux ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(80119..80868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 81045..81740 product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208206.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 82298..83710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 83922..85058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(85159..87078) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208203.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene htpG CDS complement(87248..87850) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208202.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 sequence003 source 1..76441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..380 product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206204.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 425..1012 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(1016..2035) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 2061..2198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 2155..3333 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(3390..3605) product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070287.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(3827..4390) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206206.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene ahpC CDS 4912..8766 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene hrpA CDS 8813..9919 product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013198471.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(9983..11689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(12052..13065) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207249.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene lipA CDS 13255..14670 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118117.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene sthA CDS 14752..15222 product DUF3465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207244.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(15286..15738) product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(15890..16501) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207241.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(16835..17836) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene mltB CDS complement(17856..18998) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene rodA CDS complement(19152..19811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(19845..20660) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene queF CDS complement(20657..21430) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(21427..22362) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(22500..23393) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 23645..24259 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043290.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 24327..26189 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 26214..26411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 26515..27864 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206925.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 27887..28597 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206013.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 28606..29190 product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 29227..31122 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206014.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(31164..32648) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020664.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 tRNA complement(32841..32916) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(33039..33596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(33725..34417) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 34657..35889 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(35916..36617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 36819..38072 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(38222..38653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 39034..40122 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene prfA CDS 40122..40943 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene prmC CDS complement(40940..41572) product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(41589..42647) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 42790..43560 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 43695..44378 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035648.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(44448..45551) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206173.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 45745..46764 product lipase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112346.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene lipC CDS 46844..47878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(47962..48732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 repeat_region 48835..49042 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctatgcggcagtgaac CDS 49201..50073 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 50119..51417 product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 51520..51903 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207120.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene folB CDS 51860..52294 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207119.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 52334..52885 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(52927..53562) product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119684.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene coq7 CDS complement(53566..54888) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207111.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 55052..57757 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 57804..62312 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207109.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 62479..62865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 63125..65764 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068571.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 65824..66462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(66614..68071) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 68341..69315 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 69406..70023 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 70342..71295 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 71288..72244 product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene yclO CDS 72235..72999 product petrobactin ABC transporter ATP-binding protein YclP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene yclP CDS 73009..73959 product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene yclQ CDS complement(74005..75165) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207106.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 75423..76247 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207105.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 sequence004 source 1..24048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(154..2292) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene fusA CDS complement(2470..2940) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138055.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene rpsG CDS complement(3101..3475) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050319.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene rpsL CDS complement(3647..4984) product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 5275..6504 product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205967.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 6537..6989 product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene hemJ CDS 7064..7588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205966.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(7644..7808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 8654..10279 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 10272..11303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 tRNA complement(11403..11479) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(11717..11793) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(12237..12500) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(12502..12993) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene coaD CDS 13123..13599 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120348.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene smpB CDS complement(13635..14207) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075275.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(14291..15031) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene pgeF CDS complement(15112..16161) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075271.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene rluD CDS 16233..17222 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 17410..19284 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(19293..20576) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205951.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene hemA CDS 20773..22374 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205950.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 22379..22960 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene lolB CDS 22974..23807 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205949.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene ispE tRNA 23806..23880 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 23909..23983 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 sequence005 source 1..24942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..2309 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 2364..2987 product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 2990..3508 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206639.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene cobU CDS 3510..4577 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206640.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene cobT CDS 4567..5175 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206641.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 5282..6868 product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206642.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 6971..7714 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206643.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(7779..9242) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963892.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(9246..11354) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(11430..11945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(12074..13165) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(13284..14171) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(14566..16122) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206646.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 16668..17852 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206649.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene lpxB CDS complement(17885..18754) product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206650.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 18793..19254 product DUF6231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206651.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 19402..20001 product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(20065..21153) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(21409..21822) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(21894..22163) product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206654.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 22485..22736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 22944..23225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(23304..24713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 sequence006 source 1..9184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(622..1437) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082922.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(1490..2248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 note possible pseudo, internal stop codon CDS 3139..4152 product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(4165..4695) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(4979..5983) product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene alc CDS 6144..6860 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 7042..8199 product FAD-dependent urate hydroxylase HpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207945.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene hpxO CDS 8382..8702 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 8695..8967 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene nadS sequence007 source 1..21196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 74..259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 274..756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(809..1879) product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(1962..3350) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene radA CDS 3708..5207 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 5540..5779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 5802..7052 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207417.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene lysA CDS 7058..7912 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene dapF CDS 7972..8586 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(8583..9194) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207414.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 9312..10238 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 10677..11426 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118903.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 11444..12376 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 12492..13007 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874483.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 13350..16079 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene gyrA CDS complement(16104..17216) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(17213..18343) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118383.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(18347..19507) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207408.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(19520..21016) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207407.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 sequence008 source 1..62729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..654) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(752..1960) product D-alanyl-D-alanine carboxypeptidase PBP5/6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118558.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene dacC CDS complement(2053..2448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 2653..2988 product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974894.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(3128..3499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207308.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 3652..4425 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene surE CDS 4524..5366 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119027.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 5514..6443 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118686.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(6508..9141) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 9329..11506 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 11509..11910 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene gloA CDS 12050..13018 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207306.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 13218..13442 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200845.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene rpmE CDS complement(13552..15630) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(15627..17381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207304.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(17395..18411) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262738.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene epmB CDS 18765..19334 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene efp CDS 19516..21630 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 21620..21919 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980869.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 22001..22960 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267404.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 23065..23892 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706923.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 23897..25888 product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463435.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 tRNA 25924..26000 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 26143..27156 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689040.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(27168..27455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(27519..29036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(29054..29980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(29983..30177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(30351..30860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(30866..31552) product transcriptional regulator PrtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113202.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene prtR CDS 31670..31885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 31894..32211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 32261..33148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 33145..33747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 33744..33923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 33928..34434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 34447..34893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 34893..35177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 35174..35473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 35466..35729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 35719..36105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 36178..36351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 36424..36756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 36760..36990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 36994..38640 product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064788614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 38637..39146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 39139..39783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 39794..40696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 40760..41128 product Gp49 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 41191..41751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 41751..43829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 43831..44283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 44286..44684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 44684..46729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 46726..49584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 49770..50255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 50320..52845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 52907..53215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 53215..54903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 54915..57056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(57081..58046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(58069..59025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(59022..59234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(59310..60155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 60308..60556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 60556..61098 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072876.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 61098..61469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(61618..62394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 sequence009 source 1..75576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 361..1458 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(1461..2951) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 3149..3625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207023.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(3673..5037) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115704.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene accC CDS complement(5055..5474) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354611.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene accB CDS complement(5500..5949) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068810.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene aroQ CDS complement(6664..7698) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207015.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(7699..8289) product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115726.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 8818..10170 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 10198..12744 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene nirB CDS 12756..14375 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207013.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene nirD CDS 14692..17472 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 17469..18098 product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207011.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(18141..19472) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene dsdA CDS 19880..22162 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207010.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 22444..23472 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene moaA CDS 23494..23745 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187654.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 23748..24260 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207008.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 24278..25201 product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene moaCB CDS 25201..26436 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207006.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 26595..27077 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(27079..28476) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 28600..29463 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207004.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(29469..29780) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115694.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(29815..30099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207003.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(30109..30459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(30503..30871) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115623.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene tusD CDS 30935..31942 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207002.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene galE CDS 32094..33488 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207001.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene fumC CDS 33602..34093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 34492..35736 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115716.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(35779..36426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206996.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 36525..37016 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene ispF CDS complement(37004..37528) product protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(37667..38587) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene argF CDS complement(38700..39341) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(39489..40988) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene glnG CDS complement(40975..42084) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene glnL CDS 42414..43757 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206991.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene rimO CDS 43813..44541 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852257.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene pyrH CDS 44618..45172 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115638.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene frr CDS 45176..45925 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115643.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene uppS CDS 45928..46752 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 46753..47949 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206989.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene ispC CDS 47955..49310 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene rseP CDS 49345..51933 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206986.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene bamA CDS 51978..52466 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 52470..53540 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206984.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene lpxD CDS 53547..54032 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115603.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene fabZ CDS 54029..54817 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206983.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene lpxA CDS complement(54870..55802) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 55993..57231 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 57416..58768 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene gorA CDS complement(58836..60035) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(60051..61346) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206632.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(61574..62947) product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(63139..63444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206634.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 63611..64078 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene ybaK CDS 64400..66184 product rhizobactin siderophore biosynthesis protein RhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene rhbC CDS 66177..67658 product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 67655..69472 product rhizobactin siderophore biosynthesis protein RhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene rhbF CDS 69500..70138 product rhizobactin siderophore biosynthesis protein RhbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene rhbD CDS 70135..70506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 70482..71738 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 71748..74006 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206636.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 74061..75287 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 sequence010 source 1..141634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 231..1091 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 tRNA complement(1234..1307) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(1374..1458) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(1607..1680) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(1749..1833) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(1934..2764) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207194.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(2739..4247) product DUF3336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 4429..5319 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115248.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 5419..6519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207195.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(6589..7149) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208449.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 7242..7784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 7922..8500 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 8497..9405 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208185.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 9428..9835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(10019..10522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(10720..11727) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene tsaD CDS 11872..12087 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene rpsU CDS 12099..12563 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(12639..12998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(13035..13400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(13434..14876) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207196.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(15001..15588) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(15690..16694) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(16673..17326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207197.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 17595..18209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 note possible pseudo, internal stop codon CDS 18420..18695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 note possible pseudo, internal stop codon CDS 18838..19185 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 19175..19639 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384079.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(19718..20578) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207778.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 20752..21516 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(21549..22847) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(22852..23463) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069871.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene umuD CDS 23752..23982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(24127..24360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(25114..26313) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382837.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 note possible pseudo, frameshifted CDS complement(26327..26770) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(26829..27872) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 28552..29481 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 29931..30722 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208454.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(30855..31073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 31692..34331 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206264.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene mutS CDS 34441..34980 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206263.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 35229..35558 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 35683..36390 product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115771.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 36525..37193 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(37313..38155) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115820.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(38272..38886) product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206261.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(38879..39478) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206260.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(39572..40762) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(40775..42898) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208470.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(42895..44430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(44620..45366) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122331.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene lptB CDS complement(45366..45953) product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122334.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene lptA CDS complement(45898..46446) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene lptC CDS complement(46491..47030) product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(47034..48011) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122342.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 48287..49717 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene cysS tRNA 49780..49855 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 50171..50551 product copper resistance protein NlpE N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206080.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(50636..52234) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 52777..53766 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 53872..55200 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117726.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(55237..55500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(55549..56064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206079.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(56264..57877) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene cysN CDS complement(57923..58831) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene cysD CDS complement(59158..60609) product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206075.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(60763..62289) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene lysS CDS complement(62450..62887) product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 63240..63404 product rubredoxin RubA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene rubA CDS 63481..64662 product rubredoxin reductase RubB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206071.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene rubB CDS 64750..65694 product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene estB CDS 65701..66606 product LysR family transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117503.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene oxyR CDS complement(66663..67688) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207350.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene dusB CDS 67771..68979 product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207351.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 68946..69638 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 69690..70811 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970876.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 70836..71852 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811185.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 71940..73577 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063864.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(73652..74785) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118789.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene proB CDS complement(74865..76085) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118576.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene cgtA CDS complement(76201..76638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 note possible pseudo, internal stop codon CDS complement(76881..77624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207353.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(77763..79220) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207354.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(79473..80414) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene rarD CDS complement(80516..81100) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207356.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(81221..83263) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118463.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene uvrB CDS 83655..85280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 85348..86142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207357.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 86259..87419 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(87475..87654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 87867..89093 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(89173..89592) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(89954..90385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207361.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 tRNA 90621..90696 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(90798..91454) product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(91459..92187) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207365.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene pdxJ CDS complement(92238..92945) product DNA repair protein RecO C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207366.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(93170..94195) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207367.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene era CDS complement(94200..94808) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067830.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene rnc CDS complement(94864..95241) product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(95269..96132) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene lepB CDS complement(96205..98022) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene lepA CDS 98021..98236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(98176..98631) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(98742..100118) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207372.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 100468..102099 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene nadB CDS complement(102324..102932) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene tmk CDS complement(102933..103904) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207374.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene mltG CDS complement(104011..104823) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207375.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene pabC CDS 105074..106075 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207376.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 106112..106714 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 106786..107619 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene cysT CDS 107616..108500 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene cysW CDS 108505..109578 product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 109735..110658 product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(110741..111493) product ornithine uptake porin CarO type 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene carO CDS 111789..112610 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene dapD CDS 112761..113477 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118723.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene queE CDS 113541..114221 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene queC CDS 114252..114674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 114772..115464 product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 115468..115932 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 116050..116628 product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207382.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 116639..117001 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(117011..117388) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(117390..117608) product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942197.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 117734..118654 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095765.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(118672..119307) product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119001.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 119356..120156 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 120445..123297 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene ptsP CDS 123290..124240 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206967.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene pfkB CDS 124227..125948 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206968.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 126122..126904 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(126906..127220) product NIF3 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207385.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(127506..128696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(128869..132699) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207387.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene purL CDS 133052..134392 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207388.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 134525..135130 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene ruvA CDS 135138..136136 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002052424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene ruvB CDS 136148..136810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 136902..137315 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699892.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene ybgC CDS 137335..138033 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207390.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene tolQ CDS 138033..138485 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene tolR CDS 138489..139721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 139821..141104 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118491.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene tolB CDS 141127..141588 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene pal sequence011 source 1..4843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1535 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206344.1:type VI secretion system Vgr family protein locus_tag LOCUS_05370 CDS 1551..4499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 sequence012 source 1..71427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 373..2553 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207935.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 2741..2926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 3252..4571 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 4650..5648 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(5692..6246) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 6463..6843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206184.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 6883..7449 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene rnhB CDS complement(7501..7764) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene csrA CDS complement(7997..9277) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115333.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(9341..11989) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene alaS CDS 12245..13270 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206186.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 13304..13618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 13699..14067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146462549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 14423..15589 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 15650..16969 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(17346..18206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(18428..19435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 19646..21196 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 21269..21871 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 21868..22647 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 22664..23398 product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 23445..23870 product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(23908..24978) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207136.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene alr CDS complement(25043..26488) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119718.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene dnaB CDS complement(26608..26943) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 27078..27632 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207877.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(27718..28164) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene rplI CDS complement(28177..28404) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene rpsR CDS complement(28416..28799) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119610.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene rpsF CDS complement(28987..29865) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene cyoE CDS complement(29876..30205) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(30205..30825) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene cyoC CDS complement(30830..32812) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068497.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene cyoB CDS complement(32816..33886) product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119579.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene cyoA CDS complement(34184..34963) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(35030..37408) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803576.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene ppsA CDS 37567..38403 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 38789..40789 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206970.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(40933..41934) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068512.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(42074..42571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 42809..43525 product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(43563..44006) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122286.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(44105..44413) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068595.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(44523..45422) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207101.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 45549..46025 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene tsaE CDS 46015..47985 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207099.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene mutL CDS 47992..48936 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene miaA CDS 49027..49539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 49618..50475 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207096.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 50510..51106 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064380616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 51176..51799 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096725.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(51858..52511) product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207095.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene nfsB CDS complement(52718..53434) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(53456..53965) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122280.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 54133..55860 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207092.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(56288..57004) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207090.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(57172..57984) product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene eutC CDS complement(57995..59380) product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(59398..60834) product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene eat CDS complement(61111..62076) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 62305..64020 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 64031..64393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(64458..64817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(65179..65895) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206201.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene trmB CDS 66076..68544 product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 68784..69395 product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(69460..69771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121546.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(69929..71425) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene ahpF sequence013 source 1..29178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..1180 product lipase secretion chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207807.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 1285..2259 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207808.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(2322..2693) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116654.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene rplS CDS complement(2829..3569) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116964.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene trmD CDS complement(3615..4163) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116736.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene rimM CDS complement(4182..4493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(4605..5039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(5068..9324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(9338..10072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(10075..11034) product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(11207..11695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(11692..12174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(12563..13021) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(13015..13512) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(13522..17532) product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207811.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(17549..18337) product type IV fimbrial biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(18334..19467) product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(19469..19969) product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene pilV CDS complement(19969..20457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(20598..21548) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116992.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene ispH CDS 21651..22274 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene gmk CDS 22344..22622 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene rpoZ CDS 22856..24964 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116807.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 25065..25445 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 25692..25886 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 26146..26610 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207818.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene bfr CDS complement(26656..28302) product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(28601..29044) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 sequence014 source 1..78963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1181..1693 product GspH/FimT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207590.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 1806..2981 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 3109..3558 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(3602..4087) product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207592.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(4080..5723) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207593.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(6029..6736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(6738..9197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(9194..9730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(9734..13138) product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207953.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(13285..15684) product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207594.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(15826..17070) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(17194..18312) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207596.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 18527..19540 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207597.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(19921..20112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 note possible pseudo, frameshifted CDS 20291..21496 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 21507..23654 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 23819..24082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 24149..25003 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207601.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 25192..25422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280981.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(25451..25903) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207602.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(25903..27120) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207603.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 27227..27862 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207604.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 27981..29291 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207605.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 29448..30353 product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene lpxO CDS complement(30412..30840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116535.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(30979..33711) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116195.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene secA CDS 34076..34711 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 34993..35517 product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207608.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(35555..36634) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(36625..37911) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene folC CDS complement(37908..38804) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804699.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene accD CDS complement(38801..39604) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207611.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene trpA CDS 39923..41254 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464256.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(41285..42307) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 42423..43298 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(43350..44345) product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207614.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 44575..46350 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206722.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(46400..47644) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene trpB CDS complement(47625..48284) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207615.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 48652..50508 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207616.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 50612..51199 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 51221..51940 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207618.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(51970..52497) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 52709..53878 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 54018..55460 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207620.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 55490..56086 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 56309..57394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(57448..58131) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116101.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(58176..59852) product sensor histidine kinase efflux regulator BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene baeS CDS 59984..60355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 60686..62488 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207624.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 62649..64430 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116088.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 64543..65043 product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(65083..65421) product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064209.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(65596..66087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 66256..66702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116392.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(66744..68207) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(68287..70374) product zinc piracy TonB-dependent receptor ZnuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207628.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene znuD CDS 70510..71274 product DUF4184 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207629.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 71412..73190 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene aspS CDS 73297..73518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207632.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 73524..74396 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(74416..75228) product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985436.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 75449..76411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 76599..77486 product sugar glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 77545..78948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 sequence015 source 1..3319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(309..863) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(994..2091) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207659.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(2301..2501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(2788..3018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207661.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 sequence016 source 1..13327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 347..1645 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207669.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(1686..2057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207668.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(2172..2975) product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207667.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(3346..4260) product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207667.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(4684..5595) product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207667.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 5759..6643 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026838.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(6677..6844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(6847..8343) product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036788256.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(8443..10386) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115449.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene dnaK CDS complement(10575..11120) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene grpE CDS complement(11280..12185) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207663.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 12281..13135 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207662.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 sequence017 source 1..66790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 82..387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 415..573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 662..3070 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 3119..3910 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene fdhD CDS 3992..4933 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(4977..5372) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(5458..6861) product multidrug efflux RND transporter outer membrane channel subunit AdeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene adeK CDS complement(6940..10062) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206728.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(10062..11204) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 11350..12081 product efflux system response regulator transcription factor AdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene adeR CDS 12071..13156 product two-component sensor histidine kinase AdeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206730.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene adeS CDS 13249..13797 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770558.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 13993..14979 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 14976..16271 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 16265..17080 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 17058..18254 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 18285..19061 product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 19070..20131 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207172.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 20154..21482 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207171.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(21479..22174) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(22185..22685) product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(22706..23278) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207168.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(23357..23974) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 24442..25401 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 25580..26554 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 26591..27415 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206179.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 27510..29030 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 29126..29998 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 30078..31007 product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene lpxL CDS 31092..31853 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 31886..33478 product urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206323.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 33462..34892 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 note possible pseudo, frameshifted CDS 34900..35190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 note possible pseudo, frameshifted CDS complement(35246..36025) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(36228..36935) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene crp CDS 37082..37504 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(37569..38378) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206191.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 38633..41212 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene clpB CDS 41382..41807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206193.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(41839..44046) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene rlmKL CDS 44311..44676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 44797..45813 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 45826..47058 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 47265..47831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 47890..48663 product F420-dependent NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(48680..49402) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(49452..50267) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene thiM CDS complement(50286..51446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207082.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 51712..52188 product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 52379..52822 product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(52903..53160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 53577..56183 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207081.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene pepN CDS 56316..57695 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 57846..58529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 58605..59027 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 59406..60128 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706774.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 60243..62075 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207190.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(62122..63294) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(63469..64116) product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207051.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene leuE CDS complement(64191..65180) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207050.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene tal CDS complement(65290..66183) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 66272..66700 product AceI family chlorhexidine efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 note possible pseudo, frameshifted sequence018 source 1..9630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(283..735) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 887..1504 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206465.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(1559..2728) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene dapC CDS complement(2809..5475) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene glnD CDS complement(5530..6738) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206528.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene purT CDS complement(6868..7257) product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 7559..7993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483316.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 8132..9262 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(9358..9597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 sequence019 source 1..86831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(643..1902) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(1907..2209) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083182810.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(2815..5772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(5769..7745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(7990..8622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 8792..9055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(9124..9438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(9538..9867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 10019..10609 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 10612..11691 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705342.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 11747..15022 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 15025..15702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 15719..17584 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555499.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 17597..20767 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922218.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 20818..21741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(21928..22566) product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene dnaC CDS 22543..22938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(22947..24401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(24414..26354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(26573..27319) product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene dnaC CDS complement(27336..27872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(27938..28189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(28179..29363) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(29383..29592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 29705..29932 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 tRNA complement(30267..30342) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(30388..30463) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 30654..30962 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114074.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 30972..31364 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208111.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 31446..32288 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 32298..32684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 32897..33487 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208112.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(33511..34152) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 34377..34799 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 34932..35300 product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207058.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(35359..36597) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 37033..38601 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene guaA CDS complement(38687..39010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 39493..40494 product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031350.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 40516..41550 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 41736..42227 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 42796..43743 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208117.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 43740..44138 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208118.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 44235..44888 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208119.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(44948..45559) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208120.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(45862..47661) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene argS CDS complement(47833..48753) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208122.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 48914..49540 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804759.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(49551..50360) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene znuB CDS complement(50364..51152) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208124.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene znuC CDS complement(51125..51622) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 51890..52729 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 52900..53298 product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072004.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 53398..54273 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114072.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene atpB CDS 54357..54602 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene atpE CDS 54642..55112 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024691.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 55124..55660 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 55703..57247 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene atpA CDS 57325..58194 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene atpG CDS 58225..59619 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene atpD CDS 59648..60067 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 60206..60685 product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 60875..63028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(63056..63658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(63825..64370) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(64486..65259) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(65271..66494) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072024.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 66641..67288 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 67391..68311 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(68687..69256) product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(69294..70424) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene dprA CDS complement(70436..71587) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208133.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 71713..72243 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene def CDS complement(72412..72561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 72775..74871 product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 75116..75433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(75496..76293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(76628..80119) product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207912.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 80306..80638 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 80640..82355 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(82411..83619) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 83705..84301 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 84579..86552 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207909.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene betT sequence020 source 1..1039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 467..802 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene tnpB sequence021 source 1..60080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..2072) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207719.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 2288..3739 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207720.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene miaB CDS 3779..4858 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207721.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 4877..5362 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119528.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene ybeY CDS 5374..5673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(5744..7921) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206936.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(8191..9045) product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207722.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 9311..9994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207723.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 10189..10905 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 11050..11625 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119547.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(11671..12444) product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986634.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 12616..13458 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208311.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene thyA CDS 13479..13988 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 14007..15062 product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208309.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(15072..15269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 15187..15663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 15768..16292 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005036987.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene msrA CDS complement(16355..16759) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885432.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(16761..17381) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(17424..18182) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208308.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(18418..19284) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene purU CDS complement(19401..20072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 20195..21649 product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115149.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 21818..22054 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048256.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene rpmB CDS 22067..22222 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205031.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene rpmG CDS 22471..24186 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079171.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(24237..24515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(24629..25132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(25251..25520) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(25560..27539) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208304.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(27660..28229) product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208303.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(28413..29171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(29260..31899) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208301.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene topA CDS complement(31933..32382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004842579.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(32543..32905) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208300.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 33024..34034 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208299.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(34076..34321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 34354..36267 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(36323..36865) product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090605.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 37073..38008 product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene lpxL CDS complement(38248..39393) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 39580..40698 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene asd CDS 40882..42303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 42362..43567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 43632..44597 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 44613..45410 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene truA CDS complement(45448..46455) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 46687..46908 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene infA CDS 47131..47538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208286.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(47596..48675) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208285.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene leuB CDS complement(48719..49282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(49409..50059) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene leuD CDS complement(50072..51490) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208284.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene leuC CDS 51746..51964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 52089..52946 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066023.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(52943..53593) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 53778..54254 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567255.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 54346..56640 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene ptsP CDS complement(56696..57154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 57736..59937 product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074054.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene katG sequence022 source 1..6220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 468..1466 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 1477..3261 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 3258..4385 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 4391..5509 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 5669..5929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 5922..6086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 sequence023 source 1..15140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(248..1186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118998.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 1395..1865 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207405.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1873..2766 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(2781..3365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 3481..4626 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 4619..5305 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene lolD CDS 5353..7827 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(7816..8772) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 8912..9934 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207400.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene sppA CDS 10081..10878 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(10925..11551) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene purN CDS complement(11551..12621) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene purM CDS 12755..13951 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 13972..14670 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene hda CDS 14783..15139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 sequence024 source 1..67317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(942..1202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(1206..1946) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388896.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(2066..2521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(2604..3488) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208161.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(3494..4276) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208162.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 4382..5821 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208163.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 6007..6792 product DUF4145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963508.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(6837..7292) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206377.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(7436..7738) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 7886..8122 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(8172..9377) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(9445..9636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 note possible pseudo, frameshifted CDS complement(9630..10637) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 note possible pseudo, frameshifted CDS 10743..12230 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206378.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(12227..13729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(13732..15414) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016117864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(15444..17585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(17569..18372) product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097953302.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(18526..20364) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene glmS CDS complement(20377..21696) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene glmU CDS complement(21764..22240) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(22263..23180) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207969.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene thiL CDS complement(23195..23644) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119137.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene nusB CDS complement(23648..24118) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119264.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene ribE CDS complement(24130..25251) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119278.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene ribBA CDS complement(25536..26810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 26897..28117 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene serB CDS 28525..28860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 29003..29482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(29588..30028) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene dtd CDS 30182..31390 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene pncB CDS 31771..32619 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207964.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 32616..33467 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene asd CDS complement(33588..33998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 34142..34534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(34925..35134) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115279.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(35651..36541) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 36636..37088 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(37155..38510) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121907.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene phoR CDS complement(38519..39229) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene phoB CDS complement(39480..40157) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 40462..41289 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(41337..42704) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804387.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(42805..43959) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207957.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 44279..44719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(44819..46126) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066720.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(46144..46701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122008.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(46728..47267) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 47451..49028 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207955.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene gshA CDS 49100..49597 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(49656..51002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121854.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 51126..51293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 51325..51873 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 51870..53753 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene parE CDS 53991..55268 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269025.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene urtA CDS 55360..56994 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene urtB CDS 57155..58069 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene urtC CDS 58070..58897 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene urtD CDS 58908..59606 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene urtE CDS complement(59850..60587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(60668..61159) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105221.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(61541..62266) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 62635..62994 product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 63134..63679 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066773.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 63710..64477 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207941.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 64555..66408 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207940.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene dsbD CDS 66411..67106 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 sequence025 source 1..51603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..504 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105006.1:thiol-disulfide oxidoreductase DCC family protein locus_tag LOCUS_10210 CDS 501..908 product DoxX-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926952.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(895..1947) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208279.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(2267..2878) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(2931..3629) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114898.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(3705..4403) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208277.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(4400..5332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(5395..5691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 6118..9489 product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208274.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 9679..11520 product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208273.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 tRNA 11694..11769 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 11886..11961 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(12077..13231) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene hemW CDS 13402..13833 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 13853..15202 product multidrug efflux MATE transporter AbeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208268.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene abeM CDS 15339..16634 product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 16726..16980 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(17086..17415) product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425054.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(17434..17814) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene crcB CDS 18132..18464 product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(18507..19115) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(19130..19543) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(19672..20934) product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206023.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene dctA CDS complement(21069..22259) product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208260.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(22249..22899) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208259.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 22985..23176 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(23191..24240) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206725.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(24257..25411) product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206724.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene pqqE CDS complement(25408..25692) product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004792407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene pqqD CDS complement(25689..26447) product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene pqqC CDS complement(26456..27367) product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206723.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene pqqB CDS 27935..29671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(29723..30367) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065967.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(30391..31407) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene hemH CDS complement(31477..32505) product DUF4062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208258.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(32603..33502) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208257.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene murI CDS complement(33532..34143) product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208256.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 34331..36043 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(36122..36313) product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(36307..36924) product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(36941..37672) product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(37669..38535) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(38601..38906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122109.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 39067..39687 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206314.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(39757..40014) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002053527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene tusA CDS 40190..41029 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 41026..42585 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene lnt CDS complement(42707..43051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(43315..43821) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene gspG CDS complement(43845..45050) product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene gspF CDS 45157..47424 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 47465..49282 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065938.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 49391..50263 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(50374..50724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 sequence026 source 1..22887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 147..1319 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206694.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1560..2924) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802478.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(3019..4293) product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(4595..5299) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206453.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(5365..7059) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206452.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(7170..7787) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 7933..9105 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076583.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 9130..10731 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 10741..11544 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 11557..13548 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206448.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 13545..14447 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(14550..15536) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 15710..19180 product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(19282..19617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(19614..21308) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064860.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(21313..21660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 21899..22843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 sequence027 source 1..465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence028 source 1..57666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(443..601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(606..1763) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(2065..3522) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(3591..4616) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(4678..6036) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 6212..8047 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene typA CDS 8293..8727 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene mscL CDS 8885..9220 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207583.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(9292..9573) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(9596..10417) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207580.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene mutM CDS 10622..12754 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(12817..13623) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207576.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(13880..14602) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 14790..15236 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 15423..15767 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 15927..16262 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(16324..18039) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(18242..18817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 19176..19559 product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene pilG CDS 19581..19943 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 19992..20528 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116439.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 20576..22657 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072794.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 22815..27896 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 27913..28368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207557.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(28417..29550) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene dapE CDS complement(29676..29816) product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(29929..30792) product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 30893..31258 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207553.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 31532..32062 product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene elsL tRNA 32206..32281 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 32305..32381 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 32425..32501 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 32602..32677 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 32717..32793 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 32934..33009 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 33103..33573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(33624..34409) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207551.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(34533..37061) product sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(37280..38884) product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073522.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(38940..40625) product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene aspT CDS complement(41001..41585) product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(41718..43898) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene yccS CDS 44041..45252 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207547.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(45298..46005) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207546.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 46431..47771 product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207512.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 47952..49187 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene gltS CDS 49283..50758 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207544.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 50934..51848 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207543.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 52052..53248 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207542.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene sbmA CDS complement(53308..53823) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(53820..54392) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206517.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 54492..55382 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 55539..56546 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 56629..57144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 sequence029 source 1..40380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8..916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1557..2573) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene ilvC CDS complement(2679..3170) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene ilvN CDS complement(3170..4894) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 5402..5752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 5896..8520 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208370.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene leuS CDS 8728..9237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 9247..10242 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene holA CDS 10350..11669 product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208368.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 11671..13662 product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208367.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 13923..15311 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(15322..15747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 16573..16887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 16957..17214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 17370..17852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(17949..18815) product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208365.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(18952..19680) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004794670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(19840..20400) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099436.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene orn CDS 20525..21583 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208364.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene rsgA CDS 21680..22096 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 22107..22367 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene grxC CDS 22395..22853 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene secB CDS complement(22909..23517) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(23504..23749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(23754..24491) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525296.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(24478..25323) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(25490..25804) product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210102.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene cybC CDS complement(26024..27277) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene coaBC CDS 27392..28126 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene radC CDS 28171..29082 product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064169.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(29077..29952) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 29998..30609 product septation protein IspZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064166.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 30632..30934 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 30938..31351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 31369..33276 product FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207650.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene mnmC CDS complement(33364..33678) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 33769..34257 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002051423.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 34272..34766 product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207651.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 34841..35335 product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(35390..35869) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(35913..36344) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116010.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(36346..36783) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene trxC CDS complement(36783..37679) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 37803..38138 product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(38218..40293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 sequence030 source 1..89602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 216..1049 product p-hydroxycinnamoyl CoA hydratase/lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206158.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1088..2539 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 2631..4508 product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 4584..5723 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206155.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 5806..7056 product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206154.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 7098..7523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 7557..9311 product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206151.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(9383..10597) product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene pobA CDS 10738..11553 product IclR family transcriptional regulator PobR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene pobR CDS complement(11627..13327) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(13599..15089) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207791.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(15265..16239) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207786.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene astE CDS complement(16335..17675) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207787.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene astB CDS complement(17709..19178) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene astD CDS complement(19178..20221) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene astA CDS complement(20243..21448) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207789.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(21529..22800) product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 23029..23451 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(23525..25990) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 26380..27552 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 27903..29282 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(29513..30694) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 30835..32346 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207086.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(32431..33120) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207073.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(33122..33862) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(33859..34533) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207075.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(34576..35724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193049.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(35823..36263) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(36302..37165) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206939.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(37354..38586) product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(38620..39483) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(39498..40244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(40241..41044) product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene cmrA CDS 41155..42204 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190629.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 tmRNA 42412..42771 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 43033..43923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 44054..44494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(44604..46130) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205993.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(46137..47285) product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(47529..48026) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205992.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 48198..49211 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene hemB CDS 49222..50355 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205991.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(50329..51237) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(51313..51759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(52048..52575) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287575.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(52541..53323) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 53731..55539 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 55612..56862 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205985.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 56872..60483 product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205984.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 60480..61076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230911.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(61073..61759) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 61886..62923 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 62952..64070 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(64159..64596) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene fur CDS 64708..65106 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121740.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(65163..65483) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(65483..66565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113997598.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(66815..67270) product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121698.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(67545..68312) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(68494..69270) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(69497..70396) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121716.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene argB CDS complement(70410..71828) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(72020..72472) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene dut CDS complement(72496..74535) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070868.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(74734..75387) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 75780..76712 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205978.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 76717..77775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205977.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 77882..78601 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205976.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene minC CDS 78661..79473 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene minD CDS 79476..79748 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896934.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene minE CDS 79871..80158 product PA4642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121755.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(80197..80814) product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene rhtC CDS complement(80953..84048) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 84351..85301 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121722.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene trxB CDS 85395..86126 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205972.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene aat CDS 86155..86970 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205971.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(86956..87417) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene rimI CDS complement(87510..88118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 note possible pseudo, frameshifted CDS complement(88108..88395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 note possible pseudo, frameshifted CDS complement(88602..89483) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 sequence031 source 1..48177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 note possible pseudo, frameshifted CDS complement(552..1112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 note possible pseudo, frameshifted CDS 1214..2236 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene nagZ CDS 2524..3366 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208333.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(3432..4742) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 5096..6361 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208331.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 6664..7839 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208325.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 7866..9998 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene pta CDS complement(10405..10746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(10756..10932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(10963..11202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(11437..12042) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(12073..12999) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 13159..14019 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206678.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 14198..15724 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 15875..17131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925742.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(17200..17916) product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208323.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(18077..19387) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene clpX CDS complement(19415..20020) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene clpP CDS complement(20227..21558) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208322.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene tig CDS 21816..24005 product bifunctional siderophore receptor/adhesin Iha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene iha CDS complement(24221..24427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 24599..26293 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114718.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene leuA CDS 26375..27535 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114709.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 27535..28128 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217230.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene metW CDS 28125..28712 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114702.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 28811..29152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 29221..29844 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene rdgB CDS 29995..30213 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 30226..30675 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114889.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene tatB CDS 30672..31460 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene tatC CDS 31635..33968 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(34026..34808) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208314.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 34915..35727 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208313.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene lgt CDS complement(35763..36299) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207725.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene wrbA CDS 36469..37719 product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112579.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(37747..38655) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 38763..39572 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943998.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(39564..40460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(40531..41172) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(41214..41711) product YcxB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 41867..43162 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121975069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 tRNA complement(43212..43288) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 sequence032 source 1..7942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 266..832 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121343.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1364..1681 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121379.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1762..3456 product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 3649..4851 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206582.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene sstT CDS 4858..5538 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 5542..6081 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 6193..7458 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268659.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(7609..7785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 sequence033 source 1..10094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 142..306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 416..616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205906.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 842..2404 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071062.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 2690..2863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205907.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(2928..4124) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(4178..5050) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(5116..6285) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205910.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(6306..7961) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(7974..8522) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(8651..9628) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 9818..10063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 sequence034 source 1..38662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..379 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002053759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 540..1277 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119163.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 1490..2524 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207997.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene mutY CDS 2600..3136 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207998.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 3146..3391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066589.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 3419..3973 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 4001..5026 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(5023..6450) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208000.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 6540..6950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(6898..7800) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208002.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 7930..8715 product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811193.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene dkgB CDS 8738..9925 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(9967..10614) product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(10704..11525) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119175.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene dapB CDS complement(11641..12756) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene dnaJ CDS 12755..12949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(12905..13282) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(13415..16543) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208007.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(16546..17646) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 17809..18432 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119184.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 18517..21198 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene ppc CDS 21511..22806 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 22910..23800 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(23808..24539) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(24619..25908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(26070..27899) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208013.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene ilvD CDS 28111..29073 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene fmt CDS 29070..30377 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene rsmB CDS complement(30562..32040) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208016.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(32409..32981) product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(32978..34426) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 34557..35309 product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(35360..37135) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(37534..38097) product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(38145..38543) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207714.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 sequence035 source 1..16835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(280..447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(462..953) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206042.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene def CDS complement(1079..1651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1678..1968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 2058..2498 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(2552..3715) product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(3831..5114) product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(5111..6859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 6977..8020 product AraC family transcriptional regulator SphR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene sphR CDS complement(8308..9153) product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206508.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene tauD CDS complement(9184..10065) product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206507.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene tauC CDS complement(10062..10853) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049389.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(10863..11885) product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene tauA CDS 12117..13040 product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196334.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 13043..14386 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene chrA CDS complement(14399..15016) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206720.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(15013..15708) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene modB CDS complement(15705..16475) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene modA sequence036 source 1..4979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 899..1177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1231..1512 product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 1500..1790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 2171..2989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 3000..3212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 3679..4041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 sequence037 source 1..1308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(39..941) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(941..1258) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 sequence038 source 1..23659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(449..525) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(530..605) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(643..719) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(789..865) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(1008..2072) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115913.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene nadA CDS complement(2216..3436) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene argJ CDS complement(3787..4275) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(4323..4640) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(4794..5336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(5339..5842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(5938..6840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(6827..8713) product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(8777..9199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(9658..10344) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043044.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene rpe CDS 10527..10802 product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(10833..11672) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene fghA CDS complement(11641..13020) product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(13276..14085) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(14079..14903) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(14906..15574) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene tsaB CDS complement(15712..16242) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(16269..16874) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 17005..17553 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(17592..19556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208429.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(19577..20782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(20782..22446) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208426.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(22459..23574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208425.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 sequence039 source 1..4883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 412..1395 product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1428..1844 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 1969..2745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 2758..3888 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131084.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 3915..4835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 sequence040 source 1..7320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(351..761) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206571.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(871..1962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 2236..2817 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206572.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(2898..3458) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207057.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(3469..3726) product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705074.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(3985..4518) product lecithin retinol acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206573.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 4677..5411 product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206574.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(5450..5689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011679.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(5926..7011) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206575.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene trmA sequence041 source 1..25418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(765..1661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1792..2913) product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(3093..4133) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(4160..4450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(4558..4893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(4968..5582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(5598..6095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(6157..6306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(6319..6576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(6699..7034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(7039..8070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 8604..8924 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(8948..9784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 10672..11877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 11883..12890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 13006..13272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(13319..13852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(13889..15238) product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(15251..18535) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385732.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(18645..19973) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167385843.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(19976..21982) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 22124..22612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 22933..24762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 sequence042 source 1..29587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(641..1429) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1442..1954) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117938.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene rraA CDS complement(1967..2632) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206619.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 2846..3112 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene rpsT CDS complement(3205..4479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(4643..7333) product M66 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776990.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(7501..8208) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(8289..9146) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206618.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 9191..9859 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206980.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 9843..10271 product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 10443..11486 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene recA CDS 11597..12079 product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 12519..13319 product YbgF trimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(13390..15261) product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206629.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(15401..15673) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(15843..16298) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069443.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 16512..17159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206628.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 17268..17741 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117915.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 17743..18960 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 19040..19426 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene iscU CDS 19456..19776 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117986.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene iscA CDS 19926..20444 product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene hscB CDS 20483..22342 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206625.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene hscA CDS 22360..22698 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene fdx CDS complement(22762..24201) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(24251..24685) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(24853..28314) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene mfd CDS complement(28452..28955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(29000..29395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 sequence043 source 1..16521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(45..560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1039..2070) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207527.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 2202..2903 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207528.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(2976..3725) product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 4072..5301 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206666.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(5393..6484) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206664.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene aroC CDS complement(6496..7506) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113580.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene prmB CDS complement(7669..8856) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(8869..9720) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113662.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(9763..10152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113949.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(10145..10450) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113722.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(10591..11733) product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(12017..12613) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113756.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene recR CDS complement(12716..13045) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113538.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(13058..14245) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206657.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 14436..15521 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 15525..16397 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207572.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 sequence044 source 1..83283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..805) product IS5-like element IS903B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176682092.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(1247..2020) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(2128..2607) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206094.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene rlmH CDS complement(2930..5359) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene lon CDS complement(5504..6091) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206095.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 6619..6819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(6899..7285) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176526623.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 7382..10090 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 10269..11519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(11814..12101) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(12098..12658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 12725..13360 product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 13415..14734 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206099.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene pepP CDS 15190..16401 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene ubiH CDS 16398..17630 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 17804..18055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117665.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(18114..18716) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 18824..19714 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(19782..20618) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075551.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene rsmI CDS 20635..21570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 21583..21987 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 22056..22748 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117601.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 22752..23624 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206106.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(23645..24397) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206107.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene nudC CDS complement(24397..26043) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206108.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(26170..27528) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206109.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene dnaQ CDS 27796..30858 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206110.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 30867..32711 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206111.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 32739..33809 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206112.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 33809..34819 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206113.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 34797..36389 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206114.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 36498..37748 product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 tRNA complement(37832..37907) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(37927..38577) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117536.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene rnt CDS complement(38574..39608) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070491.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene pyrC CDS 39771..41048 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070488.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(41104..42342) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118952.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 42540..43613 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene hemE CDS 43669..44463 product DUF817 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 44653..45123 product DUF3015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 45206..47086 product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207273.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(47122..47484) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336963.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(47499..48053) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene folE CDS complement(48138..48905) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207268.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(48988..49461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(49657..50463) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene trpC CDS complement(50473..51522) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene trpD CDS 51909..52598 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(52691..54052) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210838.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(54414..54989) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 55624..57033 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002052696.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene glnA CDS 57157..57648 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207261.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 57663..58544 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207260.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene ubiA CDS 58655..59914 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 60003..60215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(60233..60673) product DUF2726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 tRNA complement(60729..60804) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(60864..60939) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(60946..61021) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(61169..61795) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208083.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(62021..62644) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037422.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(62981..63739) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207257.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 63934..65115 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(65310..66521) product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(66604..67950) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(68341..69399) product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(69592..70416) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene map CDS 70917..71669 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene rpsB CDS 71809..72684 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene tsf CDS complement(72740..73969) product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207256.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(74063..76333) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118176.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(76552..78789) product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207255.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(79514..80233) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(80256..81092) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene metF CDS complement(81167..82549) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene ahcY CDS complement(82865..83071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 sequence045 source 1..21420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 266..601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(618..1529) product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196337679.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1591..2349) product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385338.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(2365..3360) product Stealth CR1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003607.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(3392..4195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(4310..5470) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684076.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(5612..6538) product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705670.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(6567..9314) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene glnE CDS complement(9402..10673) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 tRNA 10982..11068 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 11133..12167 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene queA CDS 12328..13356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 13419..13988 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871101.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 14085..15212 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207645.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene tgt CDS 15312..15641 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene yajC CDS 15694..17595 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116237.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene secD CDS 17606..18574 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene secF CDS complement(18705..18923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(19037..20698) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene ltrA sequence046 source 1..81080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 12..854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(905..2962) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205915.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene metG CDS complement(3055..3552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 3654..4196 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 4384..4833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120385.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 5061..6293 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205916.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene apbC CDS 6411..7286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(7361..9373) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(9370..9846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(9843..10847) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(10999..11541) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205919.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 11844..12437 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071033.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 12538..13107 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003653416.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene dcd CDS 13372..14763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 15174..16562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205920.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 16806..18884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 18899..19606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205922.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 19636..22095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205923.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 22188..23180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205924.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(23249..24181) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205925.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(24262..25071) product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 25219..26628 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene ffh CDS 26780..27376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(27346..28089) product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(28105..28860) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205928.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 28886..29686 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 30055..30750 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 30761..34210 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205930.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene smc CDS 34212..35249 product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205931.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 35322..37349 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205932.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene ligA CDS complement(37405..38460) product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 38814..39278 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214863.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene bfr CDS complement(39321..39902) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene bcp CDS 40064..40798 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 41110..42405 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205937.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene bioA CDS 42392..43546 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 43537..44295 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene bioC CDS 44292..44933 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205940.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene bioD CDS complement(44970..45332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 45520..46185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(46261..46680) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206607.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(46702..47127) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(47139..48014) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(48054..48761) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(48908..51505) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 52240..52941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 52956..54767 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 54789..56804 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 56817..57755 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 57764..58906 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206615.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 58918..60642 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(60708..61652) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120431.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(61694..62293) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120355.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene scpB CDS complement(62290..63084) product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070982.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 63330..64043 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(64056..64325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(64337..64954) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205941.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(65043..65705) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205942.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 65802..66362 product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120393.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 66437..66622 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene rpmF CDS 66820..67806 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene fabD CDS 67803..68537 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120395.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene fabG CDS 68624..68860 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279871.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene acpP CDS 69049..69291 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene acpP CDS 69507..69980 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene lysM CDS complement(70055..72103) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206116.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(72333..73100) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 73194..73868 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205944.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(73912..74571) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205945.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene ribB CDS 75247..76434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(76431..78221) product cyclic nucleotide-binding and patatin-like phospholipase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390858.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(78401..78781) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(78927..79508) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120328.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene pth CDS complement(79528..79824) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene rplY CDS complement(79921..80874) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120445.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 80809..80994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 sequence047 source 1..38940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(29..724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 1216..2163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(2256..3104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(3088..3435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(3943..4296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 5154..5762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 5793..7376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 7400..8161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 8190..8573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 8689..8991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 9305..9760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 9808..11007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 11018..12493 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 12508..15636 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 15648..16019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 16025..16738 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 16750..17388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 17469..18776 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970462.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(19047..20399) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene chrA CDS complement(20402..21208) product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196334.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 21688..23787 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123659250.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 23793..25526 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368616.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(25599..26822) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 26981..27691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 27715..27864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 27893..28276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 28399..28719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 28951..29529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 29623..29868 product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082903.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 29877..30107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 30188..31822 product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 31932..32777 product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350563.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene dinD CDS 32774..34000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 33997..37260 product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 37260..38006 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 38651..38896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 sequence048 source 1..23200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..697) product acinetobactin biosynthesis thioesterase BasH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene basH CDS complement(753..2345) product acinetobactin export ABC transporter permease/ATP-binding subunit BarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene barB CDS complement(2342..3952) product acinetobactin export ABC transporter permease/ATP-binding subunit BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207280.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene barA CDS complement(3945..4100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(4197..5348) product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(5466..6335) product acinetobactin biosynthesis bifunctional isochorismatase/aryl carrier protein BasF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018273.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene basF CDS complement(6354..7982) product (2,3-dihydroxybenzoyl)adenylate synthase BasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207283.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene basE CDS 8231..11122 product acinetobactin non-ribosomal peptide synthetase subunit BasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207284.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene basD CDS 11158..12468 product putative histamine N-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene basC CDS complement(12533..14791) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207286.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(14906..15874) product siderophore-binding periplasmic lipoprotein BauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene bauB CDS complement(15881..16651) product ferric acinetobactin ABC transporter ATP-binding protein BauE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582117.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene bauE CDS complement(16648..17595) product ferric acinetobactin ABC transporter permease subunit BauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene bauC CDS complement(17595..18536) product ferric acinetobactin ABC transporter permease subunit BauD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene bauD CDS 19091..21187 product acinetobactin non-ribosomal peptide synthetase subunit BasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene basB CDS complement(21318..23150) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207291.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 sequence049 source 1..11379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 235..1299 product type II asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206524.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1469..5032 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206523.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene dnaE CDS 5046..5882 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206522.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 5879..6700 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206521.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene cysE CDS 6806..7705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206520.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 7819..9834 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206519.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(9881..11377) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene ahpF sequence050 source 1..72885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(316..906) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705175.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1256..1690 product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372636.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene arsC CDS 1743..2069 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206514.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 2076..2549 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267059.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 2561..3607 product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206515.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene arsB CDS 3594..4313 product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene arsH CDS 4817..5251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 5381..5956 product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930801.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene ectA CDS 6002..7321 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene ectB CDS 7318..7731 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063969.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 7734..8639 product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene thpD CDS complement(8684..9871) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208380.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(9888..10307) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208381.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 10379..10876 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973425.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene soxR CDS complement(10840..11037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 11569..12696 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208383.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 12708..13031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 13035..14501 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(14563..15384) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(15550..15948) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098046.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene rsfS CDS complement(16030..16824) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(16850..17713) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208388.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(17789..18577) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208389.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(18655..21465) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208390.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 21612..22541 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208391.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene cysM CDS 22605..23426 product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 23436..24827 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208393.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene rlmD CDS 24874..27180 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117181.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(27307..27735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(28087..28863) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208394.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 28960..29766 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208395.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene mazG CDS 29735..30160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 30299..31750 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208397.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene pcnB CDS 31747..32235 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208398.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene folK CDS 32275..33084 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene panB CDS 33088..33933 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208399.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene panC CDS 33962..34813 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208400.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene rapZ CDS 34810..35079 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984428.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 35082..35618 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene yjgA CDS complement(35666..37309) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 37609..39531 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene thrS CDS 39750..40088 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117275.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene infC CDS 40227..40544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207835.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 40682..41302 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208403.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 41865..42722 product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195415.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 42776..43204 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114414.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 43406..43600 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054552.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene rpmI CDS 43612..43971 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124858.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene rplT CDS complement(44026..45153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 45226..45618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818687.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(45603..46604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208406.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 46761..47741 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117277.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene pheS CDS 47775..50156 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene pheT CDS 50153..50449 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126166.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(50543..50779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(51175..52443) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene rho CDS complement(52775..53101) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054512.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene trxA CDS 53634..55154 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene ppx CDS 55244..56068 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 56152..57396 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene tilS CDS 57400..58239 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene proC CDS 58256..58804 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501183.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(58870..61635) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208411.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene polA CDS 61823..64693 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208412.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(64694..65611) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066312.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(65621..66439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804297.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 66533..68023 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208413.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene gspE CDS complement(68080..68511) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208414.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(68664..69026) product DUF4951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(69215..70039) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(70068..70589) product anti-anti-sigma factor GigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117273.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene gigB CDS complement(70692..71660) product RsbU family protein phosphatase GigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene gigA CDS complement(71792..72685) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208418.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 sequence051 source 1..19696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..1249) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208171.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1259..2803) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208170.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene gpmI CDS complement(2928..3998) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121203.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene lptG CDS complement(3998..5098) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208169.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene lptF CDS 5173..6702 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 6706..7113 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 7149..7775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(7822..8481) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301612.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(8637..9476) product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405433.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(9875..11167) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(11164..12264) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene ribD CDS complement(12277..12741) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543541.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene nrdR CDS complement(12877..14268) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(14337..14675) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene glnK CDS 14949..15176 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 15207..16187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 16430..17500 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 17740..17868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 17978..19018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 sequence052 source 1..5381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 118..987 product IS5-like element IS903B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012579081.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(955..1797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(1809..3491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205890.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 misc_feature complement(3595..>5381) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207470.1:Ig-like domain-containing protein locus_tag LOCUS_18140 sequence053 source 1..87571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..1030) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114637.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene sucD CDS complement(1043..2209) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene sucC CDS complement(2346..3779) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene lpdA CDS complement(3839..5026) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064561.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene odhB CDS complement(5026..7866) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(8574..9284) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207476.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(9299..11191) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene sdhA CDS complement(11204..11584) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833672.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene sdhD CDS complement(11569..11931) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207477.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene sdhC CDS 12872..14146 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene gltA CDS complement(14212..14700) product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064555.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 14811..15743 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 15880..16500 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 16516..17166 product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(17238..18113) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208464.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 18215..18820 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208463.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(18948..19472) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(19545..19751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 19879..20088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 20095..21975 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207479.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene rpoD CDS 22114..22401 product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 22574..23227 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207480.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene lipB CDS 23310..23843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072911.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 23846..25030 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 25331..26728 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207482.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(26788..27345) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207483.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 27463..27843 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116344.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 27859..28239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(28253..28723) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072891.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(28871..30247) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene cysG CDS complement(30315..31586) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072887.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene serS CDS complement(31689..32453) product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207489.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(32572..33267) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207490.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene lolA CDS 33560..34429 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809214.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(34495..34749) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539872.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene rpmA CDS complement(34768..35079) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271409.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene rplU CDS 35527..36504 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116233.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 36518..38560 product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 39359..40582 product multidrug efflux RND transporter periplasmic adaptor subunit AdeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116482.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene adeI CDS 40595..43771 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 43768..45228 product multidrug efflux RND transporter outer membrane channel subunit AdeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene adeK CDS 45339..45689 product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 45699..46139 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(46185..46367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(46563..47369) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(47382..48044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(48169..48849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 49101..51998 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 52024..53559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(53602..53982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 note possible pseudo, internal stop codon CDS complement(54109..55149) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207503.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(55271..56176) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 56584..57768 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 58221..59165 product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004664079.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 59244..59987 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396522.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 59989..60672 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082765.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 60669..61412 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 61586..62398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980885.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(62421..63761) product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207509.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(63764..64441) product DNA-binding response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207510.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(64456..66096) product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207511.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(66266..67528) product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207512.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(68053..69303) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207514.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 69449..70075 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207515.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 70138..71055 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 71187..71648 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 71667..72518 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(72572..73483) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(73597..74784) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene prpF CDS 75215..76510 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 tRNA 76581..76656 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(76658..77938) product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(77970..79319) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 79700..80776 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206162.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 80789..81733 product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206161.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(81776..82462) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206160.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(82587..83573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 83736..85769 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 85784..87013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(87053..87478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 sequence054 source 1..92707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 553..1986 product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407279.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene gabP CDS complement(2044..3546) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066896.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 3701..4993 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207897.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene gabT CDS 4990..6438 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207896.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(6501..7436) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(7505..8131) product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046156.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene ycaC CDS 8416..9276 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207894.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 9712..11010 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207893.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 11012..11839 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 tRNA complement(11889..11964) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(12029..12118) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 12240..14120 product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 14325..15356 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 15428..15670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207871.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(15740..16429) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene aqpZ CDS complement(16603..17610) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 17725..18372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(18674..19432) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001007.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene hisF CDS 19545..20495 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207866.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 20505..21122 product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207865.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 21159..21551 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(21588..22472) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207863.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(22459..23913) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206973.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(24148..24879) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207860.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene hisA CDS complement(25047..25586) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067011.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(25736..26353) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207858.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene hisH CDS complement(26353..26946) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116767.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene hisB CDS 27051..27428 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116928.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 tRNA 27530..27605 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 27741..27816 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 28078..28509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 28576..29295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(29432..30949) product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116671.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(31068..32522) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(32541..33305) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene ompR CDS 33694..36048 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116875.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 36209..37039 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 37117..37827 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 37824..38141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(38190..38945) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208271.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 39053..39937 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208272.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 40038..40802 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(41062..41949) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207854.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(42199..43476) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207853.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 43774..45435 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207852.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene ettA CDS 45581..46165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 46418..46777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207849.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 46942..47127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 47761..49182 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207846.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 49187..50428 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207845.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 50418..53561 product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 53846..54790 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207843.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(54815..55153) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078496.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 55380..56999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 57168..58103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116860.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 tRNA complement(58160..58235) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(58267..58342) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(58556..59971) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207841.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 tRNA complement(60083..60158) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(60280..60355) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(60414..61922) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene gltX CDS complement(62029..62349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116889.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 62729..63721 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 63922..64845 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207838.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene rsmH CDS 64845..65183 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116847.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene ftsL CDS 65194..67023 product penicillin-binding protein PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117016.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene ftsI CDS 67031..68530 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207837.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 68553..69950 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207836.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 69951..71069 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116751.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene mraY CDS 71131..71949 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(71978..74569) product penicillin-binding protein PBP1a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207833.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene ponA CDS 74733..75791 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804529.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 75791..76435 product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207832.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 76432..76689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 note possible pseudo, internal stop codon CDS 76750..77142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 note possible pseudo, internal stop codon CDS 77142..77669 product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 77686..79863 product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 79953..80444 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116987.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene aroK CDS 80465..81550 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene aroB CDS 81566..82438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207827.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 82894..87378 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207826.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene gltB CDS 87450..88871 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 89041..89931 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 90105..90695 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117090.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 90720..91781 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207823.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 91775..92335 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207822.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 sequence055 source 1..1422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence056 source 1..15618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1..594) product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121106.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(616..939) product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(941..1954) product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2181..5120 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 5141..6310 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206954.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 6311..6820 product cysteine peptidase family C39 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207252.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(6834..8171) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(8173..8823) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206952.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(8975..10513) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206951.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene ilvA CDS 10618..11289 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206950.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene rpiA CDS 11289..11981 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(12001..12654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(12741..14231) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113164.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene phoA CDS complement(14414..15568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 sequence057 source 1..36133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..1843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 1876..2262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 2377..3378 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208137.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene cysK CDS complement(3429..3896) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208138.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 4140..5336 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 5407..5796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 5972..8356 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065662.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 8675..9205 product DUF2726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208143.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(9202..9564) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208144.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(9962..11029) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208149.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene dinB CDS complement(11019..11780) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208150.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(11886..13274) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208151.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene mdtD CDS 13439..15433 product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(15489..16097) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 16445..18028 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208153.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 18231..18713 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208154.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 18766..19410 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121256.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 19441..19956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 20117..22336 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208155.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene parC CDS 22494..24173 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(24241..24627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 24777..25175 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208157.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 25294..25821 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121243.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene ppa CDS complement(25920..27191) product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 27932..28702 product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 29111..29914 product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(29961..30485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 30726..31415 product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223862839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 31417..33306 product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044392641.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 33303..34154 product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102975.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 34171..35256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 35286..35495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 35759..36091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 sequence058 source 1..91274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..1317 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071167.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 1414..1857 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208457.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 1872..3368 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382837.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 3434..4498 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 tRNA complement(4518..4594) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(4642..4718) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(4730..4819) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 5078..7501 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207733.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene rnr CDS 7693..9732 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207734.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 9756..9977 product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117042.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 9990..10439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207735.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 10579..11370 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181015.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(11477..13687) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(13865..14446) product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene rrtA CDS complement(14574..15617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(15977..16186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(16394..16789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207739.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(16776..17033) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 17220..18392 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207741.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(18444..18941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(19064..20554) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207742.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 20802..20993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 20998..21456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(21589..21954) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049717.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene rplQ CDS complement(21973..22980) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116730.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene rpoA CDS complement(22999..23625) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135204.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene rpsD CDS complement(23638..24024) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene rpsK CDS complement(24044..24400) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090815.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene rpsM CDS complement(24646..26004) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207743.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene secY CDS complement(26011..26451) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene rplO CDS complement(26456..26632) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849088.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene rpmD CDS complement(26639..27136) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141025.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene rpsE CDS complement(27139..27489) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049741.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene rplR CDS complement(27504..28037) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116801.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene rplF CDS complement(28051..28446) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049732.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene rpsH CDS complement(28458..28763) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049689.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene rpsN CDS complement(28773..29309) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116961.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene rplE CDS complement(29325..29642) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116820.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene rplX CDS complement(29652..30020) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982634.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene rplN CDS complement(30113..30370) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene rpsQ CDS complement(30367..30564) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849928.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene rpmC CDS complement(30564..30977) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207745.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene rplP CDS complement(30981..31733) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207746.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene rpsC note possible pseudo, frameshifted CDS complement(31735..32064) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982638.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene rplV CDS complement(32076..32351) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138119.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene rpsS CDS complement(32365..33189) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049686.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene rplB CDS complement(33201..33521) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene rplW CDS complement(33518..34120) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049755.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene rplD CDS complement(34132..34770) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207747.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene rplC CDS complement(34828..35139) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116694.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene rpsJ CDS complement(35367..36095) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116949.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 36264..37457 product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207748.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 37477..39024 product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 39168..40379 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene hmpA CDS 40459..40911 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207752.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 40983..41759 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116788.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene yihA CDS 41889..42833 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(42907..44991) product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(45344..46585) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(46713..47585) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207755.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 47944..50496 product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene plsB CDS complement(50546..51514) product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207757.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(51670..52497) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207758.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 52516..54561 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078352.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene recG CDS 54548..55213 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207759.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(55182..55589) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207760.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(55600..56124) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067248.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 56358..57374 product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116978.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(57448..59364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(59484..59771) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078357.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(59783..60415) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207761.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(60435..61097) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207762.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(61097..61873) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117010.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene mlaE CDS complement(61870..62700) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207763.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(63107..65047) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(65465..66001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(66076..66906) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207766.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(67038..68933) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117085.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene dxs CDS 69084..69842 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116908.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene ribA CDS 69885..70349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 70487..71431 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207767.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene hemF CDS complement(71480..72061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 72207..72995 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207768.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene aroE CDS complement(73045..75396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 75637..77460 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(77513..78112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207770.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 78510..78779 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207771.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(78853..80019) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117107.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 80581..81996 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223903.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(82082..83368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(83524..84318) product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(84321..85583) product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 85823..86578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 86668..87657 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002044989.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene glyQ CDS 87657..89726 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207776.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene glyS CDS complement(89765..90244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(90338..91009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 sequence059 source 1..2460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence060 source 1..70328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(361..906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(1024..3630) product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208069.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene acnD CDS complement(3630..4787) product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097521.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene prpC CDS complement(5084..5965) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071840.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene prpB CDS complement(5958..6668) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208068.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 7111..8316 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071835.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 8564..9934 product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208062.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(9992..11665) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208058.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene pgi CDS complement(11668..12927) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208057.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(12945..13820) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208056.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene galU CDS complement(13834..15708) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462474.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(15859..17034) product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(17131..17793) product GDP-perosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055391.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene perB CDS complement(17780..18397) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462478.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(18394..19545) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(19545..20843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(20843..21964) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073063.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(21946..22890) product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(22894..24147) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966346.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(24144..25169) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073076.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(25188..26465) product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607932.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene tviB CDS complement(26683..27816) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176215.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene wecB CDS 28131..29231 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 29231..29659 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208041.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 29677..31863 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208040.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 32060..32767 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208039.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 32863..33510 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208038.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(33572..35122) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804817.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene murJ CDS complement(35184..35777) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208037.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene ampD CDS 35921..36766 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208036.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene nadC CDS complement(36763..36954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(37396..39576) product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208034.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(39894..40610) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120794.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene rph CDS complement(40735..41925) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208032.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(41955..42995) product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208031.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 43594..44244 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120796.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 44352..44981 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120773.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(45044..45664) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804825.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 45843..46556 product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804826.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene ubiG CDS 46556..47254 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 47285..48031 product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 48196..48573 product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120752.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 48716..50071 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120768.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene argA CDS 50381..51370 product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208029.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 51383..52372 product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208028.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 52399..53574 product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene ssuD CDS 53571..54374 product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene ssuC CDS 54388..55188 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 55430..56041 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071782.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(56332..57264) product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(57501..58067) product 5'-nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208025.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(58127..59260) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208024.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 59468..60469 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208023.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene ribF CDS 60532..63369 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208022.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene ileS CDS 63362..63892 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene lspA CDS 63892..64374 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208021.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 64481..65023 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208020.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(65318..65794) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968167.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 rRNA complement(66862..66971) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(67148..70035) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence061 source 1..14953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 312..659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 780..992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206557.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(1043..2032) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206558.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene bioB CDS complement(2112..3140) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene queG CDS 3260..4768 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206560.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(4775..5320) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121356.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene ruvC tRNA 5620..5696 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 5888..6106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070233.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 6217..6426 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115279.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 6730..6942 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115279.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(7044..8090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 8598..8759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 8873..9307 product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206381.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 9507..10070 product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206565.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(10116..10289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 10530..10787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(10859..12025) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084948.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene metK CDS 12407..14395 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206570.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene tkt sequence062 source 1..36097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(314..1546) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115433.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene tyrS CDS 1608..2741 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207693.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2796..3131) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115421.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene erpA CDS complement(3253..4257) product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(4546..5556) product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207688.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(5698..6699) product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207688.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 6929..8857 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804875.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 9191..9748 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(9837..12305) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115497.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene gyrB CDS complement(12355..13449) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115479.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene recF CDS complement(13477..14625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(14738..16132) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115442.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene dnaA CDS 16803..16937 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831329.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene rpmH CDS 16965..17360 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207683.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene rnpA CDS 17370..17693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 17696..19456 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207682.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene yidC CDS 19539..20903 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207681.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene mnmE CDS 21038..21736 product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207679.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(21790..22041) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115476.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(22266..22793) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene hpt CDS complement(23019..24335) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207678.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene guaD CDS 24517..25122 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815863.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(25166..26119) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207675.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(26414..27340) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 27447..28679 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206918.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 28690..29811 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 29808..30506 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 30526..31269 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(31515..32876) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207672.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene mpl CDS complement(33157..33540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 33672..33971 product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207671.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 34109..34621 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115451.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene purE CDS 34691..35812 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207670.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 sequence063 source 1..6587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(554..2101) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206817.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(2127..3194) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206818.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 3876..4751 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206870.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(4814..5815) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186428.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(5963..6523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 sequence064 source 1..16753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..1075) product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067912.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 1269..2525 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207335.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene icd CDS 2672..3181 product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229705.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 3407..4225 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207330.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 4365..7133 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325625.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 7299..8264 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(8325..8741) product DUF3144 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118682.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 8815..9447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118705.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(9717..11165) product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207327.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 11364..11735 product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207325.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 11943..12821 product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene cas1f CDS 12821..16213 product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene cas3f CDS 16213..16749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 sequence065 source 1..45129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..801 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000415806.1:type I-F CRISPR-associated protein Csy1 locus_tag LOCUS_22390 CDS 801..1685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 1712..2725 product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene csy3 CDS 2729..3340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 repeat_region 3473..4881 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcatggcggcatacgccatttagaaa CDS 4973..5584 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207324.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene thiE CDS 5669..6967 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene hemL CDS 7317..7733 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 7834..8520 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067937.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 8707..11535 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207322.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene rapA CDS complement(11591..12085) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816761.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene dps CDS 12333..13421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(13444..14076) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118668.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene fabR CDS 14334..15347 product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207321.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 15356..16456 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(16503..16970) product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 17154..17717 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 17820..18281 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206733.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(18328..20460) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207071.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(20704..21405) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207320.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 21873..23243 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207319.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 23247..24779 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207318.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(24854..25906) product molybdenum cofactor-independent xanthine hydroxylase subunit HpxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097237.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene hpxD CDS 25890..26060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 26458..27489 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118975.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 27588..28967 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119004.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene pstC CDS 28964..30361 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene pstA CDS 30376..31287 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118636.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene pstB CDS 31557..32519 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207313.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene sohB CDS 32764..34950 product Ig-like repeat protein Blp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207312.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene blp2 CDS complement(34980..35627) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207311.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(35666..36016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117704.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 36159..36557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(36554..37102) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206088.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene rsmD CDS complement(37102..39087) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802923.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene mrdA CDS 39329..39847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117557.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 39909..41222 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 41305..41958 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene adk CDS 42020..42202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(42199..42885) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802915.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene nth CDS complement(42887..43591) product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206091.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 sequence066 source 1..19612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 68..523 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119281.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 638..1798 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 1824..3011 product class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975881.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene ampC CDS 3093..4373 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207994.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 4373..5254 product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene yddG CDS 5433..7172 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482972.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(7221..7940) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(7976..8581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207991.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(8594..9487) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene dapA CDS 9760..10419 product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207990.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene pncA CDS 10445..10972 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967454.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 11197..11835 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464880.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(12044..12841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920547.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(12838..14376) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265837.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 14577..15494 product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920548.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(15551..17146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(17251..18558) product transcriptional regulator PtsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703133.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene ptsJ CDS complement(18580..19278) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 sequence067 source 1..55111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 56..1840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207346.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 1917..2699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207347.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(2735..3949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 4170..4871 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118524.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(5118..5243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 5690..7123 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206501.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 7125..8129 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206500.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene cydB CDS 8406..9449 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207349.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(9497..11575) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206067.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene ppk1 CDS complement(11731..12402) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206066.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene mtgA CDS 12501..13304 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206065.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 13566..13994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(14075..16561) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206064.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(16558..17262) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070633.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 17399..17929 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129345.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(17951..18388) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706546.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(18473..19087) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 19349..20356 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206062.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 20381..21388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206061.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(21423..23411) product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707645.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(23636..24274) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117617.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene nfuA CDS 24428..25045 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 25260..25439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854552.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(25485..26471) product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207420.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene epmA CDS complement(26468..27535) product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207421.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 27727..28101 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(28157..28894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969420.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(29046..30680) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120607.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene groL CDS complement(30738..31028) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650103.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(31220..31972) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207450.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(31953..32891) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115559.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 33288..35117 product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115528.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(35233..35799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(35875..36438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(36495..36632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(36984..37394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(37509..37775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 37998..40193 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(40226..41746) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207451.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene glpD CDS complement(41986..42744) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011169330.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(42797..44311) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207452.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene glpK CDS 44599..45021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115580.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(45078..45362) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(45489..46157) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(46208..47056) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207454.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene folD tRNA 47209..47282 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 47291..47376 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(47500..49260) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 tRNA 49459..49544 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(49611..50099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(50395..50736) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117532.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(50773..51303) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075397.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(51364..52380) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206022.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 52851..53039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(53164..53679) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(53816..54433) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117499.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(54509..55075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 sequence068 source 1..32874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(604..756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 1131..2240 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207441.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(2288..2671) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(2868..3773) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118895.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene ttcA CDS 4291..5133 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207442.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 5351..6256 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118851.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene htpX CDS complement(6319..6897) product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207443.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(6974..8311) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene mgtE CDS complement(8591..11692) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207444.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(12021..12200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 12280..13647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 13968..14993 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207445.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(15043..15645) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206028.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene pnuC CDS 16095..17042 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399570.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 17197..18795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(18826..19140) product DUF5713 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115563.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(19250..20869) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994007.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(20996..21847) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene folP CDS complement(21981..23777) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene ftsH CDS complement(24014..24613) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235573.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene rlmE CDS 24929..25255 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207458.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene yhbY CDS 25261..25797 product DOMON-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115550.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(25850..26392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 26753..27892 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207460.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene carA CDS 27907..31140 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067595.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene carB CDS 31233..31709 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115570.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene greA CDS 31810..32025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 32088..32714 product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207463.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 sequence069 source 1..9564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..559 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207144.1:zinc-ribbon and DUF3426 domain-containing protein locus_tag LOCUS_23790 CDS 936..1205 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000816.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene fis CDS 1288..2862 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene purH CDS 2968..4254 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207146.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene purD CDS 4858..5730 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207147.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 5799..6824 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119636.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 6821..7516 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(7566..7856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 note possible pseudo, internal stop codon, frameshifted CDS complement(7864..8436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(8430..9416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 sequence070 source 1..730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence071 source 1..19236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..931 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(1103..2125) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(2190..2624) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118705.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(2629..2754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(3281..6886) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206334.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene uca CDS complement(6890..7543) product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206333.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(7561..7896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 note possible pseudo, frameshifted CDS complement(7914..8297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 note possible pseudo, frameshifted CDS complement(8568..9047) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 9163..9816 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406576.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(9892..10722) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(10738..11811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(12147..14351) product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(14655..15824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206813.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(15836..17143) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206814.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(17161..18747) product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206815.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(18744..19163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 sequence072 source 1..25725 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(802..1941) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene thrC CDS complement(2000..3301) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121263.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(3433..4329) product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208175.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(4381..5301) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208176.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene xerD CDS 5449..5712 product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121198.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 5709..7562 product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208177.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 7575..7826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208178.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 8000..9358 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208179.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene murD CDS 9369..10562 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079447.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene ftsW CDS complement(10624..11556) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208180.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene gluQRS CDS complement(11559..12092) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121205.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene dksA CDS complement(12296..13111) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208181.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(13134..13652) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208182.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(13821..15716) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121180.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene thiC CDS 16119..16841 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948570.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene phoU CDS 16972..17121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(17562..17837) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089995.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(17848..19281) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121138.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene argH CDS 19272..20414 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208187.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 20472..21209 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208188.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 21318..22235 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208189.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene hemC CDS 22235..23011 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208190.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 23008..23835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208191.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 23841..25034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208192.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 25043..25474 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208193.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 sequence073 source 1..16765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..1636) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114813.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(1713..2585) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208201.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 2680..3195 product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079397.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(3272..3628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115127.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(3833..4198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065793.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(4365..8558) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208200.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene rpoC CDS complement(8731..12819) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene rpoB CDS complement(13128..13499) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229360.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene rplL CDS complement(13542..14048) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115099.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene rplJ CDS complement(14298..14993) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065788.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene rplA CDS complement(14997..15425) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene rplK CDS complement(15537..16070) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115092.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene nusG CDS complement(16077..16517) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114837.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene secE tRNA complement(16594..16669) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 sequence074 source 1..795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence075 source 1..20291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..624) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene tnpB CDS complement(621..1004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(1050..1709) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208363.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(1769..3178) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208345.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene der CDS complement(3553..4695) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208344.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene bamB CDS complement(4695..5393) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208343.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(5418..6710) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208342.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene hisS CDS complement(6707..7822) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208340.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene ispG CDS complement(7844..8638) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(8629..9381) product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene pilW CDS complement(9447..10682) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115097.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene rlmN CDS complement(10803..11234) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963851.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene ndk CDS complement(11344..11544) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene iscX CDS complement(11629..12180) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208337.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(12204..13520) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208336.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(13688..14533) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207697.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(14533..15345) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349619.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene rsmA CDS complement(15381..16346) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207700.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene pdxA CDS complement(16433..17074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 17339..17767 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117832.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene rplM CDS 17780..18166 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048725.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene rpsI CDS 18299..18955 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065247.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 18969..19394 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207701.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 19408..20064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065252.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 sequence076 source 1..21898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..896 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207277.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 1024..2196 product acinetobactin biosynthesis isochorismate synthase BasJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207276.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene basJ CDS 2249..3001 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(3106..3918) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206030.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 4185..4490 product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117586.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 4516..4815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070730.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 4833..5900 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070727.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 5893..6657 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206031.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 6670..7602 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206032.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 7629..8840 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206033.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 8882..10105 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206034.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 10139..10336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 note possible pseudo, frameshifted CDS 10269..10661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 note possible pseudo, frameshifted CDS 10695..11507 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 11521..12321 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009973.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 12331..13122 product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 13134..14600 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206038.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 14642..16282 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 16402..17625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206040.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(17694..19082) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118712.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene purB CDS complement(19137..19868) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207310.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene hflD CDS complement(19887..21020) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073282.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene mnmA CDS complement(21025..21525) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119006.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 sequence077 source 1..29154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 73..315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(350..1111) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120057.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 1220..2104 product LysR family transcriptional regulator GigC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120024.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene gigC CDS complement(2116..2814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(2896..3189) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205904.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(3309..3944) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120045.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene upp CDS complement(4051..5547) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205903.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene nuoN CDS complement(5551..7149) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120006.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene nuoM CDS complement(7151..9046) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120008.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene nuoL CDS complement(9043..9351) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529822.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene nuoK CDS complement(9351..9872) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205902.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene nuoJ CDS complement(9869..10411) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172747.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene nuoI CDS complement(10430..11446) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004703499.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene nuoH CDS complement(11450..14134) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205900.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene nuoG CDS complement(14146..15474) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120030.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene nuoF CDS complement(15471..15980) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120040.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene nuoE CDS complement(15993..17780) product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120052.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene nuoC CDS complement(17869..18546) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120034.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(18553..19104) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205899.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene ndhC CDS 19648..20922 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205898.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 21035..21373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205897.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(21511..23088) product sensor histidine kinase BfmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205896.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene bfmS CDS complement(23233..23949) product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene bfmR CDS 24472..27306 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071099.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 27649..28932 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005007934.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 sequence078 source 1..23987 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(25..261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(408..1760) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208101.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(1879..2904) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208100.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(2917..3690) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002069758.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(3712..4839) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160774.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(4851..6500) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(6583..7473) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208097.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene mmsB CDS complement(7487..9004) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208096.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 9171..10052 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208095.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(10125..11558) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208093.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(11750..12109) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208092.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS complement(12096..13223) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208091.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene alr CDS complement(13248..14504) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208090.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 14642..15109 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208089.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 15262..17352 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208087.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(17400..17765) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079563.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(18160..18645) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931149.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(18668..19333) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208085.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(19485..20264) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene dapB CDS complement(20992..21948) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(22394..22849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(23093..23782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 sequence079 source 1..1927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(49..1581) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence080 source 1..13534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(888..1160) product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(1157..2065) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118179.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 2287..4689 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073474.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene mrcB CDS 4708..5265 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207218.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(5294..6205) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207219.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 6382..6552 product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118129.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(6616..7977) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207220.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(7981..8640) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207221.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(8733..9098) product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207222.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(9185..10981) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207223.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(10995..11738) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene tsaA CDS 11839..12618 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118187.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(12699..13259) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121343.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 sequence081 source 1..4435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 637..1272 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208174.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 1342..1830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 note possible pseudo, internal stop codon CDS 1900..2856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 note possible pseudo, internal stop codon CDS 2939..4309 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208172.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 sequence082 source 1..9721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(25..408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(423..1325) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119634.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene prmA CDS complement(1524..1931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 2183..4063 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207143.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene mnmG CDS 4165..4497 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257651.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(5256..5879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(5975..6910) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(7174..9231) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385039.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(9408..9542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 sequence083 source 1..13109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..2017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206735.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 2208..4058 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206581.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS 4058..4498 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121358.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 4628..5653 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 5750..6124 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069578.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene gcvH CDS 6693..8189 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206579.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene putP CDS complement(8233..8724) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206578.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 8925..12689 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206577.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene putA sequence084 source 1..25002 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(628..2097) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207537.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene gatB CDS complement(2097..3575) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207536.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene gatA CDS complement(3629..3946) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107699.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene gatC CDS 4080..5120 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene mreB CDS 5138..5995 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116449.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene mreC CDS 5982..6476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 6527..7024 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207531.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 7079..8533 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116044.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene rng CDS 8668..8841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116397.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(8871..10259) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(10443..11174) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 11347..11964 product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene thrH CDS complement(12063..13292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(13516..15015) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207529.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 15481..17190 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207118.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene kdpA CDS 17204..19213 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207117.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene kdpB CDS 19223..19834 product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207116.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene kdpC CDS 19848..22484 product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207115.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 22494..23198 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207114.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(23259..24719) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206143.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 sequence085 source 1..80198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 675..1208 product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206533.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(1278..2369) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene ychF CDS complement(2469..3128) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069679.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(3109..4179) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206534.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(4191..5021) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206536.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(5046..6458) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206537.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(6458..7681) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(7695..8906) product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206539.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 9265..10035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 10271..10654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207212.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 10758..12218 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207211.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 12669..12989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 12989..14218 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763811.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(14222..15295) product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815761.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(15389..16018) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207209.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 16144..16926 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207208.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene yaaA CDS 16948..17211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 17221..17841 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 17855..18547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221911.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(18606..19391) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154366.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(19415..19612) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115323.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene thiS CDS complement(19622..19987) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(20095..20964) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207206.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene rpoH CDS complement(21111..21353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 21731..21943 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126912.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 22045..23196 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803629.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene rhlB CDS 23407..24444 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121428.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene fba CDS complement(24494..25741) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206586.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(25807..28278) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206587.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 28397..29410 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206588.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 29410..30099 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 30254..30889 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121443.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene rsmG CDS 30908..31690 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121458.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 31687..32574 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206589.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 32633..33262 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 33277..33705 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 33702..35429 product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206591.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene msbA CDS 35432..36439 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206592.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene lpxK CDS 36449..37210 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206593.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene kdsB CDS 37212..38195 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206594.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 38339..38647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 38970..39314 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121335.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 39335..40108 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069538.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 40144..40755 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206595.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 40770..41381 product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206596.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 41371..41868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 42003..42593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 note possible pseudo, frameshifted CDS 42595..43572 product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene gspK CDS 43658..44254 product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121363.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 44301..45014 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene ung CDS 45014..46135 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206599.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 46140..46652 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121378.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene tadA CDS 46720..47160 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206600.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 47170..47850 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206601.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene cmk CDS 47966..49648 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121348.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene rpsA CDS 49806..50108 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121337.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 50124..50483 product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121360.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 50517..51197 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069518.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene pyrF CDS complement(51194..52111) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206602.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(52159..53673) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206603.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 53853..54848 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206604.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 54967..56112 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117902.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene zapE CDS 56407..58569 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 58705..59325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 59406..60068 product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206617.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(60142..60606) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206969.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(61291..62151) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206965.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 62292..62747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(62759..63019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(63416..64717) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206962.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene brnQ CDS 65073..65867 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206961.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene map CDS complement(65909..66829) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 66958..67281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121003.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(67345..67686) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene grxD CDS 67854..69068 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121101.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(69113..69781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 note possible pseudo, frameshifted CDS complement(69934..70335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 note possible pseudo, frameshifted CDS complement(70438..70869) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(71011..71346) product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121078.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(71788..72021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121063.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 72263..72622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120892.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 72762..73091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 73209..74324 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121114.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene ftsY CDS 74499..75095 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121011.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 75320..75997 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206959.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 76022..76597 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(76692..76988) product cyd operon YbgE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791954.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(77110..78255) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206958.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene cydB CDS complement(78252..79829) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(79829..80020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 sequence086 source 1..22546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..1416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(1601..2977) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066765.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(3025..3360) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626013.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene uraH CDS complement(3360..3860) product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207943.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene uraD CDS complement(4016..6439) product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206924.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(6456..7784) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206925.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(7845..9305) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206926.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(9415..10164) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene aroD CDS complement(10242..10871) product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206928.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene pcaG CDS complement(10884..11609) product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene pcaH CDS complement(11620..12033) product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004701356.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene pcaC CDS complement(12060..13412) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206929.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(13455..14240) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206930.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene pcaD CDS complement(14237..15592) product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206931.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(15601..16809) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206932.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene pcaF CDS complement(16925..17578) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206933.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(17590..18276) product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206898.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 18527..19351 product IclR family transcriptional regulator PcaU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120879.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene pcaU CDS complement(19415..20638) product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene zigA CDS complement(20654..21052) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975836.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(21059..21772) product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207984.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 21883..22500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 sequence087 source 1..7389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..855 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_114555269.1:IS30 family transposase locus_tag LOCUS_27070 CDS 938..1546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804634.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 1716..2702 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 2857..3099 product DUF2789 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119522.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(3131..3658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207718.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(3751..4359) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207717.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 4478..5335 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207716.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene rlmJ CDS 5374..6207 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119541.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene pssA CDS 6224..7285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207715.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 sequence088 source 1..718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence089 source 1..6165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(45..329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(486..1136) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211305.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene pyrE CDS 1178..2002 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122009.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 2442..2792 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(2856..3293) product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121971.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 3483..4394 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004790086.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 4677..5861 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207939.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(5902..6069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 sequence090 source 1..5903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..4450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121646688.1:RHS repeat-associated core domain-containing protein locus_tag LOCUS_27240 CDS 4503..4802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 5310..5498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 sequence091 source 1..20608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 179..601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207781.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(654..2150) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228753.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 2353..2799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207782.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(2896..4242) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207783.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(4313..4624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207784.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 5214..5789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207785.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(5859..7136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207792.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 7243..8022 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207793.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 8031..8573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067173.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(8653..9216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207794.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 9386..10018 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209604823.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(10015..10482) product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116954.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 10615..11259 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804567.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 11378..12478 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 12786..14936 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207796.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene yccS CDS complement(14958..15905) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 note possible pseudo, frameshifted CDS complement(15935..16189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 note possible pseudo, frameshifted CDS complement(16538..16909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207798.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 17163..17753 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207799.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 17766..18080 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207800.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(18340..19104) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 19240..20031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207802.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(20075..20377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 sequence092 source 1..766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence093 source 1..3166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..1360) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067892.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(1347..2252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207345.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(2252..3001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207344.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 sequence094 source 1..22231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1859 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206351.1:type VI secretion system Vgr family protein locus_tag LOCUS_27530 CDS 1856..3373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 3376..4440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 4683..5132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(5129..6127) product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 6375..7520 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(7574..8149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207215.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 8542..9651 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049199.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene pheA CDS 9724..11973 product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 12261..12731 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050132.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(12775..13524) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114471.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(13663..14220) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 tRNA 14488..14564 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 14830..15150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(15308..15601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(15909..16805) product DUF4882 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(16966..17982) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206738.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(17979..20456) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206739.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(20593..21324) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206740.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(21411..21944) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113678.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 sequence095 source 1..569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence096 source 1..5734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(26..193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(240..2432) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206690.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 2648..3079 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114206.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 3238..4119 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206698.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 4350..5054 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206697.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 5056..5688 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206696.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 sequence097 source 1..8215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..730 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114003.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 1296..2456 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207036.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 2453..2896 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207037.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(2938..4836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 5029..6192 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206583.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 6496..7479 product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207030.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 7504..8004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 sequence098 source 1..522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(157..456) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 sequence099 source 1..18499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 67..924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(996..1358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(1392..4538) product Cu(+)/Ag(+) efflux RND transporter permease subunit CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573945.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 gene cusA CDS complement(4553..6052) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936048.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(6052..7359) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817191.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(7440..7745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(7956..8837) product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208440.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(8824..10737) product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208439.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(10827..11177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 11328..12011 product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 12001..13374 product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211179.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene pcoS CDS complement(13449..15806) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921601.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 16085..16465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 16533..17414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 17431..17691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(17816..18181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 sequence100 source 1..17480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(458..1462) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207523.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(1470..2345) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(2609..2821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(2854..3549) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763967.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(3561..7166) product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene uca CDS complement(7183..9009) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene atzF CDS complement(9269..10381) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206736.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(10399..10674) product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 10968..12416 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(12431..13015) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206731.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(13143..13403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(13545..14243) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206916.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(14412..15284) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(15299..15712) product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206922.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(15714..16127) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069081.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 16343..16714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS 16711..17436 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 sequence101 source 1..15516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..1703 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266553.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(1954..2904) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207942.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene puuE CDS complement(3009..3965) product LysR family hpxDE operon transcriptional regulator HpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705425.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene hpxR CDS 4142..5197 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207677.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 5342..6094 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207981.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene hutC CDS 6431..8104 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207979.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene hutU CDS 8194..9732 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421598.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene hutH CDS 9798..11006 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207978.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene hutI CDS 11037..11957 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207977.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene hutG CDS 11994..13265 product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207790.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(13334..14740) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206498.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 14969..15472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 sequence102 source 1..20327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 719..1768 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206947.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene argC CDS 1850..2599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206946.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 2643..3035 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121129.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 gene clpS CDS 3454..5739 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073979.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene clpA CDS 5739..6101 product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069026.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 6493..7536 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206945.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(7595..8515) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120883.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(8515..9075) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206944.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 9199..11223 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 11296..11712 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206942.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 11743..12459 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206941.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 12481..13569 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206940.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(13641..14105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206938.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 14474..16111 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121060.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 16142..16999 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121042.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene kdsA CDS 17091..18380 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121066.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene eno CDS 18510..18875 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121014.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene ftsB CDS 18865..19572 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206935.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 gene ispD CDS 19699..20175 product DUF6438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206923.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 sequence103 source 1..6021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 522..1622 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 1606..2478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(2503..5193) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(5203..5724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 sequence104 source 1..6100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 454..960 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207034.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 978..2006 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207033.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene murB CDS 2129..3142 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207032.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 3142..4170 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115207.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(4199..5869) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151815123.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 sequence105 source 1..18831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..1237 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214278.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 1440..2603 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207712.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(2617..3021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(3087..3596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(3593..4192) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207711.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 4384..6189 product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207710.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 6208..7134 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 7144..8757 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207708.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 8847..10004 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207707.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 10019..10855 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207706.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 10915..12873 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207705.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS complement(12903..13370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(13474..14394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(14408..15754) product sphingomyelin phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489150.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(16110..16529) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207704.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(16553..17095) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207703.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(17104..18072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207702.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(18227..18586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003656109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 sequence106 source 1..3022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 900..1898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 1895..2086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 sequence107 source 1..1345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence108 source 1..25833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..1788) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207047.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 1814..2023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 2262..3653 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 3719..4573 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207045.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 4658..5911 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207044.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 6248..8026 product metalloendopeptidase CpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207041.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene cpaA CDS 8041..8664 product metalloprotease secretion chaperone CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207040.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene cpaB CDS complement(8666..9247) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207043.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 9375..10865 product multidrug efflux MFS transporter AmvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207042.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene amvA CDS complement(10945..11634) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206659.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 11751..12638 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895522.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(12635..13228) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121436.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(13228..13611) product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121396.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 13751..14938 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206584.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 15104..15331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(15381..15764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073503.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 15981..16559 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073504.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 16604..17677 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 17806..18261 product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068324.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 18301..19440 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207202.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene gspL CDS 19440..19919 product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207201.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 gene gspM CDS 20029..21045 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207200.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS 21047..21640 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207199.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 21681..23219 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068333.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene purF CDS 23314..25206 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207198.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 25215..25811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 sequence109 source 1..27047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(403..2667) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815963.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(3319..4023) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207824.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 note possible pseudo, internal stop codon CDS complement(4171..4965) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004747277.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(5071..6726) product bifunctional protein tyrosine phosphatase family protein/NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(6845..7423) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206673.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 note possible pseudo, frameshifted CDS 7618..8916 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206672.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(9057..9881) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172934.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(9878..11764) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207940.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene dsbD CDS 11874..12545 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 12542..13927 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 13954..14211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS complement(14208..15398) product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206914.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(15549..16886) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194222.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(16995..17696) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365722.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(17733..18368) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene maiA CDS complement(18365..19426) product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706105.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene gtdA CDS 19581..20471 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113533.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(20847..23405) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146312796.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 23578..24837 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206230.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene xseA CDS 24830..25024 product exodeoxyribonuclease VII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206229.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 25399..25776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(25778..26680) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299612.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(26680..26997) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165196.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 sequence110 source 1..7305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(593..1276) product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207293.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(1471..2814) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206117.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 gene argG CDS complement(3045..3347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 3604..5634 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206118.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 tRNA 5721..5810 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 5979..7184 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 sequence111 source 1..10501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 332..751 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 gene hisI CDS 773..1333 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617714.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 1323..2678 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097095.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(2960..3430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(3541..4011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(4008..8999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 misc_feature complement(9070..>10501) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206344.1:type VI secretion system Vgr family protein locus_tag LOCUS_29430 sequence112 source 1..801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(43..>801) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000336721.1:IS3 family transposase locus_tag LOCUS_29440 sequence113 source 1..10432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(54..782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 note possible pseudo, internal stop codon CDS complement(1127..1309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 1685..2140 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233166.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 2207..2635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 2742..2996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 3218..3625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 3705..4079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 4304..4570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 note possible pseudo, frameshifted CDS 4690..5025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 note possible pseudo, frameshifted CDS complement(5036..6748) product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(6783..7427) product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087241.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(7843..8856) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116097.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 gene trpS CDS 9025..9942 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 sequence114 source 1..7949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(46..948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29580 note possible pseudo, frameshifted CDS complement(879..1271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 note possible pseudo, frameshifted CDS complement(1379..3010) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206054.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 3447..7133 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene metH CDS complement(7206..7856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 sequence115 source 1..634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 310..630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 sequence116 source 1..7627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..695 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021706804.1:IS5-like element ISVpa3 family transposase locus_tag LOCUS_29650 CDS 784..1974 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 1976..5116 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(5169..5657) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114194.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(5654..6073) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114184.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene msrB CDS 6333..7463 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206525.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 sequence117 source 1..11197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 82..3396 product VPA1262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477100.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(3418..3879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 3998..4216 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 4670..9715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 9708..11096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 sequence118 source 1..6286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(46..207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(358..831) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856695.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene greB CDS complement(828..1439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(1429..4197) product integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477239.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(4194..5132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 5630..5947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 tRNA 6055..6144 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 sequence119 source 1..1159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 295..1026 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207149.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene gloB sequence120 source 1..983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence121 source 1..25816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 252..530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(549..1763) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693486.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 1831..2853 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208379.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene dusA CDS 3111..3566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208378.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(3589..4380) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208375.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(4443..5636) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268964.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(5742..8498) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208374.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene acnA CDS complement(8624..9439) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208373.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(9501..10397) product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208372.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(10504..11322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117238.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(11396..12988) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066204.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(13304..14176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(14465..16069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(16126..17631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 18071..18421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(18426..19250) product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207485.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 20059..20454 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207251.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 20614..22125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 22420..23127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206308.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 23357..24502 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(24570..25784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 sequence122 source 1..8404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 276..602 product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801427.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 744..1520 product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208194.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene gspN CDS 1520..2356 product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079413.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 2398..4605 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208195.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 gene gspD CDS 4678..5292 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208196.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 5405..6097 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208197.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 6180..7673 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804103.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 gene trpE tRNA 7772..7847 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 7900..7983 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 8018..8093 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 8105..8179 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 sequence123 source 1..13073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 734..2182 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208419.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 2353..2694 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071251.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 gene raiA CDS 2832..3083 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115399.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 gene ibaG CDS 3090..4349 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115380.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene murA CDS 4346..5029 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071248.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene hisG CDS complement(5075..5941) product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140671.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(5948..6379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 6653..7945 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208420.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene hisD CDS 8105..9190 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208421.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 gene hisC CDS complement(9199..10542) product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208422.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 10510..10698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 11057..11905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208423.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 12178..13011 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208424.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 sequence124 source 1..2443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 1094..2203 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 sequence125 source 1..552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 sequence126 source 1..1504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 68..595 product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 676..1410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 sequence127 source 1..8207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 194..1036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 1029..1520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 1532..3133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 3187..4992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102972.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(5139..5531) product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene cadR CDS 5619..6947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 6959..7219 product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121198.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 7209..8162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 sequence128 source 1..1180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(2..>1180) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005065785.1:elongation factor Tu locus_tag LOCUS_30380 sequence129 source 1..1058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence130 source 1..4766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 707..4717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 sequence131 source 1..2329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 31..1728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 1725..2141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 sequence132 source 1..610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence133 source 1..2070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(511..687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 1028..1237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(1727..1960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 sequence134 source 1..7778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..1623) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207343.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(1741..2223) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(2345..3631) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207341.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(3725..5062) product D-alanyl-D-alanine carboxypeptidase PBP6B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207340.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 5208..6911 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207339.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(7068..7466) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167347.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene uraH sequence135 source 1..11934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 272..2455 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208335.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(2527..2970) product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117847.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(3059..3727) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804924.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(3738..4100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117849.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(4175..5512) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207696.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene hflX CDS complement(5587..5727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 5927..6757 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065232.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(6750..8378) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117884.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 8480..9490 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(9547..10026) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117846.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(10035..11258) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207695.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(11264..11725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 11783..11914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 sequence136 source 1..865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence137 source 1..5117 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..610) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206379.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 854..1774 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207104.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(1879..2334) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207103.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(2459..2857) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207183.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 3012..3890 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207182.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(3953..4813) product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206545.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 sequence138 source 1..560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence139 source 1..4039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(198..386) product NF038105 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 563..1537 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207393.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 1591..2367 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 2525..3136 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118814.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 3129..3452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118556.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 3442..3831 product DUF3106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118619.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 sequence140 source 1..2744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..2480) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400583.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 sequence141 source 1..8889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(445..1854) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(2087..2227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 2216..3448 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116919.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 gene serA CDS complement(3504..4331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 4809..5642 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207804.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 5639..6505 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207805.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(6530..6976) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019905.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(7123..7893) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525218.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(7905..8738) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207806.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene truB sequence142 source 1..864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence143 source 1..3321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..2826) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108570.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(2920..3114) product exodeoxyribonuclease VII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206229.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 sequence144 source 1..2019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(16..534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(531..1994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 sequence145 source 1..1248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence146 source 1..1357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..511) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206159.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 misc_feature complement(582..>1357) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000411707.1:3-(3-hydroxy-phenyl)propionate transporter MhpT locus_tag LOCUS_30920 sequence147 source 1..2641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(427..732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(729..2060) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626009.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 2297..2623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 sequence148 source 1..3224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS 596..892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 note possible pseudo, frameshifted CDS 840..1310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 note possible pseudo, frameshifted CDS complement(1432..2634) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766116.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 sequence149 source 1..1526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(23..523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(520..933) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 sequence150 source 1..1514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(202..1281) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207406.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene serC sequence151 source 1..598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence152 source 1..2347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 35..469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 sequence153 source 1..2458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 226..663 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207464.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(843..1157) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207466.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 1240..1977 product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207467.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(1970..2362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 sequence154 source 1..5386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1094..1621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 1630..2616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS 2680..4221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS 4335..4478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 4475..4933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 sequence155 source 1..1304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 318..1262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 sequence156 source 1..530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence157 source 1..832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence158 source 1..798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence159 source 1..645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 sequence160 source 1..700 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence161 source 1..594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 26..181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 sequence162 source 1..620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence163 source 1..622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence164 source 1..609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence165 source 1..578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence166 source 1..620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence167 source 1..615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence168 source 1..649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 253..558 product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368685.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene cbpM sequence169 source 1..545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence170 source 1..676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence171 source 1..620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence172 source 1..781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(199..513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100858.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 sequence173 source 1..822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence174 source 1..615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence175 source 1..632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence176 source 1..573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence177 source 1..647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence178 source 1..546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence179 source 1..719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence180 source 1..729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence181 source 1..663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence182 source 1..563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@